You are on page 1of 23

GENETICS

JAN 2012 EXPERIMENT 1

INFORMATION
 CHITRA

NAIDU  Email id : cnaidu@clarku.edu  OFFICE HOURS : By appointment  Student Office : Lasry 340  Lab : Lasry 325 (Dr Thackeray’s Lab)

 ATTENDANCE  GRADING grade : Counts for 20% of your final .

LAB OVERVIEW Dates: Week Topic 1: Mendel & Genes 2: Genome annotation 3: Mapping unknowns to a chromosome 12 x x x Page 3 11 x x x (x) (x) Jan 31 1 Feb 7 2 Feb 14 3 Feb 21 4 Feb 28 5 Mar 6 Mar 13 6 Mar 20 7 Mar 27 8 Apr 3 9 Apr 10 10 Apr 17 11 Apr 23 12 4: Genetic testing of 18 x x your own DNA 5: Recombination mapping 6: Phylogenetics of bears 29 x 23 x x x x x .

EXPERIMENT 1 MENDEL AND GENES .

AIM THE GENE (USING BIOINFORMATIC TOOLS) OF INHERITANCE (PEDIGREE ANALYSIS) CROSSES (PUNNETT’S SQUARE)  PREDICTING  MODE  IDENTIFYING .

KEY CONCEPTS DNA 5’ EXON Start Codon ATG INTRON 3’ Stop Codon TAG/TGA/TAA TRANSCRIPTION mRNA 5’ AUG ORF 3’ SPLICING 5’ AUG mRNA protein M 3’ TRANSLATION .

.

Phase 0 introns break between codons: Gly Thr GGT|GTRAGT---------(intron)----------AG|ACT  Phase 1 introns: Gly Thr GGTA|GTRAGT---------(intron)----------AG|CT  Phase 2 introns: Gly Thr GGTAC|GTRAGT---------(intron)----------AG|T  .

 Enter .the Unknown DNA sequence into the BLAST software BLAST : Basic Local Alignment Search Tool It compares the given unknown sequence to ALL the genes and nucleotide sequences in its database and gives you the gene it is most closely related to.

.

..BLASTx search.

.

.

10 20 30 40 50 60 70 80 90 100 ATCGTACGTCGTCGTATCGTAGCAGCGGCGTACGTAGCTAGCGGCGCGCGCGCGCGCGCGCGCGATACGATATATATTTATATATAAAAAAATATTTTTT TAGCATGCAGCAGCATAGCATCGTCGCCGCATGCATCGATCGCCGCGCGCGCGCGCGCGCGCGCTATGCTATATATAAATATATATTTTTTTATAAAAAA I V R R R I V A A A Y V A S G A R A R A R D T I Y I Y I * K N I F> S Y V V V S * Q R R T * L A A R A R A R A I R Y I F I Y K K I F F> R T S S Y R S S G V R S * R R A R A R A R Y D I Y L Y I K K Y F F> <D Y T T T D Y C R R V Y S A A R A R A R A I R Y I N I Y L F I N K <T R R R I T A A A Y T A L P A R A R A R S V I Y I * I Y F F I K E <R V D D Y R L L P T R L * R R A R A R A R Y S I Y K Y I F F Y K K Stop OPEN READING FRAME .

draw separate lines .GENETICS SYMBOLS  Dominant/Wild Type = +  Mutant phenotype : lowercase letter  Chromosome :  Diploid :  For genes on different chromosomes.

+ Chromosome 1 (Sex-Linked) Two different genes on separate chromosomes Key + = wildtype g = Green C = Cuboid F M .Genetic Notation Female Wild-Type Flobes (Pink. + Chromosome 2 (Autosomal) + + . Sphericle) Male + + + .

+ Female + + + . Sphericle) + + + + + + + + Genes on the same Chromosome Key + = wildtype g = Green C = Cuboid To Be Continued… In Week 7 .Genetic Notation Female Wild-Type Flobes (Pink. Male Genes on separate Chromosomes Wild-Type Flobes (Pink. Sphericle) Male + + + .

+ Genes on separate Chromosomes g . c + . + + .Genetic Notation Female Wild-Type Flobes (Pink. + g c . Sphericle) Male g c + . c . c g . c g . + Key + = wildtype g = Green C = Cuboid g . + . + .

+ + g + . c Female + g c . c Male c + + .Genetic Notation Homozygous Male Female Autosomal Mutation Heterozygous Male Female + c + . + Female + + c . + + . . Male Sex-Linked Mutation Key + = wildtype g = Green C = Cuboid g + g . + + g + .

PEDIGREE NOTATION .

you are requested to please bring your own if possible… .  Due to shortage of laptops.NEXT WEEK…  MORE GENOME ANNOTATION..

arizona. the F2 generation?  EXTRA PROBLEMS FOR DIHYBRID CROSSES/PEDIGREE ANALYSIS :  http://www.html . the child will have sickle-cell anemia. Steve.com/sites/0072919329/student_view0/lab_exercises. Neither Karen. sphere-shaped fruit. disk-shaped fruit is crossed with a plant truebreeding for yellow. what will the phenotypic and genotypic ratios be for: a.edu/mendelian_genetics/problem_sets/dihy brid_cross/dihybrid_cross. Based on this incomplete information. and none of them has been tested to reveal sickle-cell trait.. the F1 generation? b. calculate the probability that if this couple should have another child.html  http://highered.mcgrawhill.biology. If a squash plant true-breeding for white. nor any of their parents has the disease. In summer squash. white fruit color is dominant over yellow fruit color and disk-shaped fruit is dominant over sphere-shaped fruit.PROBLEMS  Karen and Steve each have a sibling with sickle-cell disease.