0pen uenetics - Wintei 2u12

1 Becembei, 2u12

The fiist euition of this book was piouuceu in }anuaiy, 2uu9 as instiuctional
mateiial foi stuuents in Biology 2u7 at the 0niveisity of Albeita, anu is ieleaseu
to the public foi non-commeicial use unuei the Cieative Commons License (See
below). 0seis aie encouiageu to make mouifications anu impiovements to the
book. All text in the oiiginal euition was wiitten by Nichael Beyholos, Ph.B.
Chaptei 9 in this euition was wiitten by Nike Baiiington, Ph.B. Photos anu some
uiagiams weie obtaineu fiom vaiious, non-copyiighteu souices, incluuing Flicki,
Wikipeuia, Public Libiaiy of Science, anu Wikimeuia Commons. Photo
attiibutions aie listeu at the enu of the book.
This woik is licenseu unuei the Cieative Commons Attiibution-Noncommeicial-
Shaie Alike 2.S Canaua License. To view a copy of this license, visit
http:cieativecommons.oiglicensesby-nc-sa2.Sca oi senu a lettei to
Cieative Commons, 171 Seconu Stieet, Suite Suu, San Fiancisco, Califoinia,
941uS, 0SA.

0nuei the teims of the license, you aie fiee:
!" $%&'( to copy, uistiibute anu tiansmit the woik
!" )(*+, to auapt the woik
0nuei the following conuitions:
-!!'+./!+"0. You must incluue the name of the oiiginal authoi in books oi
exceipts ueiiveu fiom this woik.
1"02"**('2+&3. You may not use this woik foi commeicial puiposes.
$%&'( -3+4(. If you altei, tiansfoim, oi builu upon this woik, you may uistiibute
the iesulting woik only unuei the same oi similai licence to this one.
Foi any ieuse oi uistiibution, you must make cleai to otheis the licence teims of
this woik.
Any of the above conuitions can be waiveu if you get peimission fiom the
copyiight holuei.
The authoi's moial iights aie ietaineu in this licence.


5-678 9: ;915815$

;%&<!(' = >0!'"?/2!+"0 &0? 9@('@+(A
1.1 uenes aie units of inheiitance
1.2 BNA is the genetic mateiial
1.S The function of genes
1.4 The stiuctuie of BNA
1.S The genome
1.6 Nouel oiganisms

;%&<!(' B ;%'"*"C"*(CD E+!"C+CD &0?
E(+"C+C
2.1 BNA is packageu into chiomatin
2.2 Nitosis
2.S Neiosis
2.4 The cell cycle anu changes in BNA
content
2.S Kaiyotypes show chiomosome
numbei anu stiuctuie
2.6 Polyploiuy
2.7 Enuoieuuplication
2.8 uene balance
2.9 0iganellai genomes

;%&<!(' F G(0(!+2C "H 90( 7"2/C
S.1 Nenuel's fiist law
S.2 Relationships between alleles anu
phenotypes
S.S Biochemical basis of uominance
S.4 The Punnett squaie anu
monohybiiu ciosses
S.S Test ciosses can be useu to
ueteimine genotypes
S.6 Sex-linkage: an exception to
Nenuel's fiist law
S.7 Phenotype may be affecteu by
factois othei than genotype
S.8 Penetiance anu expiessivity
S.9 Beviations fiom expecteu iatios

;%&<!(' I E/!&!+"0 &0? J&'+&!+"0
4.1 Nutation anu polymoiphism
4.2 0iigins of mutations
4.S Nutant scieening 4.4 Some
mutations may not have uetectable
phenotypes
4.S Complementation testing

;%&<!(' K L(?+M'((C &0? L"</3&!+"0C
S.1 Peuigiee analysis
S.2 Infeiiing the moue of inheiitance
S.S Spoiauic anu non-heiitable
uiseases
S.4 Calculating piobabilities
S.S Population genetics


;%&<!(' N G(0(!+2 -0&3OC+C "H 5A" 7"2+
6.1 Bihybiiu ciosses
6.2 Epistasis anu othei gene
inteiactions

;%&<!(' P 7+04&M( Q E&<<+0M
7.1 Linkage
7.2 Recombination
7.S Linkage suppiesses
iecombination
7.4 Ciossoveis allow iecombination
between linkeu loci
7.S Infeiiing iecombination fiom
genetic uata
7.6 uenetic mapping
7.7 Napping with thiee-point ciosses

;%&<!(' R 5(2%0+S/(C "H E"3(2/3&' 6+"3"MO
8.1 Isolating genomic BNA
8.2 Isolating oi uetecting a specific
sequence by PCR
8.S Cutting anu pasting BNA:
iestiiction anu ligation
8.4 Cloning BNA: plasmiu vectois
8.S BNA analysis: gel electiophoiesis
8.6 BNA analysis: blotting anu
hybiiuization

;%&<!(' T ;%&0M(C +0 ;%'"*"C"*(C
9.1 What causes chiomosome
changes.
9.2 Chiomosome abnoimalities in
humans
9.S Biagnosing human chiomosome
abnoimalities

;%&<!(' =U E"3(2/3&' E&'4('C Q
V/&0!+!&!+@( 5'&+!C
1u.1 Some vaiiations in the genome
affect complex tiaits
1u.2 0iigins of moleculai
polymoiphisms
1u.S Classification anu uetection of
moleculai maikeis
1u.4 Applications of moleculai
maikeis
1u.S Quantitative tiait locus analysis

;%&<!(' == G(0"*+2C &0? $OC!(*C 6+"3"MO
11.1 '0mics technologies
11.2 BNA sequencing
11.S Whole genome sequencing
11.4 Functional genomics

;%&<!(' =B )(M/3&!+"0 "H G(0( 8,<'(CC+"0
12.1 The !"# opeion
12.2 Nutants of the !"# opeion
12.S Eukaiyotic gene iegulation
12.4 Regulatoiy elements in
evolution
12.S 0thei iegulatois of tiansciiption

;%&<!(' =F ;&02(' G(0(!+2C
1S.1 Classification of canceis
1S.2 Cancei cell biology
1S.S Ballmaiks of cancei
1S.4 Nutagens anu caicinogens
1S.S 0ncogenes
1S.6 Tumoi suppiessoi genes

Cieuits
Bibliogiaphy

Why uo offspiing look like theii paients. Even ancient people weie awaie that
the chaiacteiistics of an inuiviuual plant oi animal coulu be passeu between
geneiations. They also knew that some heiitable chaiacteiistics (such as the
size of fiuit) vaiieu between inuiviuuals, anu that they coulu select foi the
most favoiable tiaits while bieeuing ciops anu animals. The once pievalent
(but now uiscieuiteu) concept of !"#$%&$' &$)#*&+,$-# pioposeu that some
unuefineu essence, in its entiiety, containeu all of the heiitable infoimation foi
an inuiviuual. Nuch like the mixing of two colois of paint, it was thought that
mating combineu the essences fiom each paient. 0nce blenueu togethei, the
inuiviuual chaiacteiistics of the paients coulu not be sepaiateu again.
./. 01213 451 62783 9: 72;157842<1
=#$%#" was one of the fiist to take a scientific appioach to the stuuy of
heieuity. Be staiteu with well-chaiacteiizeu mateiials, iepeateu his
expeiiments many times, anu kept caieful iecoius of his obseivations.
Woiking with peas, Nenuel showeu that white-floweieu plants coulu be
piouuceu by ciossing two puiple-floweieu plants, but only if the puiple-
floweieu plants themselves hau at least one white-floweieu paient (Fig 1.2).
This was eviuence that the genetic factoi that piouuceu white-floweis hau !"#
blenueu iiieveisibly with the factoi foi puiple-floweis. Nenuel's obseivations
helpeu to uispiove blenuing inheiitance, in favoi of an alteinative concept
calleu >,*+&-?",+# &$)#*&+,$-#, in which heieuity is the piouuct of uisciete
factois that contiol inuepenuent tiaits. Each heieuitaiy factoi coulu exist in
one oi moie uiffeient veisions, oi ,""#"#@.
Nenuel's uisciete factois of heieuity latei became known as '#$#@. In its
naiiowest uefinition, a gene is an abstiact concept: a unit of inheiitance. The
connection between genes anu substances like BNA anu chiomosomes was
establisheu laigely thiough the expeiiments uesciibeu in the iemainuei of this
Chaptei 1 INTR0B0CTI0N ANB 0vERvIEW

Figure 1.1
Gregor Mendel
C h a p t e i 1 | .AB


chaptei. Bowevei, it is woith noting that Nenuel anu many ieseaicheis who
followeu him weie able to pioviue gieat insights into biology, simply by
obseiving the inheiitance of specific tiaits.

./B C24 73 8;1 012187< =481574D
By the eaily 19uu's, biochemists hau isolateu hunuieus of uiffeient chemicals
fiom living cells. Which of these was the genetic mateiial. Pioteins seemeu
like piomising canuiuates, since they weie abunuant anu complex molecules.
Bowevei, a few key expeiiments helpeu to piove that BNA, iathei than
piotein, is the genetic mateiial.
1.2.1 uRIFFITB'S EXPERINENT
Niciobiologists iuentifieu two stiains of the bacteiium $#%&'#"("(()*
'!&),"!-.&. 0ne stiain (R) piouuceu iough colonies, while the othei (S) was
smooth (Fig. 1.S). Noie impoitantly, the S-type bacteiia causeu fatal
infections, while the R-type uiu not. 0*&EE&+) noticeu that simply mixing the
stiains togethei coulu tiansfoim some R-type bacteiia into smooth, pathogenic
stiains (Fig. 1.4). This tiansfoimation occuiieu even when the S-type stiains
weie fiist killeu by heat. Thus, some component of the S-type stiains
containeu genetic infoimation that coulu be tiansfeiieu to the R-type stiains.

Figure 1.2 Inheritance of flower color in peas. Mendel observed that a cross between pure
breeding,white and purple peas (generation P) produced only progeny (generation F
1
) with
purple flowers. However, white flowered plant reappeared among the F
2
generation progeny
of a mating between two F
1
plants. The symbols P, F
1
and F
2
are abbreviations for parental,
first filial, and second filial generations, respectively.

C h a p t e i 1 | .AF

1.2.2 AvERY, NACLE0B ANB NCCARTY'S EXPERINENT
What kinu of molecule fiom within the S-type cells was iesponsible foi the
tiansfoimation. To answei this, ieseaicheis nameu 4G#*HI =,-D#J% ,$%
=-<,*+H sepaiateu the S-type cells into vaiious components, such as pioteins,
polysacchaiiues, lipius, anu nucleic acius. 0nly the nucleic acius fiom S-type
cells weie able to make the R-stiains smooth anu fatal. Fuitheimoie, when
cellulai extiacts of S-type cells weie tieateu with BNase (an enzyme that
uigests BNA), the tiansfoimation ability was lost. The ieseaicheis theiefoie
concluueu that BNA was the genetic mateiial, which in this case contiolleu the
appeaiance anu pathogenicity of the bacteiia.

Figure 1.4 Experiments of Griffith and of Avery , MacLeod and McCarty. R strains of S.
pneumoniae do not cause lethality. However, DNA-containing extracts from pathogenic S
strains are sufficient to make R strains pathogenic.


Figure 1.3 Colonies of
Rough (top) and Smooth
(bottom) strains of S.
pneumoniae.



C h a p t e i 1 | .AK



1.2.S BERSBEY ANB CBASE'S EXPERINENT
Fuithei eviuence that BNA is the genetic mateiial came fiom expeiiments
conuucteu by ;#*@)#H ,$% <),@#. These ieseaicheis stuuieu the
tiansmission of genetic infoimation fiom a viius calleu the T2 bacteiiophage
to its host bacteiium, /*(0&%-(0-. ("1- (Fig. 1.S). Like all viiuses, T2 hijacks the
cellulai machineiy of its host to manufactuie moie viiuses. The T2 phage
contains both piotein anu BNA. To ueteimine which of these types of
molecules containeu the genetic bluepiint foi the viius, Beishey anu Chase
giew viial cultuies in the piesence of iauioactive isotopes of eithei
phosphoius (
S2
P) oi sulphui (
SS
S). The phage incoipoiateu these isotopes
into theii BNA anu pioteins, iespectively (Fig 1.6). The ieseaicheis then
infecteu /2 ("1- with the iauiolabeleu viiuses, anu lookeu to see whethei
S2
P oi
SS
S enteieu the bacteiia. Aftei ensuiing that any viiuses hau been iemoveu
fiom the suiface of the cells, the ieseaicheis obseiveu that infection with
S2
P
labeleu viiuses (but not the
SS
S labeleu viiuses) iesulteu in iauioactive
bacteiia. This uemonstiateu that BNA was the mateiial that containeu genetic
instiuctions.

Figure 1.6 When
32
P-labeled phage infects E. coli, radioactivity is found only in the
bacteria, after the phage are removed by agitation and centrifugation. In contrast, after
infection with
35
S-labeled phage, radioactivity is found only in the supernatant that remains
after the bacteria are removed.


Figure 1.5
Electronmicrograph of
T2 bacteriophage on
surface of E. coli

C h a p t e i 1 | .AL
./F 8;1 :62<8792 9: 01213
1.S.1 BEABLE ANB TAT0N'S EXPERINENT
Life uepenus on metabolism to supply eneigy anu to piouuce the molecules
that make cells. In 1941, M#,%"# ,$% 8,+?N uemonstiateu the connection
between genes anu metabolic pathways. Theii iesults leu to the "J$# '#$#I
J$# >*J+#&$" piinciple, which states that each of the enzymes that acts in a
biochemical pathway is encoueu by a uiffeient gene. Although we now know
of many exceptions to this mouel, it is geneially tiue that each gene piouuces a
piotein that has a paiticulai catalytic, iegulatoiy, oi stiuctuial function.
Beaule anu Tatum's expeiiments aie impoitant because of this conceptual
auvances anu also because they uemonstiate the utility of N?+,$+ @-*##$&$'.
Beaule anu Tatum anu theii colleagues Sib anu Boiowitz weie inteiesteu in
the metabolic pathways that piouuce amino acius. They useu the fungus
!"#$%&'%$( *$(&&( (a molu) foi theii stuuies because it hau piactical
auvantages as a laboiatoiy subject. The ieseaicheis knew that Neuiospoia
was >*J+J+*J>)&- foi most amino acius, meaning that it coulu synthesize
amino acius fiom minimal meuium, which lackeu most nutiients except foi
simple sugais anu a few vitamins anu mineials. They also knew that by
exposing Neuiospoia to X-iays, they coulu ianuomly uamage its BNA. Each
spoie that was exposeu to X-iays potentially containeu a mutation in a
uiffeient gene. Some mutations changeu Neuiospoia into an ,?OJ+*J>), which
woulu no longei giow on minimal meuium, but which uiu giow on complete

Figure 1.7 A single mutagenized spore is used to establish a colony of genetically identical
fungi, from which spores are tested for their ability to grow on different types of media.
Because spores of this particular colony are able to grown only on complete medium (CM),
or on miminal medium supplemented with arginine (MM+Arg), they are considered Arg
auxotrophs and we infer that they have a mutation in a gene in the Arg biosynthetic
pathway. This type of screen is repeated many times to identify other mutants in the Arg
pathway and in other pathways.
C h a p t e i 1 | .AP


meuium supplementeu with all of the amino acius (Fig. 1.7). Impoitantly, the
ieseaicheis testeu the ability of inuiviuual amino acius to iescue the
auxotiophs: they auueu one of each of the amino acius to minimal meuium anu
iecoiueu which of these iestoieu giowth to inuepenuent mutants. Foi
example, if the piogeny of a mutagenizeu spoie coulu giow on minimal
meuium only when it was supplementeu with aiginine (Aig), then the
auxotioph must beai a mutation in the Aig biosynthetic pathway.
Synthesis of even a ielatively simple molecule such
as Aig iequiies many uiffeient enzymes. Each
enzyme woiks sequentially on a uiffeient
inteimeuiate in the pathway (Fig. 1.8). Foi Aig, two
of the inteimeuiates aie calleu oinithine (0in) anu
citiulline (Cit). In theoiy, mutation of any one of the
enzymes in this pathway coulu tuin Neuiospoia into
an Aig auxotioph. The ieseaicheis extenueu theii
analysis by testing the ability of inteimeuiates of
amino aciu biosynthesis to iestoie giowth of
mutants (Figuie 1.9). They founu that some of the
Aig auxotiophs coulu be iescueu only by Aig, otheis
coulu be iescueu by eithei Aig oi Cit, anu still othei
mutants coulu be iescueu by Aig, Cit, oi 0in (Table
1.1). Baseu on these iesults, they coulu ueuuce the
location of each mutation in the Aig biochemical
pathway, i.e. which gene was iesponsible foi the
metabolism of which inteimeuiate.


Figure 1.8 A simplified version of the Arg biosynthetic
pathway, showing citrulline (Cit) and ornithine (Orn)
as intermediates in Arg metabolism. These chemical
reactions depend on enzymes represented here as the
products of three different genes.

Figure 1.9 Testing different Arg auxotrophs for their ability to grow on media supplemented with
intermediates in the Arg biosynthetic pathway.
C h a p t e i 1 | .AQ







1.S.2 N0TANT SCREENINu BELPS CBARACTERIZE uENES
Beaule anu Tatum's expeiiments paveu the way foi the genetic uissection of
many biochemical anu uevelopmental pathways. The geneial stiategy foi a
mutant scieen is to expose a population to a mutagen, then look foi inuiviuuals
among the piogeny that have uefects in a biological piocess of inteiest. Theie
aie many uetails that must be consiueieu when uesigning a mutant scieen (e.g.
how can iecessive alleles be maue homozygous). Neveitheless, mutational
analysis has been pioven to be a poweiful anu efficient tool in iuentifying anu
chaiacteiizing the functions of genes ielateu to a wiue vaiiety of biological
piocesses, incluuing many uisease-ielateu genes.

./K 8;1 3856<8651 9: C24
The expeiiments outlineu in the pievious sections pioveu that BNA was the
genetic mateiial, but veiy little was known about its stiuctuie.
1.4.1 CBARuAFF'S R0LES
When R,+@J$ ,$% <*&-S set out in the 194u's to ueteimine the stiuctuie of
BNA, it was alieauy known that BNA is maue up of foui uiffeient types of
molecules, calleu bases oi nucleotiues: auenine (A), cytosine (C), thymine (T),
guanine (u). Watson anu Ciick also knew of <),*',EET@ 5?"#@, which weie a
set of obseivations about the ielative amount of each nucleotiue that was
piesent in almost any extiact of BNA. Chaigaff hau obseiveu that foi any
given species, the abunuance of A was the same as T, anu u was the same as C.




MM + Orn MM + Cit MM + Arg
gene A
mutants
Yes Yes Yes
gene B
mutants
No Yes Yes
gene C
mutants
No No Yes
Table 1.1 Ability of auxotrophic mutants of each of the three enzymes of the Arg
biosynthetic pathways to grow on minimal medium (MM) supplemented with Arg or
either of its precursors, Orn and Cit. Gene names refer to the labels used in Figure 1.8

Figure 1.10
DNA structure
C h a p t e i 1 | .AU



1.4.2 TBE B00BLE BELIX
0sing metal mouels of the inuiviuual nucleotiues, Watson anu Ciick ueuuceu a
stiuctuie foi BNA that was consistent with Chaigaff's Rules anu with x-iay
ciystallogiaphy uata that was obtaineu (with some contioveisy) fiom anothei
ieseaichei nameu Rosalinu Fianklin. In Watson anu Ciick's famous uouble
helix, each of the two stianus contains BNA bases connecteu thiough covalent
bonus to a sugai-phosphate backbone (Fig 1.1u, 1.11). Because one siue of
each sugai molecule is always connecteu to the opposite siue of the next sugai
molecule, each stianu of BNA has polaiity: these aie calleu the S' (S-piime)
enu anu the S' (S-piime) enu, in accoiuance with the nomenclatuie of the
caibons in the sugais. The two stianus of the uouble helix iun in anti-paiallel
(i.e. opposite) uiiections, with the S' enu of one stianu aujacent to the S' enu of
the othei stianu. The uouble helix has a *&')+A),$%#% twist, (iathei than the
left-hanueu twist that is often iepiesenteu in populai meuia). The BNA bases
extenu fiom the backbone towaius the centei of the helix, with a paii of bases
fiom each stianu foiming hyuiogen bonus that help to holu the two stianus
togethei. 0nuei most conuitions, the two stianus aie slightly offset, which
cieates a majoi gioove on one face of the uouble helix, anu a minoi gioove on
the othei. Because of the stiuctuie of the bases, A can only foim hyuiogen
bonus with T, anu u can only foim hyuiogen bonus with C (hence, Chaigaff's
Rules). Each stianu is theiefoie saiu to be complementaiy to the othei, anu
each stianu also contains enough infoimation to ieplace the othei. This
ieuunuancy is impoitant in iepaiiing BNA, anu also in its ieplication.

Figure 1.11 Chemical structure of two pairs of nucleotides in a fragment of double-
stranded DNA. Sugar, phosphate, and bases A,C,G,T are labeled. Hydrogen bonds
between bases on opposite strands are shown by dashed lines. Note that the G-C pair has
more hydrogen bonds than A-T. The numbering of carbons within sugars is indicated by
red numbers. Based on this numbering the polarity of each strand is indicated by the
labels 5 and 3.
C h a p t e i 1 | .AV


1.4.S TBE CENTRAL B0uNA
Bow uoes the stiuctuie of BNA ielate to inheiitance of biological tiaits such as
the flowei coloi of Nenuel's peas. The answei to this lies in what has become
known as moleculai biology's <#$+*," CJ'N,, which states that each gene is
encoueu in BNA, anu then as neeueu, this genetic infoimation is tiansciibeu
into RNA anu then tianslateu into piotein. In ceitain ciicumstances, RNA may
also be conveiteu to BNA thiough a piocess calleu ieveise tiansciiption. The
oiuei of bases in BNA uiiectly contiols the oiuei of amino acius that make up
a piotein. Pioteins uo most of the woik in a cell, anu catalyze the foimation
anu bieakuown of almost all of the molecules within an oiganism. By
uictating the stiuctuie of each piotein, BNA affects the function of that
piotein, anu can theieby affect the entiie oiganism. In the case of Nenuel's
peas, puiple-floweieu plants have a gene that encoues an enzyme that
piouuces a puiple pigment molecule. In the white-floweieu plants, the BNA
foi this gene has been changeu so that it no longei encoues a functional
piotein. This is an example of a natuial mutation in a biochemical pathway.
./L 8;1 0129=1
The complete set of BNA within the nucleus of any oiganism is calleu its
genome. 0iganelles such as mitochonuiia anu chloioplasts also have theii
own genomes. Theie is suipiisingly little coiielation between the nucleai BNA
content of a genome (i.e. the -AG,"?#) anu the physical size oi complexity of an
oiganism. Foi example, a single copy of the human genome contains
appioximately S x 1u
9
BNA bases, while a single wheat genome contains 17 x
1u
9
BNA bases. This appaient paiauox (calleu the c-value paiauox) can be
explaineu by the fact that not all BNA encoues genes. In fact, in many
oiganisms, genes aie sepaiateu fiom each othei by long stietches of BNA that
uo not coue foi a piotein. Some of this "non-couing" BNA may be tiansposable
elements, which aie an inteiesting class of self-ieplicating BNA elements
uiscusseu in moie uetail in a subsequent chaptei.
345 ("!#&!#
6789 :;<
/*#-,.#&= >&!&
!),8&%
5?&%.>& >&!&
=&!*-#@
;0%","*",&
!),8&% 6:4<
A"," *.'-&!* S,2uu 2S,uuu 1uu,uuu 2S
7)* ,)*()1)* 2,6uu 2S,uuu 1uu,uuu 2u
3%"*"'0-1. ,&1.!">.*#&% 14u 1S,uuu 9,uuu 4
5%.8-="'*-* #0.1-.!. 1Su 2S,uuu 4,uuu S
;.&!"%0.8=-#-* &1&>.!* 1uu 19,uuu S,uuu 6
$.((0.%",@(&* (&%&?-*-.& 12 6,uuu 2,uuu 16
/*(0&%-(0-. ("1- S S,2uu 1,4uu 1

Table 1.2 Measures of genome size in selected organisms. The DNA content (1C) is shown in millions of
basepairs (Mb). Average gene density is the mean number of non-coding bases (in bp)
between genes in the genome. For eukaryotes, the chromosome number is the chromosomes
counted in a gamete (1N) from each organism.


Figure 1.12Central
Dogma of molecular
biology
C h a p t e i 1 | .A.W


./P =9C1D 9504273=3
We have seen alieauy that many of the gieat auvances in genetics weie maue
using species that aie not especially impoitant fiom a meuical, economic, oi
even ecological peispective. ueneticists, fiom Nenuel onwaius, have useu
mouel oiganisms foi theii expeiiments. Touay, a small numbei of species aie
wiuely useu a mouel genetic oiganisms. All of these species have
chaiacteiistics that make them easy to giow in laige numbeis in laboiatoiies:
they aie small, fast giowing with a shoit geneiation time anu piouuce lots of
piogeny fiom matings that can be easily contiolleu. uenetic mouel oiganisms
also usually have small genomes (small c-value), anu aie uiploiu (i.e.
chiomosomes aie piesent in paiis). Yeast (+(**,($%-.*"& *"$"/0&0(") is a
goou geneial mouel foi the basic functions of eukaiyotic cells. The
iounuwoim, 1("2%$,(34050& "6"7(2& is a useful mouel foi the uevelopment of
multicellulai oiganisms, in pait because it is tianspaient thioughout its life
cycle, anu its cells unueigo a well-chaiacteiizeu seiies of uivisions to piouuce
the auult bouy. The fiuit fly (8$%&%',06( -"6(2%7(&5"$) has been stuuieu
longei, anu piobably in moie uetail, than any of the othei genetic mouel
oiganisms still in use, anu is a useful mouel foi stuuying uevelopment as well
as physiology anu even behavioui. As a mammal, mouse (9#& -#&*#6#&) is
the mouel oiganism most closely ielateu to humans, howevei some of the
piactical uifficulties of woiking with mice leu ieseaicheis moie iecently to
uevelop zebiafish (8(20% $"$0%) as a genetic mouel foi veitebiates. 0nlike
mice, zebiafish embiyos uevelop exteinally to theii motheis anu aie
tianspaient, making it easiei to stuuy theii uevelopment. Finally, a small
weeu, :$(304%'&0& 5,(60(2(, is the most wiuely stuuieu plant genetic mouel
oiganism.

The stuuy of genetic mouel oiganisms has gieatly incieaseu oui knowleuge of
genetics, anu biology in geneial. Nouel oiganisms also have impoitant
implications in meuical ieseaich. Foi example, at least 7S% of the
appioximately 1,uuu genes that have been associateu with specific human
uiseases have highly similai sequences in both humans anu 8; -"6(2%7(&5"$.
Infoimation leaineu fiom mouel oiganisms about paiticulai biochemical


Figure 1.13 Some of the most important genetic model organisms in use today. Clockwise from top left: yeast,
fruit fly, arabidopsis, mouse, roundworm, zebrafish.
C h a p t e i 1 | .A..

pathways can usually be applieu to othei species, since the main featuies of
many biochemical pathways tenu to be shaieu between species.
It is also possible, anu sometimes necessaiy, to stuuy biological piocesses in
non-mouel oiganisms. Bumans, foi example, have none of the chaiacteiistics
of a mouel oiganism, anu theie aie some uiseases oi othei tiaits foi which no
cleai analog exists in othei oiganisms. Some of the tools of genetic analysis
can be applieu to non-mouel oiganisms, especially with the uevelopment of
new types of genetic mapping anu whole genome sequencing.

C h a p t e i 1 | .A.B


XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
36==45Y
Nenuel uemonstiateu that heieuity involveu uisciete, heiitable factois
that affecteu specific tiaits.
A gene can be uefineu abstiactly as unit of inheiitance; many genetic
expeiiments can be conuucteu without a knowleuge of BNA.
The ability of BNA fiom bacteiia anu viiuses to tiansfei genetic
infoimation into bacteiia helpeu piove that BNA is the genetic
mateiial.
BNA is a uouble helix maue of two anti-paiallel stianus of bases on a
sugai-phosphate backbone.
Specific bases on opposite stianus paii thiough hyuiogen bonuing,
ensuiing complementaiity of the stianus.
The Cential Bogma explains how BNA affects heiitable tiaits.
Not all of the BNA in an oiganism contains genes.
Nouel oiganisms acceleiate the use of genetics in basic anu applieu
ieseaich in biology, agiicultuie anu meuicine.

Z1Y 815=3
blenuing inheiitance
paiticulate
inheiitance
Nenuel
gene
allele
tiait
P, F1, F2
uiiffith
Aveiy, NacLeou,
NcCaity
Beishey anu Chase
BNase
pioteinase
SS
S
S2
P
bacteiiophage
Beaule, Tatum
auxotioph
piototioph
metabolic pathway
Neuiospoia
Chaigaff's Rules
Watson anu Ciick
BNA bases
sugai-phosphate
backbone
anti-paiallel
complementaiy
hyuiogen bonu
minoi gioove
majoi gioove
auenine
cytosine
thymine
guanine
Cential Bogma
tiansciiption
tianslation
RNA
genome
c-value paiauox
mouel oiganism
$.((0.%",@(&*
(&%&?-*-.&
;.&!"%0.8=-#-*
&1&>.!*
3%"*"'0-1.
,&1.!">.*#&%
7)* ,)*()1)*
3.!-" %&%-"
5%.8-="'*-* #0.1-.!.
/*(0&%-(0-. ("1-

XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
386CY [61387923
./. Bow woulu the iesults of the
cioss in Figuie 1.2 have been
uiffeient if heieuity woikeu
thiough blenuing inheiitance
iathei than paiticulate inheiitance.

./B Imagine that astionauts
pioviue you with living samples of
multicellulai oiganisms uiscoveieu
on anothei planet. These oiganisms
iepiouuce with a shoit geneiation
time, but nothing else is known
about theii genetics.
,\ Bow coulu you uefine laws
of heieuity foi these
oiganisms.
!\ Bow coulu you ueteimine
what molecules within these
oiganisms containeu genetic
infoimation.
-\ Woulu the mechanisms of
genetic inheiitance likely be
similai foi all oiganisms fiom
this planet.
%\ Woulu the mechanisms of
genetic inheiitance likely be
similai to oiganisms fiom
eaith.

./F It is ielatively easy to extiact
BNA anu piotein fiom cells;
biochemists hau been uoing this
since at least the 18uu's. Why then
uiu Beishey anu Chase neeu to use
iauioactivity to label BNA anu
pioteins in theii expeiiments.

./K Compaie Watson anu Ciick's
uiscoveiy with Aveiy, NacLeou anu
NcCaity's uiscoveiy.
,\ What uiu each uiscovei, anu
what was the impact of these
uiscoveiies on biology.
!\ Bow uiu Watson anu Ciick's
appioach geneially uiffei fiom
Aveiy, NacLeou anu
NcCaity's.
-\ Biiefly ieseaich Rosalinu
Fianklin on the inteinet. Why
is hei contiibution to the
stiuctuie of BNA
contioveisial.

./L Staiting with mice anu R anu S
stiains of $2 '!&),"!-.&, what
expeiiments in auuitional to those
shown in Figuie 1.4 to uemonstiate
that BNA is the genetic mateiial.

./P List the infoimation that
Watson anu Ciick useu to ueuuce
the stiuctuie of BNA.

./Q Refei to Watson anu Ciick'
,\ List the uefining
chaiacteiistics of the stiuctuie
of a BNA molecule.
!\ Which of these
chaiacteiistics aie most
impoitant to ieplication.
-\ Which chaiacteiistics aie
most impoitant to the Cential
Bogma.

./U Compaie Figuie 1.9 anu Table
1.1. Which of the mutants (#1, #2,
#S) shown in Figuie 1.9 matches
each of the phenotypes expecteu
foi mutations in genes A, B,C.

./V Refei to Table 1.2
,\ What is the ielationship
between BNA content of a
genome, numbei of genes,
gene uensity, anu chiomosome
numbei.
C h a p t e i 1 | .A.K


!\ What featuie of genomes
explains the c-value paiauox.
-\ Bo any of the numbeis in
Table 1.2 show a coiielation
with oiganismal complexity.


./.W ,\ List the chaiacteiistics of
an iueal mouel oiganism.
!\ Which mouel oiganism can
be useu most efficiently to
iuentify genes ielateu to:

i) eye uevelopment
ii) skeletal
uevelopment
iii) photosynthesis
iii) cell uivision
iv) cell uiffeientiation
v) cancei

./.. Refei to Figuie 1.8
,\ Iuentify the pait of the BNA
molecule that woulu be
iauioactively labeleu in the
mannei useu by Beishey &
Chase
!\ BNA helices that aie iich in
u-C base paiis aie haiuei to
sepaiate (e.g. by heating) that
A-T iich helices. Why.




Chiomosomes contain genetic infoimation. We often take this fact foi gianteu,
but just ovei a centuiy ago, even the best biologists in the woilu weie
unceitain of the function of these iou-shapeu stiuctuies. We now know that
most chiomosomes contain a single molecule of uouble-stianueu BNA that is
complexeu with pioteins. This aiiangement allows veiy long BNA molecules
to be compacteu into a small volume that can moie easily be moveu uuiing
mitosis anu meiosis (Fig 2.1). The compact stiuctuie also makes it easiei foi
paiis of chiomosomes to align with each othei uuiing meiosis. Finally, we
shall see that chiomosomal stiuctuie can affect whethei genes aie active oi
silent.
!"# %&' () *'+,'-.% (&/0 +1203'/(&
2.1.1 BNA CAN BE BIuBLY C0NPACTEB
If stietcheu to its full length, the BNA molecule of the laigest human
chiomosome woulu be 8Smm. Yet uuiing mitosis anu meiosis, this BNA
molecule is compacteu into a chiomosome appioximately Sm long. Although
this compaction makes it easiei to tianspoit BNA within a uiviuing cell, it also
makes BNA less accessible foi othei cellulai functions such as BNA synthesis
anu tiansciiption. Thus, chiomosomes vaiy in how tightly BNA is packageu,
uepenuing on the stage of the cell cycle anu also uepenuing on the level of gene
activity iequiieu in any paiticulai iegion of the chiomosome.
2.1.2 LEvELS 0F C0NPACTI0N
Theie aie seveial uiffeient levels of stiuctuial oiganization in eukaiyotic
chiomosomes, with each successive level contiibuting to the fuithei
compaction of BNA (Fig. 2.2). Foi moie loosely compacteu BNA, only the fiist
few levels of oiganization may apply. Each level involves a specific set of
pioteins that associate with the BNA to compact it. Fiist, pioteins calleu the
4567 89:;5<7: act as spool aiounu which BNA is coileu twice to foim a
Chaptei 2 CBR0N0S0NES, NIT0SIS, ANB NEI0SIS
Figure 2.1 Moving
chromosomes (blue)
towards the poles at
anaphase requires
many proteins (red), all
of which interact with
microtubules (green).
C h a p t e i 2 | !=!


stiuctuie calleu the <>4?75:5@7. Nucleosomes aie foimeu at iegulai
inteivals along the BNA stianu, giving the molecule the appeaiance of "beaus
on a stiing". At the next level of oiganization, 89:;5<7 1# helps to compact the
BNA stianu anu its nucleosomes into a AB<@ C9D67. Subsequent levels of
oiganization involve the auuition of :4ECC5?F G65;79<: that winu the Sunm
fibie into coils, which aie in tuin wounu aiounu othei scaffolu pioteins.

2.1.S CBR0NATIN, E0CBR0NATIN, BETER0CBR0NATIN
Chiomosomes stain veiy intensely with some types of uyes, which is how
they got theii name (chiomosome means "coloieu bouy"). Ceitain uyes stain
some iegions within a chiomosome moie intensely that otheis, giving some
chiomosomes a banueu appeaiance. The mateiial that makes up
chiomosomes, which we now know to be pioteins anu BNA, is calleu
4865@E;9<. Theie aie two geneial types of chiomatin. .>4865@E;9< is moie
loosely packeu, anu tenus to contain moie genes that aie being tiansciibeu, as
compaieu to the moie uensely compacteu 87;7654865@E;9< which is iich in
shoit, iepetitive sequences calleu @9465:E;7??9;7:.

2.1.4 N0RPB0L0uICAL FEAT0RES 0F CBR0N0S0NES
Chiomosomes also contain othei uistinctive featuies such as centiomeies anu
telomeies. Both of these aie heteiochiomatic. In most cases, each
chiomosome contains one 47<;65@767. These sequences aie bounu by
centiomeiic pioteins that link the centiomeie to miciotubules that tianspoit
chiomosomes uuiing cell uivision. 0nuei the micioscope, centiomeies can
sometimes appeai as constiictions in the bouy of the chiomosome (Fig. 2.S). If
a centiomeie is locateu neai the miuule of a chiomosome, it is saiu to be
@7;E47<;694, while an E46547<;694 centiomeie is closei to one enu of a
chiomosome, anu a ;7?547<;694 chiomsome is at the veiy enu. Noie iaiely, in
a 85?547<;694 centiomeie, no single centiomeie can be uefineu anu the entiie
chiomsome acts as the centiomeie. /7?5@767: aie iepetitive sequences neai
the enus of lineai chiomosomes, anu aie impoitant in maintaining the length
of the chiomosomes uuiing ieplication, anu piotecting the enus of the
chiomosomes fiom alteiations.


Figure 2.2 Successive
stages of chromosome
compaction depend on
the introduction of
additional proteins.
Figure 2.3 A pair of
metacentric
chromosomes. The
arrow shows a
centromeric region.
C h a p t e i 2 | !=A



It is useful to uesciibe the similaiity between chiomosomes using appiopiiate
teiminology (Fig 2.4). 15@5?5H5>: chiomosomes aie typically paiis of
similai, but non-iuentical, chiomosomes in which one membei of the paii
comes fiom the male paient, anu the othei comes fiom the female paient.
Bomologs contain the same genes but not necessaiily the same alleles. &5<=
85@5?5H5>: chiomosomes contain uiffeient sets of genes, anu may oi may
not be uistinguishable baseu on cytological featuies such as length anu
centiomeie position. Within a chiomosomes that has unueigone ieplication,
theie aie :9:;76 4865@E;9F:I which aie physically connecteu to each othei at
the centiomeie anu iemain joineu until cell uivision. Because a paii of sistei
chiomatius is piouuceu by the ieplication of a single BNA molecule, theii
sequences aie essentially iuentical. 0n the othei hanu, <5<=:9:;76 4865@E;9F:
come fiom two sepaiate, but homologous chiomosomes, anu theiefoie usually
contain the same genes in the same oiuei, but uo not necessaiily have iuentical
BNA sequences.







Figure 2.4
Relationships between
chromosomes and
chromatids.
Figure 2.5
Top: FISH
(Fluorescence in situ
hybridization) labeling
of all 24 different
human chromosomes (1
- 22, X, and Y) in a
fibroblast nucleus, each
with a different
combination of in total
seven fluorochromes.
Bottom: False color
representation of all
chromosome territories
visible in this mid-
section after computer
classification.
C h a p t e i 2 | !=J



!"! 3(/0)()
Cell uivision is essential to asexual iepiouuction anu the uevelopment of
multicellulai oiganisms. Accoiuingly, the piimaiy function of mitosis is to
ensuie that each uaughtei cell inheiits iuentical genetic mateiial, i.e. exactly
one copy of each chiomosome. To make this happen, ieplicateu chiomosomes
conuense (G65G8E:7), anu aie positioneu neai the miuule of the uiviuing cell
(@7;EG8E:7), anu then one sistei chiomatiu fiom each chiomosome migiates
towaius opposite poles of the uiviuing cell (E<EG8E:7), until the iuentical sets
of chiomosomes aie completely sepaiateu fiom each othei within the newly
foimeu nuclei of each uaughtei cell (;7?5G8E:7) (see Figs. 2.S-2.7 foi uiagiams
of the piocess). This is followeu by the completion of the uivision of the
cytoplasm (4K;5L9<7:9:). The movement of chiomosomes is aiueu by
miciotubules that attach to the chiomosomes at centiomeie.


!"A 3.(0)()
Neiosis, like mitosis, is also a necessaiy pait of cell uivision. Bowevei, in
meiosis not only uo sistei chiomatius sepaiate fiom each othei, homologous
chiomosomes also sepaiate fiom each othei. This extia, ieuuctional step of
meiosis is essential to sexual iepiouuction. Without meiosis, the chiomosome
numbei woulu uouble in each geneiation of a species anu woulu quickly
become too laige to be viable.
Neiosis is uiviueu into two stages uesignateu by the ioman numeials I anu II.
Neiosis I is calleu a 67F>4;95<E? uivision, because it ieuuces the numbei of
chiomosomes inheiiteu by each of the uaughtei cells. Neiosis I is fuithei
uiviueu into Piophase I, Netaphase I, Anaphase I, anu Telophase I, which aie
ioughly similai to the coiiesponuing stages of mitosis, except that in Piophase
I anu Netaphase I, homologous chiomosomes paii with each othei in tiansient
stiuctuies calleu D9ME?7<;: (Figs. 2.7, 2.8). This is an impoitant uiffeience
between mitosis anu meiosis, because it affects the segiegation of alleles, anu
also allows foi iecombination to occui thiough ciossing-ovei, as uesciibeu
latei. Buiing Anaphase I, one membei of each paii of homologous
chiomosomes migiates into a uaughtei cell. Neiosis II is essentially the same
as mitosis, with one sistei chiomatiu fiom each chiomosome sepaiating to
piouuce two iuentical cells. Because Neiosis II, like mitosis, iesults in piouucts
that contain iuentical sequences, Neiosis II is calleu an 7N>E;95<E? uivision.
Figure 2.6 Mitosis in
arabidopsis showing
fluorescently labeled
chromosomes (blue)
and microtubules
(green) at metaphase,
anaphase and telophase
(from left to right).
C h a p t e i 2 | !=O




Figure 2.7 Mitosis and meiosis. Note the similarities and differences between metaphase in mitosis and
metaphase I and II of meiosis.
C h a p t e i 2 | !=P





!"J /1. +.QQ +R+Q. '&% +1'&-.) (& %&' +0&/.&/
2.4.1 F00R STAuES 0F A TYPICAL CELL CYCLE
The life cycle of eukaiyotic cellS can geneially be uiviueu into at least foui
stages (Fig. 2.9). When a cell is piouuceu thiough feitilization oi cell uivision,
theie is usually a lag befoie it unueigoes BNA synthesis. This lag peiiou is
calleu uap 1 (-#), anu enus with the onset of the BNA synthesis ()) phase,
uuiing which each chiomosome is ieplicateu. Following ieplication, theie
may be anothei lag, calleu uap 2 (-!), befoie mitosis (3). Cells unueigoing
meiosis uo not usually have a u2 phase. Inteiphase is as teim useu to
uesciibe all phases of the cell cycle excluuing mitosis anu meiosis. A typical cell
cycle is shown in Fig. 2.9. Nany vaiiants of this geneializeu cell cycle also exist.
Some cells nevei leave u1 phase, anu aie saiu to entei a peimanent, non-
uiviuing stage calleu -B. 0n the othei hanu, some cells unueigo many iounus
of BNA synthesis (S) without any mitosis oi cell uivision, leauing to
enuoieuuplication. 0nueistanuing the contiol of the cell cycle is an active aiea
of ieseaich, paiticulaily because of the ielationship between cell uivision anu
cancei.
2.4.2 NEAS0RES 0F BNA C0NTENT ANB CBR0NS0NE C0NTENT
The amount of BNA within a cell changes following each of the following
events: feitilization, BNA synthesis, mitosis, anu meiosis (Fig 2.1u). We use "4"
to iepiesent the BNA content in a cell, anu "<" to iepiesent the numbei of
complete sets of chiomosomes. In a gamete (i.e. speim oi egg), the amount of
BNA is 1c, anu the numbei of chiomosomes is 1n. 0pon feitilization, both the
BNA content anu the numbei of chiomosomes uoubles to 2c anu 2n,
iespectively. Following BNA synthesis, the BNA content uoubles again to 4c,
Figure 2.8 Meiosis in Arabidopsis (n=5). Panels A-C show different stages of prophase I, each with an
increasing degree of chromosome condensation. Subsequent phases are shown: metaphase I (D), telophase
I (E), metaphase II (F), anaphase II (G), and telophase II (H).

