Prof(Dr) Francis Xavier

Head, CBF Research Station

Kerala Agricultural University

* Rapid development and urbanization * Constant change in consumption pattern * Social behaviour and uncivil attitude
Average daily per capita generation comes to 0.178 kg 0.034 kg for Koothuparamba to 0.707 kg for Thalassery
(CESS, 2001; Padmalal & Maya, 2002; Varma &Dileepkumar, 2004).

MSW generation varies between 0.21-0.35 kg/capita/day in the urban centres MSW of 0.5 kg/capita/day in large cities (NEERI, 1996).

Climate change, from anthropogenic emissions and wastes Fossil fuel use Agricultural and industrial activities, Deforestation

On farm disposal of Livestock waste in Kerala Burial

(labour intensive, carelessness attract carnivores) (need an incinerator ,costly, labour intensive) (carnivores dig it out, pollute water bodies ) (seepage, attract public protest ,carnivores) (Existing methods not user friendly)

Incineration Pit disposal

Sanitary land fill

Traditional Composting

Farm type

Condition of manure (%)

Method of disposal (%)

Odour

Fly problem

Dry

Wet

Agri use

Bio gas

Disposed

evaluation

Seasonally yes

Dairy shed

10

90

65

30

5

Odour

Seasonally yes

Dry Shed

20

80

95

00

5

Odour

Seasonally yes

Heifer shed

20

80

95

00

5

odour

Seasonally yes

Calf shed

15

85

95

00

5

odour

Seasonally yes

Others

mixed

Thrown outside

At times

Yes

COMPOSTING

“Composting is the natural process of 'rotting' or decomposition of organic matter by microorganisms under controlled conditions. ” M e s o p se: U h 3 TYPES gen y x i on O l ed Bas re: c tu robi era e p 1. A em obic T er on Ana 2. d ase B :
1.
do ase B gic ol o hn Tec n w ch roa pp al A

ro ind d /W ile lose p c nc tati l /E S ca 1. ani ch Me 2.

Thumburmuzhy

Model Aerobic

Composting

for Rural Waste Management

THUMBURMUZHY AEROBIC COMPOST

RURAL TECHNOLOGY Developed by CBF Thumburmuzhy

m fro tions d ate opera er en arm g te k f s Wa stoc e Liv

e e nur r wast Ma de Fodcenta h um Pla er birt ves rialst-mort Aft ad cal mate os De l birth after p Stil case Car

Aerobic Vs. Anaerobic Composting
Aerobic Composting
Oxygen present Low methane emission No bad smell High heat generated Rapid decomposition Lower salinity

Anaerobic Composting

Oxygen absent High methane emission Disagreeable odour Less heat generated Slow decomposition Higher salinity.

Aerobic composting Vs Vermi composting

• Less labour needed • High layer temperature • Less time required

• Labour intensive • No temperature rise • More time for composting • Worms care and sustainability a must

 Aerobic composting takes place in the presence of ample oxygen.  Temperature rises rapidly in the waste. In this process the temperature rises to 70 to 80° C. pathogens and weed seeds.  Every waste in the farm can be utilized as a raw material for the compost making and every material are put in the compost with the layers of dung.  By the time the composting is completed the material become dark brown in color. This peak temperature kills the

70 to 75 degrees Celsius

Thumburmuzhy Composting –Aerobic Layering

Select an ideal space. roof in monsoon

3 models were researched for economic feasibility at CBF

Floor can be Ferro cement slabs

Why Thumburmuzhy Composting?
 Environment friendly  No disagreeable odours  Organic waste converted to a value added product  Improves soil stability and fertility  Less area requirement  Less expensive  Pathogens free

 Aerobic composting takes place in the presence of ample oxygen.

.
. 

Temperature rises rapidly in the waste. This peak temperature kills the pathogens and weed seeds Every waste in the farm can be utilized as a raw material

 By the time the composting is completed the material become dark brown in colour.

Layers of Dung carbon source and organic waste

Cow dung + Carbon source + Organic waste + moisture C:N ratio = 20:1 Moisture content = 60% Temperature to be checked fortnightly

.90 days for composting in Thumburmuzhy model at Kerala agro climatic conditions

LOCUS       bankit1371318            524 bp    DNA     linear   ENV 12-JUL-2010 DEFINITION  16S ribosomal RNA gene, partial sequence.
ACCESSION   1371318 VERSION KEYWORDS    ENV. SOURCE      Uncultured  Alistipes sp ORGANISM  Uncultured  Alistipes sp            Unclassified. REFERENCE   1  (bases 1 to 524) AUTHORS   Girija,D., Francis,X., Deepa,K., Sunil,E., Irin,A. and Jisharaj,K. TITLE     Molecular diversity of bacteria in cow dung REFERENCE   2  (bases 1 to 524)

AUTHORS   Girija,D., Francis,X., Deepa,K., Sunil,E., Irin,A. and Jisharaj,K.
TITLE     Direct Submission JOURNAL   Submitted (12-JUL-2010) Agricultural Microbiology, Kerala            Agricultural University, Vellanikkara, Thrissur, Kerala 680656,            India &CBF Thumburmuzhy FEATURES             Location/Qualifiers     source          1..524                     /organism="Uncultured  Alistipes sp"                     /mol type="genomic DNA"                     /isolation source="Cow dung"                     /environmental sample                     /country="India"                     /identified by="Dr. D. Girija"                     /PCR_primers="fwd_seq: caggcctaacacatgcaagtc, rev_seq:                     gggcggwgtgtacaaggc"                     /metagenomic BASE COUNT      139 a    119 c    138 g    128 t ORIGIN        1 gtttgatcct ggctcaggat gaacgctagc ggcaggctta acacatgcaa gtcgaggggc

The Thumburmuzhy fodder grown organically

Thumburmuzhy Model aerobic compost
No fly menace or odour due to high temperature High temperature retained for about one week Decomposed wastes settle down No seepage Manure can be taken within 12-15 weeks Manure can be priced about Rs. 5 / kg

Harvested compost

     

A new layering system for Kerala Agro zones New cost effective construction technique Suitable for composting the animal waste and carcass Not labour intensive Minimum care needed Less methane and carbon dioxide so Ecofriendly

Three cost effective models developed at CBF Thumburmuzhy ,KAU by Dr Francis Xavier & Team Professor and Head Mail : fx@jananeethi.org

VIP AND NS IBITIO EXH ost comp

the ewing S vi SITOR VI

DR FRANCIS XAVIER PROFESSOR & HEAD,CBF THUMBURMUZHY,KONNAKUZ HY.P.O CHALKUDY,THRISSUR E mail: fx @ jananeethi.org Phone;0480 2746065 Mob;9447131598

Sign up to vote on this title
UsefulNot useful