Figure 2.9 A typical
eukaryotic cell cycle.

C h a p t e i 2 | !=S

but each paii of sistei chiomatius is still counteu as a single chiomosome, so
the numbei of chiomosomes iemains unchangeu at 2n. If the cell unueigoes
mitosis, each uaughtei cell will be 2c anu 2n, because it will ieceive half of the
BNA, anu one of each paii of sistei chiomatius. In contiast, the cells that aie
piouuceu fiom the meiosis of a 2n, 4c cell aie 1c anu 1n, since each paii of
sistei chiomatius, anu each paii of homologous chiomosomes, uiviues uuiing
meiosis.
Figure 2.10 Changes in DNA and chromosome content during the cell cycle. For
simplicity, nuclear membranes are not shown, and all chromosomes are represented
in a similar stage of condensation.

C h a p t e i 2 | !=T


!"O ,'2R0/R*.) )10U +12030)03. &V3W.2 '&% )/2V+/V2.
2.S.1 KARY0TYPES ARE INAuES 0F REAL CBR0N0S0NES
Each eukaiyotic species has its total nucleai genome uiviueu among a numbei
of chiomosomes that is chaiacteiistic of that species. Foi example, a haploiu
human nucleus (i.e. speim oi egg) noimally has 2S chiomosomes (n=2S), anu
a uiploiu human nucleus has 2S paiis of chiomosomes (2n=46). A LE6K5;KG7
shows the complete set of chiomosomes of an inuiviuual (Fig. 2.11). vaiious
stains anu fluoiescent uyes piouuce chaiacteiistic banuing patteins on some
chiomosomes. This can make it easiei to iuentify specific chiomosomes. The
numbei of chiomosomes vaiies between species (see Table 1.1), but theie
appeais to be veiy little coiielation between chiomosome numbei anu eithei
the complexity of an oiganism oi its total amount genomic BNA.

2.S.2 ANE0PL0IBY
Analysis of kaiyotypes can iuentify chiomosomal abnoimalities, incluuing
E<7>G?59FK, which is the auuition oi subtiaction of a chiomosome fiom a paii
of homologs. Noie specifically, the absence of one membei of a paii of
homologous chiomosomes is calleu @5<5:5@K. 0n the othei hanu, in a
;69:5@K, theie aie thiee, iathei than two homologs of a paiticulai
chiomosome. Biffeient types of aneuploiuy aie sometimes iepiesenteu
symbolically; if !< symbolizes the noimal numbei of chiomosomes in a cell,
then !<=# inuicates monosomy anu !<X# iepiesents tiisomy.
The most familiai human aneuploiuy is tiisomy-21 (i.e. thiee copies of
chiomosome 21), which is one cause of %5Y<Z: :K<F65@7. Nost (but not all)
othei human aneuploiuies aie lethal at an eaily stage of embiyonic
uevelopment. Note that aneuploiuy usually affects only one set of homologs
within a kaiyotype, anu is theiefoie uistinct fiom G5?KG?59FK, in which the
Figure 2.11 Karyotype
of a normal human
male
C h a p t e i 2 | !=[

entiie kaiyotype is uuplicateu (see below). Aneuploiuy is almost always
ueleteiious, wheieas polyploiuy appeais to be beneficial in some oiganisms,
paiticulaily some species of plants.





2.S.S CBR0N0S0NAL ABN0RNALITIES
Stiuctuial uefects in chiomosomes aie anothei type of abnoimality that can be
uetecteu in kaiyotypes (Fig 2.12). These uefects incluue F7?7;95<:I
F>G?94E;95<:, anu 9<M76:95<:, which all involve changes in a segment of a
single chiomosome. (<:76;95<: anu ;6E<:?54E;95<: involve two non-
homologous chiomosomes. In an inseition, BNA fiom one chiomosome is
uniuiiectional, while in tianslocation, the tiansfei of chiomosomal segments is
biuiiectional. Stiuctuial uefects affect only pait of a chiomosome, anu so tenu
to be less haimful than aneuploiuy. In fact, theie aie many examples of ancient
chiomosomal ieaiiangements in the genomes of species incluuing oui own.
Buplications of some small chiomosomal segments, in paiticulai, may have
some evolutionaiy auvantage by pioviuing extia copies of some genes, which
can then evolve in new ways.
Chiomosomal abnoimalities aiise in many uiffeient ways. Nany of these can
be tiaceu to iaie eiiois in natuial cellulai piocesses. &5<=F9:\><4;95< is the
failuie of at least one paii of chiomosomes oi chiomatius to sepaiate uuiing
mitosis oi meiosis. +865@5:5@7 D67ELEH7 also occuis infiequently as the
iesult of physical uamage (such as iauiation), movement of some types of
tiansposons, anu othei factois. Buiing the iepaii of a bioken chiomosome,
ueletions, inseitions, tianslocations anu even inveisions can be intiouuceu.




Figure 2.12
Structural abberations
in chromosomes.
C h a p t e i 2 | !=#B


!"P *0QR*Q0(%R
Bumans, like most animals anu all of the eukaiyotic genetic mouel oiganisms
in wiue use, aie uiploiu. This means that most of theii cells have two
homologous copies of each chiomosome. In contiast, many plant species anu
even a few animal species aie G5?KG?59F:. This means theie aie moie than
two homologs of each chiomosome in each cell.
2.6.1 N0TATI0N 0F PL0IBY
When uesciibing polyploius, we use the lettei "]" to uefine the level of ploiuy.
A uiploiu is 2x, because theie aie two basic sets of chiomosomes, anu a
tetiaploiu is 4x, because it contains foui copies of each chiomosome. Foi
claiity when uiscussing polyploius, geneticists will often combine the "x"
notation with the "n" notation alieauy uefineu pieviously in this chaptei. Thus
foi both uiploius anu polyploius, "n" is the numbei of chiomosomes in a
gamete, anu "2n" is the numbei of chiomosomes following feitilization. Foi a
uiploiu, theiefoie, n=x, anu 2n=2x. Foi a tetiaploiu, n=2x, anu 2n=4x.
2.6.2 P0LYPL0IBS CAN BE STABLE 0R STERILE
Like uiploius (2n=2x), stable polyploius geneially have an even numbei of
copies of each chiomosome: tetiaploiu (2n=4x), hexaploiu (2n=6x), anu so on.
The ieason foi this is cleai fiom a consiueiation of meiosis. Remembeiing that
the puipose of meiosis is to ieuuce the sum of the genetic mateiial by half,
meiosis can equally uiviue an even numbei of chiomosome sets, but not an ouu
numbei. Thus, polyploius with an uneven numbei of chiomosomes (e.g.
tiiploius, 2n=Sx) tenu to be steiile, even if they aie otheiwise healthy. The
mechanism of meiosis in stable polyploius is essentially the same as in
uiploius: uuiing metaphase I, homologous chiomosomes paii with each othei.
Bepenuing on the species, all of the homologs may be aligneu togethei at
metaphase, oi in multiple sepaiate paiis. Foi example, in a tetiaploiu, some
species may foim ;7;6EME?7<;: in which the foui homologs fiom each
chiomosome align togethei, oi alteinatively, two paiis of homologs may foim
two bivalents. Note that because that mitosis uoes not involve any paiiing of
homologous chiomosomes, mitosis is equally effective in uiploius, even-
numbei polyploius, anu ouu-numbei polyploius.
Tiiploiuy is useu in the piouuction of seeuless fiuits, such as wateimelon,
giapes anu bananas. All of the tissues of these fiuit aie tiiploiu. Because
almost all of the cells of the plant, incluuing its fiuit, aie piouuceu thiough
mitosis, the uneven numbei of chiomosome sets uoes not affect theii
uevelopment. Bowevei, cells that contiibute to the piouuction of gametes aie
piouuceu thiough meiosis, anu because the tiiploius aie unable to complete
noimal meioses, theii gametes fail to uevelop, so no zygotes aie foimeu, anu
the seeus (which noimally contain embiyos that uevelop fiom the zygotes) aie
aboiteu.


Figure 2.13. Part of a
triploid watermelon,
showing white, aborted
seeds within the flesh
C h a p t e i 2 | !=##


If tiiploius cannot make seeus, how uo we obtain enough tiiploiu inuiviuuals
foi cultivation. The answei uepenus on the plant species involveu. In some
cases, such as banana, it is possible to piopagate the plant asexually; new
piogeny can simply be giown fiom cuttings fiom a tiiploiu plant. 0n the othei
hanu, seeus foi seeuless wateimelon aie piouuceu sexually: a tetiaploiu
wateimelon plant is ciosseu with a uiploiu wateimelon plant. Both the
tetiaploiu anu the uiploiu aie fully feitile, anu piouuce gametes with two
(1n=2x) oi one (1n=1x) sets of chiomosomes, iespectively. These gametes
fuse to piouuce a zygote (2n=Sx), that is able to uevelop noimally into an auult
plant thiough multiple iounus of mitosis, but is unable to compete noimal
meiosis oi piouuce seeus.



!"S .&%02.%V*Q(+'/(0&
.<F567F>G?94E;95<, is a special type of tissue-specific genome amplification
that occuis in many types of plant cells anu in specializeu cells of some animals
incluuing humans. Enuoieuuplication uoes not affect the geimline oi gametes,
so species with enuoieuuplication aie not consiueieu polyploius.
Enuopolyploiuy occuis when a cell unueigoes multiple iounus of BNA
synthesis (S-phase) without any mitosis. This piouuces multiple chiomatius of
each chiomosome. Enuopolyploiuy seems to be associateu with cells that aie
metabolically veiy active, anu piouuce a lot of enzymes anu othei pioteins in a
shoit amount of time. The highly enuoieuuplicateu salivaiy glanu
Figure 2.14.
Endoreduplicated
chromosomes from an
insect salivary gland.
The banding pattern is
produced with
fluorescent labels.
C h a p t e i 2 | !=#!


chiomosomes of !" $%&'()*'+,%- have been useful ieseaich mouels in genetics,
since theii ielatively laige size makes them easy to stuuy unuei the
micioscope.
!"T -.&. W'Q'&+.
Why uo tiisomies, uuplications, anu othei chiomosomal abnoimalities that
inciease gene copy numbei sometimes have a negative effect on the noimal
uevelopment oi physiology of an oiganism. This is paiticulaily intiiguing
because in many species, aneuploiuy is uetiimental oi lethal, while polyploiuy
is toleiateu oi even beneficial. The answei is piobably ielateu to the concept
of H7<7 DE?E<47, which can be summaiizeu as follows: genes, anu the pioteins
they piouuce, have evolveu to be pait of complex metabolic anu iegulatoiy
netwoiks. Some of these netwoiks function best when ceitain enzymes anu
iegulatois aie piesent in specific iatios to each othei. Incieasing the gene
copy numbei foi just one pait of the netwoik may thiow the netwoik out of
balance, leauing to incieases oi uecieases of ceitain metabolites, which may be
toxic in high concentiations oi which may be limiting in othei impoitant
piocesses in the cell. The activity of genes anu metabolic netwoiks is iegulateu
in many uiffeient ways besiues changes in gene copy numbei, so uuplication of
just a few genes will usually not be haimful. Bowevei, tiisomy anu laige
segmental uuplications of chiomosomes affect the uosage of so many genes
that cellulai netwoiks aie unable to aujust to the changes.
!"[ 02-'&.QQ'2 -.&03.)
Chiomosomes also exist outsiue of the nucleus, within both the chloioplast anu
mitochonuiia. These oiganelles aie likely the iemnants of a piokaiyotic
enuosymbionts that enteieu the cytoplasm of ancient piogenitois of touay's
eukaiyotes. These enuosymbionts hau theii own, ciiculai chiomosomes, like
most bacteiia that exist touay. Likewise, chloioplasts anu mitochonuiia
typically have ciiculai chiomosomes that behave moie like bacteiial
chiomosomes than eukaiyotic chiomosomes, i.e. these oiganellai genomes uo
not unueigo mitosis oi meiosis. 0iganellai genomes aie also often piesent in
multiple copies within each oiganelle. In most sexually iepiouucing species,
oiganellai chiomosomes aie inheiiteu fiom only one paient, usually this is the
paient that piouuces the laigest gamete. Thus, in mammals, angiospeims, anu
many othei oiganisms, mitochonuiia anu chloioplasts aie inheiiteu
mateinally.

C h a p t e i 2 | !=#A

^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
)V33'2R
Chiomosomes aie complex anu uynamic stiuctuies consisting of BNA
anu pioteins (chiomatin).
The uegiee of chiomatin compaction vaiies between heteiochiomatic
anu euchiomatic iegions anu between stages of the cell cycle.
Some chiomosomes can be uistinguisheu cytologicaly baseu on theii
length, centiomeie position, anu banuing patteins when staineu uyes
oi labelleu with sequence-specific piobes.
Bomologous chiomosomes contain the same genes, but not necessaiily
the same alleles. Sistei chiomatius usually contain the same genes anu
the same alleles.
Nitosis ieuuces the c-numbei, but not the n-numbei. Neiosis ieuuces
both c anu n.
Bomologous chiomosomes associate with each othei uuiing meiosis,
but not mitosis.
Seveial types of stiuctuial uefects in chiomosomes occui natuially, anu
can affect cellulai function anu even evolution.
Aneuploiuy iesults fiom the auuition oi subtiaction of one oi moie
chiomosomes fiom a gioup of homologs, anu is usually ueleteiious to
the cell.
Polyploiuy is the piesence of moie than two complete sets of
chiomosomes in a genome. Even-numbeieu multiple sets of
chiomosomes can be stably inheiiteu in some species, especially
plants.
Enuopolyploiuy is tissue-specific type of polyploiuy obseiveu in some
species, incluuing uiploius.
Both aneuploiuy anu stiuctuial uefects such as uuplications can affect
gene balance.
0iganelles also contain chiomosomes, but these aie much moie like
piokaiyotic chiomosomes than the nucleai chiomosomes of
eukaiyotes.




C h a p t e i 2 | !=#J




,.R /.23)
chiomosome
coie histones
nucleosome
Sunm fibei
histone B1
scaffolu pioteins
heteiochiomatin
euchiomatin
miciosatellite
chiomatiu
centiomeie
metacentiic
aciocentiic
telocentiic
holocentiic
telomeie
homolog
non-homologous
chiomatiu
sistei chiomatiu
non-sistei chiomatiu
inteiphase
mitosis
piophase
metaphase
anaphase
telophase
piophase
meiosis
piophase (I, II)
metaphase (I, II)
anaphase (I, II)
telophase (I, II)
cytokinesis
bivalent
ieuuctional uivision
equational uivision
u1
u2
S
N
uu
inteiphase
n
c
kaiyotype
aneuploiuy
monsomic
tiisomic
Bown's synuiome
ueletion
uuplication
inseition
inveision
tianslocation
non-uisjunction
chiomosome
bieakage
polyploiu
x
tetiavalent
enuoieuuplication
enuopolyploiuy
gene balance
cellulai netwoik
enuosymbiont
oiganellaichiomo

C h a p t e i 2 | !=#O

)/V%R _V.)/(0&)
!"# Befine chiomatin. What is the
uiffeience between BNA,
chiomatin anu chiomosomes.
!"! Species A has n=4
chiomosomes anu Species B has
n=6 chiomosomes. Can you tell
fiom this infoimation which
species has moie BNA. Can you tell
which species has moie genes.
!"A The answei to question 2
implies that not all BNA within a
chiomosome encoues genes. Can
you name any examples of
chiomosomal iegions that
containielatively few genes.
!"J E` Bow many centiomeies
uoes a typical chiomosome have.
D` What woulu happen if theie was
moie than one centiomeie pei
chiomosome.
4` What if a chiomosome hau zeio
centiomeies.

!"O Foi a uiploiu with 2n=16
chiomosomes, how many
chiomosomes anu chiomatius aie
pei cell piesent in the gamete, anu
zygote anu immeuiately following
u1, S, u2, mitosis, anu meiosis.
!"P Bieau wheat (.-/,/01$
'%+,/21$) is a hexaploiu. 0sing the
nomenclatuie piesenteu in class,
an egg cell of wheat has n=21
chiomosomes. Bow many
chiomosomes in a zygote of bieau
wheat.



!"S Foi a given gene:
E` What is the maximum numbei of
alleles that can exist in a 2n cell of a
given uiploiu inuiviuual.
D` What is the maximum numbei of
alleles that can exist in a 1n cell of a
tetiaploiu inuiviuual.
4` What is the maximum numbei of
alleles that can exist in a 2n cell of a
tetiaploiu inuiviuual.
F` What is the maximum numbei of
alleles that can exist in a
population.

!"T E` Why is aneuploiuy moie
often lethal than polyploiuy.
D` Which is moie likely to uisiupt
gene balance: polyploiuy oi
uuplication.
!"[ Foi a uiploiu oiganism with
2n=4 chiomosomes, uiaw a
uiagiam of all of the possible
configuiations of chiomosomes
uuiing noimal anaphase I, with the
mateinally anu pateinally ueiiveu
chiomosomes labelleu.
!"#B Foi a tiiploiu oiganism with
2n=Sx=6 chiomosomes, uiaw a
uiagiam of all of the possible
configuiations of chiomosomes at
anaphase I (it is not necessaiy label
mateinal anu pateinal
chiomosomes).
!"## Foi a tetiaploiu oiganism
with 2n=4x=8 chiomosomes, uiaw
all of the possible configuiations of
chiomosomes uuiing a noimal
metaphase.


C h a p t e i 2 | !=#P








"#$%&# '#()#*+ ,-# ./012 &3*#0 %$ -#&#)1,4 5#&# (%, 3()#&0,%%)6 7%& #8/9:*#+
1, 5/0 ;(%5( ,-/, <&##(=0##)#) :#/ :*/(,0 %22/01%(/**4 :&%)32#) %$$0:&1(<
,-/, -/) 4#**%5 0##)0> .3, 5#&# ,-# -#&#)1,/&4 $/2,%&0 ,-/, 2%(,&%**#) 0##)
2%*%& 0%9#-%5 2-/(<1(< $&%9 %(# <#(#&/,1%( ,% ,-# (#8,+ %& 5#&# 2#&,/1(
$/2,%&0 )10/::#/&1(< /() &#/::#/&1(<? @() )1) ,-# 0/9# $/2,%&0 ,-/,
2%(,&%**#) 0##) 2%*%& /*0% 2%(,&%* ,-1(<0 *1;# :*/(, -#1<-,?
!"# %&'(&)*+ ,-.+/ )01
A6B6B @CCDCDE FEF@CCG DHIEJ IK L@IME JN@J ELCIJ @J 'DIOEIE
J-&%3<- 2/&#$3* 0,3)4 %$ :/,,#&(0 %$ 1(-#&1,/(2#+ '#()#* &#2%<(1P#) ,-/, /
01(<*# <#(# 2%3*) #810, 1( %(# %& 9%&# Q#&01%(0+ %& 2334345+ #Q#( 51,-1( /(
1()1Q1)3/* :*/(, %& /(19/*6 7%& #8/9:*#+ -# $%3() ,5% /**#*#0 %$ / <#(# $%& 0##)
2%*%&R %(# /**#*# </Q# <&##( 0##)0+ /() ,-# %,-#& </Q# 4#**%5 0##)06 '#()#*
/*0% %.0#&Q#) ,-/, /*,-%3<- )1$$#&#(, /**#*#0 2%3*) 1($*3#(2# / 01(<*# ,&/1,+ ,-#4
&#9/1(#) 1()#:#()#(, /() 2%3*) .# 1(-#&1,#) 0#:/&/,#*46 J-10 10 ,-# ./010 %$
%46743*5 ,895: )2;+ /*0% 2/**#) /<4 )2; => &?@23 +4A94A2:8=6+ 5-12- 0,/,#0R
)3&1(< </9#,# $%&9/,1%(+ ,-# ,5% 9#9.#&0 %$ / <#(# :/1& 0#<&#</,# $&%9 #/2-
%,-#&> #/2- </9#,# -/0 /( #S3/* :&%./.1*1,4 %$ 2%(,/1(1(< #1,-#& 9#9.#& %$ ,-#
<#(# :/1&6
T-/:,#& A UDKDJITE O7 OKD COTFE
Figure 3.1 Pea plants
were used in the
discovery of some
fundamental laws of
genetics.
O ( # C % 2 3 0 V !BC




A6B6W NDJDMO=+ NO'O=+ ND'IXGUOEIJG
'#()#*Y0 71&0, C/5 10 #0:#21/**4 &#9/&;/.*# .#2/30# -# 9/)# -10 %.0#&Q/,1%(0
51,-%3, ;(%51(< /.%3, ,-# &#*/,1%(0-1:0 .#,5##( <#(#0+ 2-&%9%0%9#0+ /()
ZK@6 [# (%5 ;(%5 ,-/, ,-# &#/0%( ,-/, 9%&# ,-/( %(# /**#*# %$ / <#(# 2/( .#
:&#0#(, 1( /( 1()1Q1)3/* 10 ,-/, 9%0, #3;/&4%,12 %&</(1090 -/Q# /, *#/0, ,5%
0#,0 %$ -%9%*%<%30 2-&%9%0%9#06 7%& %&</(1090 ,-/, /&# :&#)%91(/(,*4
)1:*%1)+ 032- /0 -39/(0 %& '#()#*Y0 :#/0+ 2-&%9%0%9#0 #810, 1( :/1&0+ 51,-
%(# -%9%*%< 1(-#&1,#) $&%9 #/2- :/&#(,6 Z1:*%1) 2#**0 2/( ,-#&#$%&# -%*) 3:
,% ,5% )1$$#&#(, /**#*#0 %$ #/2- <#(#+ 51,- %(# /**#*# %( #/2- 9#9.#& %$ / :/1&
%$ -%9%*%<%30 2-&%9%0%9#06 I$ .%,- /**#*#0 %$ / :/&,123*/& <#(# /&# 1)#(,12/*+
,-# 1()1Q1)3/* 10 0/1) ,% .# <=D=EFA=@5 $%& ,-/, <#(#6 O( ,-# %,-#& -/()+ 1$
,-# /**#*#0 /&# )1$$#&#(, $&%9 #/2- %,-#&+ ,-# <#(%,4:# 10 <4:49=EFA=@56 I(
0%9# 2/0#0+ 032- /0 5-#( )#02&1.1(< <#(#0 %( ,-# 0#8 2-&%9%0%9#0 %$ /
-39/( 9/*#+ 5# 30# ,-# ,#&9 <4D8EFA=@56 J-10 10 .#2/30# ,-# 2#** 2%(,/1(0
%(*4 %(# H /() %(# G 2-&%9%0%9#+ 0% ,-#&# 10 %(*4 %(# :%001.*# /**#*# $%& #/2-
<#(#6 @*,-%3<- / ,4:12/* )1:*%1) 1()1Q1)3/* 2/( -/Q# /, 9%0, ,5% )1$$#&#(,
/**#*#0 %$ / :/&,123*/& <#(#+ 9%&# ,-/( ,5% /**#*#0 2/( #810, 1( / :%:3*/,1%( %$
1()1Q1)3/*06 J-# 9%0, 2%99%( /**#*# 1( / (/,3&/* :%:3*/,1%( 10 2/**#) ,-# ;837B
:FG4 /**#*#6
!"C .&)0/-H'+I-J+ K&/1&&' 0))&)&+ 0'( JI&'H/LJ&+
A6W6B JDM'IKOCOUGR COTFE+ UDKOJLD+ LNDKOJGLD
@ 0:#21$12 :%01,1%( %( / 2-&%9%0%9# 10 2/**#) / 3=M@56 '%0, %$ ,-# *%21
<#(#,1210,0 )102300 /&# %223:1#) .4 <#(#0+ /() ,-# ,#&90 *%230 /() <#(# /&#
%$,#( 30#) 1(,#&2-/(<#/.*46 J-# 2%9:*#,# 0#, %$ /**#*#0 /, /(4 *%21 %$ 1(,#&#0, 1(
/( 1()1Q1)3/* )#$1(# 1,0 A46=:FG46 J-# )#,#2,/.*# #$$#2, %$ ,-#0# /**#*#0 %( ,-#
0,&32,3&# %& $3(2,1%( %$ ,-/, 1()1Q1)3/* 10 2/**#) 1,0 G<46=:FG46 J-#
:-#(%,4:# 0,3)1#) 1( /(4 :/&,123*/& <#(#,12 #8:#&19#(, 9/4 &/(<# $&%9
Figure 3.2 Seven traits
Mendel studied in peas.
O ( # C % 2 3 0 V !B!

019:*#+ Q101.*# ,&/1,0 032- /0 -/1& 2%*%&+ ,% 9%&# 2%9:*#8 :-#(%,4:#0 1(2*3)1(<
)10#/0# 0302#:,1.1*1,4 %& .#-/Q1%&
6

A6W6W TO'LCDJD ZO'IK@KTD
C#, 30 &#,3&( ,% /( #8/9:*# %$ / 019:*# :-#(%,4:#R $*%5#& 2%*%& 1( '#()#*Y0
:#/06 [# -/Q# /*&#/)4 0/1) ,-/, %(# /**#*# :&%)32#0 :3&:*# $*%5#&0+ 5-1*# ,-#
%,-#& /**#*# :&%)32#0 5-1,# $*%5#&0 \71<3&# A6A]6 "3, 5-/, )%#0 ,-10 ,#** 30
/.%3, ,-# $*%5#& 2%*%& %$ /( 1()1Q1)3/* ,-/, -/0 %(# :3&:*# /**#*# /() %(# 5-1,#
/**#*#+ 1( %,-#& 5%&)0+ 5-/, 10 ,-# :-#(%,4:# %$ /( 1()1Q1)3/* 5-%0# <#(%,4:#
10 -#,#&%P4<%30? [# ;(%5 $&%9 #8:#&19#(,/* )/,/ ,-/, 1()1Q1)3/*0
-#,#&%P4<%30 $%& ,-# :3&:*# /() 5-1,# /**#*#0 %$ ,-# $*%5#& 2%*%& <#(# -/Q#
:3&:*# $*%5#&06 J-# /**#*# /00%21/,#) 51,- :3&:*# 2%*%& 10 ,-#&#$%&# 0/1) ,% .#
7=D8626: ,% ,-# /**#*# ,-/, :&%)32#0 ,-# 5-1,# 2%*%&6 J-# %,-#& /**#*#+ 5-%0#
:-#(%,4:# 10 9/0;#) .4 / )%91(/(, /**#*# 1( / -#,#&%P4<%,#+ 10 2/**#)
94M4558N46 O$,#(+ / )%91(/(, /**#*# 51** .# &#:&#0#(,#) .4 / 2/:1,/* *#,,#& \#6<6
!] 5-1*# / &#2#001Q# /**#*# 51** .# &#:&#0#(,#) 1( *%5#& 2/0# \#6<6 "]6 N%5#Q#&+
9/(4 )1$$#&#(, 040,#90 %$ <#(#,12 049.%*0 /&# 1( 30# \J/.*# A6B]+ 0% 1, 10
19:%&,/(, ,% 3()#&0,/() ,-# )1$$#&#(, ,4:#0 %$ (%,/,1%( /() ,% 30# ,-#9
2%(010,#(,*46
#8/9:*#0 %$
<#(%,4:#0 %$
-#,#&%P4<%,#0
,4:12/* 1(,#&:&#,/,1%(
!" F::#&2/0# *#,,#&\0] 9%0, %$,#( &#:&#0#(,0 )%91(/(, /**#*#+
/() *%5#&2/0# *#,,#&\0] 1()12/,#0 &#2#001Q# /**#*#6
"
$
"%
&'


C%5#&2/0# *#,,#&0 51,- ^ 03:#&02&1:, &#:&#0#(, 51*)=,4:#
/**#*#+ 5-12- 10 %$,#( )%91(/(,6 @ *%5#& 2/0# *#,,#& 51,-
%,-#& 03:#&02&1:,0 \%& 51,- (% 03:#&02&1:,0] &#:&#0#(,0
%,-#& /**#*#0+ 5-12- /&# %$,#( &#2#001Q#6
!(!' J-# (/9# %$ ,-# *%230 10 1( 3::#&2/0# %& *%5#& 2/0# *#,,#&0+
51,- 03.02&1:,0 %& 03:#&02&1:,0 30#) ,% 1()12/,# )1$$#&#(,
/**#*#06 U#(#&/**4+ (#1,-#& /**#*# 10 2%9:*#,#*4 )%91(/(,+ %&
#*0# ,-# )%91(/(2# &#*/,1%(0-1:0 /&# 3(;(%5(6


Figure 3.3
Relationship between
genotype and
phenotype for a
dominant allele.
Table 3.1 Examples of
symbols used to
represent alleles, and
their dominance
relationships
O ( # C % 2 3 0 V !BO

A6W6A IKTO'LCDJD ZO'IK@KTD
"#01)#0 )%91(/(2# /() &#2#001Q1,4+ %,-#& &#*/,1%(0-1:0 2/( #810, .#,5##(
/**#*#06 I( 54D8B7=D8626M4 \/*0% 2/**#) 86M=DG34:4 7=D8626M4P 71<3&# A6_]+
.%,- /**#*#0 /$$#2, ,-# ,&/1, /))1,1Q#*4+ /() ,-# :-#(%,4:# %$ ,-# -#,#&%P4<%,# 10
1(,#&9#)1/,# .#,5##( #1,-#& %$ ,-# -%9%P4<%,#06 7%& #8/9:*#+ /**#*#0 $%& &#)
2%*%& 1( 2/&(/,1%(0 /() 0%9# %,-#& 0:#21#0 #8-1.1, 0#91=)%91(/(2#+ 0% ,-/, /
-#,#&%P4<%,# -/0 :1(; :#,/*0+ 5-1*# / -%9%P4<%,# $%& %(# /**#*# -/0 &#) :#,/*0
/() ,-# %,-#& -/0 5-1,# :#,/*06 J-30 1( 0#91=)%91(/(2#+ ,-# )%0/<# %$ ,-#
/**#*#0 /$$#2,0 ,-# :-#(%,4:#+ #6<6 ,-# :-#(%,4:# %$ ,-# -#,#&%P4<%,# 10
/::&%819/,#*4 -/*$ /0 0,&%(< /0 ,-# :-#(%,4:# %$ / -%9%P4<%,#6


A6W6_ TO=ZO'IK@KTD
Q=B7=D8626M4 10 /(%,-#& ,4:# %$ /**#*12 &#*/,1%(0-1:+ 1( 5-12- / -#,#&%P4<%30
1()1Q1)3/* #8:&#00#0 ,-# :-#(%,4:# %$ .%,- /**#*#0 0193*,/(#%30*46 @( #8/9:*#
%$ 2%=)%91(/(2# 10 $%3() 51,-1( ,-# @"O .*%%) <&%3: %$ -39/(0+ 5-12- 10
2%(,&%**#) .4 / <#(# 2/**#) ) \71<3&# A6`]6 J-#&# /&# ,-&## :%001.*# /**#*#0 /,
,-10 *%230R )
!
+ )
*
+ /() +6 N%9%P4<%30 1()1Q1)3/*0 $%& )
!
%& )
*
:&%)32# %(*4 @ %& "
,4:# /(,1<#(0+ &#0:#2,1Q#*4+ %( ,-# 03&$/2# %$ ,-#1& .*%%) 2#**0+ /() ,-#&#$%&#
-/Q# #1,-#& ,4:# @ %& ,4:# " .*%%)6 N#,#&%P4<%30 )
!
)
*
1()1Q1)3/*0 -/Q# .%,- @
/() " /(,1<#(0 %( ,-#1& 2#** 03&$/2#+ /() 0% -/Q# ,4:# @" .*%%)6 K%,12# ,-/, ,-#
-#,#&%P4<%,# #8:&#00#0 .%,- /**#*#0 0193*,/(#%30*4+ /() 10 (%, 0%9# ;1() %$
(%Q#* 1(,#&9#)1/,# .#,5##( @ /() "6 T%=)%91(/(2# 10 ,-#&#$%&# )10,1(2, $&%9
0#91=)%91(/(2#+ /*,-%3<- ,-#4 /&# 0%9#,19#0 2%($30#)6 '/(4 ,4:#0 %$
9%*#23*/& 9/&;#&0+ 5-12- 5# 51** )102300 1( / */,#& 2-/:,#&+ )10:*/4 / 2%=
)%91(/(, &#*/,1%(0-1: /9%(< /**#*#06 I, 10 /*0% 19:%&,/(, ,% (%,# ,-/, ,-# ,-1&)
/**#*#+ ++ )%#0 (%, 9/;# /(4 /(,1<#(0 /() 10 &#2#001Q# ,% /** %,-#& /**#*#06
N%9%P4<%30 &#2#001Q# 1()1Q1)3/*0 \++] -/Q# ,4:# O .*%%)6 J-10 10 / 30#$3*
&#91()#& ,-/, )1$$#&#(, ,4:#0 %$ )%91(/(2# &#*/,1%(0-1:0 2/( #810,+ #Q#( $%&
/**#*#0 %$ ,-# 0/9# <#(#6





Figure 3.4
Relationship between
genotype and
phenotype for semi-
dominant alleles.
O ( # C % 2 3 0 V !BR



!"! K-HQI&%-Q0) K0+-+ H, (H%-'0'Q&
[# 2/((%, :&#)12, 5-#,-#& /( /**#*# 51** .# )%91(/(, ./0#) 019:*4 %( ,-#
:-#(%,4:# %$ -%9%P4<%,#0> 5# 930, /*0% ;(%5 ,-# :-#(%,4:# %$ /
-#,#&%P4<%,#6 [-/,+ ,-#(+ 2/30#0 )%91(/(2#? J-#&# /&# 9/(4 )1$$#&#(,
.1%2-#912/* 2%()1,1%(0 ,-/, 9/4 9/;# %(# /**#*# )%91(/(, ,% /(%,-#&+ .3, %(#
%$ ,-# 9%0, 2%99%( 10 <2G3=5@>>8M846MF6 '%0, <#(#0 :&%)32# 9%&# ,-/(
#(%3<- :&%,#1( ,% /22%9:*10- ,-#1& (%&9/* .1%*%<12/* $3(2,1%(6 I$ /( /**#*# 10
-/:*%03$$121#(,+ ,-#( a30, %(# 2%:4 %$ ,-/, /**#*# :&%)32#0 #(%3<- :&%,#1( ,%
-/Q# ,-# 0/9# #$$#2, /0 ,-# /9%3(, %$ :&%,#1( :&%)32#) .4 ,5% 2%:1#0 %$ ,-/,
/**#*#6 7%& ,-# 9/a%&1,4 %$ <#(#0 0,3)1#)+ ,-# (%&9/* \16#6 ;837B:FG4] /**#*#0 /&#
-/:*%03$$121#(,+ 0% #Q#( 1$ / 93,/,1%( 2/30#0 / 2%9:*#,# *%00 %$ $3(2,1%( 1( %(#
/**#*#+ ,-# 51*)=,4:# /**#*# 51** .# )%91(/(, /() ,-# (%&9/* $3(2,1%( %$ ,-#
.1%2-#912/* :/,-5/4 51** .# &#,/1(#)6 O( ,-# %,-#& -/()+ 1( 0%9# .1%2-#912/*
:/,-5/40+ / 01(<*# 51*)=,4:# /**#*# 9/4 .# <2G3=865@>>8M846:+ 16#6 1, 9/4 (%,
:&%)32# #(%3<- :&%,#1( ,% &#03*, 1( / (%&9/* :-#(%,4:# 1$ ,-# %,-#& /**#*# 1( /
-#,#&%P4<%,# 10 (%, $3(2,1%(/*6 I( ,-10 2/0#+ / (%(=$3(2,1%(/* /**#*# 51** .#
)%91(/(, ,% / 51*)=,4:# /**#*#6
!"O /I& JS''&// +TS0.& 0'( %H'HILK.-( Q.H++&+
A6_6B JMFD "MDDZIKU CIKDE
U#(#,1210,0+ 1(2*3)1(< '#()#*+ 9/;# 30# %$ :9@4 U944786A 38645 \71<3&# A6b /]6
J-#0# /&# :%:3*/,1%(0 %$ :*/(,0 %& /(19/*0 1( 5-12- /** :/&#(,0 /() ,-#1&
%$$0:&1(< -/Q# 1)#(,12/* :-#(%,4:#0 %Q#& 9/(4 <#(#&/,1%(0 51,- &#0:#2, ,% /
:/&,123*/& ,&/1,6 J&3# .&##)1(< *1(#0 /&# 30#$3*+ .#2/30# ,-#4 2/( .# /0039#) ,%
.# -%9%P4<%30 $%& ,-# /**#*#0 ,-/, /$$#2, / ,&/1, %$ 1(,#&#0,6 [-#( ,5%
1()1Q1)3/*0 ,-/, /&# -%9%P4<%30 $%& ,-# 0/9# /**#*#0 /&# 2&%00#)+ /** %$ ,-#1&
%$$0:&1(< 51** /** /*0% .# -%9%P4<%306




Figure 3.5
Relationship between
genotype and
phenotype for co-
dominant alleles (I
A
,
I
B
), and a recessive
allele.
O ( # C % 2 3 0 V !BV




A6_6W LFKKDJJ EcF@MD ENO[ JND UDKOJGLDE O7 @ TMOEE
U1Q#( ,-# <#(%,4:#0 %$ /(4 ,5% :/&#(,0+ 5# 2/( :&#)12, /** %$ ,-# :%001.*#
<#(%,4:#0 %$ ,-# %$$0:&1(<6 73&,-#&9%&#+ 1$ 5# /*0% ;(%5 ,-# )%91(/(2#
&#*/,1%(0-1:0 $%& /** %$ ,-# /**#*#0+ 5# 2/( :&#)12, ,-# :-#(%,4:#0 %$ ,-#
%$$0:&1(<6 @ 2%(Q#(1#(, 9#,-%) $%& 2/*23*/,1(< ,-# #8:#2,#) <#(%,4:12 /()
:-#(%,4:12 &/,1%0 $&%9 / 2&%00 10 ,-# 30# %$ L3((#,, ES3/&#+ 5-12- 10 / 9/,&18
1( 5-12- /** %$ ,-# :%001.*# </9#,#0 :&%)32#) .4 %(# :/&#(, /&# *10,#) /*%(<
%(# /810+ /() ,-# </9#,#0 $&%9 ,-# %,-#& :/&#(, /&# *10,#) /*%(< ,-# %,-#& /8106
D/2- :%001.*# 2%9.1(/,1%( %$ </9#,#0 10 *10,#) /, ,-# 1(,#&0#2,1%( %$ #/2- &%5
/() 2%*39(6
[-#( ,5% -#,#&%P4<%,#0 /&# 2&%00#)+ 5-/, <#(%,4:#0 /&# :&%)32#)+ /() 5-/,
10 ,-# #8:#2,#) $&#S3#(24 %$ #/2- <#(%,4:#? I$ 5# 30# ,-# 049.%*0 ! /() " ,%
&#:&#0#(, #/2- ,-# ,5% /**#*#0 %$ ,-# -#,#&%P4<%,#+ ,-#( $&%9 ,-# J@664::
+?@294 \71<3&# A6d] 5# 0## ,-/, ,-&## <#(%,4:#0 /&# :&%)32#) 1( / &/,1% %$
BRWRB6 I$ 5# ;(%5 0%9#,-1(< /.%3, ,-# :-#(%,4:#0 /() )%91(/(2#
&#*/,1%(0-1:0 %$ ,-#0# /**#*#0 \/0 19:*1#) .4 ,-# 049.%*0 30#)]+ 5# 2/( :&#)12,
,-# #8:#2,#) :-#(%,4:12 &/,1% %$ ,-# :&%<#(4 $&%9 ,-10 2&%00 10 ARB6 @ 2&%00
.#,5##( ,5% 1()1Q1)3/*0 ,-/, /&# .%,- -#,#&%P4<%30 /, / 01(<*# *%230 10 0%
2%99%( 1( <#(#,120 ,-/, ,-10 2&%00 10 <1Q#( 1,0 %5( (/9#R ,-# D=6=<FU987
M9=55 \71<3&# A6b .]6
! #
! !! !"
# !" ""

Figure 3.6 a) a true-
breeding line b) a
monohybrid cross
produced by mating
two pure-breeding lines
Figure 3.7 A Punnett
Square showing a
monohybrid cross
O ( # C % 2 3 0 V !BW


!"R /&+/ Q.H++&+ Q0' K& S+&( /H (&/&.%-'& X&'H/LJ&+
e(%51(< ,-# <#(%,4:#0 %$ /( 1()1Q1)3/* 10 303/**4 /( 19:%&,/(, :/&, %$ /
<#(#,12 #8:#&19#(,6 N%5#Q#&+ <#(%,4:#0 2/((%, .# %.0#&Q#) )1&#2,*4> ,-#4
930, .# 1($#&&#) ./0#) %( :-#(%,4:#06 "#2/30# %$ )%91(/(2#+ 1, 10 %$,#( (%,
:%001.*# ,% )10,1(<310- .#,5##( / -#,#&%P4<%,# /() / -%9%P<4%,# ./0#) %(
:-#(%,4:# /*%(# \#6<6 0## ,-# :3&:*#=$*%5#&#) 7W :*/(,0 1( 71<3&# A6b.]6 J%
)#,#&91(# ,-# <#(%,4:#+ / :45: M9=55 2/( .# :#&$%&9#)+ 1( 5-12- /( 1()1Q1)3/*
51,- /( /9.1<3%30 <#(%,4:# 10 2&%00#) 51,- /( 1()1Q1)3/* ,-/, 10 -%9%P4<%30
&#2#001Q# $%& /** %$ ,-# *%21 .#1(< ,#0,#)6 7%& #8/9:*#+ 1$ 4%3 5#&# <1Q#( / :#/
:*/(, 51,- :3&:*# $*%5#&0 \/() (% %,-#& 1($%&9/,1%(]+ 4%3 5%3*) (%, ;(%5
5-#,-#& ,-# :*/(, 5/0 / -%9%P4<%,# \!!] %& -#,#&%P4<%,# \!"]6 G%3 2%3*)
2&%00 ,-10 :3&:*#=$*%5#&#) :*/(, ,% / 5-1,#=$*%5#&#) :*/(, /0 / :45:49+ 01(2#
4%3 ;(%5 ,-# <#(%,4:# %$ ,-# ,#0,#& 10 ""6 G%3 51** %.0#&Q# )1$$#&#(, &/,1%0 1(
,-# 7B <#(#&/,1%(+ )#:#()1(< %( ,-# <#(%,4:# %$ ,-# :3&:*#=$*%5#&#) :/&#(,6 I$
,-# :3&:*#=$*%5#&#) :/&#(, 5/0 / -%9%P<4%,#+ /** %$ ,-# 7B :&%<#(4 51** .#
:3&:*#6 I$ ,-# :3&:*#=$*%5#&#) :/&#(, 5/0 / -#,#&%P4<%,#+ ,-# 7B :&%<#(4
0-%3*) 0#<&#</,# :3&:*#=$*%5#&#) /() 5-1,#=$*%5#&#) :*/(,0 1( / BRB &/,1%6

! #
# !" ""
# !" ""

! !
# !" !"
# !" !"

!"V +&YB)-'Z0X& [ 0' &YQ&J/-H' /H %&'(&)*+ ,-.+/ )01
I( 9/99/*0+ Z&%0%:-1*/+ /() 9/(4 %,-#& %&</(1090+ 9/*#0 -/Q# %(# 2%:4 %$
#/2- %$ ,5% )1$$#&#(, 0#8 2-&%9%0%9#0 \HG]+ 5-1*# $#9/*#0 -/Q# ,5% 2%:1#0 %$
,-# 0/9# 2-&%9%0%9# \HH] \.3, (%,# ,-/, /*,-%3<- ,-# 2-&%9%0%9#0 -/Q# ,-#
0/9# (/9#0+ ,-# 9#2-/(109 %$ 0#8 )#,#&91(/,1%( 10 Q#&4 )1$$#&#(, 1( 9/99/*0
/() $*1#0]6 J-# H /() G 2-&%9%0%9#0 )% (%, 2/&&4 ,-# 0/9# *%21+ 0% 0%9# <#(#0
/&# :&#0#(, %( ,-# H+ .3, (%, G 2-&%9%0%9#06 E32- <#(#0 /&# 0/1) ,% .# H=
*1(;#) \,-#&# /&# Q#&4 $#5 #8/9:*#0 %$ G=*1(;#) <#(#0+ #82#:, ,-%0# 1(Q%*Q#)
0:#21$12/**4 1( 0#83/* )1$$#&#(,1/,1%(]6 @ 2&%00 1(Q%*Q1(< /( H=*1(;#) <#(# 51,-
/ -#,#&%P4<%30 $#9/*# /() / -#91P4<%30 9/*# ,-#&#$%&# :&%)32#0 :&%<#(4 1(
:-#(%,4:12 &/,1%0 Q#&4 )1$$#&#(, $&%9 ,-# ARB &/,1% %.,/1(#) 1( / 9%(%-4.&1)
2&%00 $%& /( 2@:=5=D23 \16#6 (%, 0#8=*1(;#)] *%2306 O,-#& 0:#21#0 51,- 0#8
2-&%9%0%9#0 9/4 /*0% .# 03.a#2, ,% 0#8=*1(;/<#+ /*,-%3<- ,-# 2-&%9%0%9#0
9/4 .# 2/**#) 0%9#,-1(< %,-#& ,-/( H /() G6



Figure 3.8 A Punnett
Squares showing
examples of test
crosses.
O ( # C % 2 3 0 V !B\



@ &#0#/&2-#& 9/4 (%, ;(%5 .#$%&#-/() 5-#,-#& / (%Q#* /**#*# 10 0#8=*1(;#)6
J-# )#$1(1,1Q# 9#,-%) ,% ,#0, $%& 0#8=*1(;/<# \/() %,-#& $%&90 %$ 0#8=
)#:#()#(, 1(-#&1,/(2#] 10 ,% 2%()32, 94M8G9=M23 M9=5545 \71<3&# A6d]6 J-10
9#/(0 ,% 2&%00 / 9/*# /() / $#9/*# ,-/, -/Q# )1$$#&#(, :-#(%,4:#0+ /() ,-#(
2%()32, / 0#2%() 0#, %$ 2&%00#0+ 1( 5-12- ,-# :-#(%,4:#0 /&# &#Q#&0#)
&#*/,1Q#*4 ,% ,-# 0#8 %$ ,-# :/&#(,0 1( ,-# $1&0, 2&%006 7%& #8/9:*#+ 2&%00 /
5-1,#=#4#) $#9/*# 51,- / &#)=#4#) 9/*# $*4+ ,-#( 0#:/&/,#*4 2&%00 / &#)=#4#)
$#9/*# 51,- / 5-1,#=#4#) 9/*#6 K%,# -%5 1( &#21:&%2/* 2&%00#0+ ,-#
:-#(%,4:#0 /9%(< ,-# :&%<#(4 %$ 0#8=*1(;#) <#(#0 /&# )1$$#&#(, $&%9 5-/, 10
#8:#2,#) $%& /3,%0%9/* <#(#0 \71<3&# A6f]6

!"W JI&'H/LJ& %0L K& 0,,&Q/&( KL ,0Q/H.+ H/I&. /I0'
X&'H/LJ&
J-# :-#(%,4:#0 )#02&1.#) 1( ,-# #8/9:*#0 30#) 1( ,-10 2-/:,#& /** -/Q# (#/&*4
:#&$#2, 2%&&#*/,1%( 51,- ,-#1& /00%21/,#) <#(%,4:#0+ 1( %,-#&5%&)0 /(
1()1Q1)3/* 51,- / :/&,123*/& <#(%,4:# /*5/40 -/0 ,-# #8:#2,#) :-#(%,4:#6
N%5#Q#&6 9/(4 :-#(%,4:#0 /&# (%, )#,#&91(#) #(,1&#*4 .4 <#(#,120> ,-#0#
/&# 1(0,#/) )#,#&91(#) .4 /( 1(,#&/2,1%( .#,5##( <#(%,4:# /() (%(=<#(#,12+
#(Q1&%(9#(,/* $/2,%&06 J-10 A46=:FG4BUFB46N89=6D46: \X ] &] 1(,#&/2,1%( 10
#0:#21/**4 10 #0:#21/**4 &#*#Q/(, 1( ,-# 0,3)4 %$ #2%(%912/**4 19:%&,/(,
:-#(%,4:#0+ 032- /0 -39/( )10#/0#0 %& /<&123*,3&/* :&%)32,1Q1,46 7%&
#8/9:*#+ / :/&,123*/& <#(%,4:# 9/4 :&#=)10:%0# /( 1()1Q1)3/* ,% 2/(2#&+ .3,
2/(2#& 9/4 %(*4 )#Q#*%: 1$ ,-# 1()1Q1)3/* 10 #8:%0#) ,% 2#&,/1( ZK@=)/9/<1(<
Figure 3.7 Reciprocal
crosses involving a sex-
linked trait.

$
%&
$
%&

$
%
,
%$
,
%
,
%$
,
%

' ,
%$
- ,
%$
-


$
%
$
%

$
%&
,
%
,
%$
,
%
,
%$

' ,
%
- ,
%
-
Figure 3.8 Reciprocal
crosses involving a sex-
linked trait.
O ( # C % 2 3 0 V !B^

2-#912/*06 J-#&#$%&#+ (%, /** 1()1Q1)3/*0 51,- ,-# :/&,123*/& <#(%,4:# 51**
)#Q#*%: ,-# 2/(2#& :-#(%,4:#6
!"\ J&'&/.0'Q& 0'( &YJ.&++-_-/L
J-# ,#&90 :#(#,&/(2# /() #8:&#001Q1,4 /&# 30#$3* 5-#( )#02&1.1(< ,-#
&#*/,1%(0-1: .#,5##( 2#&,/1( <#(%,4:#0 /() ,-#1& :-#(%,4:#06 J464:926M4 10
,-# :&%:%&,1%( %$ 1()1Q1)3/*0 51,- / :/&,123*/& <#(%,4:# ,-/, )10:*/4 /
2%&&#0:%()1(< :-#(%,4:#6 "#2/30# /** :#/ :*/(,0 ,-/, /&# -%9%P4<%30 $%& ,-#
/**#*# $%& 5-1,# $*%5#&0 \#6<6 "" 1( 71<3&# A6A] /2,3/**4 -/Q# 5-1,# $*%5#&0+ ,-10
<#(%,4:# 10 Bggh :#(#,&/(,6 I( 2%(,&/0,+ 9/(4 -39/( <#(#,12 )10#/0#0 /&#
1(2%9:*#,#*4 :#(#,&/(,+ 01(2# *#00 ,-/( Bggh %$ 1()1Q1)3/*0 51,- ,-# )10#/0#
<#(%,4:# /2,3/**4 )#Q#*%: /(4 049:,%90 /00%21/,#) 51,- ,-# )10#/0#6
&`G94558N8:F )#02&1.#0 ,-# &/(<# %$ Q/&1/,1%( 1( :-#(%,4:#0 %.0#&Q#) 1(
1()1Q1)3/*0 51,- / :/&,123*/& <#(%,4:#6 '/(4 -39/( <#(#,12 )10#/0#0 :&%Q1)#
#8/9:*#0 %$ Q/&1/.*# #8:&#001Q1,4+ 01(2# 1()1Q1)3/*0 51,- ,-# 0/9# <#(%,4:#0
9/4 Q/&4 <&#/,*4 1( ,-# 0#Q#&1,4 %$ ,-#1& 049:,%906 "%,- 1(2%9:*#,#
:#(#,&/(2# /() Q/&1/.*# #8:&#001Q1,4 9/4 .# )3# ,% #(Q1&%(9#(,/* %& %,-#&
<#(#,12 %& (%(=<#(#,12 $/2,%&06
!"^ (&_-0/-H'+ ,.H% &YJ&Q/&( .0/-H+
A6i6B O"EDMjDZ M@JIOE @MD O7JDK ZI77DMDKJ 7MO' DHLDTJ@JIOKE
7%& / Q/&1#,4 %$ &#/0%(0+ ,-# :-#(%,4:12 &/,1%0 %.0#&Q#) $&%9 &#/* 2&%00#0
&/&#*4 9/,2- ,-# &/,1%0 #8:#2,#) ./0#) %( / L3((#,, ES3/&# %& %,-#&
:&#)12,1%( ,#2-(1S3#06 J-#&# /&# 9/(4 :%001.*# #8:*/(/,1%(0 $%& )#Q1/,1%(0
$&%9 #8:#2,#) &/,1%06 E%9#,19#0 ,-#0# )#Q1/,1%(0 /&# )3# ,% 52DG386A
4>>4M:5+ 1( %,-#& 5%&)0+ ,-# &/()%9 0#*#2,1%( %$ / (%(=&#:&#0#(,/,1Q# 03.0#, %$
1()1Q1)3/*0 $%& %.0#&Q/,1%(6 O( ,-# %,-#& -/()+ 1, 9/4 .# ,-/, ,-# #8:#2,#)
&/,1%0 5#&# 2/*23*/,#) 301(< 1(2%&&#2, /0039:,1%(06 7%& #8/9:*#+ / :/&,123*/&
/**#*# 9/4 /2,3/**4 .# 0#91=)%91(/(, &/,-#& ,-/( )%91(/(,+ %& 9/4.# ,-#
<#(%,4:# %$ %(# :/&#(, 5/0 &#/**4 -#,#&%P4<%30+ &/,-#& ,-/( -%9%P4<%30+ %&
:#&-/:0 / <#(# ,-/, 5/0 /0039#) ,% .# /3,%0%9/* 10 &#/**4 0#8=*1(;#)6
A6i6W JND k
W
JDEJ 7OM UOOZKDEE=O7=7IJ
@ 0,/,10,12/* :&%2#)3&# 2/**#) ,-# M<8B5?@294 ,#0, \a
C
] 2/( .# 30#) ,% -#*: /
<#(#,1210, )#21)# 5-#,-#& ,-# )#Q1/,1%( .#,5##( %.0#&Q#) /() #8:#2,#) &/,1%0
10 )3# ,% 0/9:*1(< #$$#2,0+ %& 5-#,-#& ,-# )1$$#&#(2# 10 0% */&<# ,-/, 0%9# %,-#&
#8:*/(/,1%( 930, .# 0%3<-, .4 &#=#8/91(1(< ,-# /0039:,1%(0 30#) ,% 2/*23*/,#
,-# #8:#2,#) &/,1%6 J-# :&%2#)3&# $%& :#&$%&91(< / 2-1=0S3/&# ,#0, 10
#8:*/1(#) 1( @::#()18 jII %$ ,-# */. 9/(3/*6 D00#(,1/**4+ ,-# :&%2#)3&#
2/*23*/,#0 ,-# )1$$#&#(2# .#,5##( %.0#&Q#) /() #8:#2,#) $&#S3#(21#0 %$ #/2-
:-#(%,4:12 2*/00+ 0S3/&#0 ,-# )1$$#&#(2# \,% &#9%Q# (#</,1Q# Q/*3#0]+ /() ,-#(
/)a30,0 ,-# 02/*# %$ ,-10 )1$$#&#(2# /0 / :&%:%&,1%( %$ ,-# #8:#2,#) $&#S3#(246
J-# 2-1=0S3/&# 0,/,10,12 10 ,-# 039 %$ /** %$ ,-#0# Q/*3#0+ /() 10 ,-#&#$%&# /
0,/()/&)1P#) 9#/03&# %$ ,-# ,%,/* )#Q1/,1%( .#,5##( %.0#&Q#) /() #8:#2,#)
:-#(%,4:12 &/,1%0> ,-# */&<#& ,-# 2-1=0S3/&# 0,/,10,12+ ,-# */&<#& ,-# )1$$#&#(2#
.#,5##( %.0#&Q#) /() #8:#2,#) &/,1%06
O ( # C % 2 3 0 V !B#b

N%5 )% 5# )#21)# 5-#,-#& / 2-1=0S3/&# 0,/,10,12 10 *1;#*4 ,%% */&<# ,% .# )3# ,%
0/9:*1(< #$$#2,0 /*%(#? J% )% ,-10+ 5# 2%9:/&# ,-# 2-1=0S3/&# Q/*3# $%& %3&
#8:#&19#(, ,% / :&#Q1%30*4 2/*23*/,#) :&%./.1*1,4 )10,&1.3,1%( $%& /** :%001.*#
2-1=0S3/&# Q/*3#06 J-10 )10,&1.3,1%( 0-%50 ,-# :&%./.1*1,4 %$ %.,/1(1(< /(4
:/&,123*/& 2-1=0S3/&# Q/*3# )3# ,% 0/9:*1(< #$$#2,06 @0 4%3 91<-, #8:#2,+ ,-#
)10,&1.3,1%( 0-%50 ,-/, *%5 2-1=0S3/&# Q/*3#0 /&# $/1&*4 2%99%(+ 5-1*# */&<#&
2-1=0S3/&# Q/*3#0 /&# &/&# \71<3&# A6i]6 7&%9 ,-10 )10,&1.3,1%( \%& 9%&#
2%(Q#(1#(,*4+ $&%9 / ,/.*# %$ 2-1=0S3/&# Q/*3#0]+ 4%3 2/( $1() ,-# :&%./.1*1,4
\%& GBN23@4] ,-/, 9/,2-#0 ,-# 2-1=0S3/&# 0,/,10,12 2/*23*/,#) $%& 4%3&
#8:#&19#(,6 7%& #8/9:*#+ / :=Q/*3# %$ g6g` 9#/(0 ,-/, 1( %(*4 %(# %& $#5#& %$
Wg #8:#&19#(,0 51** 032- / */&<# )1$$#&#(2# .# %.0#&Q#) .#,5##( %.0#&Q#) /()
#8:#2,#) &#03*,0+ 1$ ,-# #8:#2,#) Q/*3#0 5#&# 2/*23*/,#) /223&/,#*4 6 @0 /
<#(#&/* &3*#+ <#(#,1210,0 30# / :=Q/*3# %$ g6g` /0 / 23,=%$$ ,% )#,#&91(# 5-#,-#&
)#Q1/,1%(0 .#,5##( %.0#&Q#) /() #8:#2,#) &/,1%0 2/( .# /,,&1.3,#) ,%
0/9:*1(< #$$#2,0+ %& 5-#,-#& ,-# 3()#&*41(< /0039:,1%(0 930, .# &#=#8/91(#)6
71(/**4+ 1, 930, .# (%,#) ,-# 2-1=0S3/&# )10,&1.3,1%( )#:#()0 %( ,-# (39.#& %$
)#<&##0 %$ $&##)%9+ 5-12- 10 / 0,/,10,12/* 2%(2#:, ,-/, 1( ,-# 2%(,#8, %$ <#(#,120
10 303/**4 %(# *#00 ,-/( ,-# (39.#& %$ :-#(%,4:12 2*/00#0 \(=B]6
Figure 3.9 Probability
distribution of the chi-
square statistic for five
different degrees of
freedom
O ( # C % 2 3 0 V !B##

ccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc
+S%%0.L
@ )1:*%1) 2/( -/Q# 3: ,% ,5% )1$$#&#(, /**#*#0 /, / 01(<*# *%2306 J-#
/**#*#0 /&# )10,&1.3,#) #S3/**4 .#,5##( </9#,#0 )3&1(< 9#1%0106
L-#(%,4:# )#:#()0 %( ,-# /**#*#0 ,-/, /&# :&#0#(,+ ,-#1& )%91(/(2#
&#*/,1%(0-1:0+ /() 0%9#,19#0 /*0% 1(,#&/2,1%(0 51,- ,-# #(Q1&%(9#(,
/() %,-#& $/2,%&06
J-# #8:#2,#) &/,1%0 %$ <#(%,4:#0 /() :-#(%,4:#0 2/( .# 2/*23*/,#) $%&
,-# :&%<#(4 %$ /(4 2&%00+ 1$ ,-# 9%)# %$ 1(-#&1,/(2# /() ,-# )%91(/(2#
&#*/,1%(0-1:0 /&# ;(%5(6
Z#Q1/,1%(0 .#,5##( #8:#2,#) /() %.0#&Q#) :-#(%,4:12 &/,1%0 9/4
&#03*, $&%9 0/9:*1(< #$$#2,0+ %& $&%9 /))1,1%(/* <#(#,12 %& (%(=<#(#,12
$/2,%&0 (%, 1(1,1/**4 2%(01)#&#) 5-#( 2/*23*/,1(< ,-# #8:#2,#) &/,1%06
J-# 2-1=0S3/&# ,#0, 10 30#$3* 5-#( )#21)1(< 5-#,-#& ,% 1(Q#0,1</,# ,-#
3()#&*41(< /0039:,1%(0 %$ ,-# #8:#2,#) &/,1%06
E#8=*1(;/<# 10 /( #82#:,1%( ,% 0%9# )#$1(1,1%(0 %$ '#()#*Y0 71&0, C/5+
/() 2/( .# .#0, )#9%(0,&/,#) ,-&%3<- &#21:&%2/* 2&%00#06
Z&L /&.%+

/**#*#
'#()#*Y0 71&0, C/5
C/5 %$ DS3/*
E#<&#</,1%(
-%9%P4<%30
-#,#&%P4<%30
-#91P4<%30
51*)=,4:#
*%230
<#(%,4:#
:-#(%,4:#
)%91(/(,
&#2#001Q#
0#91=)%91(/(2#
1(2%9:*#,#
)%91(/(2#
2%=)%91(/(2#
@"O
-/:*%03$$121#(24
-/:*%1(03$$121#(24
,&3# .&##)1(< *1(#0
L3((#,, ES3/&#
9%(%-4.&1) 2&%00
,#0, 2&%00
,#0,#&
0#8=*1(;#)
/3,%0%9/*
&#21:&%2/* 2&%00
U l D
:#(#,&/(2#
#8:&#001Q1,4
0/9:*1(< #$$#2,0
2-1=0S3/&#+ m
W

:=Q/*3#
)#<&##0 %$ $&##)%9





0 n e L o c u s | !"#$

%&'()*+,(
!.# What is the maximum numbei
of alleles foi a given locus in a
noimal gamete of a uiploiu species.

!.$ Wiiey haii (!) is uominant to
smooth haii (") in uogs.
/0 If you cioss a homozygous,
wiiey-haiieu uog with a
smooth-haiieu uog, what will be
the genotype anu phenotype of
the F1 geneiation.
10 If two uogs fiom the F1
geneiation mateu, what woulu
be the most likely iatio of haii
phenotypes among theii
piogeny.
20 When two wiiey-haiieu !"
uogs actually mateu, they hau
alittei of thiee puppies, which
all hau smooth haii. Bow uo you
explain this obseivation.
30 Someone left a wiiey-haiieu
uog on youi uooistep. Without
extiacting BNA,
what woulu be the easiest way
to ueteimine the genotype of
this uog.
40 Baseu on the infoimation
pioviueu in question 1, can you
tell which, if eithei, of
the alleles is wilu-type.

!.! An impoitant pait of Nenuel's
expeiiments was the use of
homozygous lines as paients foi his
ciosses. Bow uiu he know they
weie homozygous, anu why was
the use of the lines impoitant.

!.5 In the table below, match the
mouse haii coloi phenotypes with
the teim fiom the list that best
explains the obseiveu phenotype,
given the genotypes shown. In this
case, the allele symbols uo not
imply anything about the
uominance ielationships between
the alleles. List of teims:
haplosufficiency,
haploinsufficiency, pleiotiopy,
semi-uominance, co-uominance,
incomplete penetiance, vaiiable
expiessivity.

!.6 Boes equal segiegation of
alleles into uaughtei cells happen
uuiing mitosis, meiosis, oi both.
!.7 If youi bloou type is B, what aie
the possible genotypes of youi
paients at the locus that contiols
AB0 bloou types.

!.8 A iaie uominant mutation
causes a neuiological uisease that
appeais late in life in all people that
caiiy the mutation. If a fathei has
this uisease, what is the piobability
that his uaughtei will also have the
uisease.

!.9 The iecessive " allele of the
"$%&' gene in fiuit flies piouuces
white eyes.
/0 If a heteiozygous female anu
a white-eyeu male aie ciosseu,
what aie theii phenotypic iatios
among theii F1 piogeny with
iespect to eye coloi.
10 What aie the phenotypic
iatios among theii F1 piogeny
with iespect to both sex anu eye
coloi.

!.: A paiticulai mutant allele of the
Baiiy wing ((") gene is uominant
anu causes haiiy wings, while the
wilu-type allele (("
)
) is iecessive.
/0 Bow coulu you test whethei
this gene is sex-linkeu.
10What woulu be the expecteu
genotypic anu phenotypic iatios
in the F2 geneiation.




0 n e L o c u s | !"#!


!.#; Almost all of the examples of
sex-linkeu inheiitance iefei to
genes on the X chiomosome.
Imagine a gene with a non-sexual
phenotype that was locateu
exclusively on the Y-chiomosome.
What woulu be inheiitance pattein
of this gene.

!.## Nenuel's Fiist Law (as stateu
in class) uoes not apply to alleles of
most genes locateu on sex
chiomosomes. Boes the law apply
to the chiomosomes themselves.

!.#$ When can you have moie
confiuence in youi assumptions
about an expecteu pattein of
inheiitance :
/0 with a biggei
2
value oi a
smallei
2
value
10with a biggei p-value oi a
smallei p-value.
20 with a biggei uf oi a smallei
uf.

!.#! Beteimine the appiopiiate
uegiees of fieeuom to use when
scoiing piogeny fiom each of the
following ciosses.
/0 Aa x aa, wheie A is uominant
10 Aa x Aa, wheie A is uominant
20 Aa x Aa, wheie A is semi-
uominant
0 n e L o c u s | !"#5


)/1<4 =>? %@4ABC>D !.5
A
1
A
1
A
1
A
2
A
2
A
2

1 all hairs black on the same
individual:
50% of hairs are all
black
50% of hairs are all
white
all hairs white
2 all hairs black all hairs are the same
shade of grey
all hairs white
3 all hairs black all hairs black 50% of individuals
have all white hairs

50% of individuals
have all black hairs

4 all hairs black all hairs black mice have no hair
5 all hairs black all hairs white all hairs white
6 all hairs black all hairs black all hairs white
7 all hairs black all hairs black hairs are a wide range
of shades of grey





The techniques of genetic analysis that we uiscusseu in the pievious chapteis
uepenu on the availability of two oi moie alleles foi a gene of inteiest. Wheie
uo these alleles come fiom. The shoit answei is !"#$#%&'.
()* ,-./.012 /23 4156,174809,
We have pieviously noteu that an impoitant piopeity of BNA is its fiuelity:
most of the time it accuiately passes the same infoimation fiom one
geneiation to the next. Bowevei, BNA sequences can also change. Changes in
BNA sequences aie calleu !"#$#%&':. If a mutation changes the phenotype of
an inuiviuual, the inuiviuual is saiu to be a !"#$'#. Natuially occuiiing, but
iaie, sequence vaiiants that aie cleaily uiffeient fiom a noimal, wilu-type
sequence aie also calleu mutations. 0n the othei hanu, many natuially
occuiiing vaiiants exist foi tiaits foi which no cleaily noimal type can be
uefineu; thus, we use the teim ;&<=!&>;?%:! to iefei to vaiiants of BNA
sequences (anu othei phenotypes) that co-exist in a population at ielatively
high fiequencies (>1%). Polymoiphisms anu mutations aiise thiough similai
biochemical piocesses, but the use of the woiu "polymoiphism" avoius
implying that any paiticulai allele is moie noimal oi abnoimal. Foi example, a
change in a peison's BNA sequence that leaus to a uisease such as cancei is
appiopiiately calleu a mutation, but a uiffeience in BNA sequence that
explains whethei a peison has ieu haii iathei than biown haii is an example
Chaptei 4 N0TATI0N ANB vARIATI0N
Figure 4.1 The
difference in
appearance between
blue and white
peacocks is due to
mutation
C h a p t e i 4 | (@A


of polymoiphism. Noleculai maikeis, which we will uiscuss in Chaptei 9, aie a
paiticulaily useful type of polymoiphism foi some aieas of genetics ieseaich.
Bumans have an inteiesting ielationship with mutation. Fiom oui
peispective, mutations can be extiaoiuinaiily useful, since mutations allow
evolution to pioceeu. Nutation is also the basis foi the uomestication anu
impiovement of almost all of oui foou. 0n the othei hanu, as the cause of
many canceis anu othei uiseases, mutation can be uevastating to inuiviuuals.
Yet, the vast majoiity of mutations piobably go unuetecteu. In this section, we
will examine some of the causes anu effects of mutations.

()A 170B029 1C ,-./.0129
4.2.1 TYPES 0F N0TATI0NS
Nutation may involve the %':D>#%&' oi ED<D#%&' of one oi moie bases, oi else
the :"F:#%#"#%&' of one BNA sequence with anothei BNA sequence of equal
length. These changes in BNA sequence can aiise in many ways, some of
which aiise spontaneously fiom natuial souices anu some of which aie
inuuceu intentionally oi unintentionally by human actions. Theie aie many
ways to classify !"#$GD':, which aie the agents that cause mutation. We will
classify mutagens heie as being eithei biological, chemical, oi physical.
4.2.2 BI0L0uICAL 0RIuINS 0F N0TATI0NS
A majoi souice of spontaneous mutation is eiiois that aiise uuiing BNA
ieplication. BNA polymeiases aie usually veiy accuiate in auuing a base to the
giowing stianu that is the exact complement of the base on the template
stianu. Bowevei, occasionally, an incoiiect base is inseiteu. 0sually, the
machineiy of BNA ieplication will iecognize anu iepaii mispaiieu bases, but
neveitheless, some eiiois become peimanently incoipoiateu in a uaughtei
stianu, anu so become mutations that will be inheiiteu by the cell's
uescenuents (Figuie 4.S).
Anothei souice of eiioi intiouuceu uuiing ieplication is causeu by a
tempoiaiy misalignment of a few bases between the template stianu anu
uaughtei stianu (Figuie 4.4). This stianu-slippage causes one oi moie bases
on eithei stianu to be tempoiaiily uisplaceu in a <&&; that is not paiieu with
the opposite stianu. If this loop foims on the template stianu, the bases in the
loop may not be ieplicateu, anu a ueletion will be intiouuceu in the giowing
uaughtei stianu. Conveisely, if a iegion of the uaughtei stianu that has just
been ieplicateu becomes uisplaceu, this iegion may be ieplicateu again,
leauing to an inseition of auuitional sequence in the uaughtei stianu, as
compaieu to the template stianu. Regions of BNA that have seveial iepeats of
the same few nucleotiues in a iow aie especially pione to this type of eiioi
uuiing ieplication. These shoit-sequence iepeats (997:) aie also calleu
miciosatellites anu tenu to be highly polymoiphic, anu aie theiefoie
paiticulaily useful in genetics.


Figure 4.2 Examples
of wild-type (A) and
mutant (B) mouse
embryos observed
while screening for
genes affecting
cranium development.
C h a p t e i 4 | (@H


Nutations can also be intiouuceu by viiuses, tiansposable elements (see Box
4-1), anu othei types of BNA that aie natuially inseiteu at moie oi less ianuom
positions in chiomosomes. The inseition may uisiupt the couing sequence of
a gene, oi have othei consequences incluuing the fusion of pait of one gene
with anothei. These inseitions occui spontaneously, anu can also be
intentionally stimulateu in the laboiatoiy as a methou of mutagenesis. Foi
example, a type of tiansposable element calleu a 4@D<D!D'# is wiuely useu as a
biological mutagen in Biosophila, anu .@32/, which is an inseitional element
mouifieu fiom a bacteiial pathogen is useu as a mutagen in some plant species.
4.2.S CBENICAL N0TAuENS
Nany chemical compounus, whethei natuial oi synthetic, can ieact with BNA.
These ieactions may change the chemical stiuctuie of paiticulai bases, so that
they aie misieau uuiing ieplication. 0thei chemical mutagens uistoit the
uouble helix causing it to be ieplicateu inaccuiately, while still otheis may
cause bieaks in chiomosomes that leau to ueletions anu othei types of
abeiiations. Following aie examples of two classes of chemical mutagens,
$<I=<$#%'G $GD'#:, anu %'#D>J$<$#%'G $GD'#:, that aie impoitant in genetics oi
meuicine.






Figure 4.3 Mispairing of bases (e.g. G with T) can occur due to tautomerism, alkylating
agents, or other effects. As a result, in this example the AT base pair in the original DNA
strand will become permanently substituted by a GC based pair in some progeny. The
mispaired GT basepair will likely be repaired or eliminated before further rounds of
replication.
C h a p t e i 4 | (@(


Ethane methyl sulfonate (K,9), is an example of an alkylating agent that is
commonly useu by geneticists to inuuce mutations in a wiue iange of both
piokaiyotes anu eukaiyotes. The oiganism is feu oi otheiwise exposeu to a
solution of ENS, which ieacts with some of the u bases it encounteis in a
piocess calleu alkylation. The auuition of an alkyl gioup to u changes the base
paiiing piopeities so that the next time the alkylateu BNA stianu is ieplicateu,
a T insteau of a C will be inseiteu opposite to the alkylateu-u in the uaughtei
stianu (Figuie 4.S). The new stianu theiefoie beais a mutation, which will be
inheiiteu, in all the stianus that aie subsequently ieplicateu fiom it.


Figure 4.4 Strand-slippage can occur occasionally during replication, especially in regions with short, repeated
sequences. This can lead to either deletion (left) or insertion (right) of sequences compared to the products of
normal replication (center), depending on whether the template strand or daughter strand loops-out during
replication

C h a p t e i 4 | (@L


Box 4-1 Tiansposable Elements
.>$':;&:$F<D D<D!D'#: M.K:N occui natuially thioughout the chiomosomes
of almost all oiganisms. These BNA sequences have a unique ability to be
inseiteu into new locations in the genome, aftei being cut oi copieu fiom theii
oiiginal location. TEs aie also known as mobile genetic elements, oi moie
infoimally as jumping genes. The locations into which TEs aie inseiteu aie not
entiiely ianuom, but TEs can in piinciple be inseiteu into almost any iegion of
the genome. TEs can theiefoie move into othei genes, causing mutations.
Reseaicheis have methous of aitificially incieasing the iate of tiansposition,
making TEs a useful type of mutagen. Bowevei the biological impoitance of
TEs extenus fai beyonu theii use in mutant scieening; TEs aie also impoitant
causes of uisease anu phenotypic instability, anu they aie a majoi foice in
evolution.
Theie aie two majoi classes of TEs in eukaiyotes (Figuie 4-B1). O<$:: 0
elements incluue >D#>&;&:&': anu >D#>&#>$':;&:&':; these aie copieu by
means of an RNA inteimeuiate. The tiansciipt is ieveise tiansciibeu into BNA
befoie being inseiteu elsewheie in the genome thiough the action of enzymes
such as %'#DG>$:D. O<$:: 00 elements aie known also as #>$':;&:&':; these uo
not use ieveise tiansciiptase oi an RNA inteimeuiate foi tiansposition. 0sing
an enzyme calleu #>$':;&:$:D, most tiansposons aie cut fiom theii oiiginal
location anu then this exciseu usBNA fiagment is inseiteu into a new location.
Note that the name tiansposon is sometimes useu incoiiectly to iefei to any
type of TEs, but in this book we use tiansposon to iefei only to Class II
elements.

C%G">D (@P* . Repiesentative examples of the two main types of tiansposable
elements. (TEs) Class I elements tianspose via an ssRNA inteimeuiate, which
is ieveise tiansciibeu to usBNA piioi to inseition of this copy in a new site in
the genome. Class II elements uo not involve an RNA inteimeuiate; most Class
II elements aie cut fiom theii oiiginal location as usBNA, piioi to being
inseiteu into a new site in the genome. Although the uiagiam shows TEs being
C h a p t e i 4 | (@Q


inseiteu on the same chiomosome as they oiiginateu fiom, TEs can also move
to othei chiomosomes within the same cell.
TEs aie ielatively shoit BNA sequences (between 1uubp anu 1ukb), anu
encoue no moie than a few pioteins (if any). Noimally, the piotein-couing
genes within a TE aie all ielateu to the TE's own tiansposition functions, e.g.
>DRD>:D #>$':J>%;#$:D, tiansposase, anu integiase. Bowevei, some TEs (of
eithei Class I oi II) uo not encoue any pioteins at all. These '&'@$"#&'&!&":
TEs can only tianspose if they aie supplieu with enzymes piouuceu by othei,
$"#&'&!&": TEs locateu elsewheie in the genome. In all cases, enzymes foi
tiansposition iecognize conseiveu nucleotiue sequences within the TE, which
show the enzymes wheie to begin cutting oi copying, anu ie-inseition.
The human genome is neaily 4S% TEs, the vast majoiity of which aie families
of Class I elements calleu 502K: anu 902K:. The shoit, !"# type of SINE occuis
in moie than one million copies in the human genome (compaie this to the
appioximately 21,uuu, non-TE, piotein-couing genes in humans). Inueeu, TEs
make up a significant poition of the genomes of almost all eukaiyotes. Class I
elements, which usually tianspose via a copy-anu-paste mechanism, tenu to be
moie abunuant than Class II elements, which mostly use a cut-anu-paste
mechanism. But even the cut-paste mechanism can leau to an inciease in TE
copy numbei, in some ciicumstances (foi example, if the site vacateu by the
exciseu tiansposon is iepaiieu with a BNA template fiom a homologous
chiomosome that itself contains a copy of a tiansposon).
Besiues gieatly expanuing the BNA content of genomes, TEs contiibute to
genome evolution in many othei ways. As alieauy mentioneu, they may
uisiupt gene function by inseition into a gene's couing iegion oi iegulatoiy
iegion. Noie inteiestingly aujacent iegions of chiomosomal BNA aie
sometimes mistakenly tiansposeu along with the TE; this can leau to gene
uuplication. The uuplicateu genes aie then fiee to evolve inuepenuently,
leauing in some cases to the uevelopment of new functions. The bieakage of
stianus by TE excision anu integiation can uisiupt genes, anu can leau to
chiomosome ieaiiangement oi ueletion if eiiois aie maue uuiing stianu
iejoining. Fuitheimoie, having so many similai TE sequences uistiibuteu
thioughout a chiomosome sometimes allows mispaiiing of iegions of
homologous chiomosomes at meiosis, which can cause unequal ciossing-ovei,
iesulting in ueletion oi uuplication of laige segments of chiomosomes. Thus,
TEs aie an impoitant evolutionaiy foice, anu aie not meiely "junk BNA" as
they weie once calleu.

C h a p t e i 4 | (@S


0'#D>J$<$#%'G $GD'#: aie anothei type of chemical mutagen. These inuuce
mutations by inseiting between the stackeu bases at the centei of the BNA
helix (Figuie 4.6). This inteicalation uistoits the shape of the BNA helix, which
can cause the wiong bases to be auueu to a giowing BNA stianu uuiing BNA
synthesis. Inteicalating agents tenu to be flat, planai molecules such as
FD'T&U$V;=>D'D, a component of woou anu tobacco smoke. Anothei
impoitant inteicalating agent was containeu in some piepaiations
thaliuomiue, an anti-nausea uiug whose consumption by thousanus of
piegnant woman iesulteu in biith uefects. Finally D#?%E%"! F>&!%ED, the uye
that fluoiescently stains BNA in laboiatoiy assays, is also an inteicalating
agent. Foi this ieason, moleculai biologists aie tiaineu to hanule this chemical
caiefully.
4.2.4 PBYSICAL N0TAuENS
Anything that uamages BNA by tiansfeiiing eneigy to it can be consiueieu a
physical mutagen. 0sually this involves iauioactive paiticles, x-iays, oi 0v
light. Smallei, fast moving paiticles may substitute oi uelete a single base,
while laigei, slightly slowei paiticles inuuce laigei ueletions by bieaking the
uouble stianueu helix. Physical mutagens can also cieate unusual stiuctuies in
BNA, such as the thymine uimeis foimeu by 0v light (Figuie 4.7). Thymine
uimeis uisiupt noimal base-paiiing in the uouble helix, anu may block
ieplication altogethei if not iepaiieu by the cell.




Figure 4.5
Alkylation of G
(shown in red)
allows G to bond
with T, rather than
with C.

Figure 4.6
Benzo[a]pyrene
(circled in red) is an
example of an
intercalating agent
C h a p t e i 4 | (@W





()H ,-./2. 9O7KK202BX C17Y/73 BK2K.0O9
0ne way to iuentify genes that affect a paiticulai biological piocess is to inuuce
ianuom mutations in a population, anu then look foi inuiviuuals with
phenotypes that might be causeu by a uisiuption of a paiticulai biochemical
pathway. This stiategy of !"#$'# :J>DD'%'G has been useu veiy effectively to
bettei unueistanu the moleculai components of hunuieus of uiffeient
biological piocesses. Foi example, to bettei unueistanu piocesses of memoiy
anu leaining, ieseaicheis have scieeneu mutagenizeu populations of
!"#$#%&'() to iuentify flies (oi laivae) that lack the noimal ability to leain to
associate a paiticulai ouoi with an electiic shock. Some of the genes iuentifieu
by this mutant scieen may be ielevant to leaining anu memoiy in othei
animals, incluuing conuitions such as Alzheimei's uisease in humans.
Exposuie of an oiganism to a mutagen causes mutations in essentially ianuom
positions along the chiomosomes. Nost of the mutant phenotypes iecoveieu
fiom a genetic scieen aie causeu by <&::@&Z@Z"'J#%&' mutations. These aie
changes in the sequence of an allele that cause it to no longei piouuce the same
level of active piotein as the wilu-type allele. Loss-of-function alleles tenu to
be iecessive because the wilu-type allele is haplosufficient (see Chaptei 6). A
loss-of-function allele that piouuces no active piotein is calleu an $!&>;?, oi
'"<<. 0n the othei hanu, alleles with only a paitial loss-of-function aie calleu
hypomoiphic. Noie iaiely, a mutant allele may have a G$%'@&Z@Z"'J#%&',
piouucing eithei moie of the active piotein (?=;D>!&>;?) oi piouucing an
active piotein with a new function ('D&!&>;?). Finally, $'#%!&>;?: have an
activity that is uominant anu opposite to the wilu-type function; antimoiphs
aie also known as uominant negatives.

Figure 4.7 Thymine
dimers are formed when
adjacent thymine bases
on the same DNA strand
become covalently
linked (red bonds)
follow exposure to
mutagens such as UV
light. The dimers distort
base pairing and can
interrupt processes such
as replication.
C h a p t e i 4 | (@[

In a typical mutant scieen, ieseaicheis will tieat a paiental population with a
mutagen. This may, foi example, involve soaking seeus in ENS, oi mixing a
mutagen with the foou feu to flies. Noimally, no phenotypes will be visible
among the inuiviuuals that aie uiiectly exposeu to the mutagen, in pait
because eveiy stianu of BNA will be affecteu inuepenuently - the iesulting
mutations will be heteiozygous anu limiteu to single cells. Nost impoitant to
geneticists aie mutations in the geimline of the mutagenizeu inuiviuuals. The
geimline is uefineu as the gametes anu any of theii uevelopmental piecuisois,
anu is theiefoie uistinct fiom the somatic (i.e. non-iepiouuctive cells) of the
bouy. Because most inuuceu mutations aie iecessive, the piogeny of
mutagenizeu inuiviuuals must be mateu in a way that allows the mutations to
become homozygous. Stiategies foi uoing this vaiy between oiganisms. In
any case, the geneiation in which inuuceu mutations aie expecteu to occui can
be examineu foi the piesence of novel phenotypes. 0nce a ielevant mutant has
been iuentifieu, geneticists can begin to make infeiences about what the
noimal function of the mutateu gene is, baseu on its mutant phenotype.
()( 91,K ,-./.0129 ,/6 21. 8/\K 3K.KO./P5K 48K21.64K9
The vast majoiity of mutations (especially substitutions) have no effect on the
phenotype. 0ften, this is because the mutation is :%<D'#; it changes the BNA
sequence of a non-couing iegion of the BNA, oi else the changes a base within
a couon without changing the amino aciu that it encoues (iecall that the
genetic coue is uegeneiate; foi example, uCT, uCC, uCA, anu uCu all encoue
alanine). Theie aie also cases wheie a mutation can cause a complete loss-of-
function of a gene, yet not piouuce a phenotype even when the mutant allele is
homozygous. This can often be attiibuteu to genetic >DE"'E$'J=, i.e. the
encouing of similai genes at moie than one locus in the genome. It is
impoitant theiefoie to iemembei this impoitant limitation of mutational
analysis: genes with ieuunuant functions cannot be easily iuentifieu by mutant
scieening.
Some phenotypes iequiie inuiviuuals to ieach a paiticulai uevelopmental
stage befoie they can be scoieu. Foi example, flowei coloi can only be scoieu
in plants that aie matuie enough to make floweis, anu eye coloi can only be
scoieu in flies that have uevelopeu eyes. Bowevei, some alleles may not
uevelop sufficiently to be incluueu among the piogeny that aie scoieu
accoiuing to theii phenotype. Lethal alleles that aiiest the uevelopment of an
inuiviuual at an embiyonic stage may theiefoie go unnoticeu in a typical
mutant scieen. Fuitheimoie, the piogeny of a monohybiiu cioss involving an
embiyonic lethal iecessive allele may theiefoie all be of a single phenotypic
class, giving a phenotypic iatio of 1:u (which is the same as S:u).
Nany genes aie fiist iuentifieu in mutant scieens, anu so they tenu to be
nameu aftei theii mutant phenotypes. This can cause some confusion foi
stuuents of genetics. Foi example, we have alieauy encounteieu an X-linkeu
gene nameu +&',- in fiuit flies. Null mutants of white have white eyes, but the
noimal function of the +&',- gene is actually to make ieu eyes. It uoes this by
impoiting a pigment into ueveloping cells of the eye.
C h a p t e i 4 | (@*]





()L O1,45K,K2./.012 .K9.02B
Nutations in uiffeient genes can piouuce the same phenotype. Foi example, in
the biochemical pathway shown in Figuie 4.8, a plant that lacks the function of
gene A (genotype ))) woulu piouuce mutant, white floweis that lookeu just
like the floweis of a plant that lackeu the function of gene B (genotype ..). The
genetics of two loci aie uiscusseu moie in the following chapteis.



As explaineu eailiei in this chaptei, mutant scieening is one of the main
activities of geneticists. When geneticists finu two mutants with similai
phenotypes, eithei in natuial populations oi uuiing a mutant scieen, an
immeuiate question is whethei oi not the mutants have lost the function of the
same gene. The othei possibility is that each mutant has lost the function of a
uiffeient gene. If they aie both mutants of the same gene, then theii genotypes
can both be iepiesenteu as )). If each has a mutation in a uiffeient gene, then
the genotype of one inuiviuual can be iepiesenteu as )), anu the othei
inuiviuual as .. (oi moie completely as ))// anu 00.., iespectively).
A technique calleu J&!;<D!D'#$#%&' #D:#%'G can be useu to ueteimine
whethei two inuiviuuals with the same phenotype caiiy mutations in the same
gene oi uiffeient genes. The only iequiiement of this test is two puie-bieeuing
inuiviuuals with the same phenotype; no piioi knowleuge of the genes oi
biochemical pathways is iequiieu. To peifoim a complementation test, two
Figure 4.8 In this
simplified biochemical
pathway, two enzymes
encoded by two
different genes modify
chemical compounds in
two sequential reactions
to produce a purple
pigment. Loss of either
of the enzymes disrupts
the pathway and no
pigment is produced.



C h a p t e i 4 | (@**

homozygous inuiviuuals with similai mutant phenotypes aie ciosseu (Figuie
4.9). If the F1 piogeny all have the mutant phenotype, then we infei that same
gene is mutateu in each paients. If the F1 piogeny all appeai to be wilu-type,
then each of the paients most likely caiiies a mutation in a uiffeient gene
(Figuie 4.1u).



Thus, if two homozygous mutants piouuce F1 piogeny that have a wilu-type
phenotype, J&!;<D!D'#$#%&' is saiu to have occuiieu, because the wilu-type
alleles of each of the genes weie able to compensate foi the iecessive, mutant
alleles that weie also inheiiteu (Case 2, Figuie 4.1u). 0n the othei hanu, if the
F1 piogeny all have a mutant phenotype, (Case 1, Figuie 4.1u), the mutant
genotypes fail to complement each othei, because they contain mutations of
the same gene. These coulu be eithei the same mutant alleles, oi uiffeient
mutant alleles of the same gene. If the two mutants aie inuepenuent (e.g. they
came fiom uiffeient natuial populations oi fiom inuepenuently mutagenizeu
inuiviuuals), the mutations aie piobably uiffeient alleles of the same gene. All
mutants that fail to complement each othei aie saiu to be in the same
J&!;<D!D'#$#%&' G>&";.






Figure 4.9 In a typical
complementation test,
the genotypes of two
parents are unknown
(although they must be
pure breeding,
homozygous mutants).
If the F1 progeny all
have a mutant
phenotype there (Case
1), there is no
complementation. If the
F1 progeny are all wild-
type, the mutations are
said to have
complemented each
other. See Figure 4.10
for interpretation.



C h a p t e i 4 | (@*A








Figure 4.10 The pure breeding, homozygous mutants parents had unknown genotypes before the
complementation test, but it could be assumed that they were either mutations in the same genes (Case 1)
or different genes (Case 2). In Case 1, all of the progeny would have a mutant phenotype, because they
would all have the same, homozygous genotype as the parents. In Case 2, each parent has a mutation in a
different gene, therefore none of the F
1
progeny will be homozygous mutant at any one locus. Note that
the genotype in Case 1 could be written as either aa or aaBB.

C h a p t e i 4 | (@*H

__________________________________________________________________________________________
9-,,/76
When a vaiiation in BNA sequence oiiginateu iecently, anu is iaie in a
population, we call that change a mutation.
When vaiiations in BNA sequence co-exist in a population, anu neithei
one can be meaningfully uefineu as wilu-type, we call the vaiiations
polymoiphisms.
Nutations may eithei occui spontaneously, oi may be inuuceu by
exposuie to mutagens.
Nutations may iesult in eithei substitutions, ueletions, oi inseitions.
Nutation usually causes eithei a paitial oi complete loss of function,
but sometimes iesults in a gain of function, incluuing new functions.
Spontaneous mutations aiise fiom many souices incluuing natuial
eiiois in BNA ieplication, usually associateu with base mispaiiing, oi
else inseition ueletion especially within iepetitive sequences.
Inuuceu mutations iesult fiom mispaiiing, BNA uamage, oi sequence
inteiiuptions causeu by chemical, biological, oi physical mutagens.
By ianuomly inuucing mutations, then scieening foi a specific
phenotype, it is possible to iuentify genes associateu with specific
biological pathways.
Tiansposable elements aie uynamic, abunuant components of
eukaiyotic genomes anu impoitant foices in evolution.
Tiansposable elements aie uynamic, abunuant components of
eukaiyotic genomes anu impoitant foices in evolution.
Nutation of uiffeient genes can piouuce a similai phenotype.
Complementation testing ueteimines whethei two mutants aie the
iesult of mutation of the same gene, oi if each mutant is causeu by
mutation of a uiffeient gene.
The efficiency of mutant scieening is limiteu by silent mutations,
ieuunuancy, anu embyionic lethality.
C h a p t e i 4 | (@*(



^K6 .K7,9
mutation
mutant
polymoiphism
inseition
ueletion
substitution
mutagen
biological mutagen
chemical mutagen
physical mutagen
mispaiiing
loop
SSR
inseitional mutagen
Class I, Class II
tiansposon
ietiotiansposon
ieveise
tiansciiptase
tiansposase
non-autonomous
autonomous
SINE, LINE, Alu
P-element
T-BNA
alkylation agent
ENS
inteicalating agent
benzopyiene
ethiuium biomiue
thymine uimei
mutant scieen

loss-of-function
gain-of-function
amoiph
null
hypomoiph
hypeimoiph
neopmoiph
somatic
geimline
Nu, N1, N2
silent mutation
ieuunuancy
lethality
complementation
gioup


_______________________________________________________________________________________









9.-36 _-K9.0129
()* Bow aie polymoiphisms anu
mutations alike. Bow aie they
uiffeient.
()A What aie some of the ways a
substitution can occui in a BNA
sequence.
()H What aie some of the ways a
ueletion can occui in a BNA
sequence.
()( What aie all of the ways an
inseition can occui in a BNA
sequence.
()L In the context of this chaptei,
explain the health hazaius of
smoking tobacco.
()Q You have exposeu a female fiuit
fly to a mutagen. Nating this fly
with a non-mutagenizeu male
piouuces offspiing that appeai to
be completely noimal.
Bowevei theie aie twice as many
females as males in the F1 piogeny
of this cioss.
$N Piopose a hypothesis to explain
these obseivations.
FN Bow coulu you test youi
hypothesis.
()S You ueciue to use genetics to
investigate how youi favouiite
plant makes its floweis smell goou.
$N What steps will you take to
iuentify some genes that aie
iequiieu foi piouuction of the
sweet floial scent. Assume that
this plantis a self-pollinating
uiploiu.
FN 0ne of the iecessive mutants
you iuentifieu has fishy-smelling
floweis, so you name the mutant
(anu the mutateu gene) 1'$&2. What
uo you hypothesize about the
noimal function of the wilu-type
1'$&2 gene.
JN Anothei iecessive mutant lacks
floial scent altogethei, so you call it
3#$4-((. What coulu you
hypothesize about the
noimalfunction of this gene.
()W Suppose you aie only
inteiesteu in finuing uominant
mutations that affect floial scent.
$N What uo you expect to be the
ielative fiequency of uominant
mutations, as compaieu to
iecessive mutations, anu why.
FN Bow will you uesign youi scieen
uiffeiently than in the pievious
question, in oiuei to uetect
uominant mutations specifically.
JN Which kinu of mutagen is most
likely to piouuce uominant
mutations, a mutagen that
piouuces point mutations, oi a
mutagen that piouuces laige
ueletions.
()[ Which types of tiansposable
elements aie tiansciibeu.
()*] You aie inteiesteu in finuing
genes involveu in synthesis of
pioline (Pio), an amino aciu that is
noimally synthesizes by a
paiticulai mouel oiganism.
$N Bow woulu you uesign a
mutant scieen to iuentify genes
iequiieu foi Pio synthesis.
F) Imagine that youi scieen
iuentifieu ten mutants (#1 thiough
#4) that giew pooily unless
supplementeu with Pio. Bow coulu
you ueteimine the numbei of


uiffeient genes iepiesenteu by
these mutants.
JN If each of the foui mutants
iepiesents a uiffeient gene, what
will be the phenotype of the F1
piogeny if any paii of the foui
mutants aie ciosseu.
EN If each of the foui mutants
iepiesents the same gene, what
will be the phenotype of the F1
piogeny if any paii of the foui
mutants aie ciosseu.









The basic concepts of genetics uesciibeu in the pieceuing chapteis can be
applieu to almost any eukaiyotic oiganism. Bowevei, some techniques, such
as test ciosses, can only be peifoimeu with mouel oiganisms oi othei species
that can be expeiimentally manipulateu. To stuuy the inheiitance patteins of
genes in humans anu othei species foi which contiolleu matings aie not
possible, geneticists use techniques incluuing the analysis of peuigiees anu
populations
!"# %&'()*&& +,+-./(/
Peuigiees use a stanuaiuizeu set of symbols to iepiesent an inuiviuual's sex,
family ielationships anu phenotype. These uiagiams aie useu to ueteimine the
0123 14 5673859:6;3 of a paiticulai uisease oi tiait, anu to pieuict the
piobability of its appeaiance among offspiing. Peuigiee analysis is theiefoie
an impoitant tool in both basic ieseaich anu <36395; ;1=6>3?56<.
Each peuigiee iepiesents all of the available infoimation about the inheiitance
of a single tiait (most often a uisease) within a family. The peuigiee is
theiefoie uiawn fiom factual infoimation iathei than theoietical pieuictions,
Chaptei S PEBIuREES ANB P0P0LATI0NS
Figure 5.1 Polydactyly is
an example of a human
trait that can be studied
by pedigree analysis
P e u i g i e e s & P o p u l a t i o n s | !@A


but theie is always some possibility of eiiois in this infoimation, especially
when ielying on family membeis' iecollections oi even clinical uiagnoses. In
ieal peuigiees, fuithei complications can aiise uue to incomplete penetiance
(incluuing age of onset) anu vaiiable expiessivity of uisease alleles, but foi the
examples piesenteu in this book, we will piesume complete accuiacy of the
peuigiees. A peuigiee may be uiawn when tiying to ueteimine the natuie of a
newly uiscoveieu uisease, oi when an inuiviuual with a family histoiy of a
uisease wants to know the piobability of passing the uisease on to theii
chiluien. In eithei case, a tiee is uiawn, as shown in Figuie S.2, with ciicles to
iepiesent females, anu squaies to iepiesent males. If an inuiviuual is known
to have symptoms of the uisease, the symbol is filleu in. Sometimes a half-
filleu in symbol is useu to inuicate a ;:88538 of a uisease; this is someone who
uoes not have any symptoms of the uisease, but who passeu the uisease on to
subsequent geneiations. Note that when a peuigiee is constiucteu, it is often
unknown whethei a paiticulai inuiviuual is a caiiiei oi not, so not all caiiieis
aie always explicitly inuicateu in a peuigiee. Foi simplicity, we will assume
that the peuigiees piesenteu in this chaptei aie accuiate, anu iepiesent fully
penetiant tiaits.

!"A (,B&**(,) CD& EF'& FB (,D&*(C+,G&
uiven a peuigiee of an unchaiacteiizeu uisease oi tiait, one of the fiist tasks is
to ueteimine the moue of inheiitance, as this infoimation is essential in
calculating the piobability that the tiait will be inheiiteu in offspiing. We will
consiuei foui majoi types of inheiitance: autosomal uominant (AB), autosomal
iecessive (AR), X-linkeu uominant (XB), X-linkeu iecessive (XR).
S.2.1 A0T0S0NAL B0NINANT (AB)



When a uisease is causeu by a uominant allele of a gene, eveiy peison with that
allele will show symptoms of the uisease (assuming complete penetiance), anu
only one uisease allele neeus to be inheiiteu foi an inuiviuual to be affecteu.
Thus, eveiy affecteu inuiviuual must have an affecteu paient. A peuigiee with
affecteu inuiviuuals in eveiy geneiation is typical of AB uiseases. Bowevei,
bewaie that othei moues of inheiitance can also show the uisease in eveiy
geneiation, as uesciibeu below. It is also possible foi an affecteu inuiviuual
with an AB uisease to have a family without any affecteu chiluien, if the
Figure 5.2 Symbols used
in drawing a pedigree.
Figure 5.3 A pedigree
consistent with AD
inheritance.
P e u i g i e e s & P o p u l a t i o n s | !@H
affecteu paient is a heteiozygote. This is paiticulaily tiue in small families,
wheie the piobability of eveiy chilu inheiiting the noimal, iathei than uisease
allele is not extiemely small. Note that AB uiseases aie usually iaie within
populations, theiefoie affecteu inuiviuuals with AB uiseases tenu to be
heteiozygotes (otheiwise, both paients woulu have hau to been affecteu with
the same iaie uisease). Achonuioplastic uwaifism, anu polyuactyly aie both
examples of human conuitions that may follow an AB moue of inheiitance.

S.2.2 X-LINKEB B0NINANT (XB)




In X-linkeu uominant inheiitance, the gene iesponsible foi the uisease is
locateu on the X-chiomosome, anu the allele that causes the uisease is
uominant to the noimal allele. Because females have twice as many X-
chiomosomes as males, females tenu to be affecteu moie fiequently than
males in XB peuigiees. Bowevei, not all peuigiees pioviue sufficient
infoimation to uistinguish XB anu AB. 0ne uefinitive inuication that a tiait is
inheiiteu as AB iathei than XB is that an affecteu fathei passes the uisease to a
son; this type of tiansmission is not possible with XB, since males inheiit theii
X chiomosome fiom theii motheis.

S.2.S A0T0S0NAL RECESSIvE (AR)
Biseases that aie inheiiteu in an autosomal iecessive pattein iequiie that both
paients of an affecteu inuiviuual caiiy at least one copy of the uisease allele.
With AR tiaits, many inuiviuuals in a peuigiee can be caiiieis, piobably
without knowing it. Compaieu to peuigiees of uominant tiaits, AR peuigiees
tenu to show fewei affecteu inuiviuuals anu aie moie likely than AB oi XB to
"skip a geneiation". Thus, the majoi featuie that uistinguishes AR fiom AB oi
XB is that unaffecteu inuiviuuals can have affecteu offspiing.
Figure 5.4 Two
pedigrees
consistent with XD
inheritance.
Figure 5.5 Some types
of rickets may follow an
XD mode of inheritance.
P e u i g i e e s & P o p u l a t i o n s | !@I






S.2.4 X-LINKEB RECESSIvE (XR)
Because males have only one X-chiomosome, any male that inheiits an X-
linkeu iecessive uisease allele will be affecteu by it (assuming complete
penetiance). Theiefoie, in XR moues of inheiitance, males tenu to be affecteu
moie fiequently than females. This is in contiast to AR anu AB, wheie both
sexes tenu to be affecteu equally, anu XB, in which females aie affecteu moie
fiequently. Note, howevei, that in the small sample sizes typical of human
families, it may not be possible to accuiately ueteimine whethei one sex is
affecteu moie fiequently than otheis. 0n the othei hanu, one featuie of a
peuigiee that can be useu to uefinitively establish that an inheiitance pattein
is not XR is the piesence of an affecteu uaughtei fiom unaffecteu paients;
because she woulu have hau to inheiit one X-chiomosome fiom hei fathei, he
woulu also have been affecteu in XR.



Figure 5.6 A pedigree
consistent with AR
inheritance.
Figure 5.7 Many inborn
errors of metabolism,
such as phenylketonuria
(PKU) are inherited as
AR. Newborns are often
tested for a few of the
most common metabolic
diseases.
Figure 5.9 Some forms of colour blindness
are inherited as XR-traits. Colour blindness
is diagnosed using tests such as this Ishihara
Test.
P e u i g i e e s & P o p u l a t i o n s | !@!

B5<=83 !"J A peuigiee consistent with XR inheiitance.

!"H /%F*+'(G +,' ,F,@D&*(C+K-& '(/&+/&/

0nly a fiaction of all of the known human tiaits anu uiseases have been pioven
to be causeu by alleles of a single gene. Nany othei uiseases have a heiitable
component, but have moie complex inheiitance patteins uue to the
involvement of multiple genes anu enviionmental factois. 0n the othei hanu,
some uiseases may appeai to be heiitable, because they affect multiple
membeis of the same family, but this coulu also be because the family
membeis aie exposeu to the same toxins oi othei enviionmental factois in
theii homes. Finally, uiseases with similai symptoms may have uiffeient
causes, so of which may be genetic while otheis aie not. 0ne example of this is
ALS (amyotiophic lateial scleiosis); appioximately S-1u% of cases aie
inheiiteu in an AB pattein, while the majoiity of the iemaining cases appeai to
be >L18:25;, in othei woius, not causeu by a mutation inheiiteu fiom a
paient. We now know that uiffeient genes oi pioteins aie affecteu in the
inheiiteu anu spoiauic foims of ALS. The physicist Stephen Bawking anu
baseball playei Lou uehiig both suffeieu fiom spoiauic ALS.

!"I G+-GM-+C(,) %*FK+K(-(C(&/
0nce the moue of inheiitance of a uisease oi tiait is known, some infeiences
about the genotype of inuiviuuals in a peuigiee can be maue, baseu on theii
phenotypes. uiven these genotypes, it is possible to calculate the piobability of
a paiticulai genotype being inheiiteu in subsequent geneiations. This can be
useful in genetic counseling, foi example when piospective paients wish to
know the likelihoou of theii offspiing inheiiting a uisease foi which they have
a family histoiy.
Piobabilities in peuigiees aie calculateu using the same basic methous as aie
useu in othei fielus. The fiist foimula is the L812=;9 8=?3: the joint piobability
of two inuepenuent events is the piouuct of theii inuiviuual piobabilities; this
is the piobability of one event ANB anothei event occuiiing. Foi example, the
piobability of a iolling a "five" with a single thiow of a single six-siueu uie is
16, anu the piobability of iolling "five" in each of thiee successive iolls is 16
x 16 x 16 = 1216. The seconu useful foimula is the >=0 8=?3, which states
Figure 5.10
Stephen Hawking
P e u i g i e e s & P o p u l a t i o n s | !@N


that the combineu piobability of two inuepenuent events is the sum of theii
inuiviuual piobabilities. This is the piobability of one event 0R anothei event
occuiiing. Foi example, the piobability of iolling a five oi six in a single thiow
of a uice is 16 + 16 = 1S.
With these iules in minu, we can calculate the piobability that two caiiieis (i.e.
heteiozygotes) of an AR uisease will have a chilu affecteu with the uisease as V
x V = , since foi each paient, the piobability of any gametes caiiying the
uisease allele is V. This is consistent with what we alieauy know fiom
calculating piobabilities using a Punnett Squaie (e.g. in a monohybiiu cioss !"
x !", of the offspiing aie "").
We can likewise calculate piobabilities in the moie complex peuigiee shown
in Figuie S.11.

Assuming the uisease has an AR pattein of inheiitance, what is the piobability
that inuiviuual 14 will be affecteu. We can assume that inuiviuuals #1, #2, #S
anu #4 aie heteiozygotes (!"), because they each hau at least one affecteu ("")
chilu, but they aie not affecteu themselves. This means that theie is a 2S
chance that inuiviuual #6 is also !". This is because accoiuing to Nenuelian
inheiitance, when two heteiozygotes mate, theie is a 1:2:1 uistiibution of
genotypes !!:!":"". Bowevei, because #6 is unaffecteu, he can't be "", so he is
eithei !" oi !!, but the piobability of him being !" is twice as likely as !!. By
the same ieasoning, theie is likewise a 2S chance that #9 is a heteiozygous
caiiiei of the uisease allele.
If inuiviuual 6 is a heteiozygous foi the uisease allele, then theie is a V chance
that #12 will also be a heteiozygote (i.e. if the mating of #6 anu #7 is !" !!,
half of the piogeny will be !"; we aie also assuming that #7, who is unielateu,
uoes not caiiy any uisease alleles). Theiefoie, the combineu piobability that
#12 is also a heteiozygote is 2S x 12 = 1S. This ieasoning also applies to
inuiviuual #1S, i.e. theie is a 1S piobability that he is a heteiozygote foi the
uisease. Thus, the oveiall piobability that both inuiviuual #12 anu #1S aie
heteiozygous, anu that a paiticulai offspiing of theiis will be homozygous foi
the uisease alleles is 1S x 1S x 14 = 1S6.

Figure 5.11
Individuals in this
pedigree are labeled with
numbers to make
discussion easier
P e u i g i e e s & P o p u l a t i o n s | !@O

!"! %F%M-+C(F, )&,&C(G/

B5<=83 !"#A
S.S.1 ALLELE FREQ0ENCIES NAY ALS0 BE ST0BIEB 0N TBE P0P0LATI0N
LEvEL
A L1L=?:9516 is a laige gioup of inuiviuuals of the same species, who aie
capable of mating with each othei. It is useful to know the fiequency of
paiticulai alleles within a population, since this infoimation can be useu to
calculate uisease iisks. Population genetics is also impoitant in ecology anu
evolution, since changes in allele fiequencies may be associateu with migiation
oi natuial selection.
When calculating the fiequency of two alleles of the same locus (e.g. !,"), we
use the symbol L to iepiesent the fiequency of the uominant allele within the
population, anu P foi the fiequency of the iecessive allele. Because theie aie
only two possible alleles, we can say that the fiequency of p anu q togethei
iepiesent 1uu% of the alleles in the population (LQPR#).
If we know the genotypes of a iepiesentative sample of inuiviuuals in a
population, we can calculate the values of p anu q by simply counting the
alleles anu uiviuing by the total numbei of alleles examineu; foi a give allele,
homozygotes will count foi twice as much as heteiozygotes. Foi example,
given:
genotype numbei of inuiviuuals
AA S2u
Aa 16u
aa 2u

L = A S++T Q +: U 919:? :??3?3> ;1=6932 = 2(S2u) + 16u 2(S2u) +
2(16u) + 2(2u) = u.8
PR A S::T Q +: U 919:? :??3?3> ;1=6932 = 2(2u) + 16u 2(S2u) +
2(16u) + 2(2u) = u.2



P e u i g i e e s & P o p u l a t i o n s | !@V


S.S.2 BARBY-WEINBERu F0RN0LA
uiven the allele fiequencies within a population we can use an extension of the
Punnett Squaie, anu the piouuct iule, to calculate the expecteu fiequency of
each genotype following matings of the entiie population. This is the basis of
the D:82W@X356Y38< 4180=?:: L
A
Q ALP Q P
A
R#, wheie p
2
is the fiequency of
homozygotes !!, wheie 2pq is the fiequency of the heteiozygotes, anu q
2
is
the fiequency of homozygotes "".
! SLT
# SPT
! SLT $
%

$&
# SPT $&
&
%


Notice that if we substitute the allele fiequencies we calculateu above (p=u.8,
q=u.2) into the foimula L
A
Q ALP Q P
A
R#Z we obtain expecteu piobabilities foi
each of the genotypes that exactly match oui oiiginal obseivations:

p
2
=u.8
2
=u.64 u.64 x Suu = S2u
2pq= 2(u.8)(u.2)=u.S2 u.S2 x Suu = 16u
q
2
=u.2
2
=u.u4 u.u4 x Suu = 2u

This is a uemonstiation of the D:82W@X356Y38< 3P=5?5Y85=0 , which states
that both the genotype fiequencies anu allele fiequencies in a population
iemain unchangeu following successive matings within a population, $% ceitain
conuitions aie met. These conuitions aie listeu in Table S.1. Few natuial
populations actually satisfy all of these conuitions. Neveitheless, laige
populations of many species, incluuing humans, appeai to appioach Baiuy-
Weinbeig equilibiium foi many loci. In these situations, ueviations of a
paiticulai gene fiom Baiuy-Weinbeig equilibiium can be an inuication that
one of the alleles affects the iepiouuctive success of oiganism, foi example
thiough natuial selection oi :>>189:95[3 0:956<.


C:Y?3 !"#" G16259516> 418 973 D:82W@X356Y38< 3P=5?5Y85=0
Ranuom mating: Inuiviuuals of all genotypes mate togethei with equal
fiequency. Assoitative mating, in which ceitain genotypes piefeientially mate
togethei, is a type of non-ianuom mating.
No natuial selection: All genotypes have equal fitness.
No migiation: Inuiviuuals uo not leave oi entei the population.
No mutation: The allele fiequencies uo not change uue to mutation.
Laige population: Ranuom sampling effects in mating (i.e. genetic uiift) aie
insignificant in laige populations.




P e u i g i e e s & P o p u l a t i o n s | !@J
The Baiuy-Weinbeig foimula can also be useu to estimate allele fiequencies,
when only the fiequency of one of the genotypic classes is known. Foi
example, if u.u4% of the population is affecteu by a paiticulai genetic
conuition, anu all of the affecteu inuiviuuals have the genotype aa, then we
assume that q
2
= u.uuu4 anu we can calculate p, q, anu 2pq as follows:

q
2
= u.u4% = u.uuu4
q= &'&&&( = u.u2
p= 1-q = u.98
2pq = 2(u.98)(u.u2) = u.u4

Thus, appioximately 4% of the population is expecteu to be heteiozygous (i.e.
a caiiiei) of this genetic conuition. Note that while we iecognize that the
population is piobably not exactly in Baiuy-Weinbeig equilibiium foi this
locus, application of the Baiuy-Weinbeig foimula neveitheless can give a
ieasonable estimate of allele fiequencies, in the absence of any othei
infoimation.
___________________________________________________________________________________________
/MEE+*.
Peuigiee analysis can be useu to ueteimine the moue of inheiitance of specific
tiaits such as uiseases.
If the moue of inheiitance is known, a peuigiee can be useu to calculate the
piobability of inheiitance of a paiticulai genotype by an inuiviuual.
The fiequencies of all alleles anu genotypes iemain unchangeu thiough
successive geneiations of a population in Baiuy-Weinbeig equilibiium.
Populations in tiue Baiuy-Weinbeig equilibiium have ianuom mating, anu no
genetic uiift, no migiation, no mutation, anu no selection with iespect to the
gene of inteiest.
The Baiuy-Weinbeig foimula can be useu to estimate allele anu genotype
fiequencies given only limiteu infoimation about a population.
\&. C&*E/
moue of inheiitance
genetic counseling
caiiiei
autosomal uominant
autosomal iecessive
X-linkeu uominant
X-linkeu iecessive
piouuct iule
sum iule
population
p+q=1
Baiuy-Weinbeig
foimula
p
2
+ 2pq + q
2
=1
Baiuy-Weinbeig
equilibiium
assoitative mating
ianuom mating
migiation
genetic uiift
___________________________________________________________________________________________

P e u i g i e e s & P o p u l a t i o n s | !@#]



/CM'. ^M&/C(F,/

#" What aie some of the moues of inheiitance that aie consistent with this
peuigiee.


A" In this peuigiee in question 1, the moue of inheiitance cannot be ueteimineu
unamibguously. What aie some examples of uata (e.g. fiom othei geneiations)
that, if auueu to the peuigiee woulu help ueteimine the moue of inheiitance.

H" Foi each of the following peuigiees, name the most likely moue of inheiitance
(AR=autosomal iecessive, AB=autosomal uominant, XR=X-linkeu iecessive,
XB=X-linkeu uominant). (These peuigiees weie obtaineu fiom vaiious
exteinal souices).

a)


b)





P e u i g i e e s & P o p u l a t i o n s | !@##



I. The following peuigiee iepiesents a iaie, autosomal iecessive uisease. What
aie the genotypes of the inuiviuuals who aie inuicateu by letteis.

!. If inuiviuual #1 in the following peuigiee is a heteiozygote foi a iaie, AR
uisease, what is the piobability that inuiviuual #7 will be affecteu by the
uisease. Assume that #2 anu the spouses of #S anu #4 aie not caiiieis.

N" You aie stuuying a population in which the fiequency of inuiviuuals with a
iecessive homozygous genotype is 1%. Assuming the population is in Baiuy-
Weinbeig equilibiium, calculate:
a) The fiequency of the iecessive allele.
b) The fiequency of uominant allele.
c) The fiequency of the heteiozygous phenotype.
u) The fiequency of the homozygous uominant phenotype.


O. Beteimine whethei the following population is in Baiuy-Weinbeig
equilibiium.
genotype numbei of inuiviuuals
!! 4S2
!" 676
b a c e f
g
h i j
k
b a c e f
g
h i j
k
a c e f
g
h
k
P e u i g i e e s & P o p u l a t i o n s | !@#A


"" 92

V. 0ut of 12uu inuiviuuals examineu, 4S2 aie homozygous uominant (!!)foi a
paiticulai gene. What numbeis of inuiviuuals of the othei two genotypic
classes (!") "") woulu be expecteu if the population is in Baiuy-Weinbeig
equilibiium.

J. Piopose an explanation foi the ueviation between the genotypic fiequencies
calculateu in question 8 anu those obseiveu in the table in question 7.
b a c e f
g
h j
k
b a c e f
g
h j
k

The piinciples of genetic analysis that we have uesciibeu foi a single
locus can be extenueu to the stuuy of two genes simultaneously.
Analysis of two genes in paiallel is iequiieu foi genetic mapping anu
can also ieveal gene inteiactions. Befoie uiscussing these techniques,
we will fiist ievisit Nenuel anu his giounubieaking expeiiments.
!"# %&'()*&% +*,--.-
!"#"# %&'(&)*+ +&,-'( )./
Befoie Nenuel, it hau not yet been establisheu that heiitable tiaits weie
contiolleu by uisciete factois. An impoitant question was theiefoie
whethei uistinct tiaits coulu be shown to be contiolleu by factois that
weie inheiiteu inuepenuently. To answei this, Nenuel took two
appaiently unielateu tiaits, such as seeu shape anu seeu coloi, anu
stuuieu theii inheiitance in the same inuiviuuals. Be stuuieu two
vaiiants of each tiait: seeu coloi was eithei gieen oi yellow, anu seeu
shape was eithei iounu oi wiinkleu. When eithei of these tiaits was
stuuieu alone, the phenotypes segiegateu in a S:1 iatio among the
piogeny of a monohybiiu cioss (Figuie 6.2), with of the seeus gieen
anu yellow in one cioss, anu iounu anu wiinkleu in the othei
cioss. To analyze the segiegation of the two tiaits at the same time, he
ciosseu a puie bieeuing line of gieen, wiinkleu peas with a puie
bieeuing line of yellow, iounu peas to piouuce F1 piogeny that weie all
gieen anu iounu, anu which weie also /012340/5; they caiiieu two
alleles at each of two loci (Figuie 6.S),.
Chaptei 6 uENETIC ANALYSIS 0F TW0 L0CI
Figure 6.1 Coat color
in animals is an
example of a trait that
affected by more than
one locus.
T w o L o c i | !67

If the inheiitance of seeu coloi was tiuly inuepenuent of seeu shape,
then when the F1 uihybiius weie ciosseu to each othei, a S:1 iatio of
one tiait shoulu be obseiveu within each phenotypic class of the othei
tiait (Figuie 6.S). 0sing the piouuct law, we woulu theiefoie pieuict
that if of the piogeny weie gieen, anu of the piogeny weie iounu,
then = 916 of the piogeny woulu be both iounu anu gieen
(Table 6.1). Likewise, = S16 of the piogeny woulu be both
iounu anu yellow, anu so on. By applying the piouuct iule to all of
these combinations of phenotypes, we can pieuict a 89:9:9# phenotypic
iatio among the piogeny of a uihybiiu cioss, if ceitain conuitions aie
met, incluuing the inuepenuent segiegation of the alleles at each locus.
Inueeu, 9:S:S:1 is veiy close to the iatio Nenuel obseiveu in his stuuies
of uihybiiu ciosses, leauing him to state his Seconu Law, the ;<= >?
&@/ABA@/A@C D55>4CEA@C, which we now expiess as follows: two loci
assoit inuepenuently of each othei uuiing gamete foimation.

-

Fiequency of phenotypic ciosses within sepaiate monohybiiu ciosses:
seeu shape: iounu wiinkleu
seeu coloi: yellow gieen

Fiequency of phenotypic ciosses within a uihybiiu cioss:
iounu yellow = 916 iounu & yellow
iounu gieen = S16 iounu & gieen
wiinkleu yellow = S16 wiinkleu & yellow
wiinkleu gieen = 116 wiinkleu & gieen


Figure 6.2
Monohybrid crosses
involving two distinct
traits in peas.
Table 6.1 Phenotypic classes expected in monohybrid and dihybrid
crosses for two seed traits in pea.
T w o L o c i | !6:
The 9:S:S:1 phenotypic iatio that we calculateu using the piouuct iule
can also be obtaineu using Punnett Squaie (Figuie 6.4). Fiist, we list
the genotypes of the possible gametes along each axis of the Punnett
Squaie. In a uiploiu with two heteiozygous genes of inteiest, theie aie
up to foui combinations of alleles in the gametes of each paient. The
gametes fiom the iespective iows anu column aie then combineu in the
each cell of the aiiay. When woiking with two loci, genotypes aie
wiitten with the symbols foi both alleles of one locus, followeu by both
alleles of the next locus (e.g. !"#$, not !#"$). Note that the oiuei in
which the loci aie wiitten uoes not imply anything about the actual
position of the loci on the chiomosomes
To calculate the expecteu phenotypic iatios, we assign a phenotype to
each of the 16 genotypes in the Punnett Squaie, baseu on oui
knowleuge of the alleles anu theii uominance ielationships. In the case
of Nenuel's seeus, any genotype with at least one % allele anu one &
allele will be iounu anu yellow; these genotypes aie shown in the nine,
gieen-shaueu cells in Figuie 6.4. We can iepiesent all of foui of the
uiffeient genotypes shown in these cells with the notation (%'&_),
wheie the blank line (__), means "any allele". The thiee offspiing that
have at least one R allele anu aie homozygous iecessive foi ( (i.e. %'(()
will have a iounu, gieen phenotype. Conveisely the thiee piogeny that
aie homozygous iecessive ), but have at least one & allele ())&') will
have wiinkleu, yellow seeus. Finally, the iaiest phenotypic class of
wiinkleu, yellow seeus is piouuceu by the uoubly homozygous
iecessive genotype, ))((, which is expecteu to occui in only one of the
sixteen possible offspiing iepiesenteu in the squaie.



Figure 6.4 A Punnett Square showing the results of the dihybrid
cross from Figure 6.3. Each of the four phenotypic classes is
represented by a different color of shading.
Figure 6.3 Pure-breeding lines are crossed to
produce dihybrids in the F
1
generation. The
cross of these particular dihybrids produces
four phenotypic classes.
T w o L o c i | !6F
*+,+- !//0123456/ 57 389 :;<;<;, %!345
Both the piouuct iule anu the Punnett Squaie appioaches showeu that
a 9:S:S:1 phenotypic iatio is expecteu among the piogeny of a uihybiiu
cioss such as Nenuel's %)&( %)&(. In making these calculations, we
assumeu that: both loci assoit inuepenuently; one allele at each locus is
completely uominant; anu each of foui possible phenotypes can be
uistinguisheu unambiguously, with no inteiactions between the two
genes that woulu altei the phenotypes. Beviations fiom the 9:S:S:1
phenotypic iatio may inuicate that one of moie of these conuitions has
not been met. Nouifieu iatios in the piogeny of a uihybiiu cioss can
theiefoie ieveal useful infoimation about the genes involveu. ;0@G<HA
is one of the most impoitant ieasons foi uistoition of the iatios
expecteu fiom inuepenuent assoitment. Linkeu genes aie locateu close
togethei on the same chiomosome, which affects which combinations
of alleles assoit togethei most fiequently. We will ietuin to the concept
of linkage in Chaptei 7. Beviations fiom 9:S:S:1 iatios can also be uue
to inteiactions between genes; these inteiactions will be uiscusseu
thioughout the iemainuei of this chaptei. Foi simplicity, we will focus
on examples that involve easily scoieu phenotypes, such as
pigmentation. Neveitheless, keep in minu that the analysis of
segiegation iatios can pioviue insight into a wiue iange of biological
piocesses.
!"7 .I&-JD-&- DK% ,J'.* L.K. &KJ.*D+J&,K-
Some uihybiiu ciosses piouuce a phenotypic iatio that uiffeis fiom
9:S:S:1 because of epistasis. Epistasis (which means "stanuing upon")
occuis when the phenotype of one locus masks the phenotype of
anothei locus. Thus, following a uihybiiu cioss with epistasis, fewei
than foui phenotypic classes will be obseiveu, with iatios such as 9:S:4,
12:S:1, 9:7, oi 1S:1. Note that each of these mouifieu iatios can be
obtaineu by summing one oi moie of the 9:S:S:1 classes expecteu fiom
oui oiiginal uihybiiu cioss. In the following paiagiaphs, we will look at
some mouifieu phenotypic iatios obtaineu fiom uihybiiu ciosses anu
what they might tell us about inteiactions between genes.


Figure 6.5 Labrador
Retrievers with
different coat colors:
(from left to right)
black, chocolate,
yellow
T w o L o c i | !6M
*+-+, %9=9//4>9 924/3!/4/
As we have alieauy uiscusseu, in the absence of epistasis, theie aie foui
phenotypic classes among the piogeny of a uihybiiu cioss. The foui
phenotypic classes coiiesponu to the genotypes: !'#'? !'$$? ""#'? anu
""$$. If eithei of the singly homozygous iecessive genotypes (i.e. !'$$
oi ""#') has the same phenotype as the uouble homozygous iecessive
(""$$), then a 89:9F phenotypic iatio will be obtaineu. Foi example, in
the Labiauoi Retiievei bieeu of uogs (Figuie 6.S), the B locus encoues a
gene foi an impoitant step in the piouuction of melanin. The uominant
allele, # is moie efficient at pigment piouuction than the iecessive $
allele, thus #_ haii appeais black, anu $$ haii appeais biown. A seconu
locus, which we will call !, iegulates the piouuction of melanin. At
least one functional ! allele is iequiieu to piouuce any pigment,
whethei it is black oi biown. Thus, all ietiieveis that aie "" fail to
piouuce any melanin (anu so appeai pale yellow), iegaiuless of the
genotype at the # locus (Figuie 6.6). The "" genotype is theiefoie saiu
to be epistatic to both the B anu b alleles, since the homozygous ""
phenotype masks the phenotype of the B locus. Because the masking
allele is in this case is iecessive, this is calleu 4ANA550OA AB05C<505.

!
"
0
"
0

(
-
%
1
'
.
'
2

&
3



Figure 6.6 Genotypes and phenotypes among the progeny of a dihybrid cross of
Labrador Retrievers heterozygous for two loci affecting coat color. The
phenotypes of the progeny are indicated by the shading of the cells in the table:
black coat (black, A_B_); chocolate coat (brown, A_bb); yellow coat (yellow,
aaB_ or aabb).

T w o L o c i | !6!
*+-+- @5146!63 924/3!/4/
In some cases, a uominant allele at one locus may mask the phenotype of a
seconu locus. This is calleu />E0@<@C AB05C<505, which piouuces a
segiegation iatio such as #79:9#, which can be vieweu as a mouification of
the 9:S:S:1 iatio in which the !'#' class is combineu with one of the othei
genotypic classes that contains a uominant allele. 0ne of the best known
examples of a 12:S:1 segiegation iatio is fiuit coloi in some types of squash
(Figuie 6.7). Alleles of a locus that we will call # piouuce eithei yellow (#_)
oi gieen ($$) fiuit. Bowevei, in the piesence of a uominant allele at a seconu
locus that we call !, no pigment is piouuceu at all, anu fiuit aie white. The !
allele is theiefoie epistatic to both # anu $$ combinations (Figuie 6.8). 0ne
possible biological inteipietation of this segiegation pattein is that the
function of the ! allele somehow blocks an eaily stage of pigment synthesis,
befoie eithei yellow oi gieen pigments aie piouuceu.








*+-+< @02A4=!39 B969 !=3456
When a uihybiiu cioss piouuces piogeny in two phenotypic classes in a
1S:1 iatio, this can be because the two loci have ieuunuant functions
within the same biological pathway. Yet anothei pigmentation pathway, in
this case coloi of some seeus, pioviues an example of this /PBQ0N<CA
HA@A <NC0>@. The biosynthesis of ieu pigment neai the suiface of some
seeus (Figuie 6.9) involves many genes, two of which we will label !
anu #. Noimal, ieu coloiation of the seeus is maintaineu if function of
eithei of these genes is lost in a homozygous mutant (e.g. in eithei ""#'
oi !'$$). 0nly the uoubly iecessive mutant (""$$), which lacks
function of both genes, shows a phenotype that uiffeis fiom that
piouuceu by any of the othei genotypes (Figuie 6.1u). A ieasonable
inteipietation of this iesult is that both genes encoue the same
biological function, anu eithei one alone is sufficient foi the noimal
activity of that pathway.

Figure 6.7 Green, yellow, and
white fruits of squash.


Figure 6.8 Genotypes and phenotypes among
the progeny of a dihybrid cross of squash plants
heterozygous for two loci affecting fruit color.
T w o L o c i | !6R





*+-+C =512A91963!%& B969 !=3456
The piogeny of a uihybiiu cioss may piouuce just two phenotypic
classes, in an appioximately 89R iatio. An inteipietation of this iatio is
that the loss of function of eithei ! oi # gene function has the same
phenotype as the loss of function of both genes, uue to N>EBQAEA@C<42
HA@A <NC0>@ (meaning that the functions of both genes woik togethei
to piouuce a final piouuct). Foi example, consiuei a simple
biochemical pathway in which a coloiless substiate is conveiteu by the
action of gene A to anothei coloiless piouuct, which is then conveiteu
by the action of gene B to a visible pigment (Figuie 6.9). Loss of
function of eithei A oi B, oi both, will have the same iesult: no pigment
piouuction. Thus !'$$, ""#', anu ""$$ will all be coloiless, while only
!'#' genotypes will piouuce pigmenteu piouuct (Figuie 6.1u). The
mouifieu 9:7 iatio may theiefoie be obtaineu when two genes act
togethei in the same biochemical pathway, anu when theii loss of
function phenotypes aie inuistinguishable fiom each othei oi fiom the
loss of both genes.




Figure 6.9 Red (left) and white (right)
seeds. cropwatch.unl.edu
Figure 6.10 Genotypes and phenotypes
among the progeny of a dihybrid cross of
plants heterozygous for two loci affecting
seed color.
Figure 6.11 A simplified biochemical pathway showing complementary gene action of A and B.
Note that in this case, the same phenotypic ratios would be obtained if gene B acted before gene A
in the pathway
T w o L o c i | !6S



__________________________________________________________________________________
-TUUD*(
The alleles of uiffeient genes aie inheiiteu inuepenuently of each
othei, unless they aie genetically linkeu.
The expecteu phenotypic iatio of a uihybiiu cioss is 9:S:S:1,
except in cases of linkage oi gene inteiactions that mouify this
iatio.
Epistasis occuis when the phenotype of one gene masks the
phenotype of anothei gene. This usually inuicates that the two
genes inteiact within the same biological pathway.
V.( J.*U-
Nenuel's Seconu
Law
uihybiiu
inuepenuent
assoitment
linkage
epistasis
iecessive epistasis
uominant epistasis
complementaiy
action
ieuunuancy
uuplicate gene
action

Figure 6.12
Genotypes and
phenotypes among the
progeny of a dihybrid
cross of a hypothetical
plant heterozygous for
two loci affecting
flower color.
T w o L o c i | !68

-JT%( WT.-J&,K-
Answei questions 6.1 -6.S using the
following biochemical pathway foi fiuit
coloi. Assume all mutations (lowei case
allele symbols) aie iecessive, anu that
DEFGD) piecuisoi 1 oi piecuisoi 2 can be
useu to piouuce piecuisoi S. If the
alleles foi a paiticulai gene aie not
listeu in a genotype, you can assume
that they aie wilu-type.

!"# If 1 anu 2 anu S aie all coloiless, anu 4
is ieu, what will be the phenotypes
associateu with the following
genotypes.
a) ""
b) $$
c) HH
u) ""$$
e) ""HH
f) $$HH
g) ""$$HH
h) What will be the phenotypic iatios
among the offspiing of a cioss
!"#$ !"#$.
i) What will be the phenotypic iatios
among the offspiing of a cioss
#$@H #$@H.
j) What will be the phenotypic iatios
among the offspiing of a cioss
!"@H !"@H.



!"7 If 1 anu 2 aie both coloiless, anu S is
blue anu 4 is ieu, what will be the
phenotypes associateu with the
following genotypes.
a) ""
b) $$
c) HH
u) ""$$
e) ""HH
f) $$HH
g) ""$$HH
h) What will be the phenotypic
iatios among the offspiing of a
cioss !"#$ !"#$.
i) What will be the phenotypic
iatios among the offspiing of a
cioss #$@H #$@H.
j) What will be the phenotypic
iatios among the offspiing of a
cioss !"@H !"@H.

!": If 1 is coloiless, 2 is yellow anu S is
blue anu 4 is ieu, what will be the
phenotypes associateu with the
following genotypes.

a) ""
b) $$
c) HH
u) ""$$
e) ""HH
f) $$HH
g) ""$$HH
h) What will be the phenotypic
iatios among the offspiing of a
cioss !"#$ !"#$.
i) What will be the phenotypic
iatios among the offspiing of a
cioss #$@H #$@H.
D
#
:
F
T w o L o c i | !6#X
j) What will be the phenotypic
iatios among the offspiing of a
cioss !"@H !"@H.

!"F Which of the situations in questions
6.1 - 6.S uemonstiate epistasis.


!"M If the genotypes wiitten within the
Punnett Squaie aief iom the F2
geneiation, what woulu be the
phenotypes anu genotypes of the F1
anu P geneiations foi:
<Y Figuie 6.6
3Y Figuie 6.8
NY Figuie 6.1u
/Y Figuie 6.12

!"! To bettei unueistanu how genes contiol
the uevelopment of thiee-uimensional
stiuctuies, you conuucteu a mutant
scieen in Aiabiuopsis anu iuentifieu a
iecessive point mutation allele of a
single gene (!) that causes leaves to
uevelop as naiiow tubes iathei than the
bioau flat suifacesthat uevelop in
wilu-type ("). Allele ! causes a
complete loss of function. Now you
want to iuentify moie genes involveu in
the same piocess. Biagiam a piocess
you coulu use to iuentify othei genes
that inteiact with gene !. Show all of the
possible genotypes that coulu aiise in
the F1 geneiation.

!"R With iefeience to question 6.6, if the
iecessive allele, I is mutateu again to
make allele IJ, what aie the possible
phenotypes of a homozygous IJ IJ
inuiviuual.

!"S Again, in iefeience to question 6.7, what
aie the possible phenotypes of a
homozygous $$!! inuiviuual, wheie $ is
a iecessive allele of a seconu gene. In
each case, also specify the phenotypic
iatios that woulu be obseiveu among
the F1 piogeny of a cioss of %$"! x %$"!

!"8 Calculate the phenotypic iatios fiom a
uihybiiu cioss involving the two loci
shown in Figuie 6.1S. Theie may be
moie than one possible set of iatios,
uepenuing on the assumptions you
make about the phenotype of allele $.

!"#X 0se the piouuct iule to calculate the
phenotypic iatios expecteu fiom a
tiihybiiu cioss. Assume inuepenuent
assoitment anu no epistasisgene
inteiactions.








!"#" %&'()*+
As we leaineu in Chaptei 6, Nenuel iepoiteu that the paiis of genes he
obseiveu behaveu inuepenuently of each othei; foi example, the segiegation of
seeu coloi alleles was inuepenuent fiom the segiegation of alleles foi seeu
shape. This obseivation was the basis foi his Seconu Law, anu contiibuteu
gieatly to oui unueistanuing of heieuity. Bowevei, fuithei ieseaich showeu
that Nenuel's Seconu Law uiu not apply to eveiy paii of genes that coulu be
stuuieu. In fact, we now know that alleles of genes that aie locateu close
togethei on the same chiomosome tenu to be inheiiteu togethei. This
phenomenon is calleu ,-./012, anu is a majoi exception to Nenuel's Seconu
Law. 0nueistanuing linkage is impoitant to natuial piocesses of heieuity anu
evolution, anu we will leain how ieseaicheis use linkage to ueteimine the
location of genes along chiomosomes in a piocess calleu genetic mapping.

!"3 4+5678&')9&6'
Recombination is teim that is useu in seveial uiffeient contexts in genetics. In
iefeience to heieuity, :2;<=>-.0?-<. is uefineu as any piocess that iesults in
gametes with combinations of alleles that weie not piesent in the gametes of a
pievious geneiation (see Figuie 7.2). Recombination may occui eithei thiough
ianuom assoitment of alleles that aie on uiffeient chiomosomes, oi thiough
;:<@@<A2:@ between loci on the same chiomosomes (as uesciibeu below). It
is impoitant to iemembei that in both of these cases, iecombination is a
Chaptei 7 LINKAuE & NAPPINu
Figure 7.1 Linkage affects
the frequency at which some
combinations of traits are
observed.
L i n k a g e | !B3
piocess that occuis uuiing meiosis (mitotic iecombination may also occui in
some species, but it is ielatively iaie). If meiosis iesults in iecombination, the
piouucts aie saiu to have a :2;<=>-.0.? genotype. 0n the othei hanu, if no
iecombination occuis uuiing meiosis, the piouucts aie saiu to have a non-
iecombinant, oi C0:2.?0, genotype. Recombination is impoitant because it
contiibutes to the vaiiation that may be obseiveu between inuiviuuals within a
population.

As an example of iecombination, consiuei loci on two uiffeient chiomosomes
as shown in Figuie 7.2. We know that if these loci aie on uiffeient
chiomosomes, theie aie no physical connections between them, so they aie
D.,-./2E anu will segiegate inuepenuently as uiu Nenuel's tiaits. When loci
aie unlinkeu, can we pieuict which combinations of alleles will segiegate
togethei in any given meiosis. No, not with ceitainty: the segiegation
uepenus on the ielative oiientation of each paii of chiomosomes at metaphase.
Since the oiientation is ianuom anu inuepenuent of othei chiomosomes, each
of the aiiangements (anu theii meiotic piouucts) is equally possible foi two
unlinkeu loci as shown in Figuie 7.2. Noie piecisely, theie is a Su%
piobability of iecombinant genotypes, anu a Su% piobability of paiental
genotypes within the gametes piouuceu by unlinkeu loci. Inueeu, if we
examineu all of the gametes piouuceu by this inuiviuual (which aie the
piouucts of multiple inuepenuent meioses), we woulu note that appioximately
Su% of the gametes woulu be iecombinant, anu Su% woulu be paiental.
42;<=>-.0?-<. F:2GD2.;H is simply the numbei of iecombinant gametes,
uiviueu by the total numbei of gametes. A fiequency of appioximately Su%
iecombination is theiefoie a uefining chaiacteiistic of unlinkeu loci.

Figure 7.2 When two loci are on non-homologous chromosomes, their alleles will segregate in
combinations identical to those present in the parental gametes (Ab, aB), and in recombinant
genotypes (AB, ab) that are different from the parental gametes. Not all of the identical products of
each meiosis are shown here.

L i n k a g e | !BI


!"I %&'()*+ JKLL4+JJ+J 4+5678&')9&6'
Baving consiueieu unlinkeu loci, let us tuin to the opposite situation, in which
two loci aie so close togethei on a chiomosome that the paiental combinations
of alleles always segiegate togethei (Figuie 7.S). This is because alleles at the
two loci aie physically attacheu anu so they always follow each othei into the
same gamete. In this case, no iecombinants will be uetecteu following meiosis,
anu the iecombination fiequency will be u%. 5<=C,2?2 ,-./012 is iaie, as
the loci must be so close togethei that ciossoveis aie nevei uetecteu between
them.


!"M 546JJ6N+4J )%%6O 4+5678&')9&6' 8+9O++' %&'(+P %65&
Thus fai, we have only consiueieu situations with eithei no linkage (Su%
iecombination) oi else complete linkage (u% iecombination). It is also
possible to obtain iecombination fiequencies between u% anu Su%, which is
a situation we call paitial linkage oi -.;<=C,2?2 ,-./012. Incomplete linkage
occuis when two loci aie locateu on the same chiomosome (i.e. they aie
physically linkeu), but the loci aie fai enough apait so that ciossoveis occui
between them uuiing some, but not all, meioses.

Ciossoveis occui uuiing piophase I of meiosis, when paiis of homologous
chiomosomes have aligneu with each othei in a piocess calleu @H.0C@-@.
Ciossing ovei begins with the uouble-stianu bieakage of a paii of non-sistei
chiomatius. The bieaks usually occui at coiiesponuing positions on two
chiomatius, anu then the bioken enus of non-sistei chiomatius aie connecteu
to each othei iesulting in a iecipiocal exchange of uouble-stianueu BNA
(Figuie 7.4). ueneially eveiy paii of chiomosomes has at least one (anu
often moie) ciossoveis uuiing meioses (Figuie 7.S)


Figure 7.3 If two loci are
completely linked, their
alleles will segregate in
combinations identical to
those present in the parental
gametes (Ab, aB). No
recombinants will be
observed.

Figure 7.4 A depiction of a
crossover from Morgans
1916 manuscript. Only one
pair of non-sister chromatids
is shown.

L i n k a g e | !BM



Because the location of ciossoveis is essentially ianuom, the gieatei the
uistance between two loci, the moie likely it is that a ciossovei will occui
between them. Fuitheimoie, loci that aie on the same chiomosome, but aie
sufficiently fai apait fiom each othei, will have ciossoveis so often that they
will behave as though they aie completely unlinkeu. A iecombination
fiequency of Su% is theiefoie the maximum iecombination fiequency that can
be obseiveu, anu is inuicative of loci that aie eithei on sepaiate chiomosomes,
oi aie locateu veiy fai apait on the same chiomosome.

!"Q &'R+44&'* 4+5678&')9&6' R467 *+'+9&5 P)9)
In the pieceuing examples, we hau the auvantage of knowing the
appioximate chiomosomal positions of each allele involveu, befoie we
calculateu the iecombination fiequencies. Knowing this infoimation
befoiehanu maue it ielatively easy to uefine the paiental anu iecombinant
genotypes, anu to calculate iecombination fiequencies. Bowevei, in most
expeiiments, we cannot uiiectly examine the chiomosomes, oi even the
gametes, so we must infei the aiiangement of alleles fiom the phenotypes
ovei two oi moie geneiations. Impoitantly, it is geneially not sufficient to
know the genotype of inuiviuuals in just one geneiation; foi example, given
an inuiviuual with the genotype !"#$, we uo not know fiom the genotype
alone whethei the loci aie locateu on the same chiomosome, anu if so,
whethei the aiiangement of alleles on each chiomosome is oi !# anu "$
(also calleu the ;-@ , oi ;<DC,-.1 aiiangement; Figuie 7.6) oi !$ anu "#
(?:0.@, oi :2CD,@-<.)&

Figure 7.5 A crossover between two linked loci can generate recombinant genotypes (AB,
ab), from the chromatids involved in the crossover. Remember that multiple, independent
meioses occur in each organism, so this particular pattern of recombination may not be
observed among all the gametes from this individual.


Figure 7.6 Alleles in cis
configuration (top) or
trans configuration
(bottom).

L i n k a g e | !BQ

Foitunately foi geneticists, the aiiangement of alleles can sometimes be
infeiieu if the genotypes of a pievious geneiation aie known. Foi example, if
the paients of !"#$ hau genotypes !!#B anu ""$$ iespectively, then the
paiental gametes that fuseu to piouuce !"#$ woulu have been genotype !#
anu genotype "$. Theiefoie, piioi to meiosis in the uihybiiu, the aiiangement
of alleles woulu likewise be !# anu "$ (Figuie 7.7). Conveisely, if the paients
of !"#$ hau genotypes ""## anu !!$$, then the aiiangement of alleles on the
chiomosomes of the uihybiiu woulu be "# anu !$. Thus, the genotype of the
pievious geneiation can ueteimine which of an inuiviuual's gametes aie
consiueieu iecombinant, anu which aie consiueieu paiental.

Let us now consiuei a complete expeiiment in which oui objective is to
measuie iecombination fiequency (Figuie 7.8). We neeu at least two alleles
foi each of two genes, anu we must know which combinations of alleles weie
piesent in the paiental gametes. The simplest way to uo this is to stait with
Figure 7.7 The genotype of gametes can be inferred unambiguously if the gametes are produced by
homozygotes. However, recombination frequencies can only be measured among the progeny of
heterozygotes (i.e. dihybrids). Note that the dihybrid on the left contains a different configuration of alleles
than the dihybrid on the rightdue to differences in the genotypes of their respective parents. Therefore,
different gametes are defined as recombinant and parental among the progeny of the two dihybrids. In the
cross at left, the recombinant gametes will be genotype AB and ab, and in the cross on the right, the
recombinant gametes will be Ab and aB

L i n k a g e | !BS
puie-bieeuing lines that have contiasting alleles at two loci. Foi example, we
coulu cioss shoit-taileu mice, biown mice (""##) with long-taileu, white mice
(!!$$). Baseu on the genotypes of the paients, we know that the paiental
gametes will be "# oi !$ (but not "$ oi !#), anu all of the piogeny will be
uihybiius, !"#$. We uo not know at this point whethei the two loci aie on
uiffeient paiis of homologous chiomosomes, oi whethei they aie on the same
chiomosome, anu if so, how close togethei they aie.




The iecombination events that may be uetecteu will occui uuiing meiosis in
the uihybiiu inuiviuual. If the loci aie completely oi paitially linkeu, then piioi
to meiosis, alleles "# will be locateu on one chiomosome, anu alleles !$ will be
on the othei chiomosome (baseu on oui knowleuge of the genotypes of the
gametes that piouuceu the uihybiiu). Thus, iecombinant gametes piouuceu by
the uihybiiu will have the genotypes "$ oi !#, anu non-iecombinant (i.e.
paiental) gametes will have the genotypes "# oi !$.

Bow uo we ueteimine the genotype of the gametes piouuceu by the uihybiiu
inuiviuual. The most piactical methou is to use a testcioss (Figuie 7.8), in
othei woius to mate !"#$ to an inuiviuual that has only iecessive alleles at
both loci (""$$). This will give a uiffeient phenotype in the F2 geneiation foi
each of the foui possible combinations of alleles in the gametes of the uihybiiu.
We can then infei unambiguously the genotype of the gametes piouuceu by
the uihybiiu inuiviuual, anu theiefoie calculate the iecombination fiequency
between these two loci. Foi example, if only two phenotypic classes weie
obseiveu in the F2 (i.e. shoit tails anu biown fui (""#$), anu white fui with
long tails (!"$$) we woulu know that the only gametes piouuceu following
meiosis of the uihybiiu inuiviuual weie of the paiental type: "# anu !$, anu the
iecombination fiequency woulu theiefoie be u%. Alteinatively, we may
obseive multiple classes of phenotypes in the F2 in iatios such as shown in
Table 7.1:
Figure 7.8 An experiment to
measure recombination
frequency between two loci.
The loci affect coat color
and tail length.
L i n k a g e | !B!

tail
phenotype
fui
phenotype
numbei
of
piogeny
gamete
fiom
uihybiiu
genotype
of F2 fiom
test cioss
(P)aiental oi
(R)ecombinant
shoit biown 48 "# ""#$ P
long white 42 !$ !"$$ P
shoit white 1S "$ ""$$ R
long biown 17 !# !"#$ R




uiven the uata in Table 7.1, the calculation of iecombination fiequency is
stiaightfoiwaiu:

iecombination fiequency = numbei of iecombinant gametes
total numbei of gametes scoieu

R.F. = ____1S+17_____
48+42+1S+17

= 2S %


!"S *+'+9&5 7)LL&'*
Because the fiequency of iecombination between two loci (up to Su%) is
piopoitional to the chiomosomal uistance between them, we can use
iecombination fiequencies to piouuce genetic maps. The units of genetic
uistance aie calleu centiNoigans (cN, also calleu map units), in honoi of
Thomas Bunt Noigan. We can easily conveit iecombination fiequencies to
cN: the iecombination fiequency in peicent is the same as the map uistance in
cN. Foi example, if two loci have a iecombination fiequency of 2S% they aie
saiu to be 2ScN apait on a chiomosome (Figuie 7.9). Note that the map
uistance of two loci alone uoes not tell us anything about the oiientation of
these loci ielative to othei featuies on the chiomosome.


Nap uistances aie always calculateu foi one paii of loci at a time. Bowevei, by
combining the iesults of multiple calculations, a genetic map of many loci on a
chiomosome can be piouuceu (Figuie 7.1u). A genetic map shows the map
uistance, in cN, that sepaiates any two loci, anu the position of these loci
ielative to all othei mappeu loci. The map uistance ioughly piopoitional to the
physical uistance, i.e. the amount of BNA between two loci. Foi example, in
Aiabiuopsis, 1.u cN coiiesponus to appioximately 1Su,uuubp anu contains
Table 7.1 An example of
quantitative data that may be
observed in a genetic
mapping experiment
involving two loci. The data
correspond to the F
2

generation in the cross
shown in Figure 7.8.

Figure 7.9 Two genetic
maps consistent with a
recombination
frequency of 25%
between A and B.

L i n k a g e | !BT
appioximately Su genes. The exact numbei of BNA bases in a cN uepenus on
the oiganism, anu on the paiticulai position in the chiomosome; some paits of
chiomosomes ("hot spots") have slightly highei iates of iecombination than
otheis.

When a novel gene is iuentifieu by mutation oi polymoiphism, its appioximate
position on a chiomosome can be ueteimineu by ciossing it with pieviously
mappeu genes, anu then calculating the iecombination fiequency. If the novel
gene anu the pieviously mappeu genes show complete oi paitial linkage, the
iecombination fiequency will inuicate the appioximate position of the novel
gene within the genetic map. This infoimation is useful in isolating (i.e.
cloning) the specific fiagment of BNA that encoues the novel gene, thiough a
piocess calleu map-baseu cloning. uenetic maps aie also useful in bieeuing
ciops anu animals, in stuuying evolutionaiy ielationships between species, anu
in ueteimining the causes anu inuiviuual susceptibility of some human
uiseases.












Figure 7.10 Genetic maps
for regions of two
chromosomes from two
species of the moth,
Bombyx. The scale at left
shows distance in cM, and
the position of various loci
is indicated on each
chromosome. Diagonal
lines connecting loci on
different chromosomes show
the position of
corresponding loci in
different species
L i n k a g e | !BU

uenetic maps aie useful tools, but genetic map uistances aie only an
appioximation of the actual physical uistance between loci. The coiielation
between iecombination fiequency anu chiomosomal uistance is moie accuiate
foi shoit uistances than long uistances. 0bseiveu iecombination fiequencies
between two ielatively uistant maikeis tenu to unueiestimate the actual
numbei of ciossoveis that occuiieu. This is because as the uistance between
loci incieases, so also incieases the possibility of having two ciossoveis occui
between the loci. This is a pioblem foi geneticists, because with iespect to the
loci being stuuieu, these uouble-ciossoveis piouuce gametes with the same
genotypes as if no iecombination events hau occuiieu (Figuie 7.11).
Reseaicheis will sometimes use specific mathematical functions to aujust
laige iecombination fiequencies to account foi the possibility of multiple
ciossoveis.
!"! 7)LL&'* O&9V 9V4++BL6&'9 546JJ+J
A paiticulaily efficient methou of mapping genes is the ?W:22BC<-.? ;:<@@,
which allows the oiuei anu uistance between thiee potentially linkeu genes to
be ueteimineu in a single expeiiment (Figuie 7.12). The basic stiategy is the
same as foi the uihybiiu mapping expeiiment uesciibeu above; puie bieeuing
lines with contiasting genotypes aie ciosseu to piouuce an inuiviuual
heteiozygous at thiee loci (a tiihybiiu), which is then testciosseu to ueteimine
the iecombination fiequency between each paii of genes.

0ne useful featuie of the thiee-point cioss is that the oiuei of the loci ielative
to each othei can usually be ueteimineu by a simple visual inspection of the F2
segiegation uata. If the genes aie linkeu, theie will often be two phenotypic
classes that aie much moie infiequent than any of the otheis. In these cases,
the iaie phenotypic classes aie usually those that aiose fiom two ciossovei
events, in which the locus in the miuule is flankeu by a ciossovei on eithei siue
of it. Thus, among the two iaiest iecombinant phenotypic classes, the one
allele that uiffeis fiom the othei two alleles ielative to the paiental genotypes
likely iepiesents the locus that is in the miuule of the othei two loci. Foi
example, baseu on the phenotypes of the puie-bieeuing paients in Figuie 7.12,
the paiental genotypes aie "#' anu !$' (iemembei the oiuei of the loci is
unknown, anu it is not necessaiily the alphabetical oiuei in which we wiote
the genotypes). Because we can ueuuce fiom the outcome of the testcioss
(Table 7.2) that the iaiest genotypes weie "$' anu !#(, we can concluue that
locus ! that is most likely locateu between the othei two loci, since it woulu
iequiie a iecombination event between both ! anu # anu between ! anu ' in
oiuei to geneiate these gametes. Thus, the oiuei of loci is #!' (which is
equivalent to '!#).







Figure 7.11 A double
crossover between two loci
(bottom) will produce
gametes with parental
genotypes (with respect to
these loci).
L i n k a g e | !B#X






















Figure 7.12 A three point cross for loci affecting tail length, fur color, and whisker
length.
tail
phenotype
fui
phenotype
whiskei
phenotype
numbei
of
piogeny
gamete
fiom
tiihybiiu
genotype
of F2
fiom test
cioss
loci
A,
B
loci
A,
C
loci
B,
C
shoit biown long S "#' ""#$'( P R R
long white long S8 !$' !"$$'( P P P
shoit white long 1 "$' ""$$'( R R P
long biown long 16 !#' !"#$'( R P R
shoit biown shoit 42 "#( ""#$(( P P P
long white shoit S !$( !"$$(( P R R
shoit white shoit 12 "$( ""$$(( R P R
long biown shoit 1 !#( !"#$(( R R P
L i n k a g e | !B##
90>,2 !"3 An example of uata that might be obtaineu fiom the F2 geneiation of
the thiee-point cioss shown in Figuie 7.12. The iaiest phenotypic classes
coiiesponu to uouble iecombinant gametes !#( anu "$'. Each phenotypic
class anu the gamete fiom the tiihybiiu that piouuceu it can also be classifieu
as paiental (P) oi iecombinant (R) with iespect to each paii of loci (A,B), (A,C),
(B,C) analyzeu in the expeiiment.


Recombination fiequencies may be calculateu foi each paii of loci in the thiee-
point cioss as we uiu befoie foi one paii of loci in oui uihybiiu (Figuie 7. 8)


loci A,B R.F. = ___1+16+12+1__ = 2S%
12u

loci A,C R.F. = ___ 1+S+1+S_ _ = 1u%
12u

loci B,C R.F. = ___S+16+12+S__ = S2%
(not coiiecteu foi uouble 12u
ciossoveis)



Bowevei, note that in the thiee point cioss, the sum of the uistances between
A-B anu A-C (SS%) is less than the uistance calculateu foi B-C (S2%)(Figuie
7.1S). this is because of uouble ciossoveis between B anu C, which weie
unuetecteu when we consiueieu only paiiwise uata foi B anu C. We can easily
account foi some of these uouble ciossoveis, anu incluue them in calculating
the map uistance between B anu C, as follows. We alieauy ueuuceu that the
map oiuei must be #!' (oi '!#), baseu on the genotypes of the two iaiest
phenotypic classes in Table 7.2. Bowevei, these uouble iecombinants, !#( anu
"$') weie not incluueu in oui calculations of iecombination fiequency
between loci # anu '. If we incluueu these uouble iecombinant classes
(multiplieu by 2, since they each iepiesent two iecombination events), the
calculation of iecombination fiequency between B anu C is as follows, anu the
iesult is now moie consistent with the sum of map uistances between A-B anu
A-C.


loci B,C R.F. = _S+16+12+S+2(1)+2(1) = SS%
(coiiecteu foi uouble 12u
iecombinants)


Thus, the thiee point cioss was useful foi ueteimining the oiuei of thiee loci
ielative to each othei, calculating map uistances between the loci, anu
uetecting some of the uouble ciossovei events that woulu otheiwise leau to an
unueiestimation of map uistance. Bowevei, it is possible that othei, uouble

Figure 7.13 Equivalent
maps based on the data in
Table 7.2 (without
correction for double
crossovers).
L i n k a g e | !B#3
ciossoveis events iemain unuetecteu, foi example uouble ciossoveis between
loci A,B oi between loci A,C. ueneticists have uevelopeu a vaiiety of
mathematical pioceuuies to tiy to coiiect foi things like uouble ciossoveis
uuiing laige-scale mapping expeiiments.
L i n k a g e | !B#I

___________________________________________________________________________________________
JK77)4Y
Recombination is uefineu as any piocess that iesults in gametes with
combinations of alleles that weie not piesent in the gametes of a
pievious geneiation.
The iecombination fiequency between any two loci uepenus on theii
ielative chiomosomal locations.
0nlinkeu loci show a maximum Su% iecombination fiequency.
Loci that aie close togethei on a chiomosome aie linkeu anu tenu to
segiegate with the same combinations of alleles that weie piesent in
eithei paient.
Ciossoveis aie a noimal pait of most meioses, anu allow foi
iecombination between linkeu loci.
Neasuiing iecombination fiequency is easiest when staiting with puie-
bieeuing lines with two alleles foi each locus, anu with suitable lines
foi test ciossing.
Because iecombination fiequency is piopoitional to the uistance
between loci, iecombination fiequencies can be useu to cieate genetic
maps.
Recombination fiequencies tenu to unueiestimate map uistances,
especially ovei long uistances, since uouble ciossoveis may be
genetically inuistinguishable fiom non-iecombinants.
Thiee-point ciosses can be useu to ueteimine the oiuei anu map
uistance between of thiee loci, anu can coiiect foi some of the uouble
ciossoveis between the two outei loci.

(+Y 9+47J

linkage
iecombination
ciossovei
iecombinant
paiental
linkeu
unlinkeu
complete linkage
iecombination fiequency
synapsis
cis
coupling
tians
iepulsion
cN
linkage map
genetic map


L i n k a g e | !B#M
J9KPY ZK+J9&6'J

!"# Compaie iecombination anu ciossovei.
Bow aie these similai. Bow aie they
uiffeient.

!"3 Explain why it usually necessaiy to stait
with puie-bieeuing lines when measuiing
genetic linkage by the methous piesenteu in
this chaptei.

!"I If you knew that a locus that affecteu
eailobe shape was tightly linkeu to a locus
that affecteu susceptibility to caiuiovasculai
uisease human, unuei what ciicumstances
woulu this infoimation be clinically useful.

!"M In a pievious chaptei, we saiu a 9:S:S:1
phenotypic iatio was expecteu among the
piogeny of a uihybiiu cioss, in absence of
gene inteiaction.
0[ What uoes this iatio assume about the
linkage between the two loci in the uihybiiu
cioss.
>[ What iatio woulu be expecteu if the loci
weie completely linkeu. Be suie to consiuei
eveiy possible configuiation of alleles in the
uihybiius.

!"Q uiven a uihybiiu with the genotype
'(*+:
0[ If the alleles aie in cis-configuiation, what
will be the genotypes of the paiental anu
iecombinant piogeny fiom a test-cioss.
>[ If the alleles aie in tians-configuiation,
what will be the genotypes of the paiental
anu iecombinant piogeny fiom a test-cioss.

!"S Imagine that white floweis aie
iecessive to puiple floweis, anu gieen seeus
aie iecessive to yellow seeus. If a yellow-
seeueu, puiple-floweieu plant is testciosseu,
anu half of the piogeny have gieen seeus
anu white floweis, what can you concluue
about linkage between these loci. What uo
you neeu to know about the paients of the
uihybiiu in this case.

!"! In coin (i.e. maize, a uiploiu species),
imagine that alleles foi iesistance to a
paiticulai pathogen aie iecessive anu aie
linkeu to a locus that affects tassel length
(shoit tassels aie iecessive to long tassels).
Besign a seiies of ciosses to ueteimine the
map uistance between these two loci. You
can stait with any genotypes you want, but
be suie to specify the phenotypes of
inuiviuuals at each stage of the piocess.
0utline the ciosses similai to what is shown
in Figuie 7.8, anu specify which piogeny will
be consiueieu iecombinant. You uo not
neeu to calculate iecombination fiequency.

!"T In a mutant scieen in Biosophila, you
iuentifieu a gene ielateu to memoiy, as
eviuenceu by the inability of iecessive
homozygotes to leain to associate a
paiticulai scent with the availability of foou.
uiven anothei line of flies with an autosomal
mutation that piouuces oiange eyes, uesign
a seiies of ciosses to ueteimine the map
uistance between these two loci. 0utline the
ciosses similai to what is shown in Figuie
7.8, anu specify which piogeny will be
consiueieu iecombinant. You uo not neeu to
calculate iecombination fiequency.

!"U Image that methionine heteiotiophy,
chloiosis (loss of chloiophyll), anu absence
of leaf haiis (tiichomes) aie each causeu by
iecessive mutations at thiee uiffeient loci in
Aiabiuopsis. uiven a tiiple mutant, anu
assuming the loci aie on the same
chiomosome, explain how you woulu
ueteimine the oiuei of the loci ielative to
each othei.







L i n k a g e | !B#Q
!"#X If the piogeny of the cioss ""## x
!!$$ is testciosseu, anu the following
genotypes aie obseiveu among the piogeny
of the testcioss, what is the fiequency of
iecombination between these loci.

!"#$ 1SS
!"$$ 4Su
""#$ S9u
""$$ 12u


!"## Thiee loci aie linkeu in the oiuei B-C-
A. If the A-B map uistance is 1cN, anu the B-
C map uistance is u.6cN, given the lines
!"#$'( anu ""$$((, what will be the
fiequency of !"$$ genotypes among theii
piogeny if one of the paients of the uihybiiu
hau the genotypes !!##''.

!"#3 uenes foi bouy coloi (B black
uominant to b yellow) anu wing shape (C
stiaight uominant to c cuiveu) aie locateu
on the same chiomosome in flies. If single
mutants foi each of these tiaits aie ciosseu
(i.e. a yellow fly ciosseu to a cuiveu-wing
fly), anu theii piogeny is testciosseu, the
following phenotypic iatios aie obseiveu
among theii piogeny.

black, stiaight 17
yellow, cuiveu 12
black, cuiveu SS7
yellow, stiaight S64

0[ Calculate the map uistance
between B anu C.
>[ Why aie the fiequencies of the
two smallest classes not exactly the same.

!"#I uiven the map uistance you calculateu
between B-C in question 12, if you ciosseu a
uouble mutant (i.e. yellow bouy anu cuiveu
wing) with a wilu-type fly, anu testciosseu
the piogeny, what phenotypes in what
piopoitions woulu you expect to obseive
among the F2 geneiation.


!"#M In a thiee-point cioss, inuiviuuals
!!$$(( anu ""##'' aie ciosseu, anu theii F1
piogeny is testciosseu. Answei the
following questions baseu on these F2
fiequency uata.

""#$'( 48u
!"#$(( 1S
!"#$'( 1u
""#$(( 1
""$$'( 1S
!"$$(( 472
!"$$'( 1
""$$(( 8

0[ Without calculating iecombination
fiequencies, ueteimine the ielative oiuei of
these genes.
>[ Calculate paii-wise iecombination
fiequencies (without consiueiing uouble
cioss oveis) anu piouuce a genetic map.
;[ Recalculate iecombination fiequencies
accounting foi uouble iecombinants.





















L i n k a g e | !B#S

!"#Q Wilu-type mice have biown fui anu
shoit tails. Loss of function of a paiticulai
gene piouuces white fui, while loss of
function of anothei gene piouuces long tails,
anu loss of function at a thiiu locus piouuces
agitateu behavioui. Each of these loss of
function alleles is iecessive. If a wilu-type
mouse is ciosseu with a tiiple mutant, anu
theii F1 piogeny is test-ciosseu, the
following iecombination fiequencies aie
obseiveu among theii piogeny. Piouuce a
genetic map foi these loci
















fui tail behavioui
white shoit noimal 16
biown shoit agitateu u
biown shoit noimal 9SS
white shoit agitateu S6
white long noimal u
biown long agitateu 14
biown long noimal 46
white long agitateu 9SS



uenetics is the stuuy of the inheiitance anu vaiiation of biological tiaits. We
have pieviously noteu that it is possible to conuuct genetic ieseaich without
uiiectly stuuying BNA. Inueeu some of the gieatest geneticists hau no special
knowleuge of BNA at all, but ielieu insteau on analysis of phenotypes anu theii
iatios in caiefully uesigneu ciosses. Touay, classical genetics is often
complementeu by !"#$%&#'( )*"#"+,, which is the stuuy of BNA anu othei
!'%("!"#$%&#$- that have been isolateu fiom an oiganism. 0sually,
moleculai biology expeiiments involve some combination of techniques to
isolate, then analyze the BNA oi RNA of a paiticulai gene. In some cases, the
BNA may be subsequently manipulateu by mutation oi by iecombination with
othei BNA fiagments. Techniques of moleculai biology have wiue application
in many fielus of biology, as well as foiensics, biotechnology, anu meuicine.
./0 234567289 9:84;2< =86
BNA puiification stiategies iely on the chemical piopeities of BNA that
uistinguish it fiom othei molecules in the cell, namely that it is a veiy long,
negatively chaigeu molecule. To extiact puiifieu BNA fiom a tissue sample,
cells aie bioken open by giinuing oi #,-*>+ in a solution that contains
chemicals that piotect the BNA while uisiupting othei components of the cell
Chaptei 8 TECBNIQ0ES 0F N0LEC0LAR
BI0L0uY
Figure 8.1 Disposable
tips for a pipette are used
to distribute microliter
volumes of liquid in
molecular biology.
N o l e c u l a i
T e c h n i q u e s | .?@


(Figuie 8.2). These chemicals may incluue A$B$(+$>B-, which uissolve
membianes anu uenatuie pioteins. A cation such as Na
+
helps to stabilize the
negatively chaigeu BNA anu sepaiate it fiom pioteins incluuing histones. A
%C$#'B*>+ '+$>B, such as :=76, is auueu to piotect BNA by sequesteiing Ng
2+
,
which can otheiwise seive as a necessaiy co-factoi foi >&%#$'-$- (enzymes
that uigest BNA). As a iesult, fiee, uouble-stianueu BNA molecules aie
ieleaseu fiom the chiomatin into the extiaction buffei, which also contains
pioteins anu all othei cellulai components.
The fiee BNA molecules aie subsequently isolateu by one of seveial methous,
such as aujusting the salt concentiation so that pioteins piecipitate. The
supeinatant, which contains BNA anu othei, smallei metabolites, is then mixeu
with ethanol, which causes the BNA to piecipitate. A small D$##$B of BNA can
be collecteu by centiifugation, anu aftei iemoval of the ethanol, the BNA pellet
can be uissolveu in watei (usually with a small amount of EBTA anu a pB
buffei) foi the use in othei ieactions. Note that this piocess has puiifieu all of
the BNA fiom a tissue sample; if we want to fuithei isolate a specific gene oi
BNA fiagment, we must use auuitional techniques, such as PCR.


./@ 234567289 4E =:7:<7289 6 3F:<2G2< 3:HI:8<: JK F<E
8.2.1 C0NP0NENTS 0F TBE PCR REACTI0N
The F"#,!$('-$ <C'*> E$'%B*"> LF<EM is a methou of BNA ieplication that is
peifoimeu in a test tube (i.e. in vitio). Beie "polymeiase" iefeis to a BNA
polymeiase enzyme extiacteu fiom bacteiia, anu "chain ieaction" iefeis to the
ability of this technique piouuce millions of copies of a BNA molecule, by using
each newly ieplicateu uouble helix as a template to synthesize two new BNA
uouble helices. PCR is theiefoie a veiy efficient methou of amplifying BNA.
Besiues its ability to make lots of BNA, theie is a seconu chaiacteiistic of PCR
that makes it extiemely useful. Recall that most BNA polymeiases can only
auu nucleotiues to the enu of an existing stianu of BNA, anu theiefoie iequiie
a D(*!$( to begin the piocess of ieplication. Foi PCR, chemically synthesizeu
piimeis of about 16 nucleotiues aie useu. In an iueal PCR, piimeis only
hybiiuize to theii exact complementaiy sequence on the template stianu
(Figuie 8.S).
Figure 8.2 Extraction of
DNA from a mixture of
solubilized cellular
components by successive
precipitations. Proteins are
precipitated, then DNA (in
the supernatant) is
precipitated in ethanol,
leaving a pellet of DNA.

N o l e c u l a i
T e c h n i q u e s | .?N


The expeiimentei can theiefoie contiol exactly what iegion of a BNA template
is amplifieu by contiolling the sequence of the piimeis useu in the ieaction.
To conuuct a PCR, an expeiimentei combines in a small, thin-walleu tube
(Figuie 8.4), all of the necessaiy components foi BNA ieplication, incluuing
BNA polymeiase anu solutions containing nucleotiues (uATP, uCTP, uuTP,
uTTP), a BNA template, BNA piimeis, a pB buffei, anu ions (e.g. Ng
2+
) iequiieu
by the polymeiase. Successful PCR ieactions have been conuucteu using a
single BNA molecule as a template, but in piactice, most PCR ieactions contain
many thousanus of template molecules. The template BNA (e.g. total genomic
BNA) has usually alieauy been puiifieu fiom cells oi tissues using the
techniques uesciibeu above. Bowevei, in some situations it is possible to put
whole cells uiiectly in a PCR ieaction foi use as a template.
An essential aspect of PCR is BC$(!'#%,%#*>+, meaning the exposuie of the
ieaction to a seiies of piecisely uefineu tempeiatuies (Figuie 8.S). The
ieaction mixtuie is fiist heateu to 9SC. This causes the hyuiogen bonus
between the stianus of the template BNA molecules to melt, oi A$>'B&($. This
piouuces two single-stianueu BNA molecules fiom each uouble helix (Figuie
8.6). In the next step ('>>$'#*>+), the mixtuie is cooleu to 4S-6SC (the exact
tempeiatuie uepenus on the piimei sequence useu anu the objectives of the
expeiiment). This allows the foimation of uouble stianueu helices between
complementaiy BNA molecules, incluuing the annealing of piimeis to the
template. In the final step ($OB$>-*">) the mixtuie is heateu to 72C. This is
the tempeiatuie at which the paiticulai BNA polymeiase useu in PCR is most
active. Buiing extension, the new BNA stianu is synthesizeu, staiting fiom the
S' enu of the piimei, along the length of the template stianu. The entiie PCR
piocess is veiy quick, with each tempeiatuie phase usually lasting Su seconus
oi less. Each cycle of thiee tempeiatuies (uenatuiation, annealing, extension)
is usually iepeateu about Su times, amplifying the taiget iegion appioximately



Figure 8.3 The primer-template duplex at the top part of the figure is perfectly matched,
and will be stable at a higher temperature than the duplex in the bottom part of the figure,
which contains many mismatches and therefore fewer hydrogen bonds. If the annealing
temperature is sufficiently high, only the perfectly matched primer will be able to initiate
extension (grey arrow) from this site on the template.
Figure 8.4 A strip of PCR
tubes

Figure 8.5 Example of a
thermalcycle, in which the
annealing temperature is
55C.
N o l e c u l a i
T e c h n i q u e s | .?P



Figure 8.6 PCR with the
three phases of the
thermalcycle numbered.
The template strand (blue) is
replicated from primers
(red), with newly
synthesized strands in green.
The green strands flanked
by two primer binding sites
will increase in abundance
exponentially through
successive PCR cycles.

N o l e c u l a i
T e c h n i q u e s | .?Q

2
Su
-folu. Notice fiom the figuie that most of the newly synthesizeu stianus in
PCR begin anu enu with sequences eithei iuentical to oi complementaiy to the
piimei sequences; although a few stianus aie longei than this, they aie in such
a small minoiity that they can almost always be ignoieu. The eailiest PCR
ieactions useu a polymeiase fiom !" $%&'. Because the high tempeiatuie of the
uenatuiation step uestioyeu the enzyme, new polymeiase hau to be auueu
aftei each cycle. To oveicome this, ieseaicheis iuentifieu theimostable BNA
polymeiases such as 7'R =86 D"#, fiom ()*+,-. /$0-/1'$-., a theimophilic
bacteiium that lives in hot spiings. Taq cannot usually amplify fiagments
longei than about Skbp, but unuei some specializeu conuitions, PCR can
amplify fiagments up to appioximately 1ukbp.
Aftei completion of the theimalcycling, pait of the PCR ieaction is usually
loaueu onto an $#$%B("DC"($B*% +$# (uesciibeu below) to ueteimine whethei a
BNA fiagment of the expecteu length was amplifieu oi not. 0sually, the
template BNA will be so uilute that it will not show up on the gel, so the
piesence of a shaip banu of the expecteu length inuicates that PCR was able to
amplify its taiget. If the puipose of the PCR was to test foi the piesence of a
paiticulai template sequence, this is the enu of the expeiiment. 0theiwise, the
iemaining PCR piouuct can be useu as staiting mateiial foi a vaiiety of othei
techniques such as sequencing oi cloning.
8.2.S AN APPLICATI0N 0F PCR: TBE STARLINK AFFAIR
PCR is sensitive (meaning it can amplify veiy small staiting amounts of BNA),
anu specific (meaning it can amplify only the taiget sequence fiom a mixtuie of
many BNA sequences). This maue PCR the peifect tool to test whethei
genetically mouifieu coin was piesent in consumei piouucts on supeimaiket
shelves. Although the majoiity of coin in the 0niteu States is genetically
mouifieu, anu contains genes that goveinment iegulatois have appioveu foi
human consumption, an enviionmental gioup became suspicious that a
uiffeient stiain of genetically mouifieu coin, which hau been appioveu foi use
only as animal feeu, hau been mixeu in with coin useu in piouuction of things
like taco shells. To piove this, the gioup puichaseu taco shells fiom stoies in
the Washington BC aiea, extiacteu BNA fiom the taco shells anu useu it as a
template in a PCR ieaction with piimeis specific to the unauthoiizeu gene.
Theii suspicions weie confiimeu when they ian this PCR piouuct on an
agaiose gel anu saw a banu of expecteu size. The company that solu both the
appioveu anu non-appioveu tiansgenic seeu to faimeis hau to pay foi the
uestiuction of laige amounts of coin, anu was the taiget of a class action law-
suit by angiy consumeis who claimeu they hau been maue sick by the taco
shells. No legitimate cases of haim weie evei pioven, anu the plaintiffs weie
awaiueu $9 million, of which $S million went to the legal fees, anu the
iemainuei of the juugment went to the consumeis in the foim of coupons foi
taco shells. The affaii uestioyeu the company, anu exposeu a weakness in the
way the genetically mouifieu ciops weie hanuleu in the 0niteu States at the
time.


N o l e c u l a i
T e c h n i q u e s | .?S


./N <I77289 68= F637289 =86T E:37E2<7248 68= 52967248
Nany bacteiia have enzymes that iecognize specific BNA sequences (usually 4
oi 6 nucleotiues) anu then cut the uouble stianueu BNA helix at this sequence
(Figuie 8.7). These enzymes aie calleu site-specific ($-B(*%B*">
$>A">&%#$'-$-, oi moie simply "iestiiction enzymes", anu they natuially
function as pait of bacteiial uefenses against viiuses anu othei souices of
foieign BNA. To cut BNA at known locations, ieseaicheis use iestiiction
enzymes that have been puiifieu fiom vaiious bacteiial species, anu which can
be puichaseu fiom commeicial souices. These enzymes aie usually nameu
aftei the bacteiium fiom which they weie fiist isolateu. Foi example, !"#$%
anu !$%23 aie both enzymes fiom !" $%&'. !$%24 cuts uouble stianueu BNA at
the sequence uAATTC, but note that this enzyme, like many otheis, uoes not
cut in exactly the miuule of the iestiiction sequence (Figuie 8.8). The enus of a
molecule cut by !$%24 have an oveihanging iegion of single stianueu BNA, anu
so aie sometimes calleu -B*%U,?$>A-. 0n the othei hanu, !$%23 is an example
of an enzyme that cuts both stianus in exactly the miuule of its iecognition
sequence, piouucing what aie calleu )#&>B?$>A-, which lack oveihangs.


The piocess of #*+'B*"> occuis when uouble-stianueu BNA molecules aie
covalently joineu, enu-to-enu, thiough the action of an enzyme calleu #*+'-$.
Ligation is theiefoie cential to the piouuction of iecombinant BNA, incluuing
the inseition of a cloneu BNA fiagment into a plasmiu. Sticky-enueu molecules
with complementaiy oveihanging sequences aie saiu to have %"!D'B*)#$
$>A-/ Likewise, two blunt-enueu sequences aie also consiueieu compatible,
although they may not ligate togethei as efficiently as sticky-enus. 0n the othei
hanu, sticky-enueu molecules with non-complementaiy sequences cannot be
ligateu togethei.
Figure 8.7 An EcoRI dimer
(blue, purple) sits like a
saddle on a double helix of
DNA (one strand is green,
one is brown). This image
is looking down the center
of the helix.
Figure 8.8 The recognition
sequence for EcoRI (blue) is
cleaved by the enzyme (grey).
This particular enzyme cuts
DNA at a position offset from
the center of the restriction site.
This creates an overhanging,
sticky-end

N o l e c u l a i
T e c h n i q u e s | .?V
./P <548289 =86T F563;2= W:<74E3
8.4.1 PLASNIBS ARE NAT0RALLY PRESENT IN S0NE BACTERIA
Nany bacteiia contain extia-chiomosomal BNA elements calleu D#'-!*A-.
These aie usually small, ciiculai, uouble stianueu molecules that ieplicate
inuepenuently of the chiomosome anu can be piesent in high copy numbeis
within a cell. Plasmius can be tiansfeiieu between inuiviuuals uuiing bacteiial
mating anu aie sometimes even tiansfeiieu between uiffeient species.
Plasmius aie paiticulaily impoitant in meuicine because they often caiiy some
genes foi pathogenicity anu uiug-iesistance.

8.4.2 0SINu PLASNIBS AS CL0NINu vECT0RS
To inseit a BNA fiagment into a plasmiu, both the fiagment anu the plasmiu
aie cut using a iestiiction enzyme that piouuces compatible enus (Figuie 8.9).
uiven the laige numbei of iestiiction enzymes that aie cuiiently available, it is
usually not too uifficult to finu an enzyme foi which coiiesponuing iecognition
sequences aie piesent in both the plasmiu anu the BNA fiagment, paiticulaily
because most plasmiu vectois useu in moleculai biology have been engineeieu
to contain iecognition sites foi a laige numbei of enuonucleases.


Aftei iestiiction uigestion, the uesiieu fiagments may be fuithei puiifieu
befoie they aie mixeu togethei with ligase. Following a shoit incubation, the
newly ligateu plasmius, containing the gene of inteiest aie B('>-X"(!$A into
!" $%&'. Tiansfoimation is accomplisheu by mixing the ligateu BNA with !" $%&'
that has been specially piepaieu (i.e. maue %"!D$B$>B) to uptake BNA when
Figure 8.9 Cloning of a
DNA fragment (red) into a
plasmid vector. The vector
already contains a selectable
marker gene (blue)
N o l e c u l a i
T e c h n i q u e s | .?.


exposeu to compounus such as CaCl2 oi to electiical fielus ($#$%B("D"('B*">).
Because only a small fiaction of cells that aie mixeu with BNA will actually be
tiansfoimeu, a -$#$%B')#$ !'(U$(, such as a gene foi antibiotic iesistance, is
usually also piesent on the plasmiu. Aftei combining BNA with competent
cells, bacteiia aie theiefoie spieau on a plate containing an appiopiiate
antibiotic so that only cells that have actually incoipoiateu the plasmiu will
giow anu foim colonies foi fuithei stuuy.
Noleculai biologists use plasmius as Y$%B"(- to contain, amplify, tiansfei, anu
sometimes expiess genes of inteiest. 0ften, the fiist step in a moleculai
biology expeiiment is to %#">$ (i.e. copy) a gene into a plasmiu, then intiouuce
tiansfoim this iecombinant plasmiu back into bacteiia so that essentially
unlimiteu copies of the gene (anu the plasmiu that caiiies it) can be maue as
the bacteiia iepiouuce. This is a piactical necessity foi fuithei manipulations
of the BNA, since most techniques of moleculai biology aie not sensitive
enough to woik with just a single molecule at a time. Nany moleculai cloning
anu iecombination expeiiments aie theiefoie iteiative piocesses in which:
a BNA fiagment (usually isolateu by PCR anuoi iestiiction
uigestion) is cloneu into a plasmiu cut with a compatible
iestiiction enzyme
the iecombinant plasmiu is tiansfoimeu into bacteiia
the bacteiia aie alloweu to uiviue, usually in liquiu cultuie
a laige quantity of the iecombinant plasmiu BNA is isolateu fiom
the bacteiial cultuie
fuithei manipulations (such as site uiiecteu mutagenesis oi the
intiouuction of anothei piece of BNA) aie conuucteu on the
iecombinant plasmiu
the mouifieu plasmiu is again tiansfoimeu into bacteiia, piioi to
fuithei manipulations, oi foi expiession

8.4.S AN APPLICATI0N 0F N0LEC0LAR CL0NINu: PR0B0CTI0N 0F
REC0NBINANT INS0LIN
Puiifieu insulin is ciitical to the tieatment of uiabetes. Bistoiically, insulin foi
clinical use was isolateu fiom human cauaveis oi fiom slaughteieu animals
such as pigs. Buman-ueiiveu insulin geneially hau bettei phaimacological
piopeities, but was in limiteu supply anu caiiieu iisks of uisease tiansmission.
By cloning the human insulin gene anu expiessing it in !" $%&', laige quantities
of insulin iuentical to the human hoimone coulu be piouuceu in feimentois,
safely anu efficiently. Piouuction of iecombinant insulin also allows
specializeu vaiiants of the piotein to be piouuceu: foi example, by changing a
few amino acius, longei-acting foims of the hoimone can be maue. The active
insulin hoimone contains two peptiue fiagments of 21 anu Su amino acius,
iespectively. Touay, essentially all insulin is piouuceu fiom iecombinant
souices (Figuie 8.1u), i.e. human genes anu theii ueiivatives expiesseu in
bacteiia oi yeast.




N - 3 # ' * 3 0 /
@ # ' ) $ & C * # ( R .?Z




./Q =86 6865K323T 9:5 :5:<7E4F[4E:323
; (-3*%&-$ -. 9:; &( '-3-/3#((? 0$+ #B'#7% .-/ 2#&$4 1&('-*( 0% )&4)
'-$'#$%/0%&-$(? &( 1&(*033, &$+&(%&$4*&()023# ./-= 80%#/5 @)#/#.-/#? %#')$&C*#(
(*') 0( +$# $#$%B("DC"($-*- )01# 2##$ +#1#3-7#+ %- +#%#'% 0$+ 0$03,D# 9:;
SM&4*/# G5[[U5 @- (%0/%? 0 (-3*%&-$ -. 9:; &( +#7-(&%#+ 0% -$# #$+ -. 0 4#3 (3025
@)&( 4#3 &( =0+# ./-= 7-3,=#/( (*') 0( '+'("-$? 8)&') &( 0 7-3,(0'')0/&+#
&(-30%#+ ./-= '#/%0&$ (#08##+5 @)# 9:; &( %)#$ 7*33#+ %)/-*4) %)# 4#3 2, 0$
#3#'%/&'03 '*//#$%? 8&%) 9:; =-3#'*3#( =-1&$4 %-80/+ %)# 7-(&%&1# #3#'%/-+#
SM&4*/# G5[TU5


Figure 8.10 A vial of insulin. Note
that the label lists the origin as
rDNA, which stands for
recombinant DNA.
Figure 8.11 Apparatus for agarose gel
electrophoresis. A waterproof tank is used to
pass current through a slab gel, which is
submerged in a buffer in the tank. The current
is supplied by an adjustable power supply. A
gel (stained blue by a dye sometimes used
when loading DNA on the gel) sits in a tray,
awaiting further analysis.
N o l e c u l a i
T e c h n i q u e s | .?0\





As it migiates, each stianu of BNA thieaus its way thiough the poies that foim
between the polymeis of the gel. Because shoitei fiagments move thiough
these poies fastei than longei fiagments, gel electiophoiesis sepaiates
molecules baseu on theii size, with smallei BNA fiagments moving fastei than
long ones. This piocess also concentiates BNA fiagments of a similai size in
one location in each gel, calleu a )'>A. Concentiating BNA fiagments of
similai size in this way make it easy to visualize BNA aftei staining the BNA
with a fluoiescent uye such as $BC*A*&! )("!*A$ (Figuie 8.1S). By
electiophoiesing a mixtuie of BNA fiagments of known size in aujacent lanes
on the same gel, the length of an unchaiacteiizeu BNA fiagment can be
estimateu. Banus can also be cut out of the gel, anu the BNA in the banu can be
extiacteu anu useu in othei types of ieactions.



Figure 8.12 Agarose gel electrophoresis. DNA is loaded into wells at the top of a gel. A current is
passed through the gel, pulling DNA towards the positively charged electrode. The DNA fragments are
separated by size, with smaller fragments moving fastest towards the electrode.
Figure 8.13 An agarose gel
stained with ethidium
bromide and illuminated by
UV light. The stain
associated with DNA is
fluorescent.

N o l e c u l a i
T e c h n i q u e s | .?00
./S =86 6865K323T J5477289 68= [KJE2=2]67248
BNA only foims uistinct banus in gel electiophoiesis if most of the BNA
molecules aie of the same size, such as following a PCR ieaction, oi iestiiction
uigestion of a plasmiu. In othei situations, such as aftei iestiiction uigestion of
chiomosomal BNA, theie will be so many molecules of so many uiffeient sizes,
that the mixtuie will appeai as a smeai, iathei than uistinct banus. In this
case, it is necessaiy to use auuitional techniques to uetect the piesence of a
specific BNA sequence within the electiophoietic gel.

In a 3"&BC$(> )#"B (the technique is nameu aftei Eu Southein, its inventoi),
BNA that has been uigesteu with iestiiction enzymes is sepaiateu by gel
electiophoiesis, anu then a sheet of nylon oi similai mateiial is laiu unuei the
gel anu the BNA is tiansfeiieu to the nylon by uiawing the liquiu out of the gel,
in a piocess calleu )#"BB*>+ (Figuie 8.14). The blotteu BNA is usually
covalently attacheu to the nylon !$!)('>$ by biiefly exposing the blot to 0v
light. Tiansfeiiing the BNA to the nylon is necessaiy be because the fiagile gel
woulu fall apait uuiing the next steps in the piocess: C,)(*A*^'B*"> anu
_'-C*>+. Foi hybiiuization, a piece of BNA that is complementaiy in
sequence to the taiget molecule is labeleu using fluoiescent oi iauioactive
molecules, anu then this labeleu D(")$ is flooueu ovei the suiface of the nylon
membiane piioi to uenatuiing the BNA on the membiane.

If the hybiiuization is peifoimeu piopeily, the piobe BNA will foim a stable
helix only with those BNA molecules on the membiane that exactly match it,
anu the iauioactive oi fluoiescent signal will appeai in a uistinct banu aftei
washing off the unbounu piobe. In this way, the piesence of a paiticulai BNA
sequence within a mixtuie of BNA can be uetecteu. The tempeiatuie of the
hybiiuization anu washing solutions is impoitant to the -B(*>+$>%, of the
hybiiuization. At maximum stiingency (highei tempeiatuie), piobes will only
hybiiuize with taiget sequences that aie peifectly complementaiy anu
theiefoie foim the maximum numbei of hyuiogen bonus. At lowei
tempeiatuies, piobes will be able to hybiiuize to taigets to which they uo not
match exactly.

Southein blotting is useful when tiying to uetect the piesence of a BNA
sequence within a mixtuie of BNA molecules. Southein blotting was inventeu
befoie PCR, anu although PCR has ieplaceu blotting in some applications,
Southein blots aie still useful when uetecting fiagments laigei than those
noimally amplifieu by PCR, anu when tiying to uetect fiagments that may be
only uistantly ielateu to a known sequence. Applications of Southein blotting
will be uiscusseu fuithei in the context of moleculai maikeis in a subsequent
chaptei.

Following the uevelopment of the Southein blot, othei types of blotting
techniques weie inventeu, incluuing the noithein blot (in which RNA is
sepaiateu on a gel befoie piobing), anu the westein blot (piotein is sepaiateu
on a gel befoie piobing with an antibouy).
N o l e c u l a i
T e c h n i q u e s | .?0@





Figure 8.14 An example of Southern blotting. Genomic DNA that has been digested with a restriction
enzyme is separated on an agarose gel, then the DNA is transferred from the gel to a nylon membrane
(blue outline) by blotting. The DNA is immobilized on the membrane, then probed with a radioactively
labeled DNA fragment that is complementary to a target sequence. After stringent washing, the blot is
exposed to X-ray film to detect where the probe is bound. In this case, the probe bound to different-sized
fragments in lanes 1 and 2, and no fragments in lane 3.

N o l e c u l a i
T e c h n i q u e s | .?0N

______________________________________________________________________
S0NNARY:
Noleculai biology involves the isolation anu analysis of BNA anu othei
maciomolecules
Isolation of total genomic BNA involves sepaiating BNA fiom piotein
anu othei cellulai components, foi example by ethanol piecipitation of
BNA.
PCR can be useu as pait of a sensitive methou to uetect the piesence of
a paiticulai BNA sequence
PCR can also be useu as pait of a methou to isolate anu piepaie laige
quantities of a paiticulai BNA sequence
Restiiction enzymes aie natuial enuonucleases useu in moleculai
biology to cut BNA sequences at specific sites.
BNA fiagments with compatible enus can be joineu togethei thiough
ligation. If the ligation piouuces a sequence not founu in natuie, the
molecule is saiu to be iecombinant.
Tiansfoimation is the intiouuction of BNA (usually iecombinant
plasmius) into bacteiia.
Cloning of genes in E. coli is a common technique in moleculai biology,
since it allows laige quantities of a BNA foi gene to maue, which allows
fuithei analysis oi manipulation

Cloning can also be useu to piouuce useful pioteins, such as insulin, in
miciobes.
Southein blotting can be useu to uetect the piesence of any sequence
that matches a piobe, within a mixtuie of BNA (such as total genomic
BNA).
The stiingency of hybiiuization in blotting anu in PCR is uepenuent on
physical paiameteis such as tempeiatuie.
N o l e c u l a i
T e c h n i q u e s | .?0P



KEY TERNS:

maciomolecules
lysis
ueteigent
chelating agent
EBTA
nuclease
pellet
PCR
piimei
theimalcycle
uenatuie
anneal
extenu
Taq BNApol
electiophoietic
gel
iestiiction
enuonuclease
EcoRI
sticky enu
blunt enu
compatible enu
ligation
ligase
plasmiu
tiansfoimation
competent
electiopoiation
selectable maikei
agaiose
vectoi
banu
ethiuium biomiue
Southein blot
membiane
hybiiuization
washing
piobe
stiingency
noithein blot
westein blot



N o l e c u l a i
T e c h n i q u e s | .?0Q

ST0BY Q0ESTI0NS:
./0 What infoimation, anu what
ieagents woulu you neeu to use
PCR to uetect BIv in a bloou
sample.

./@ A 6uuubp PCR fiagment
flankeu by iecognition sites foi the
5'67444 iestiiction enzyme is cut
with 5'67444 then ligateu with a
Skb plasmiu vectoi that has also
been cut with 5'67444. This
iecombinant plasmiu is
tiansfoimeu into !" $%&' anu a laige
piepaiation of plasmiu is uigesteu
with BinuIII.
'M When the piouuct of the 5'67444
uigestion is analyzeu by gel
electiophoiesis, what will be the
size of the banus obseiveu.
)M What banus woulu be obseiveu
if the iecombinant plasmiu was cut
with !$%24, which has only one site,
uiiectly in the miuule of the PCR
fiagment.
%M What banus woulu be obseiveu
if the iecombinant plasmiu was cut
with both !$%24 anu 5'67444 at the
same time.

./N If you staiteu with 1u
molecules of uouble stianueu BNA
template, what is the maximum
numbei of molecules you woulu
you have aftei 1u PCR cycles.

./P What is piesent in a PCR tube
at the enu of a ieaction. With this
in minu, why uo you usually only
see a single, shaip banu on a gel
when a successful PCR ieaction is
analyzeu by electiophoiesis.

./Q A coat piotein fiom a
paiticulai viius can be useu to
immunize chiluien against fuithei
infection. Bowevei, inoculation of
chiluien with pioteins extiacteu
fiom natuial viiuses sometimes
causes fatal uisease, uue to
contamination with live viiuses.
Bow coulu you use moleculai
biology to piouuce an optimal
vaccine.

./S Bow woulu cloning be
uiffeient if theie weie no selectable
maikeis.
./V You believe that a paiticulai
foim of cancei is causeu by a 2uubp
ueletion in a paiticulai human gene
that is noimally 2kb long.
'M Explain how you woulu use
Southein blotting to uiagnose the
uisease.
)M Bow woulu the blot appeai in a
heteiozygote.
%M Bow woulu the blot appeai in a
homozygote with the ueletion.
u) Bow woulu the blot appeai in a
homozygote without the ueletion.
$M Bow woulu any of the blots
appeai if you hybiiuizeu anu
washeu at veiy low tempeiatuie.

./. Refei to question 8.7.
'M Explain how you woulu uetect
the piesence of the same ueletion
using PCR, iathei than Southein
blot.
)M Bow woulu the iesults appeai in
a heteiozygote.
%M Bow woulu the iesults appeai in
a homozygote with the ueletion.
AM Bow woulu the iesults appeai in
a homozygote without the
ueletion.
$M Bow woulu any of the gels
appeai if you annealeu at veiy low
tempeiatuie.

N o l e c u l a i
T e c h n i q u e s | .?0S


./Z You have a PCR fiagment foi a
human olfactoiy ieceptoi gene
(peiception of smells). You want to
know what genes a uog might have
that aie ielateu to this human gene.
Bow can you use youi PCR
fiagment anu genomic BNA fiom a
uog to finu this out.

./0\ You mix ligase with a sticky-
enueu plasmiu anu stick-enueu
inseit fiagment, which both have
compatible enus. 0nbeknownst to
you, someone in the lab left the
stock of ligase enzyme out of the
fieezei anu it no longei woiks.
Explain in uetail what will happen
in youi ligation expeiiment in this
situation.

In pievious chapteis you leaineu that chiomosomes aie like containeis in
which genes aie kept. Foi example, youi laigest chiomosome, chiomosome 1,
has about SSS6 genes. To ensuie that each of youi cells possesses these genes
the chiomosome has featuies that allow it to be passeu on uuiing cell uivision.
!"#$#%& () "*+,#-./#(% founu along its length pioviue places foi BNA
ieplication to stait, /*,(0*"*& piotect each enu of the chiomosome, anu a
single -*%/"(0*"* neai the miuule pioviues a place foi miciotubules to attach
anu move the chiomosome uuiing mitosis.

If the chiomosome is uamageu but still ietains these thiee featuies it will
continue to be inheiiteu uuiing cell uivisions but the uaughtei cells may not be
ieceiving exactly SSS6 genes. If a poition of the chiomosome has been lost the
cells will be missing some genes. If a poition of the chiomosome has been
uuplicateu the cells will ieceive too many genes. Buman cells aie uiploiu so
usually theie will be a seconu copy of the chiomosome that uoes have the
piopei numbei of genes. Sometimes this is sufficient but usually not. The
ieason is that human cells woik best wheie theie aie two copies of each gene.
Chiomosome changes aie often uetiimental because they compiomise this
genetic balance (see Section 2.8). This chaptei will examine how things can go
wiong with an oiganism's chiomosomes anu the consequences, often negative,
that iesult





Chaptei 9 CBANuES IN CBR0N0S0NES
Figure 9.1 Fluorescence
in situ hybridization of
mitotic chromosomes
from a human cell.
C h a n g e s i n
C h i o m o s o m e s | 123


145 6789 :8;<=< :7>!?!<!?= :78@A=<B
9.1.1 N0NBIS}0NCTI0N 0R CBR0N0S0NE L0SS B0RINu NIT0SIS 0R
NEI0SIS
Buiing anaphase of mitosis anu meiosis II, ieplicateu chiomosomes sepaiate
anu the sistei chiomatius aie pulleu to opposite enus of the cell (Figuie 9.2a).
Neiosis I is slightly uiffeient in that it is homologous chiomosomes that
sepaiate anu move apait (see Figuie 2.7 in Chaptei 2). In geneial, two things
can go wiong uuiing anaphase. If a chiomosome begins moving befoie
sepaiation is complete theie will be an extia copy of this chiomosome at one
pole anu none at the othei (Figuie 9.2b). This failuie of the chiomosomes to
segiegate piopeily is calleu %(%C#&DE%-/#(%. Alteinatively, if the miciotubules
aie unsuccessful in pulling a chiomosome to the pole of the cell it might not
become pait of the new nucleus (Figuie 9.2c). 0ltimately, eiiois uuiing
anaphase piouuce uaughtei cells with too many oi too few chiomosomes. This
situation is calleu .%*E+,(#CF.



9.1.2 INC0RRECT REPAIR 0F B00BLE STRANB BNA BREAKS B0RINu
INTERPBASE
A chiomosome is a veiy long but veiy thin molecule. Theie aie only two
covalent bonus holuing each base paii to the next (anu seveial non-covalent
bonus as well). If one of these covalent bonus is bioken the chiomosome will
still be intact although a BNA Ligase will be neeueu to iepaii the nick (Figuie
9.Sa). Pioblems aiise when both stianus aie bioken at oi neai the same
location. This C(EG,* &/".%C G"*.H will cleave the chiomosome into two
inuepenuent pieces (Figuie 9.Sb). Because this event uoes occui fiom time to
time in cells theie is a iepaii system calleu the %(%I(0(,($(E& *%C D(#%#%$
(NBE}) &F&/*0 to fix them. Pioteins binu to each bioken enu of the BNA anu
ieattach them with new covalent bonus.

Figure 9.2 Errors during
anaphase can cause
aneuploidy. This diagram
shows a chromosome
during anaphase and
telophase of mitosis. The
process occurs normally (a),
with a nondisjunction event
(b), and with a chromosome
loss event (c). The daughter
cells are diploid and have a
normal number of
chromosomes (2n), have
one too many chromosomes
(2n+1), or one two few
chromosomes (2n-1).

C h a n g e s i n
C h i o m o s o m e s | 12J


The NBE} system pioteins only function if iequiieu. If the chiomosomes
within an inteiphase nucleus aie all intact the system is not neeueu. The
telomeies at the natuial enus of chiomosomes pievent the NBE} system fiom
attempting to join chiomosomes togethei. If theie is one uouble stianu bieak
the two bioken enus can be iecognizeu anu joineu. But if theie aie two uouble
stianu bieaks at the same time theie will be foui bioken enus in total. The
NBE} system pioteins may join the enus togethei coiiectly but if they uo not
the iesult is a -I"(0(&(0* "*."".%$*0*%/ (Figuie 9.4).

Figure 9.3 Repair of single
strand nicks and double
strand breaks in DNA.
Figure 9.4 Errors during
DNA repair can cause a
chromosome deletion. In
this diagram A, B, and C
are genes on the same
chromosome. As in Figure
9.3 there has been breaks in
the DNA, recruitment of
NHEJ proteins, and repair.
After the repairs are
completed the small piece
of DNA with gene B is lost
and the chromosome now
only has genes A and C.
C h a n g e s i n
C h i o m o s o m e s | 12K


The type of chiomosome ieaiiangement is uepenuent upon wheie the two
bieaks weie oiiginally (Figuie 9.S). If both bieaks weie on the same piece of
BNA the iesult is a C*,*/#(% oi an #%L*"&#(%. If the bieaks weie on sistei
chiomatius oi homologous chiomosomes the iesults aie ueletions anu
CE+,#-./#(%&. Anu if each bieak was on a completely uiffeient chiomosome
the iesult is a chiomosome /".%&,(-./#(%.



Figure 9.5 Errors during DNA repair can cause several types of chromosome
rearrangements. This diagram shows an acrocentric chromosome with the genes A, B, and
C. In each case there is a double stranded DNA break between the B and C genes, shown
here as a red X. A second DNA break occurs and the NHEJ proteins mend the damage
incorrectly by joining the ends shown with the blue arrows. a) Two breaks have occurred on
the same unreplicated chromosome. The ends are joined incorrectly and the result is a
deletion. The piece of DNA with the B gene on it (see Figure 9.4) does not have a
centromere and will be lost during the next cell division. b) Two breaks have occurred on
the same unreplicated chromosome. The ends are joined incorrectly and the result is an
inversion. c) Two DNA breaks have occurred on a replicated chromosome. The ends are
joined together incorrectly and later, after cell division, one of the chromosomes has a
duplication while the chromosome in the other daughter cell has a deletion. d) Two breaks
have occured on different unreplicated chromosomes. The other chromosome has genes D
and E on it. The ends are joined incorrectly and the result is a translocation.

C h a n g e s i n
C h i o m o s o m e s | 12M
9.1.S INC0RRECT CR0SS0vERS B0RINu NEI0SIS
Ciossoveis occui at the beginning of meiosis foi two ieasons. They help holu
the homologous chiomosomes togethei until sepaiation occuis uuiing
anaphase I (see Chaptei 2). They also allow iecombination to occui between
linkeu genes (see Chaptei 7). The event itself takes place uuiing piophase I
when a uouble stianu bieak on one piece of BNA is paiieu with a uouble stianu
bieak on anothei piece of BNA anu the enus aie put togethei (Figuie 9.6a).
Nost of the time the bieaks aie on non-sistei chiomatius anu most of the time
the bieaks aie at the same ielative locations.

Pioblems occui when the wiong pieces of BNA aie matcheu up uuiing
ciossovei events. This can happen if the same BNA sequence is founu at
multiple sites on the chiomosomes (Figuie 9.6b). Foi example, if theie aie two
alu tiansposable elements on a chiomosome, when the homologous
chiomosomes paii uuiing piophase I the wiong alu sequences might line up. A
ciossovei may occui in this iegion. If so, when the chiomosomes sepaiate
uuiing anaphase I one of the chiomatius will have a uuplication anu one will
have a ueletion. 0ltimately, of the foui cells piouuceu by this meiosis two will
be noimal, one will have a chiomosome with extia genes, anu one will have a
chiomosome missing some genes. Eiiois of this type can also cause inveisions
anu tianslocations.





Figure 9.6 Errors during
meiotic crossovers can
cause duplications and
deletions. This diagram
shows homologous
chromosomes pairing in
prophase I and then
separating in anaphase I.
The shaded boxes are alu
transposable elements. a)
The homologous
chromosomes pair properly,
a crossover occurs, and all
four chromatids in anaphase
I are normal. b) The pairing
is incorrect, a crossover
occurs in the misspaired
region, and in anaphase I
one chromatid has a
duplication and another has
a deletion.
C h a n g e s i n
C h i o m o s o m e s | 12N


143 :7>!?!<!?= 8O@!>?8PQ9Q=< Q@ 7;?8@<

The pioblems uesciibeu above can affect all eukaiyotes, unicellulai anu
multicellulai. To bettei unueistanu the consequences let us consiuei those that
affect people. As you will iecall fiom Figuie 2.11, humans aie 2n=46. The
convention when uesciibing a peison's H."F(/F+* (chiomosome composition)
is to list the total numbei of chiomosomes, then the sex chiomosomes, anu
then anything out of the oiuinaiy. Nost of us aie 46,XX oi 46,XY. What follows
aie some examples of chiomosome numbei anu chiomosome stiuctuie
abnoimalities.
9.2.1 B0WN SYNBR0NE
The most common chiomosome numbei abnoimality is tiisomy-21 oi, as it is
moie commonly known, R(S% &F%C"(0*. It is piesent in about 1 in 8uu
biiths. Infants with this conuition have thiee copies of chiomosome 21 iathei
than the noimal two. (Bon't confuse /"#&(0F, having thiee copies of one
chiomosome with tiiploiuy, having thiee entiie chiomosome sets - see Section
2.6.2.) Females with tiisomy-21 aie 47,XX,+21 while males aie 47,XY,+21. In
geneial, people with Bown synuiome aie 47,sex,+21 wheie the woiu 'sex'
signifies that the sex chiomosomes may be XX oi XY.

Tiisomy-21 may aiise fiom a nonuisjunction event uuiing meioisis in eithei
paient oi uuiing mitosis veiy eaily uuiing embiyogenesis. Bowevei, most
cases aie uue to a non-uisjunction event occuiiing in the female paient uuiing
meiosis I (Figuie 9.7).

Figure 9.7 Errors during
chromosome segregation
can cause Down syndrome.
This diagram shows the
chromosome 21s during
meiosis in both parents and
fusion of the gametes. Note
that the cells that begin
meiosis are called
meiocytes and that this
diagram only shows one of
the four cells produced by
meiosis. Meiosis has
occurred properly in the
male parent but there was a
nondisjunction event in the
female parent in anaphase I.

C h a n g e s i n
C h i o m o s o m e s | 12T
People with Bown synuiome have mental ietaiuation anu often have othei
health pioblems such as heait uefects. The uisease was fiist uesciibeu by }ohn
Bown in 1866 but it was not until 19S9 when its chiomosomal basis was
ievealeu. Cuiient ieseaich suggests that at least some of the mental pioblems
aie uue to having thiee copies of the !"#$ gene on chiomosome 21. This gene
is active in the biain anu theie is eviuence fiom humans anu fiom mice that
neuions aie uamageu if theie aie too many BYRK pioteins synthesizeu.
9.2.2 XYY ANB XXX
Baving an extia copy of the smallest human chiomosome, chiomosome 21,
causes substantial health pioblems. Fetuses may be tiisomic foi one of the
othei laigei autosomes but these fetuses usually uo not suivive to teim. The
situation is quite uiffeient foi the sex chiomosomes howevei. 1 1uuu males
have an extia Y chiomosome anu yet most aie unawaie of it! Theie is little
haim in having two Y chiomosomes because they have ielatively few genes.
Similaily, 1 1uuu females have an extia X chiomosome. This situation is also
haimless although foi a uiffeient ieason. Noimally in female mammals one of
the two X chiomosomes is inactivateu in each cell so that theie can be genetic
balance (males only have one X). In 46,XX females one of the X chiomosomes is
inactivateu while in 47,XXX females two aie.
9.2.S CRI-B0-CBAT SYNBR0NE
:"#2CE2-I./ &F%C"(0* occuis when a chilu inheiits a uefective chiomosome S
fiom one paient (Figuie 9.8). This conuition is iaie - it is piesent in only 1 in
2u uuu to 1 in Su uuu biiths but it uoes account foi 1% of cases of piofounu
mental ietaiuation. The specific uefect is a ueletion that iemoves 2 Nb oi moie
fiom the tip of the shoit aim of the chiomosome. In most cases the ueletion is
the iesult of a chiomosomal ieaiiangement in one of the paient's geim line
cells. People with cii-uu-chat have a kaiyotype of 46,sex,ueletion(S).


Figure 9.8 A boy with cri-
du-chat syndrome. The
pictures were taken at 8
months (A), 2 years (B), 4
years (C), and 9 years (D).
C h a n g e s i n
C h i o m o s o m e s | 12U


As with Bown synuiome this conuition is associateu with mental ietaiuation
anu othei health pioblems. These pioblems incluue an impiopeily foimeu
laiynx which leaus to infants making high pitcheu cat-like ciying sounus
(hence the name "ciy of the cat"). It is suspecteu that at least some of the
mental ietaiuation phenotype is uue to having only a single copy of the
%&''!( gene. This gene is active uuiing embiyogenesis anu makes a piotein
essential foi neuion migiation. Bown synuiome anu cii-uu-chat synuiome aie
two examples of the neeu foi genomes to contain the piopei numbei of genes.
Baving too many copies of key genes (Bown synuiome) oi too few (cii-uu-chat
synuiome) can leau to substantial uevelopmental pioblems.
9.2.4 INvERSI0N(9)
The most common chiomosome ieaiiangements in humans aie inveisions of
chiomosome 9. About 2% of the woilu's population is heteiozygous oi
homozygous foi inveision(9). This ieaiiangement uoes not affect a peison's
health because the genes on the chiomosome aie all piesent - all that has
changeu is theii ielative locations. Inveision(9) is uiffeient fiom ueletion(S) in
two main iespects. As mentioneu above because it is a balanceu
ieaiiangement it uoes not cause haim. Anu because of this neaily eveiyone
with an inveision(9) chiomosome has inheiiteu it fiom a paient who hau
inheiiteu it fiom one of theii paients anu so on. In contiast, most cases of
ueletion(S) aie uue to new mutations occuiiing in a paient.

14J RQ8A@!<Q@A 7;?8@ :7>!?!<!?= 8O@!>?8PQ9Q=<
9.S.1 BRIuBT FIELB NICR0SC0PY
Bow can we confiim that a peison has a specific chiomosomal abnoimality.
The fiist methou was simply to obtain a sample of theii cells, stain the
chiomosomes with A#*0&. uye, anu examine the iesults with a light
micioscope (Figuie 9.9). Each chiomosome can be iecognizeu by its length, the
location of its centiomeie, anu the chaiacteiistic pattein of puiple banus
piouuceu by the uiemsa. Foi example, if mitotic cells fiom a peison

Figure 9.9 Human chromosomes. One way to
obtain chromosomes is to take a blood sample,
culture the cells for three days in the presence of
a T-cell growth factor, arrest the cells in
metaphase with a microtubule inhibitor, and then
drop the cells onto a slide. The cells burst and the
chromosomes stick to the slide. The
chromosomes can then be stained or probed.
Because the cells are in metaphase it is possible
to see 46 replicated chromosomes here. There
will be dozens of collections of chromosomes
like this over the entire slide.

C h a n g e s i n
C h i o m o s o m e s | 121

consistently containeu foity seven chiomosomes in total with thiee
chiomosome 21s this woulu be inuicative of Bown synuiome. Biight fielu
micioscopy uoes have its limitations : it only woiks with mitotic chiomosomes
anu many chiomosome ieaiiangements aie eithei too subtle oi too complex
foi even a skilleu cytogeneticist to uiscein.
9.S.2 FL00RESCENCE IN SIT0 BYBRIBIZATI0N
The solution to these pioblems was ),E("*&-*%-* #% &#/E IFG"#C#V./#(%
(FISB). The technique is similai to a Southein blot in that a single stianueu
R@8 +"(G* is alloweu to hybiiuize to uenatuieu taiget BNA (see Section 8.6).
Bowevei, insteau of the piobe being iauioactive it is fluoiescent anu insteau of
the taiget BNA being iestiiction fiagments on a nylon membiane it is
uenatuieu chiomosomes on a glass sliue. Because theie aie seveial fluoiescent
colouis available it is common to use moie than one piobe at the same time.
Typically the chiomosomes aie also labeleu with a fluoiescent stain calleu
R8WQ which gives them a unifoim blue coloui. If the chiomosomes have come
fiom a mitotic cell it is possible to see all foity six of them spieau out in a small
aiea. Alteinatively, if the chiomosomes aie within the nucleus of an
inteiphase cell they appeai togethei within a laige blue ciicle.
9.S.S 0SINu FISB T0 BIAuN0SE B0WN SYNBR0NE
Nost piegnancies iesult in healthy chiluien. Bowevei in some cases theie is an
elevateu chance that the fetus has tiisomy-21. 0luei women aie at a highei
iisk because the non-uisjunction events that leau to tiisomy become moie
fiequent with age. The seconu consiueiation is what the fetus looks like uuiing
an ultiasounu examination. Fetuses with tiisomy-21 anu some othei
chiomosome abnoimalities have a swelling in the back of the neck calleu a
nuchal tianslucency. If eithei oi both factois is piesent the woman may choose
amniocentesis. In this test some amniotic fluiu is withuiawn so that the fetal
cells within it can be examineu. Figuie 9.1u shows a positive iesult foi tiisomy-
21. Baseu upon this image the fetus has two X chiomosomes anu thiee
chiomosome 21s anu theiefoie has a kaiyotype of 47,XX,+21.

Figure 9.10 Confirmation of Down syndrome in a fetal cell. This diagram is based upon
actual results. The DNA has been stained blue with DAPI. A red fluorescent probe is
binding to the centromeres of chromosome 21 (shown here as filled circles). A green
fluorescent probe is binding to the centromeres of the X chromosome (open circles). Source:
Figure 4 in Antonarakis, S. E. et al. 2004. Chromosome 21 and Down syndrome: From
genomics to pathophysiology. Nature Reviews Genetics 5:725-738 PubMed ID: 15510164.
C h a n g e s i n
C h i o m o s o m e s | 125X


9.S.4 0SINu FISB T0 BIAuN0SE CRI-B0-CBAT SYNBR0NE
A physician may suspect that a patient has a specific genetic conuition baseu
upon the patient's physical appeaiance, mental abilities, health pioblems, anu
othei factois. FISB can be useu to confiim the uiagnosis. Foi example, Figuie
9.11 shows a positive iesult foi cii-uu-chat synuiome. The piobes aie binuing
to two long aims of chiomosome S but only one shoit aim. 0ne of the
chiomosome Ss must theiefoie be missing pait of its shoit aim.


9.S.S NEWER TECBNIQ0ES
FISB is an elegant technique that piouuces uiamatic images of oui
chiomosomes. 0nfoitunately, FISB is also expensive, slow, anu iequiies a high
uegiee of skill. Foi these ieasons, FISB is slowly being ieplaceu with PCR anu
BNA chip baseu methous. veisions of these techniques have been uevelopeu
that can accuiately quantify a peison's BNA. Foi example a sample of BNA
fiom a peison with Bown synuiome will contain 1Su% moie BNA fiom
chiomosome 21 than the othei chiomosomes. Likewise BNA fiom a peison
Figure 9.11 A positive
result for cri-du-chat
syndrome. This diagram is
based upon actual results.
Cells from a patient's blood
were prepared to show an
interphase nucleus (a) and
mitotic chromosomes (b).
The DNA has been
coloured blue with DAPI.
The green fluorescent probe
is binding to the tip of the
short arm of chromosome 5
(shown here as open
circles). This is the region
absent in cri-du-chat. The
red fluorescent probe is
binding to the middle of the
long arm of the same
chromosome (filled circles).
This probe is used as a
control. Source: Figure 1 in
Fang J.-S. et al. 2008
Cytogenetic and molecular
characterization of three-
generation family with
chromosome 5p terminal
deletion. Clinical Genetics
73:585-590 PubMed ID:
18400035.

C h a n g e s i n
C h i o m o s o m e s | 1255
with cii-uu-chat synuiome will contain Su% less BNA fiom the enu of
chiomosome S. These techniques aie veiy useful if the suspecteu abnoimality
is a ueletion, a uuplication, oi a change in chiomosome numbei. They aie less
useful foi uiagnosing chiomosome inveisions anu tianslocations because
these ieaiiangements often involve no net loss oi gain of genes.

In the futuie all of these techniques will likely be ieplaceu with BNA
sequencing. Each new geneiation of genome sequencing machines can
sequence moie BNA in less time. Eventually it will be cheapei just to sequence
a patient's entiie genome than to use FISB oi PCR to test foi specific
chiomosome uefects.





___________________________________________________________________________________________

<;??8>YZ
Eiiois uuiing anaphase in mitosis oi meiosis can leau to tiisomy anu
othei foims of aneuploiuy.
Eiiois uuiing the iepaii of BNA bieaks oi uuiing meiotic ciossing ovei
can leau to chiomosome ieaiiangements.
Thiee common foims of aneuploiuy in humans aie 47,sex,+21 (Bown
synuiome), 47,XYY, anu 47,XXX.
Beletion(S) causes a seiious conuition (cii-uu-chat synuiome) because
ueletions aie unbalanceu chiomosome ieaiiangements.
Inveision(9) causes few health consequences because inveisions aie
balanceu chiomosome ieaiiangements.
Biight fielu micioscopy can be useu to uetect chiomosome numbei
abnoimalities anu some chiomosome ieaiiangements.
Fluoiescence in situ hybiiuization can be useu to uetect all types of
chiomosome abnoimalities.
PCR anu BNA chip baseu techniques can be useu to uetect chiomosome
numbei abnoimalities, ueletions, anu uuplications.
C h a n g e s i n
C h i o m o s o m e s | 1253


[=Y 9=>?<Z

nonuisjunction 46,XX
chiomosome loss 46,XY
uouble stianu BNA bieak 47,sex,+21 (Bown synuiome)
nonhomologous enu joining 47,XYY
BNA iepaii system 47,XXX
aneuploiuy 46,sex,ueletion(S) (cii-uu-chat synuiome)
tiisomy 46,sex,inveision(9)
chiomosome ieaiiangement biight fielu micioscopy
ueletion uiemsa stain
uuplication fluoiescence in situ hybiiuization
inveision fluoiescent piobe
tianslocation BAPI stain
meiotic ciossovei amniocentesis
kaiyotype




<9;RY \;=<9Q!@<Z
145 Nake uiagiams showing how
an impiopei ciossovei event
uuiing meiosis can leau to:
.] an inveision
G] a tianslocation

143 Nake a uiagiam showing how
a nonuisjunction event can leau to
a chilu with a 47,XYY kaiyotype.

14J The inactive X chiomosome in
XX mammals is visible in
inteiphase nuclei as a compact
stiuctuie nameu a Baii bouy. Bow
many Baii bouies woulu you
expect to see in cells fiom people
who aie:
.] 46,XY
G] 47,XYY
-] 47,XXX

14K Why can people suivive with
tiisomy-21 (47,sex,+21) but not
monosomy-21 (4S,sex,-21).



14M If !)*+*,-./0 geneticists want
to geneiate mutant stiains with
ueletions they expose flies to
gamma iays. What uoes this imply
about gamma iays.

14N What woulu happen if theie
was a nonuisjunction event
involving chiomosome 21 in a
46,XY zygote.

14T Besign a FISB baseu
expeiiment to finu out if youi lab
paitnei is a 47,XXX female oi a
47,XYY male.

14U What woulu Figuie 9.1u look
like if it also showeu metaphase
chiomosomes fiom anothei cell.



!"# ! %&'( )*+,*-,&.% ,. -/( 0(.&'( *11(2- 2&'34(5
-+*,-%
Imagine that you coulu compaie the complete BNA of any two people
you meet touay. Although theii genomic BNA sequences woulu be veiy
similai, they woulu not be iuentical at each of the S billion base paii
positions you examineu (unless, peihaps, youi subjects weie iuentical
twins). In fact, the genomic sequences of almost any two unielateu
people uiffei at millions of nucleotiue positions. Some of these
polymoiphisms aie founu in the iegions of genes that coue foi pioteins.
0thei polymoiphisms might affect the amount of tiansciipt that is
maue foi a paiticulai gene. A peison's health, appeaiance, behavioi,
anu othei chaiacteiistics uepenu in pait on these polymoiphisms.
Bowevei, the vast majoiity of BNA polymoiphisms have no effect on
piotein sequences, because they occui within iegions of BNA that
neithei encoue pioteins, noi iegulate the expiession of genes. These
polymoiphisms aie neveitheless veiy useful because they can be useu
as 6789:;8<= 6<=>9=? in meuicine, foiensics, ecology, agiicultuie, anu
many othei fielus. In most situations, moleculai maikeis obey the
same iules of inheiitance that we have alieauy uesciibeu foi othei
types of loci, anu so can be useu to cieate genetic maps anu to iuentify
linkeu genes.

Chaptei 1u N0LEC0LAR NARKERS &
Q0ANTITATIvE TRAITS
1@A;=9 !"#! Nany
inteiesting tiaits, such as
bouy mass, show
continuous vaiiation.
Although enviionment
obviously also affects this
tiait, some of the vaiiation
obseiveu between
inuiviuuals is heiitable,
anu is uepenuent on
inteiactions involving
multiple genes. The stuuy
of quantitative tiaits is
one of many applications
of moleculai maikeis.
.
N o l e c u l a i N a i k e i s | !"BC


1u.2 0RIuINS 0F N0LEC0LAR P0LYN0RPBISNS
Nutations of BNA sequences can aiise in many ways (Chaptei 4). Some
of these changes occui uuiing BNA ieplication piocesses, iesulting in
an inseition, ueletion, oi substitution of one oi a few nucleotiues.
Laigei mutations can be causeu by mobile genetic elements such as
tiansposons, which aie inseiteu moie oi less ianuomly into
chiomosomal BNA, sometimes occuiiing in clusteis. In these anu othei
types of iepetitive BNA sequences, the numbei of iepeateu units is
pione to change thiough unequal ciossoveis anu othei iaie events.



1u.S CLASSIFICATI0N ANB BETECTI0N 0F N0LEC0LAR NARKERS
Regaiuless of theii oiigins, moleculai maikeis can be classifieu as
polymoiphisms that eithei vaiy in the length of a BNA sequence, oi
vaiy only in the iuentity of nucleotiues at a paiticulai position on a
chiomosome (Figuie 1u.2). In both cases, because two oi moie
alteinative veisions of the BNA sequence exist, we can tieat each
vaiiant as a uiffeient allele of a single locus. Each allele gives a uiffeient
moleculai phenotype.
1@A;=9 !"#C Some examples of BNA polymoiphisms. The vaiiant iegion is maikeu in blue, anu each
vaiiant sequence is aibitiaiily assigneu one of two allele labels. Abbieviations: SNP (Single Nucleotiue
Polymoiphism); SSR (Simple Sequence Repeat) = SSLP (Simple Sequence Length Polymoiphism); ).-+
(vaiiable Numbei of Tanuem Repeats); +143 (Restiiction Fiagment Length Polymoiphisms. vNTRs anu
SSRs uiffei in the size of the iepeat unit; vNTRs aie laigei than SSRs.
N o l e c u l a i N a i k e i s | !"BD
Foi example, polymoiphisms of %%+? (shoit sequence iepeats) can be
uistinguisheu baseu on the length of PCR piouucts: one allele of a
paiticulai SSR locus might piouuce a 1uubp banu, while the same
piimeis useu with a uiffeient allele as a template might piouuce a
12ubp banu (Figuie 1u.S). A uiffeient type of maikei, calleu a %.3
(single nucleotiue polymoiphism), is an example of polymoiphism that
vaiies in nucleotiue iuentity, but not length. SNPs occui at the highest
uensity of any moleculai maikeis, anu the genotypes of thousanus of
SNP loci can be ueteimineu in paiallel, using new, hybiiuization baseu
instiuments aie one the of the most common types of Note that the
alleles of most moleculai maikeis aie co-uominant, since it is possible
to uistinguish the phenotype of a heteiozygote fiom eithei homozygote.




Nutations that uo not affect the function of piotein sequences oi gene
expiession aie likely to be ietaineu in a population as polymoiphisms,
since theie will be no selection eithei in favoi oi against them (i.e. they
aie E9;F=<8). Note that the although the iate of spontaneous mutation
in natuial populations is sufficient to geneiate millions of
polymoiphisms that accumulate ovei thousanus of geneiations, the
iate of mutation is on the othei hanu sufficiently low that existing
polymoiphisms aie stable thioughout the geneiations we stuuy in a
typical genetic expeiiment.
!"#G *334,2*-,&.% &1 '&4(2H4*+ '*+I(+%
Seveial chaiacteiistics of moleculai maikeis make them useful to
geneticists. Because of the way BNA polymoiphisms aiise anu aie
ietaineu, they aie piesent at high uensity thioughout the genome.
Because they aie phenotypically neutial, they can also be highly
polymoiphic, meaning that it is ielatively easy to finu maikeis that
uiffei between two inuiviuuals. The neutiality of moleculai maikeis
makes it possible to stuuy hunuieus of loci without woiiying about

Figure 10.3
Determining the
genotype of an
individual at a single
SSR locus using a
specific pair of PCR
primers and agarose
gel electrophoresis. S=
size standard
N o l e c u l a i N a i k e i s | !"BG


gene inteiactions oi othei influences that make it uifficult to infei
genotype fiom phenotype. Noieovei, unlike visible tiaits such as eye
coloi oi petal coloi, the phenotype of a moleculai maikei can be
uetecteu in any tissue oi uevelopmental stage, anu the same type of
assay can be useu to scoie moleculai phenotypes at millions of uiffeient
loci. Thus, the neutiality, high uensity, high uegiee of polymoiphism,
co-uominance, anu ease of uetection of moleculai maikeis have leau to
theii wiue auoption in many aieas of ieseaich.
It is woith emphasizing again that BNA polymoiphisms aie a natuial
pait of most genomes. ueneticists uiscovei these polymoiphisms in
vaiious ways, incluuing compaiison of ianuom BNA sequence
fiagments fiom seveial inuiviuuals in a population. 0nce moleculai
maikeis have been iuentifieu, they can be useu in many ways,
incluuing:
1u.4.1 BNA FINuERPRINTINu
By compaiing the genotypes of seveial moleculai maikeis, it is
possible to ueteimine the ielationship between two BNA samples. Foi
example, a foiensic scientist can uemonstiate that some of the bloou
on a weapon came fiom a paiticulai suspect, oi even that leaves in the
back of a suspect's pick-up tiuck came fiom a paiticulai tiee at a ciime
scene (Figuie 1u.4). BNA fingeipiinting is also useful in pateinity
testing anu in commeicial applications such as veiification of species of
oiigin of ceitain foous anu heibal meuicines.
1u.4.2 C0NSTR0CTI0N 0F uENETIC LINKAuE NAPS
By calculating the iecombination fiequency between paiis of moleculai
maikeis, a map of each chiomosome can be geneiateu foi almost any
oiganism (Figuie 1u.S). These maps aie calculateu using the same
mapping techniques uesciibeu pieviously, howevei, the high uensity
anu ease with which moleculai maikeis can be genotypeu makes them
moie useful than othei phenotypes foi constiucting genetic maps.
These maps aie useful in fuithei stuuies, incluuing map-baseu cloning
of piotein couing genes that weie iuentifieu by mutation.
1u.4.S P0P0LATI0N ST0BIES
As uesciibeu in Chaptei S, the obseiveu fiequency of alleles, incluuing
alleles of moleculai maikeis, can be compaieu to fiequencies expecteu
foi populations in Baiuy-Weinbeig equilibiium to ueteimine whethei
the population is in equilibiium. By monitoiing moleculai maikeis,
ecologists anu wilulife biologists can make infeiences about migiation,
selection, uiveisity, anu othei population-level paiameteis. Noleculai
maikeis can also be useu by anthiopologists to stuuy migiation events
in human ancestiy.

Figure 10.4 Paternity
testing. Given the
molecular phenotype of
the child (C) and mother
(M), only one of the
possible fathers (#2) has
alleles that are consistent
with the childs
phenotype.
N o l e c u l a i N a i k e i s | !"BJ
1u.4.4 IBENTIFICATI0N 0F LINKEB TRAITS
It is often possible to iuentify an allele of a moleculai maikei whose
piesence is coiielateu with a paiticulai uisease oi othei tiait of
inteiest. 0ne way to make this coiielation is to obtain genomic BNA
samples fiom hunuieus of inuiviuuals with a paiticulai uisease, as well
as samples fiom a contiol population of healthy inuiviuuals. The
genotype of each inuiviuual is scoieu at hunuieus oi thousanus of
moleculai maikei loci (e.g. SNPs), to finu alleles that aie usually


1@A;=9 !"#J Neasuiing iecombination fiequency between two moleculai maikei loci, " anu #. A
uiffeient paii of piimeis is useu to amplify BNA fiom eithei paient (P) anu 1S of the F2 offspiing fiom
the cioss shown. Recombinant piogeny will have the genotype "$"%#%#% oi "%"%#$#%& Inuiviuuals #S,
#8, #1S aie iecombinant, so the iecombination fiequency is S1S=2u%.

N o l e c u l a i N a i k e i s | !"BK


piesent in peisons with the uisease, but not in healthy subjects. The
moleculai maikei is piesumeu to be tightly linkeu to the gene that
causes the uisease, although this piotein-couing gene may itself be
unknown. The piesence of a paiticulai moleculai polymoiphism may
theiefoie be useu to uiagnose a uisease, oi to auvise an inuiviuual of
susceptibility to a uisease.
Noleculai maikeis may also be useu in a similai way in agiicultuie.
Foi example, maikeis associateu with uesiiable tiaits can be iuentifieu
by scieening both the tiaits anu moleculai maikei genotypes of
hunuieus of inuiviuuals. Naikeis that aie linkeu to uesiiable tiaits can
then be useu uuiing bieeuing to select vaiieties with economically
useful combinations of tiaits, even when the genes unueilying the tiaits
aie not known.
$'&(&) *+",-.-"-./0 -1".- 234+5 6*-27 8"99.,:
Noleculai maikeis can be useu to iuentify iegions of chiomosomes that
contain genes that act togethei to piouuce complex tiaits. This
piocess involves finuing combinations of alleles of moleculai maikeis
that aie coiielateu with a quantitative phenotype such as bouy mass, oi
intelligence. QTL mapping is uesciibeu in moie uetail in the following
section.
1u.S Q0ANTITATIvE TRAIT L0C0S ANALYSIS
Nost of the phenotypic tiaits commonly useu in intiouuctoiy genetics
aie qualitative, meaning that the phenotype exists in only two (oi
possibly a few moie) alteinative foims, such as eithei puiple oi white
floweis, oi ieu oi white eyes. These qualitative tiaits aie theiefoie saiu
to exhibit L@?:=9F9 M<=@<F@7E. 0n the othei hanu, many inteiesting anu
impoitant tiaits exhibit :7EF@E;7;? M<=@<F@7E; these exhibit a
continuous iange of phenotypes that aie usually measuieu
quantitatively, such as intelligence, bouy mass, bloou piessuie in
animals incluuing humans, anu yielu, watei use, oi vitamin content in
ciops. Tiaits with continuous vaiiation aie often complex, anu uo not
show the simple Nenuelian segiegation iatios (e.g. S:1) obseiveu with
some qualitative tiaits. Nany complex tiaits aie also influenceu heavily
by the enviionment. Neveitheless, complex tiaits can often be shown
to have a component that is heiitable, anu which must theiefoie involve
one oi moie genes.
Bow can genes, which aie inheiiteu (in the case of a uiploiu) as at most
two vaiiants each, explain the wiue iange of continuous vaiiation
obseiveu foi many tiaits. The lack of an immeuiately obvious
explanation to this question was one of the eaily objections to Nenuel's
explanation of the mechanisms of heieuity. Bowevei, upon fuithei
consiueiation, it becomes cleai that the moie loci that contiibute to
tiait, the moie phenotypic classes may be obseiveu foi that tiait
(Figuie 1u.6). If the numbei of phenotypic classes is sufficiently laige,
N o l e c u l a i N a i k e i s | !"BN




Figure 10.6 Punnett
Squares for one, two, or
three loci. We are using
a simplified example of
up to three semi-
dominant genes, and in
each case the effect on
the phenotype is
additive, meaning the
more upper case
alleles present, the
stronger the phenotype.
Comparison of the
Punnett Squares and the
associated phenotypes
shows that under these
conditions, the larger the
number of genes that
affect a trait, the more
intermediate phenotypic
classes that will be
expected.
N o l e c u l a i N a i k e i s | !"BO


inuiviuual classes may become inuistinguishable fiom each othei
(paiticulaily when enviionmental effects aie incluueu), anu the iesult
is continuous vaiiation (Figuie 1u.7). Thus, quantitative tiaits aie
sometimes calleu P78QA9E@: F=<@F?, because it is assumeu that theii
phenotypes aie contiolleu by the combineu activity of many genes.
Note that this uoes not imply that each of the inuiviuual genes has an
equal influence on a polygenic tiait. Fuitheimoie, any give gene may
influence moie than one tiait, whethei these tiaits aie quantitative oi
qualitative tiaits.


We can use moleculai maikeis to iuentify at least some of the genes
that affect a given quantitative tiait. This is essentially an extension of
the mapping techniques we have alieauy consiueieu foi uisciete tiaits.
A QTL mapping expeiiment will iueally stait with two puie-bieeuing
lines that uiffei gieatly fiom each othei in iespect to one oi moie
quantitative tiaits (Figuie 1u.8). The paients anu all of theii piogeny
shoulu be iaiseu in unuei similai enviionmental conuitions, to ensuie
that obseiveu vaiiation is uue to genetic iathei than exteinal factois.
These paiental lines must also be polymoiphic foi a laige numbei of
moleculai loci, meaning that they must have uiffeient alleles fiom each
othei at hunuieus of loci. The paiental lines aie ciosseu, anu then this
F1 inuiviuual, in which iecombination between paiental chiomosomes
has occuiieu is self-feitilizeu (oi back-ciosseu). Because of
iecombination, each of the F2 inuiviuuals will contain a uiffeient
combination of moleculai maikeis, anu also a uiffeient combination of
alleles foi the genes that contiol the quantitative tiait of inteiest (Table
1u.1). By compaiing the moleculai maikei genotypes of seveial
hunuieu F2 inuiviuuals with theii quantitative phenotypes, a ieseaichei
can iuentify moleculai maikeis foi which the piesence of paiticulai
alleles is always associateu with extieme values of the tiait. In this way,
iegions of chiomosomes that contain genes that contiibute to
quantitative tiaits can be iuentifieu. (Figuie 1u.9) It then takes much
moie woik (fuithei mapping anu othei expeiimentation) to iuentify
the inuiviuual genes in each of the iegions that contiol the quantitative
tiait.

Figure 10.7 The more
loci that affect a trait,
the larger the number
of phenotypic classes
that can be expected.
For some traits, the
number of contributing
loci is so large that the
phenotypic classes
blend together in
apparently continuous
variation.
N o l e c u l a i N a i k e i s | !"BR

Figure 10.8 Strategy for a typical QTL mapping experiment. Two parents that differ in a quantitative trait
(e.g. fruit mass) are crossed, and the F
1
is self-fertilized (as shown by the cross-in-circle symbol). The F
2

progeny will show a range of quantitative values for the trait. The task is then to identify alleles of
markers from one parent that are strongly correlated with the quantitative trait. For example, markers
from the large-fruit parent that are always present in large-fruit F
2
individuals (but never in small-fruit
individuals) are likely linked to loci that control fruit mass.
N o l e c u l a i N a i k e i s | !"B!"




-<S89 !"#! uenotypes anu quantitative uata foi some inuiviuuals fiom the ciosses shown in
Figuie 1u.8

genotype
fiuit
mass
P "$"$#$#$4$4$;$;$0$0$<$<$:$:$=$=$>$>$?$?$ 1ug
P "%"%#%#%4%4%;%;%0%0%<%<%:%:%=%=%>%>%?%?% 9ug
F1 "$"%#$#%4$4%;$;%0$0%<$<%:$:%=$=%>$>%?$?% Sug
F2 #uu1 "$"$#$#%4$4$;%;%0$0%<$<%:$:%=$=$>$>%?$?% 8ug
F2 #uu2 "$"%#$#%4$4%;$;$0$0%<$<%:%:%=$=%>%>%?$?$ 1ug
F2 #uuS "%"%#$#%4%4%;$;%0$0%<$<%:$:$=$=%>$>%?$?% Sug
F2 #uu4 "$"%#$#%4$4%;$;%0$0%<$<%:$:%=$=%>$>%?%?% 6ug
F2 #uuS "$"%#$#$4$4%;%;%0$0%<$<%:$:%=$=%>$>$?%?% 9ug
F2 #uu6 "$"%#%#%4$4%;$;%0$0%<$<%:%:%=$=%>$>%?$?% 6ug
F2 #uu7 "%"%#$#$4$4%;%;%0$0%<$<%:$:$=$=%>$>$?$?% 8ug
F2 #uu8 "$"$#$#%4$4%;$;%0$0%<$<%:$:%=$=%>$>%?$?% Sug
F2 #uu9 "$"%#$#%4%4%;$;%0$0%<$<%:$:%=$=%>$>%?$?% Sug
F2 #u1u "$"%#$#%4$4%;$;%0$0%<$<%:$:%=$=%>$>%?%?% Sug
F2 #u11 "$"%#$#%4$4%;%;%0$0$<$<%:$:%=$=%>$>%?$?% 8ug
F2 #u12 "$"$#$#%4$4%;$;$0$0%<%<%:$:%=$=%>$>%?%?% Sug
F2 #u1S "%"%#$#$4$4%;$;$0$0%<$<$:$:%=%=%>$>$?$?$ 1ug
N o l e c u l a i N a i k e i s | !"B!!
F2 #u14 "%"%#$#$4$4$;%;%0$0%<$<%:$:%=$=%>$>$?$?$ 7ug
F2 #u1S "%"%#%#%4$4%;$;%0$0%<%<%:$:%=$=$>%>%?$?% 4ug
F2 #u16 "$"%#%#%4$4%;$;$0$0%<$<$:%:%=$=$>$>%?$?$ 1ug
F2 #u17 "$"%#%#%4$4%;%;%0%0%<$<$:%:%=$=%>$>%?%?% 9ug
F2 #u18 "$"%#%#%4$4%;$;%0$0%<$<$:%:%=$=%>$>%?$?$ 4ug
F2 #u19 "$"$#$#%4$4%;$;$0$0%<%<%:$:$=$=$>$>%?$?% 2ug
F2 #1uu "$"$#$#%4$4%;%;%0$0%<$<%:%:%=$=%>%>%?$?% 8ug




Figure 10.9 Plots of fruit mass and genotype for selected loci from Table 10.1. For most loci (e.g. H), the
genotype shows no significant correlation with fruit weight. However, for some molecular markers, the
genotype will be highly correlated with fruit weight. Both D and K influence fruit weight, but the effect
of genotype at locus D is larger than at locus K.
N o l e c u l a i N a i k e i s | !"B!C


______________________________________________________________________________________
S0NNARY:
Natuial vaiiations in the length oi iuentity of BNA sequences occui at millions of
locations thioughout most genomes.
BNA polymoiphisms aie often neutial, but because of linkage may be useu as moleculai
maikeis to iuentify iegions of genomes that contain genes of inteiest.
Noleculai maikeis aie useful because of theii neutiality, co-uominance, uensity, allele
fiequencies, ease of uetection, anu expiession in all tissues.
Noleculai maikeis can be useu foi any application in which the iuentity of two BNA
samples is to be compaieu, oi when a paiticulai iegion of a chiomosome is to be
coiielateu with inheiitance of a tiait.
Nany impoitant tiaits show continuous, iathei than uisciete vaiiation. These aie also
calleu quantitative tiaits.
Nany quantitative tiaits aie influenceu by a combination of enviionment anu genetics.
The heiitable component of quantitative tiaits can best be stuuieu unuei contiolleu
conuitions, with puie-bieeuing paients that aie polymoiphic foi both a quantitative tiait
anu a laige numbei of moleculai maikeis.
Noleculai maikeis can be iuentifieu foi which specific alleles aie tightly coiielateu with
the quantitative value of a paiticulai phenotype. The genes that aie linkeu to these
maikeis can be iuentifieu thiough subsequent ieseaich.

KEY TERNS:
moleculai maikei
iepetitive BNA
SSR
SSLP
vNTR
SNP
RFLP
neutial mutation
QTL
uisciete vaiiation
continuous vaiiation
polygenic


N o l e c u l a i N a i k e i s | !"B!D

ST0BY Q0ESTI0NS:
!"#! Thiee uiffeient polymoiphisms have been iuentifieu at a paiticulai moleculai maikei locus.
A single paii of PCR piimeis will amplify eithei a Subp fiagment (#%), a 6ubp fiagment (#@), oi a
1uubp fiagment (#().
Biaw the PCR banus that woulu be expecteu if these piimeis weie useu to amplify BNA
fiom inuiviuuals with each of the following genotypes:
<T #%#%
ST #(#(
:T #%#@
LT #%#(


!"#C In auuition to the piimeis useu to genotype locus # (uesciibeu above), a sepaiate paii of
piimeis can amplify anothei polymoiphic SSR locus 0A with eithei a 6ubp piouuct (0$) oi a 9ubp
(0%) piouuct. BNA was extiacteu fiom six inuiviuuals (#1- #6), anu BNA fiom each inuiviuual
was useu as a template in sepaiate PCR ieactions with piimeis foi eithei locus # oi piimeis foi
locus 0, anu the PCR piouucts weie visualizeu on electiophoietic gels as shown below.
Baseu on the following PCR banuing patteins, what is the full genotype of each of the six
inuiviuuals.


!"#D Baseu on the genotypes you iecoiueu in Question 1u.2, can you ueteimine which of the
inuiviuuals coulu be a paient of inuiviuual #1.
!"#G Beie is pait of the BNA sequence of a chiomosome:

TAAAGGAATCAATTACTTCTGTGTGTGTGTGTGTGTGTGTGTGTTCTTAGTTGTTTAAGTTTTAAGTTGTGA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ATTTCCTTAGTTAATGAAGACACACACACACACACACACACACAAGAATCAACAAATTCAAAATTCAACACT

Iuentify the following featuies on the sequence:

N o l e c u l a i N a i k e i s | !"B!G


<T the iegion of the fiagment that is most likely to be polymoiphic
ST any simple sequence iepeats
c) the best taiget sites foi PCR piimeis that coulu be useu to uetect
polymoiphisms in the length of the simple sequence iepeat iegion in uiffeient
inuiviuuals

!"#J In a paiticulai uiploiu plant, seeu coloi is a polygenic tiait. If tiue-bieeuing plants that
piouuce ieu seeus aie ciosseu with tiue bieeuing plants that piouuce white seeus, the F1
piouuces seeus that aie inteimeuiate in coloi (i.e. pink). When an F1 plant self-feitilizes,
white seeus aie obseiveu in the next geneiation. Bow many genes aie involveu in seeu coloi
foi each of the following fiequencies of white seeus in the F2 geneiation.

<T 14 white seeus
ST 116 white seeus
:T 164 white seeus
LT 12S6 white seeus

!"#K If height in humans is a polygenic tiait, explain why it occasionally happens that two tall
paients have a chilu who giows up to be much shoitei than eithei of them.

!"#N In quantitative tiait (QTL) mapping, ieseaicheis cioss two paients that uiffei in
expiession of some quantitative tiait, then allow chiomosomes fiom these paients to
iecombine ianuomly, anu aftei seveial geneiations of inbieeuing, piouuce a laige numbei of
offspiing ("iecombinant inbieu lines"). Because the position of ciossoveis is ianuom, each of
the offspiing contain a uiffeient combination of chiomosomal iegions fiom each of the two
paients. The ieseaicheis then use moleculai maikeis to ueteimine which chiomosomal
iegions have the gieatest influence on the quantitative tiait, e.g. in tall offspiing, which
chiomosomal iegions always come fiom the tall paient.
N o l e c u l a i N a i k e i s | !"B!J

Imagine that two mice stiains have been iuentifieu that uiffei in the time iequiieu to complete a
maze, which may be an inuication of intelligence. The time foi maze completion is heiitable anu
these paiental stiains "bieeu tiue" foi the same completion time in each geneiation. Imagine
also that theii chiomosomes aie uiffeient colois anu we can tiack the inheiitance of
chiomosomal iegions fiom each paient baseu on this coloi.

Baseu on the following uiagiams of one chiomosome fiom each inuiviuual in a peuigiee,
iuentify a chiomosomal iegion that may contain a gene that affects time to complete a
maze. The time foi each inuiviuual is shown below each chiomosome. Assume that all
inuiviuuals aie homozygous foi all loci.
Paients:



Selecteu inuiviuuals fiom among F8 piogeny of the above paients:






!"#O In a moie iealistic situation (as compaieu to question 7), wheie you coulu not uistinguish
the paiental oiigin of uiffeient chiomosomal iegions just by appeaiance of chiomosomes,
explain how you coulu iuentify which paient was the souice of a paiticulai iegion of a
chiomosome in iecombinant offspiing.
1
u
u

s
e
c
2
u
u

s
e
c
1
1
u

s
e
c
2
1
u

s
e
c
1
1
S

s
e
c
1
2
u

s
e
c
1
9
S

s
e
c
1
8
S

s
e
c
1
2
u

s
e
c
1
1
u

s
e
c
1
9
u

s
e
c
N o l e c u l a i N a i k e i s | !"B!K







Imagine that you coulu iuentify anu quantify eveiy molecule within a cell
(Figuie 11.1) in a single assay. You coulu use this ability to bettei unueistanu
almost any aspect of biology. Foi example, by compaiing the moleculai
piofiles of plants that uiffeieu in theii iesistance to uiought, you might
uiscovei which combination of genes oi pioteins makes a ciop uiought
toleiant. Although it is not cuiiently possible to stuuy liteially eveiy molecule
in a cell in a single expeiiment, iecent auvances in moleculai biology have
maue it possible to stuuy many genes (oi theii
piouucts) in paiallel.

!!"! $%&'() *+(,-%.%/'+)
The complete set of BNA within an oiganism is calleu its 012341. /1234567
is theiefoie the laige-scale application of techniques of moleculai biology; the
stuuy of many genes oi even many thousanus of genes at once. This type of
ieseaich is facilitateu by technologies that inciease thioughput (i.e. iate of
analysis), anu ueciease cost. The -34567 suffix has been useu to inuicate high-
thioughput analysis of many types of molecules, incluuing tiansciipts
Chaptei 11 uEN0NICS ANB SYSTENS BI0L0uY
8509:1 !!"! An aitist's
uepiction of pait of an
!"#$%& cell, showing
many uiffeient types of
molecules in theii
typical abunuance.
mRNA appeais as white
lines associateu with
puiple iibosomes, while
BNA anu pioteins such
as histones aie yellow.
.
u e n o m i c s | !!;<


(=:>276:5?=34567), pioteins (?:3=134567), anu the piouucts of enzymatic
ieactions, oi metabolites (41=>@3A34567; Figuie 11.2). Inteipietation of the
laige uata sets geneiateu by -omics ieseaich uepenus on a combination of
computational, biological, anu statistical knowleuge pioviueu by expeits in
@5352B3:4>=567. Attempts to combine infoimation fiom uiffeient types of -
omics stuuies is sometimes calleu 7C7=147 @53A30C.

8509:1 !!"< A woiu clouu listing some of the uiffeient -omics technologies. Teims
that aie moie wiuely useu aie wiitten in the laigest chaiacteis. Theie is no
significance to the coloi of each woiu.
.
!!"< D-E )+FG+-('-/
The puipose of BNA sequencing is to ueteimine the oiuei of nucleotiue bases
within a given fiagment of BNA. This infoimation can be useu to infei the
piotein sequence encoueu by the gene, fiom which fuithei infeiences may be
maue about the gene's function anu its ielationship to othei genes. BNA
sequence infoimation is also useful in stuuying the iegulation of gene
expiession. If BNA sequencing is applieu to the stuuy of many genes, oi even a
whole genome, it is consiueieu an example of genomics.



11.2.1 BIBE0XY SEQ0ENCINu
Recall that BNA polymeiases incoipoiate nucleotiues (uNTPs) into a giowing
stianu of BNA, baseu on the sequence of a template stianu. BNA polymeiases
can geneially auu a new base only to the S'-0B gioup of an existing stianu of
BNA; this is why piimeis aie iequiieu in natuial BNA synthesis anu in
techniques such as PCR. Nost of the cuiiently useu BNA sequencing
techniques iely on the ianuom incoipoiation of mouifieu nucleotiues calleu
teiminatois. Examples of teiminatois aie the uiueoxy nucleotiues (HH-*I7),
which lack a S'-0B gioup anu theiefoie cannot seive as an attachment site foi
the auuition of new bases to a giowing stianu of BNA (Figuie 11.S). Aftei a
uuNTP is incoipoiateu into a stianu of BNA, no fuithei elongation can occui.
Teiminatois labeleu with fluoiescent uyes specific to each of the foui
nucleotiue bases aie paiticulaily useful in BNA sequencing.

Figure 11.3 ddNTPs

u e n o m i c s | !!;J

To sequence a BNA fiagment, you neeu many copies of that fiagment (Figuie
11.4). 0nlike PCR, BNA sequencing uoes not amplify the taiget sequence. In
anothei uiffeience fiom PCR, only one piimei is useu in BNA sequencing. This
piimei is hybiiuizeu to the uenatuieu template BNA, anu ueteimines wheie on
the template stianu the sequencing ieaction will begin. A mixtuie of uNTPs,
fluoiescently labeleu teiminatois, anu BNA polymeiase is auueu to a tube
containing the piimei-template hybiiu. The BNA polymeiase will then
synthesize a new stianu of BNA until a fluoiescently labeleu nucleotiue is
incoipoiateu. Because the ieaction contains millions of template molecules, a
coiiesponuing numbei of shoitei molecules is synthesizeu, each enuing in a
fluoiescent label that coiiesponus to the last base incoipoiateu. The newly
synthesizeu stianus can be uenatuieu fiom the template, anu then sepaiateu
electiophoietically baseu on theii length (Figuie 11.S). Since each banu uiffeis
in length by one nucleotiue, anu the iuentity of that nucleotiue is known fiom
its fluoiescence, the BNA sequence can be ieau simply fiom the oiuei of the
colois in successive banus. In piactice, the maximum length of sequence that
can be ieau fiom a single sequencing ieaction is about 7uubp.


A paiticulaily sensitive electiophoiesis methou useu in the analysis of BNA
sequencing ieactions is calleu capillaiy electiophoiesis (Figuie 11.6). In this
methou, a cuiient pulls the sequencing piouucts thiough a gel-like matiix
that is encaseu in a fine tube of cleai plastic. As in conventional
electiophoiesis, the smallest fiagments move thiough the capillaiy the
fastest. As they pass thiough a point neai the enu of the capillaiy, the
fluoiescent intensity of each uye is ieau. This piouuces a giaph calleu a
chiomatogiam. The sequence is ueteimineu by iuentifying the highest peak
(i.e. the uye with the most intense fluoiescent signal) at each position.



Figure 11.4 A sequencing reactions begins with many identical copies of a template DNA fragment.
The template is denatured, then primers are annealed to the template. Following the addition of
polymerase, regular dNTPS, and fluorescently labeled terminators, extension begins at the primer site.
Elongation proceeds until a fluorescently labeled terminator (shown here in color) is incorporated.

Figure 11.5
Fluorescently labeled
products can be
separated
electrophoretically
based on their length.
u e n o m i c s | !!;K





11.2.2 NEXT-uENERATI0N SEQ0ENCINu

Auvances in technology ovei the past two uecaues have incieaseu the speeu
anu quality of sequencing, while uecieasing the cost. This has become
especially tiue with the most iecently uevelopeu methous calleu next-
geneiation sequencing. Not all of these new methous iely on teiminatois, but
one that uoes is a methou useu in instiuments solu by a company calleu
'AA9452>. Illumina sequenceis use a special vaiiant of PCR calleu biiuge PCR
to make many thousanus of copies of a shoit (~1uubp) template fiagment.
Each of these shoit template fiagments is attacheu in a clustei in a small spot
on a ieaction suiface. Nillions of othei clusteis, each maue by uiffeient
template fiagment, aie locateu at othei positions on the ieaction suiface. BNA
synthesis at each template stianu then pioceeus using uye-labeleu teiminatois
that aie useu aie ieveisible. Synthesis is theiefoie teiminateu (tempoiaiily)
aftei the incoipoiation of each nucleotiue. Thus, aftei the fiist nucleotiue is
incoipoiateu in each stianu, a cameia iecoius the coloi of fluoiescence
emitteu fiom each clustei. The teiminatois aie then mouifieu, anu a seconu
nucleotiue is incoipoiateu in each stianu, anu again the ieaction suiface is
photogiapheu. This cycle is iepeateu a total of 4S times. Because millions of
1uubp templates aie sequenceu in paiallel in a single piocess, Illumina
sequencing is veiy efficient compaieu to othei sequencing techniques.
Bowevei, the shoit length of the templates cuiiently limits the application of
the technology.

Figure 11.6 Fluorescently labeled products can be separated by capillary
electrophoresis, generating a chromatogram from which the sequence can be read.

u e n o m i c s | !!;L

!!"J M,%.+ /+-%&+ )+FG+-('-/
11.S.1 TBE NEEB F0R ASSENBLY
uiven that the length of a single sequencing ieau is somewheie between 4Sbp
anu 7uubp, we aie faceu with a pioblem when we want to ueteimine the
sequence of longei fiagments, incluuing each of the chiomosomes in an entiie
genome such as that of humans (S x1u
9
bp). 0bviously, we neeu to bieak the
genome into smallei fiagments. Theie aie two uiffeient stiategies foi uoing
this: clone-by-clone sequencing, which ielies on the cieation of a physical map,
anu whole genome shotgun sequencing, which uoes not iequiie a physical
map.
11.S.2 PBYSICAL NAPPINu
A physical map is a iepiesentation of a genome, compiiseu of cloneu fiagments
of BNA. The map is theiefoie maue of physical entities (pieces of BNA) iathei
than abstiact concepts such as the linkage fiequencies anu genes that make up
a genetic map. It is usually possible to coiielate genetic anu physical maps, foi
example by iuentifying the clone that contains a paiticulai moleculai maikei.
The connection between physical anu genetic maps allows the genes
unueilying paiticulai mutations to be iuentifieu thiough a piocess call map-
baseu cloning.


To cieate a physical map, laige fiagments of the genome aie cloneu into
plasmiu vectois, oi into laigei vectois calleu bacteiial aitificial chiomosomes
(BACs). BACs can contain appioximately 1uukb fiagments . The set of BACs
piouuceu in a cloning ieaction will be ieuunuant, meaning that uiffeient clones
will contain BNA fiom the same pait of the genome. Because of this
ieuunuancy, it is useful to select the minimum set of clones that iepiesent the
Figure 11.7 A
portion of the
physical map for
human chromosome
4. The entire
chromosome is
shown at left. The
physical map is
made up of small
blue lines, each of
which represents a
cloned piece of DNA
approximately 100kb
in length.
u e n o m i c s | !!;N


entiie genome, anu to oiuei these clones iespective to the sequence of the
oiiginal chiomosome. Note that this is all to be uone without knowing the
complete sequence of each BAC. Naking a physical map may theiefoie iely on
techniques ielateu to Southein blotting: BNA fiom the enus of one BAC is useu
as a piobe to finu clones that contain the same sequence. These clones aie
then assumeu to oveilap each othei. A set of oveilapping clones is calleu a
contig.

11.S.S CL0NE-BY-CL0NE SEQ0ENCINu
Physical mapping, was once consiueieu a pie-iequisite foi whole genome
sequencing. The piocess woulu begin by bieaking the genome into an BAC-
sizeu pieces, aiianging these BACs into a map, then biaking each BAC up into
successively smallei clones, which weie usually then also mappeu. Eventually,
a minimum set of clones woulu be iuentifieu, each of which was small enough
to be sequenceu (Figuie 11.8). Because the oiuei of clones ielative to the
complete chiomosome was known piioi to sequencing, the iesulting sequence
infoimation coulu be easily assembleu into one complete chiomosome at the
enu of the pioject. Clone-by-clone sequencing theiefoie minimizes the numbei
of sequencing ieactions that must be peifoimeu, anu makes sequence
assembly stiaightfoiwaiu. Bowevei, a uiawback of this sequencing stiategy is
the teuious piocess of builuing physical map.

11.S.4 WB0LE uEN0NE SB0Tu0N SEQ0ENCINu
Why not simply bieak the genome into fiagments that aie small enough to be
sequenceu, then ieassemble the genome simply by looking foi oveilaps in the
sequence of each fiagment. This avoius the piocess of making a physical map
(Figuie 11.8). Bowevei, this iequiies many moie sequencing ieactions than
the clone-by-clone methou, because in the shotgun appioach, theie is no way
to avoiu sequencing ieuunuant fiagments. Theie is also a question of the
feasibility of assembling complete chiomosomes baseu simply on the sequence
of many small fiagments. This is paiticulaily a pioblem when the size of the
fiagments is smallei than the length of a iepetitive iegion of BNA.
Neveitheless, it has now been uemonstiateu in the sequencing of iice, human,
anu many othei laige genomes , that whole genome shotgun sequencing is an
efficient way to obtain neaily complete genome sequence. Bowevei, shotgun
assemblies aie iaiely sufficient to iepiesent entiie genomes; the human
genome, foi example, ielieu on a combination of shotgun sequence anu
physical mapping to piouuce contiguous sequence foi the length of each aim of
each chiomosome. Note that because of the highly iepetitive natuie of
centiomeiic anu telomeiic BNA, sequencing piojects iaiely incluue these
heteiochiomatic iegions.

u e n o m i c s | !!;O


11.S.S uEN0NE ANN0TATI0N
An assembleu genome is a stiing of millions of A's,C's,u's,T's. Which of these
iepiesent nucleotiues that encoue pioteins, anu which of these iepiesent
othei featuies of genes anu theii iegulatoiy elements. The piocess of genome
annotation ielies on computeis to uefine featuies such a stait anu stop couons,
intions, exons, anu splice sites. Bowevei, none of the pieuictions maue by
these piogiams is entiiely accuiate, anu must be veiifieu expeiimentally foi
any gene of paiticulai impoitance.

!!"K 8G-(*'%-E. /+-%&'()
Baving iuentifieu putative genes within a genome sequence, how uo we
ueteimine theii function. Techniques of functional genomics aie an
expeiimental appioach to auuiess this question. 0ne wiuely useu technique in
functional genomics is calleu micioaiiay analysis. Nicioaiiays measuie the
abunuance of mRNA foi hunuieus oi thousanus of genes at once. The
abunuance of mRNA of a paiticulai gene is sometimes coiielateu with the
activity of that gene. Foi example, genes that aie involveu in neuional
uevelopment likely piouuce moie mRNA in biain tissue than in heait tissue.
We can theiefoie leain about the ielationship between paiticulai genes an
paiticulai piocesses by compaiing tiansciipt abunuance unuei uiffeient
conuitions.



Figure 11.8 Genome
sequencing strategies.
The figure on the left
shows a clone by-
clone sequencing
strategy, in which the
genome is divided into
progressively smaller
units before
sequencing The figure
on the right is a whole
genome shotgun
strategy.
u e n o m i c s | !!;P





Figure 11.9 An example of a type of DNA microarray. Fluorescently labeled molecules derived from
the transcripts of two tissue samples are hybridized to immobilized DNA molecules on the surface of an
array. The labeled molecules bind in proportion to their abundance in the original tissue samples. The
amount of green or red fluorescence at each spot can be measured using filters for the appropriate
wavelengths. Thus, spots on the micoarray that are more green than red represent genes that are more
abundant in the tissue sample from which green-labeled molecules were derived.

u e n o m i c s | !!;Q
)G&&ERS
uenomics anu ielateu technologies uiffei fiom othei techniques of
moleculai biology laigely because of theii scale; they allow many
uiffeient genes (oi gene piouucts) to be stuuieu in paiallel.
BNA sequencing can be applieu to eithei a single gene, oi in the case of
genomics, to a laige numbei of genes.
Nost BNA sequencing ielies on the incoipoiation of uye-labeleu
teiminatoi molecules, which cieate piouucts that uiffei in length anu
enu in a known nucleotiue. The piouucts can then be sepaiateu baseu
on length, anu the iuentity of the last baseu in each fiagment can be
ueteimineu baseu on fluoiescence.
Next-geneiation sequencing technologies have fuithei ieuuceu costs of
sequencing, thiough miniatuiization anu paiallelization.
Physical maps aie oiueieu sets of clones containing oveilapping pieces
of BNA, which togethei iepiesent laige pieces of chiomosomes.
Whole genomes may be sequenceu using eithei a clone-by-clone
appioach, which iequiieu a physical map, oi by a shot gun appioach, in
which small fiagments aie ianuomly sequenceu.
uenome analysis uoes not enu aftei sequence acquisition; vaiious
featuies of the genome incluuing genes (anu theii intions, exons, etc.)
must be iuentifieu thiough a piocess calleu annotation.
Functional genomics techniques incluuing micioaiiay analysis
coiielate tiansciipt abunuance with paiticulai tissue samples. uenes
whose tiansciipts aie highly abunuant unuei ceitain biological
conuitions may cause oi iesponu to that conuition.

T+S *+R&)
genome
genomics
pioteomics
tiansciiptomics
uuNTP
teiminatoi nucleotiue
capillaiy electiophoiesis
chiomatogiam
next-geneiation sequencing
Ilumina
physical map
BAC
clone-by-clone sequencing
whole genome shotgun
genome annotation
functional genomics
micioaiiay
u e n o m i c s | !!;!U


ST0BY Q0ESTI0NS

11.1 What aie the auvantages of
high-thioughput -omics techniques
compaieu to stuuying a single gene
oi piotein at a time. What aie the
uisauvantages

11.2 What woulu the
chiomatogiam fiom a capillaiy
sequencei look like if you
acciuentally auueu only template,
piimeis, polymeiase, anu
fluoiescent teiminatois to the
sequencing ieaction.

11.S What aie the auvantages anu
uisauvantages of clone-by-clone vs.
whole genome shotgun
sequencing.

11.4 Bow coulu you use BNA
squencing to iuentify new species
of maiine miciooiganisms.



11.S Explain how you coulu use a
micioaiiay to iuentify genes that
aie affecteu uuiing uiought in
wheat.

11.6 A micioaiiay iuentifieu 1uu
genes whose tianciipts aie highly
abunuant in tumois, but not in
noimal tissues. Bo any oi all of
these tiansciipts cause cancei.
Explain youi answei.

11.7 Bow uo you ensuie that each
spot piinteu on a micioaiiay
contains BNA foi only one gene.

11.8 What woulu the spots look
like on a micioaiiay aftei
hybiiuization, if each spot
containeu a mixtuie of genes.

11.9 What woulu the spots look
like if the hybiiuization of gieen
anu ieu labeleu BNA was uone at
low stiingency.




Within an inuiviuual oiganism, eveiy cell contains essentially iuentical
genomic sequence. Bow then uo cells uevelop anu function uiffeiently fiom
each othei. The answei lies in the iegulation of !"#" "%&'"(()*#. 0nly
ceitain genes aie expiesseu (i.e. aie functionally active) unuei any paiticulai
biological ciicumstances. uene expiession is iegulateu at many uiffeient
stages of the piocess that conveits BNA infoimation into active piotein. In the
fiist stage, tiansciipt abunuance can be contiolleu by iegulating the iate of
initiation of tiansciiption, anu the piocessing anu uegiauation of tiansciipts.
In many cases, highei abunuance of a gene's tiansciipts is coiielateu with its
incieaseu expiession. In this chaptei, we will focus on +',#(-')&+)*#,.
'"!/.,+)*#, but be awaie that cells also iegulate the activity of genes in othei
ways. Foi example, by contiolling the iate of tianslation, piocessing,
uegiauation, anu post-tianslational mouification of pioteins anu piotein
complexes.
0120 345 !"# 675869
12.1.1 !"# 0PER0N STR0CT0RE
Eaily insights into mechanisms of tiansciiptional iegulation came fiom stuuies
of $% #'!( by ieseaicheis Fiancois }acob & }acques Nonou. In $% #'!( anu many
othei bacteiia, genes foi seveial uiffeient pioteins may be encoueu on a single
tiansciipt in a unit calleu an *&"'*#. The genes of an opeion shaie the same
tiansciiptional iegulation, but aie tianslateu inuiviuually. With the exception
of )% *!*+",- anu a few othei species, eukaiyotes geneially uo not gioup genes
togethei in opeions.
Chaptei 12 REu0LATI0N 0F uENE EXPRESSI0N
Figure 12.1 The
stickleback is an
example of an organism
for which changes in
the regulation of gene
expression have been
shown to confer a
selective advantage in
some environments.

R e g u l a t i o n | 01:1






$% #'!( encounteis many uiffeient sugais in its enviionment. These sugais,
such as .,-+*(" anu !./-*(", iequiie uiffeient enzymes foi theii metabolism.
Thiee of the enzymes foi lactose metabolism aie gioupeu in the !"# *&"'*#:
!"#$, !"#%, anu !"#& (Figuie 12.2). ."#/ encoues an enzyme calleu ;:
!,.,-+*()<,(", which uigests lactose into its two constituent sugais: glucose
anu galactose. !"#0 is a &"'=",(" that helps to tiansfei lactose into the cell.
Finally, !"#1 is a +',#(:,-"+>.,("; the ielevance of which in lactose
metabolism is not entiiely cleai. $% #'!( activates tiansciiption of the !"#
opeion only when lactose is available foi it to uigest. Piesumably, this avoius
wasting eneigy in the synthesis of enzymes foi which no substiate is piesent.
12.1.2 #(-2 ANB 34",-- REu0LAT0RS
In auuition to the thiee piotein-couing genes, the !"# opeion contains shoit
BNA sequences that uo not encoue pioteins, but aie insteau binuing sites foi
pioteins involveu in tiansciiptional iegulation of the opeion. In the !"#
opeion, these sequences aie calleu 7 ?&'*=*+"'@, 6 ?*&"',+*'@, anu ABC
?AD7:E)#<)#! ()+"@. Collectively, sequence elements such as these aie calleu
#'(:"."="#+( because they must be locateu on the same piece of BNA as the
genes they iegulate. 0n the othei hanu, the pioteins that binu to these #(--
elements aie calleu )*"+(:'"!/.,+*'( because (as uiffusible molecules) they
uo not necessaiily neeu to be encoueu on the same piece of BNA as the genes
they iegulate.

12.1.S !"#5 IS AN ALL0STERICALLY REu0LATEB REPRESS0R
0ne of the majoi 34",--iegulatois of the !"# opeion is encoueu by !"#,% Foui
iuentical molecules of !"#5 pioteins assemble togethei to foim a
F*=*+"+',="' calleu a '"&'"((*' (Figuie 12.S). This iepiessoi binus to two
opeiatoi sequences aujacent to the piomotei of the !"# opeion. Binuing of the
iepiessoi pievents RNA polymeiase fiom binuing to the piomotei (Figuie
12.4). Theiefoie, the opeion cannot be tiansciibeu when the opeiatoi is
occupieu by a iepiessoi.
Besiues its ability to binu to specific BNA sequences at the opeiatoi, anothei
impoitant piopeity of the !"#5 piotein is its ability to binu to lactose. When
lactose is bounu to !"#5, the shape of the piotein changes in a way that pievents
it fiom binuing to the opeiatoi. Theiefoie, in the piesence of lactose, RNA
polymeiase is able to binu to the piomotei anu tiansciibe the !"# opeion,
leauing to a moueiate level of expiession of the !"#/, !"#0, anu !"#1 genes.
Figure 12.2 Diagram
of a segment of an E.
coli chromosome
containing the lac
operon, as well as the
lacI coding region. The
various genes and cis-
elements are not drawn
to scale.
G)!/'" 012H Stiuctuie
of lacI homotetramer
bound to DNA

R e g u l a t i o n | 01:H
Pioteins such as !"#5 that change theii shape anu functional piopeities aftei
binuing to a liganu aie saiu to be iegulateu thiough an ,..*(+"')- mechanism.
The iole of !"#5 in iegulating the !"# opeion is summaiizeu in Figuie 12.4.
12.1.4 )16 IS AN ALL0STERIC ACTIvAT0R 0F TBE .1) 0PER0N
A seconu aspect of !"# opeion iegulation is confeiieu by a 34",--factoi calleu
-DI7 E)#<)#! &'*+")# (AD7, Figuie 12.S). CAP is anothei example of an
allosteiically iegulateu 34",--factoi. 0nly when the CAP piotein is bounu to
cANP can anothei pait of the piotein binu to a specific #(--element within the
!"# piomotei calleu the AD7 E)#<)#! ("J/"#-" ?ABC@. CBS is locateu veiy
close to the piomotei (P). When CAP is bounu to at CBS, RNApol is bettei able
to binu to the piomotei anu initiate tiansciiption. Thus, the piesence of cANP
ultimately leaus to a fuithei inciease in !"# opeion tiansciiption.


The physiological significance of iegulation by cANP becomes moie obvious in
the context of the following infoimation. The concentiation of cANP is
inveisely piopoitional to the abunuance of glucose: when glucose
concentiations aie low, an enzyme calleu ,<"#>.,+" ->-.,(" is able to piouuce
cANP fiom ATP. Eviuently, $% #'!( piefeis glucose ovei lactose, anu so
expiesses the !"# opeion at high levels only when glucose is absent anu lactose
Figure 12.4 When the concentration of lactose [Lac] is low, lacI tetramers bind to
operator sequences (O), thereby blocking binding of RNApol (green) to the promoter (P).
Alternatively, when [Lac] is high, lactose binds to lacI, preventing the repressor from
attaching to O, and allowing transcription by RNApol.
R e g u l a t i o n | 01:K


is piesent. This pioviues anothei layei of logical contiol of !"# opeion
expiession: only in the piesence of lactose, anu in the absence of glucose is the
opeion expiesseu at its highest levels.


0121 IL3D93C 6G 345 !"# 675869
The !"# opeion anu its iegulatois weie fiist chaiacteiizeu by stuuying mutants
of $% #'!( that exhibiteu vaiious abnoimalities in lactose metabolism. Some
mutants expiesseu the !"# opeion genes constitutively, meaning the opeion
was expiesseu whethei lactose was piesent in the meuium oi not. 0ne
example of a -*#(+)+/+)M" mutant is 7
#
, in which a mutation in an opeiatoi
sequence pievents !"#5 fiom iecognizing anu binuing to the opeiatoi. Thus, in
7
#
mutants, !"#/, !"#0, anu !"#1 aie expiesseu whethei lactose is piesent oi not.
A mutant allele of !"#5 (e.g. 5
2
) that pievents it fiom binuing to BNA is also a
constitutive expiessei of the !"# opeion. 0n the othei hanu, a mutant of !"#5
calleu 5
-
pievents it fiom binuing lactose, so that the mutant iepiesses the !"#
opeion whethei lactose is piesent oi not.





Figure 12.5 CAP, when bound to cAMP, helps RNApol to bind to the lac operon. cAMP
is produced only when glucose [Glc] is low.

R e g u l a t i o n | 01:N



Figure 12.6 When glucose [Glc] and lactose [Lac] are both high, the lac operon is transcribed at
a moderate level, because CAP (in the absence of cAMP) is unable to bind to its corresponding
cis-element (yellow) and therefore cannot help to stabilize binding of RNApol at the promoter.
Alternatively, when [Glc] is low, and [Lac] is high, CAP and cAMP can bind near the promoter
and increase further the transcription of the lac operon.

R e g u l a t i o n | 01:O


012H 5LPD8Q63RA S595 85SLTD3R69
12.S.1 REu0LAT0RY ELENENTS IN REu0LAT0RY uENES.
As we have seen in piokaiyotes, tiansciiptional iegulation in eukaiyotes
involves both #(--elements anu 34",--factois. A typical eukaiyotic gene,
incluuing seveial types of #(--elements, is shown in Figuie 12.7. RNA
polymeiase binus to the gene at its piomotei. In eukaiyotes, RNApol is pait of
a laige piotein complex that incluues auuitional pioteins that binu to one oi
moie specific #(--elements neai the piomotei, incluuing SA E*%"(, ADD3
E*%"(, ,#< 3D3D E*%"(. Bigh levels of tiansciiption iequiie both the
piesence of this piotein complex at the piomotei, as well as theii inteiaction
with othei 34",--factois uesciibeu below. The appioximate position of these
elements ielative to the +',#(-')&+)*# (+,'+ ()+" (
+
1) is shown in Figuie 12.7,
but it shoulu be emphasizeu that the uistance between any of these elements
anu the tiansciiption stait site can vaiy.
Even moie vaiiation is obseiveu in the position anu oiientation of the seconu
majoi type of #(--iegulatoiy element in eukaiyotes, which aie calleu
"#F,#-"'(. Regulatoiy 34",--factoi pioteins calleu +',#(-')&+)*# U,-+*'(
binu to enhanceis, then while still bounu to BNA, these pioteins inteiact with
RNApol anu othei pioteins at the piomotei to activate tiansciiption. Specific
tiansciiption factois iecognize the BNA sequence of specific enhanceis to
activate gene expiession in specific ciicumstances. Because BNA is a flexible
molecule, enhanceis can be locateu neai oi fai, anu eithei upstieam oi
uownstieam, fiom the piomotei (Figuie 12.8).



Figure 12.7 Structure of a typical eukaryotic gene. RNA polymerase binding may involve one or more cis-
elements within the region of a promoter (green boxes). Enhancers (yellow boxes) may be located any distance
upstream or downstream of the promoter.

R e g u l a t i o n | 01:V

12.S.2 EXANPLE: BR0S0PBILA YELL0W uENE
The 8*!!'9 gene of Biosophila uemonstiates the mouulai natuie of enhanceis.
This gene is pait of a pathway that piouuces a tan pigment (iecall that genes
aie sometimes nameu aftei theii mutant phenotypes). Each tissue in
Biosophila that makes the black pigment piouuces a specific tiansciiption
factoi that binus to a coiiesponuing enhancei in 8*!!'9 to activate its
tiansciiption (Figuie 12.9). Thus, specific combinations of #(--elements anu
34",--factois contiol the tissue-specific expiession of genes. This is typical of
the tiansciiptional activation of almost any eukaiyotic gene: specific
tiansciiption factois activate (oi in some cases iepiess) the tiansciiption of
taiget genes unuei specific conuitions.







Figure 12.8 A transcription factor (yellow) bound to an enhancer that is located far
from a promoter. Because of the flexibility of the DNA molecule, the transcription
factor and RNApol are able to interact physically, even though the cis-elements to
which they are bound are located far apart. In eukaryotic cells, RNApol is actually part
of a large complex of proteins (not shown here) that assembles at the promoter.
Figure 12.9 Tissue-specific cis-regulatory elements within a simplified representation of the yellow gene of Drosophila.
R e g u l a t i o n | 01:W



012K 85SLTD368Q 5T5I593C R9 5X6TL3R69
Nutations can occui in both #(--elements anu 34",--factois, iesulting in alteieu
patteins of gene expiession. If these alteieu patteins of gene expiession
piouuce a selective auvantage (oi at least uo not piouuce a majoi
uisauvantage), they may be maintaineu anu even contiibute to evolution of
new species.
12.4.1 EXANPLE: 65:; EXPRESSI0N IN STICKLEBACK
The thiee-spineu (+)-Y."E,-Y (Figuie 12.1) pioviues an example of natuial
selection of a mutation in a #(--iegulatoiy element. This fish occuis in two
foims: populations that natuially inhabit ueep, open watei have a spiny pelvic
fin that ueteis laigei pieuatoi fish fiom feeuing on the stickleback. Bowevei,
populations of stickleback fiom shallow watei enviionments lack this spiny
pelvic fin. In shallow watei, it appeais that a long, spiny pelvic fin woulu be a
uisauvantage because it fiequently contacts the seuiment at the bottom of the
ponu anu allows paiasitic insects in the seuiment to invaue the stickleback.
Reseaicheis compaieu genomic BNA fiagments of inuiviuuals fiom both ueep
anu shallow watei enviionments as shown in Figuie 12.1u. They obseiveu
that in embiyos fiom the ueep-watei population, a gene calleu 6(3< was
expiesseu in seveial gioups of cells, incluuing those that uevelopeu into the
pelvic fin. Embiyos fiom the shallow-watei population expiesseu 6(3< in the
same gioups of cells as the othei population, with an impoitant exception: 6(3<
was not expiesseu in the pelvic fin &')=*'<)/= in the shallow-watei
population. Fuithei analysis showeu that the absence of 6(3< gene expiession
fiom the ueveloping pelvic fin of shallow-watei stickleback was uue to the
absence of a paiticulai enhancei element upstieam of 6(3<.

G)!/'" 0120Z Development of a large, spiny pelvic fin in stickleback depends on the presence of a particular
enhancer element upstream of a gene called Pitx. Mutants lacking this element (and therefore the large pelvic
fin) have been selected for in shallow-water environments.

R e g u l a t i o n | 01:[

12.4.2 EXANPLE: BEN0uL0BIN EXPRESSI0N IN PLACENTAL NANNALS.
4"=*!.*E)# is the oxygen-caiiying component of ieu bloou cells
(eiythiocytes). Bemoglobin consists of !.*E)# pioteins that aie covalently
attacheu to heme. Beme is not maue of amino acius, but is specializeu
metabolic pathway anu is then bounu to globin thiough &*(+:+',#(.,+)*#,.
=*<)U)-,+)*#. Bemoglobin usually exists as tetiameis of foui non-covalently
bounu hemoglobin molecules (Fig 12.11). The composition of the tetiameis
changes uuiing uevelopment (Fig. 12.12). Fiom eaily chiluhoou onwaiu, most
tetiameis aie of the type !1"1, which means they contain of two copies of each
of two slightly uiffeient globin pioteins nameu ! anu ". A small amount of
auult hemoglobin is !2#2, which has # globin insteau of the moie common "
globin. 0thei tetiameiic combinations pieuominate befoie biith: $2%2 is most
abunuant in embiyos, anu !2&2 is most abunuant in fetuses. Although the six
globin pioteins (! = alpha, " = beta , & = gamma, # =uelta, % =epsilon , $ = zeta)
aie veiy similai to each othei, they uo have slightly uiffeient functional
piopeities. Foi example, fetal hemoglobin has a highei oxygen affinity than
auult hemoglobin, allowing the fetus to moie effectively extiact oxygen fiom
mateinal bloou. The specializeu & globin genes that aie chaiacteiistic of fetal
hemoglobin aie founu only in placental mammals.



Figure 12.11 A
tetramer of human
hemoglobin, type
!2"2. The ! chains
are labeled red, and the
" chains are labeled
blue. Heme groups are
green.
Figure 12.12 Expression of globin genes during prenatal and postnatal development in
humans. The organs in which globin genes are primarily expressed at each
developmental stage are also indicated.
R e g u l a t i o n | 01:0Z



The evolution of the globin genes in the genome is inteiesting. Some of the
globin pioteins (e.g !, &) aie piouuceu by genes at two uiffeient loci, while the
otheis aie encoueu by a single gene each. In humans, globin genes aie locateu
in clusteis on two chiomosomes (Figuie 12.1S). We can infei that these
clusteis aiose thiough successive uuplications of an ancestial globin gene.
uene uuplication occuis thiough iaie eiiois in piocesses such as BNA
ieplication, meiosis, oi tiansposition. The piouucts of a !"#" </&.)-,+)*#
event accumulate mutations inuepenuently of the othei. Nutations can occui
in eithei the iegulatoiy iegions (e.g. piomotei iegions), oi in the couing
iegions, oi both. In this way, the piomoteis of globin genes have evolveu to be
expiesseu at uiffeient phases of uevelopment, anu to piouuce pioteins
optimizeu foi vaiious functions. 0f couise, not all mutations aie beneficial:
mutations can also leau to inactivation one oi moie of the piouucts of a gene
uuplication, which iesults in a &("/<*!"#". Examples of pseuuogenes (') aie
also founu in the globin clusteis. Pseuuogenes have mutations that pievent
them fiom being expiesseu unuei any conuitions. The globin genes pioviue
examples of how mutation anu selection following uuplication allows genes to
evolve specializeu expiession patteins anu functions. Nany genes have
evolveu as !"#" U,=).)"( in this way, although they aie not always clusteieu
togethei as aie the globins.



012N 63458 85SLTD368C 6G 38D9CA8R73R69\
12.S.1 CBR0NATIN BYNANICS
Bespite the simplifieu way in which we often iepiesent BNA in figuies such as
those in this chaptei, BNA is almost nevei entiiely sepaiateu fiom chiomatin
pioteins uuiing inteiphase, anu histones iemain associateu with the BNA at
many positions along the molecule even uuiing tiansciiption. The iate of
tiansciiption is theiefoie also contiolleu by the accessibility of BNA to RNApol
anu iegulatoiy pioteins. If the chiomatin that contains a paiticulai gene is
highly compacteu, it is unlikely that the gene will be tiansciibeu, even if all of
the necessaiy #(-- anu 34",-- factois aie piesent. Cells iegulate the local
stiuctuie of chiomatin thiough the action of pioteins calleu -F'*=,+)#
'"=*<".)#! pioteins. These incluue enzymes that auu oi iemove chemical
tags such as methyl oi acetyl gioups. D-"+>.,+"< histones, foi example, tenu to
be associateu with actively tiansciibeu genes, wheieas ueacetylation can
Figure 12.13
Fragments of human
chromosome 11 and
human chromosome 16
on which are located
clusters of "-like and !-
like goblin genes,
respectively.
Additional globin genes
((, ) have also been
described by some
researchers, but are not
shown here.

R e g u l a t i o n | 01:00
causes associateu genes to be silenceu. Nethylation of BNA itself also iegulates
tiansciiption. Cytosine bases, paiticulaily when followeu by a guanine (A&S
()+"() aie impoitant taigets foi methylation. Nethylateu cytosine within
clusteis of Cpu sites is often associateu with tiansciiptionally inactive BNA.
Reveisible histone mouification anu BNA methylation aie thus anothei layei
by which eukaiyotic cells contiol the tiansciiption of specific genes.
12.S.2 EPIuENETICS
Inteiestingly, some appaient changes in gene expiession aie heiitable. Foi
example, the gianuchiluien of famine victims aie known to have lowei biith
weight than chiluien without a family histoiy of famine. The heiitability of
alteieu states of gene expiession is suipiising, since gene iegulation uoes not
usually involve changes in the sequence of BNA. The teim "&)!"#"+)-(
uesciibes any heiitable change in phenotype that is associateu with a change
in something othei than chiomosomal BNA sequence. Some epigenetic
infoimation is inheiiteu tiansgeneiationally, while in othei cases, the
epigenetic state is inheiiteu following mitotic uivisions, but not following
meiosis. The basis of at least some types of epigenetic inheiitance appeais to
be the ieplication of patteins of histone mouifications anu BNA methylation in
paiallel with the ieplication of the piimaiy BNA sequence. It is becoming cleai
that epigenetics is an impoitant pait of biology, anu can seive as a type of
cellulai memoiy, sometimes within an inuiviuual, oi sometimes acioss a few
geneiations.



12.S.S vERNALIZATI0N AS AN EXANPLE 0F EPIuENETICS
Nany plant species in tempeiate iegions aie ])#+"' ,##/,.(, meaning that
theii seeus geiminate in the late summei, anu giow vegetatively thiough eaily
fall befoie enteiing a uoimant phase uuiing the wintei, often unuei a covei of
G)!/'" 0120K A winter
wheat crop (green) in
early spring in the
English countryside.
R e g u l a t i o n | 01:01


snow. In the spiing, the plant iesumes giowth anu is able to piouuce seeus
befoie othei species that geiminateu in the spiing. In oiuei foi this life
stiategy to woik, the wintei annual must not iesume giowth oi stait flowei
piouuction until wintei has enueu. X"'#,.)^,+)*# is the name given to the
iequiiement to expeiience a long peiiou of colu tempeiatuies piioi to
floweiing.
Bow uoes a plant sense that wintei has passeu. The signal foi iesuming
giowth cannot simply be waim aii tempeiatuie, since occasional waim uays,
followeu by long peiious of fieezing, aie common in tempeiate climates.
Reseaicheis have uiscoveieu that wintei annuals use epigenetic mechanisms
to sense anu "iemembei" that wintei has occuiieu
Foitunately foi the ieseaicheis who weie inteiesteu in veinalization, some
vaiieties of Aiabiuopsis aie wintei annuals. Thiough mutational analysis of
Aiabiuopsis, ieseaicheis founu that a gene calleu =.) (=.7>$?5@A .7)BC ))
is a iepiessoi of the tiansciiption of seveial of the genes involveu in eaily
stages of floweiing (Figuie 12.1S). In the fall anu unuei othei waim
conuitions, the histones associateu with =.) aie acetylateu anu so =.) is
tiansciibeu at high levels; expiession of floweiing genes is theiefoie entiiely
iepiesseu. Bowevei, in iesponse to colu tempeiatuies, enzymes giauually
ueacetylate the histones associateu with =.). The longei the colu
tempeiatuies peisist, the moie acetyl gioups aie iemoveu fiom the =.)-
associateu histones, until finally the =.) locus is no longei tiansciibeu anu the
floweiing genes aie fiee to iesponu to othei enviionmental anu hoimonal
signals that inuuce floweiing latei in the spiing. Because the ueacetylateu
state of =.) is inheiiteu as cells uiviue anu the plant giows in the eaily spiing,
this is an example of a type of cellulai memoiy meuiateu by an epigenetic
mechanism


G)!/'" 0120N In the autumn, histones associated with FLC are acetylated, allowing this repressor of
flowering genes to be expressed. During winter, enzymes progressive deacetylate FLC, preventing it from
being expressed, and therefore allowing flowering genes to respond to other signals that induce flowering.

R e g u l a t i o n | 01:0H




CLIID8Q\
Regulation of gene expiession is essential to the noimal uevelopment anu
efficient functioning of cells
uene expiession may be iegulateu by many mechanisms, incluuing those
affecting tiansciipt abunuance, piotein abunuance, anu post-tianslational
mouifications
Regulation of tiansciipt abunuance may involve contiolling the iate of
initiation anu elongation of tiansciiption, as well as tiansciipt splicing,
stability, anu tuinovei
The iate of initiation of tiansciiption is ielateu to the piesence of RNA
polymeiase anu associateu pioteins at the piomotei.
RNApol may be blockeu fiom the piomotei by iepiessois, oi may be ieciuiteu
oi stabilizeu at the piomotei by othei pioteins incluuing tiansciiption factois
The !"# opeion is an impoitant paiauigm uemonstiating both positive anu
negative iegulation thiough allosteiic effects on 34",--factois.
In eukaiyotes, #(--elements that aie usually calleu enhanceis binu to specific
34",--factois to iegulate tiansciiptional initiation.
Enhanceis may be mouulai, with each enhancei anu its tiansciiption factoi
iegulating a uistinct component of a gene's expiession pattein, as in the 8*!!'9
gene.
Sticklebacks pioviue examples of iecent evolutionaiy events in which
mutation of an enhancei piouuceu a change in moiphology anu a selective
auvantage.
Chiomatin stiuctuie, incluuing ieveisible mouifications such as acetylation of
histones, anu BNA methylation Cpu sites also iegulates the initiation of
tiansciiption.
Chiomatin mouifications oi BNA methylation of some genes aie heiitable ovei
many mitotic, anu sometimes even meiotic uivisions.
Beiitable changes in phenotype that uo not iesult fiom a change in BNA
sequence aie calleu epigenetic. Nany epigenetic phenomena involve
iegulation of gene expiession by chiomatin mouification anuoi BNA
methylation.
R e g u l a t i o n | 01:0K


P5Q 358IC\
gene expiession
tiansciiptional iegulation
opeion
lactose
glucose
lac opeion
!"#/
!"#0
!"#1
galactosiuase
peimease
tians-acetylase
P
piomotei
0
opeiatoi
CBS
CAP-binuing site
cis-elements
tians-iegulatois
!"#5
homotetiamei
iepiessoi
allosteiic
cANP binuing piotein
CAP
CAP binuing sequence
CBS
auenylate cyclase
constitutive
7
#

5
2

5
-

uC boxes
CAAT boxes
TATA boxes
tiansciiption stait site
enhanceis
tiansciiption factois
stickleback
piimoiuium
chiomatin iemoueling
acetylation
ueacetylation
methylation
Cpu
epigenetics
wintei annual
veinalization
=.)


R e g u l a t i o n | 01:0N
C3L_Q `L5C3R69C\
0120 List all the mechanisms that
can be useu to iegulate gene
expiession in eukaiyotes.

0121 With iespect to the
expiession of -galactosiuase, what
woulu be the phenotype of each of
the following stiains of $% #'!(.

a) 5
D
E 7
D
E /
D
E 0
D
(no glucose, no
lactose)
b) 5
D
E 7
D
E /
D
E 0
D
(no glucose, high
lactose)
c) 5
D
E 7
D
E /
D
E 0
D
(high glucose, no
lactose)
u) 5
D
E 7
D
E /
D
E 0
D
(high glucose, high
lactose)
e) 5
D
E 7
D
E /
2
E 0
D
(no glucose, no
lactose)
f) 5
D
E 7
D
E /
2
E 0
D
(high glucose, high
lactose)
g) 5
D
E 7
D
E /
D
E 0
2
(high glucose, high
lactose)
h) 5
D
E 7#E /
D
E 0
D
(no glucose, no
lactose)
i) 5
D
E 7#E/
D
E 0
D
(no glucose, high
lactose)
j) 5
D
E 7#E /
D
E 0
D
(high glucose, no
lactose)
k) 5
D
E 7#E /
D
E 0
D
(high glucose, high
lactose)
l) 5
2
E 7
D
E /
D
E 0
D
(no glucose, no
lactose)
m) 5
2
E 7
D
E /
D
E 0
D
(no glucose, high
lactose)
n) 5
2
E 7
D
E /
D
E 0
D
(high glucose, no
lactose)
o) 5
2
E 7
D
E /
D
E 0
D
(high glucose, high
lactose)
p) 5
-
E 7
D
E /
D
E 0
D
(no glucose, no
lactose)
q) 5
-
E 7
D
E /
D
E 0
D
(no glucose, high
lactose)
i) 5
-
E 7
D
E /
D
E 0
D
(high glucose, no
lactose)
s) 5
-
E 7
D
E /
D
E 0
D
(high glucose, high
lactose)

012H In the $% #'!( stiains listeu
below, some genes aie piesent on
both the chiomosome, anu the
extiachiomosomal F
-
factoi
episome. The genotypes of the
chiomosome anu episome aie
sepaiateu by a slash. What will be
the
-
galactosiuase phenotype of
these stiains. All of the stiains aie
giown in meuia that lacks glucose.

a) 5
D
E 7
D
E /
D
E 0
D
F 7
2
E /
2
E 0
2
(high
lactose)
b) 5
D
E 7
D
E /
D
E 0
D
F 7
2
E /
2
E 0
2
(no
lactose)
c) 5
D
E 7
D
E /
2
E 0
D
F 7
2
E /
D
E 0
D
(high
lactose)
u) 5
D
E 7
D
E /
2
E 0
D
F 7
2
E /
D
E 0
D
(no
lactose)
e) 5
D
E 7
D
E /
2
E 0
D
F 5
2
E 7
D
E /
D
E 0
D
(high
lactose)
f) 5
D
E 7
D
E /
2
E 0
D
F 5
2
E 7
D
E /
D
E 0
D
(no
lactose)
g) 5
2
E 7
D
E /
D
E 0
D
F 5
D
E 7
D
E /
2
E 0
D
(high
lactose)
h) 5
2
E 7
D
E /
D
E 0
D
F 5
D
E 7
D
E /
2
E 0
D
(no
lactose)
i) 5
D
E 7#E /
D
E 0
D
F 5
D
E 7
D
E /
2
E 0
D
(high
lactose)
j) 5
D
E 7#E /
D
E 0
D
F 5
D
E 7
D
E /
2
E 0
D
(no
lactose)
k) 5
D
E 7
D
E /
2
E 0
D
F 5
D
E 7#E /
D
E 0
D
(high
lactose)
l) 5
D
E 7
D
E /
2
E 0
D
F 5
D
E 7#E /
D
E 0
D
(no
lactose)
m) 5
D
E 7
D
E /
2
E 0
D
F 5
-
E 7
D
E /
D
E 0
D
(high
lactose)
n) 5
D
E 7
D
E /
2
E 0
D
F 5
-
E 7
D
E /
D
E 0
D
(no
lactose)
o) 5
-
E 7
D
E /
D
E 0
D
F 5
D
E 7
D
E /
2
E 0
D
(high
lactose)
p) 5
-
E 7
D
E /
D
E 0
D
F 5
D
E 7
D
E /
2
E 0
D
(no
lactose)

012K What genotypes of $% #'!(
woulu be most useful in
uemonstiating that the !"#7
R e g u l a t i o n | 01:0O


opeiatoi is a #(--acting iegulatoiy
factoi.

012N What genotypes of E. coli
woulu be useful in uemonstiating
that the !"#5 iepiessoi is a 34",--
acting iegulatoiy factoi.

012O What woulu be the effect of
the following loss-of-function
mutations on the expiession of the
lac opeion.

a) loss-of-function of auenylate
cyclase
b) loss of BNA binuing ability of
CAP
c) loss of cANP binuing ability of
CAP
u) mutation of CAP binuing site
(CBS) #(--element so that CAP coulu
not binu

012V Bow aie eukaiyotic anu
piokaiyotic gene iegulation
systems similai. Bow aie they
uiffeient.

012W Beep-watei sticklebacks that
aie heteiozygous foi a loss-of-
function mutation in the couing
iegion of 6(3< look just like
homozygous wilu-type fish fiom
the same population. What
phenotype oi phenotypes woulu be
obseiveu if a wilu-type fish fiom a
ueep-watei population mateu with
a wilu-type fish fiom a shallow-
watei population.

012[ Some vaiieties of Aiabiuopsis,
incluuing those auopteu foi lab use,
uo not iequiie veinalization befoie
floweiing. Bow might these
vaiieties have evolveu.

0120Z Bistone ueacetylase (BBAC)
is an enzyme involveu in gene
iegulation. What might be the
phenotype of a wintei annual plant
that lackeu BBAC function.




Cancei is a gioup of uiseases that exhibit uncontiolleu giowth, invasion of
aujacent tissues, anu sometimes !"#$%#$%&% (the movement of cancei cells
thiough the bloou oi lymph). In cancei cells, the iegulatoiy mechanisms that
contiol cell uivision anu limit abnoimal giowth have been uisiupteu, usually
by the accumulation of seveial mutations. Cancei is theiefoie essentially a
genetic uisease. Although some cancei-ielateu mutations may be heiitable,
most canceis aie spoiauic, meaning they aiise fiom new mutations that occui
in the inuiviuual who has the uisease. In this chaptei we will examine the
connection between cancei anu genes.
'()' +,-../0/+-1/23 20 +-3+45.
Canceis can be classifieu baseu on the tissues in which they oiiginate.
.$678!$% aie canceis that oiiginate in mesoueim tissues, such as bone oi
muscle, anu canceis aiising in glanuulai tissues (e.g. bieast, piostate) aie
classifieu as $9":87$67&:8!$%. +$67&:8!$% oiiginate in epithelial cells (both
insiue the bouy anu on its suiface) anu aie the most common types of cancei
(~8S%). Each of these classifications may be fuithei sub-uiviueu. Foi
example, %;<$!8<% 7"== 7$67&:8!$ >.++?, @$%$= 7"== 7$67&:8!$ >A++?, anu
!"=$:8!$ aie all types of skin canceis oiiginating iespectively in the
squamous cells, basal cells, oi melanocytes of the skin.



Chaptei 1S CANCER uENETICS
0&B<6" '()' Staineu
histological section of
a neuioblastoma in an
auienal glanu. Photo
Cieuit Eu 0thman, N.B.
.
C a n c e i | '(CD


'()D +-3+45 +4,, A/2,2EF

Cancei is a piogiessive uisease that usually begins with incieaseu fiequency of
cell uivision (Figuie 1S.2). 0nuei the micioscope, this may be uetectable as
incieaseu cellulai anu nucleai size, anu an incieaseu piopoition of cells
unueigoing mitosis. As the uisease piogiesses, cells typically lose theii noimal
shape anu tissue oiganization. Tissues with incieaseu cell uivision anu
abnoimal tissue oiganization exhibit 9G%H=$%&$. Eventually a tumoi uevelops,
which can giow iapiuly anu expanu into aujacent tissues. As cellulai uamage
accumulates anu auuitional contiol mechanisms aie lost, some cells may bieak
fiee of the piimaiy tumoi, pass into the bloou oi lymph system, anu be
tianspoiteu to anothei oigan, wheie they uevelop into new tumois (Figuie
1S.S). The eaily uetection of tumois is impoitant so that they can be tieateu oi
iemoveu befoie the onset of metastasis, but note that not all tumois will leau
to cancei. Tumois that uo not metastasize aie classifieu as @":&B:I anu aie not
usually consiueieu life thieatening. In contiast, !$=&B:$:# tumois become
invasive, anu ultimately iesult in cancei.






0&B<6" '()D Piogiessive
incieases in cell uivision
anu abnoimal cell
moiphology associateu
with cancei
0&B<6" '()( Seconuaiy
tumois (white) uevelop in
the livei fiom cells of a
metastatic pancieatic
cancei.
.
C a n c e i | '(C(
'()( J-,,K-5L. 20 +-3+45

Reseaicheis have inuentifieu six moleculai anu cellulai tiaits that chaiacteiize
most canceis. These six hallmaiks of cancei aie summaiizeu in Table 1S.1. In
this chaptei, we will focus on the fiist two hallmaiks, namely giowth signal
autonomy anu insensitivity to anti-giowth signals.

Table 1S.1 Ten Ballmaiks of Cancei (Banahan anu Weinbeig, 2uuu; Banahan
2u11)
1. uiowth signal autonomy
Cancei cells can uiviue without the exteinal signals noimally iequiieu
to stimulate uivision.
2. Insensitivity to giowth inhibitoiy signals
Cancei cells aie unaffecteu by exteinal signals that inhibit uivision of
noimal cells.
S. Evasion of apoptosis
When excessive BNA uamage anu othei abnoimalities aie uetecteu,
apoptosis (a type of piogiammeu cell ueath) is inuuceu in noimal cells,
but not in cancei cells.
4. Repiouuctive potential not limiteu by telomeies
Each uivision of a noimal cell ieuuces the length of its telomeies.
Noimal cells aiiest fuithei uivision once telomeies ieach a ceitain
length. Cancei cells avoiu this aiiest anuoi maintain the length of
theii telomeies.
S. Sustaineu angiogenesis
Nost canceis iequiie the giowth of new bloou vessels into the tumoi.
Noimal angiogenesis is iegulateu by both inhibitoiy anu stimulatoiy
signals not iequiieu in cancei cells.
6. Tissue invasion anu metastasis
Noimal cells geneially uo not migiate (except in embiyo uevelopment).
Cancei cells invaue othei tissues incluuing vital oigans.
7. Beiegulateu metabolic pathways
Cancei cells use an abnoimal metabolism to satisfy a high uemanu foi
eneigy anu nutiients.
8. Evasion of the immune system
Cancei cells aie able to evaue the immune system.
9. Chiomosomal instability
Seveie chiomosomal abnoimalities aie founu in most canceis.
1u. Inflammation
Local chionic inflammation is associateu with many types of cancei.



C a n c e i | '(CM




'()M KN1-E43. -3O +-5+/32E43.

A 7$67&:8B": is any agent that uiiectly incieases the inciuence of cancei.
Nost, but not all caicinogens aie mutagens. Caicinogens that uo not uiiectly
uamage BNA incluue substances that acceleiate cell uivision, theieby leaving
less oppoitunity foi cell to iepaii inuuceu mutations, oi eiiois in ieplication.
Caicinogens that act as mutagens may be biological, physical, oi chemical in
natuie, although the teim is most often useu in ielation to chemical
substances.

J<!$: P$H&==8!$ Q&6<% (JPQ, Figuie 1S.4) is an example of a biological
caicinogen. Almost all ceivical canceis begin with infection by BPv, which
contains genes that uisiupt the noimal pattein of cell uivision within the host
cell. Any gene that leaus to an uncontiolleu inciease in cell uivision is calleu an
8:78B":". The BPv E6 anu E7 genes aie consiueieu oncogenes because they
inhibit the host cell's natuial tumoi suppiessing pioteins (incluue pSS,
uesciibeu below). The piouuct of the ES gene mimics the host's own signals
foi cell uivision, anu these anu othei viial gene piouucts may contiibute to
uysplasia, which is uetecteu uuiing a Pap smeai (Figuie 1S.S). Betection of
abnoimal cell moiphology in a Pap smeai is not necessaiily eviuence of cancei.
It must be emphasizeu again that cells have many iegulatoiy mechanisms to
limit uivision anu giowth, anu foi cancei to occui, each of these mechanisms
must be uisiupteu. This is one ieason why only a minoiity of inuiviuuals with
BPv infections ultimately uevelop cancei. Although most BPv-ielateu canceis
aie ceivical, BPv infection can also leau to cancei in othei tissues, in both
women anu men.

Rauiation is a well-known physical caicinogen, because of its potential to
inuuce BNA uamage within the bouy. The most uamaging type of iauiation is
&8:&R&:B, meaning waves oi paiticles with sufficient eneigy to stiip elections
fiom the molecules they encountei, incluuing BNA oi molecules that can
subsequently ieact with BNA. Ionizing iauiation, which incluues x-iays,
gamma iays, anu some wavelengths of ultiaviolet iays, is uistinct fiom the
non-ionizing iauiation of miciowave ovens, cell phones, anu iauios. As with
othei caicinogens, mutation of multiple, inuepenuent genes that noimally
iegulate cell uivision is iequiieu befoie cancei uevelops.

Chemical caicinogens (Table 1S.2) can be eithei natuial oi synthetic
compounus that, baseu on animal feeuing tiials oi "H&9"!&8=8B&7$= (i.e.
human population) stuuies, inciease the inciuence of cancei. The uefinition of
a chemical as a caicinogen is pioblematic foi seveial ieasons. Some chemicals
become caicinogenic only aftei they aie metabolizeu into anothei compounu
in the bouy; not all species oi inuiviuuals may metabolize chemicals in the
same way. Also, the caicinogenic piopeities of a compounu aie usually

0&B<6" '()M Election
miciogiaph of BPv.
.

0&B<6" '()S
Bysplastic (left) anu
noimal (iight) cells
fiom a Pap smeai.
Photo Cieuit Eu 0thman,
N.B
C a n c e i | '(CS
uepenuent on its uose. It can be uifficult to uefine a ielevant uose foi both lab
animals anu humans. Neveitheless, when a coiielation between cancei
inciuence anu chemical exposuie is obseiveu, it is usually possible to finu ways
to ieuuce exposuie to that chemical.


Table 1S.2 Some classes of chemical caicinogens (Pecoiino 2uu8)
1. PABs (polycyclic aiomatic hyuiocaibons)
e.g. benzo|ajpyiene anu seveial othei components of the smoke of
cigaiettes, woou, anu fossil fuels
2. Aiomatic amines
e.g. foimeu in foou when meat (incluuing fish, poultiy) aie cookeu at
high tempeiatuie
S. Nitiosamines anu nitiosamiues
e.g. founu in tobacco anu in some smokeu meat anu fish
4. Azo uyes
e.g. vaiious uyes anu pigments useu in textiles, leathei, paints.
S. Caibamates
e.g. ethyl caibamate (uiethane) founu in some uistilleu beveiages anu
feimenteu foous
6. Balogenateu compounus
e.g. pentachloiophenol useu in some woou pieseivatives anu
pesticiues.
7. Inoiganic compounus
e.g. asbestos; may inuuce chionic inflammation anu ieactive oxygen
species
8. Niscellaneous compounus
e.g. alkylating agents, phenolics




'()S 23+2E434.
The contiol of cell uivision involves many uiffeient genes. Some of these genes
act as signaling molecules to activate noimal piogiession thiough the cell
cycle. 0ne of the pie-iequisites foi cancei occuis when one oi moie of these
activatois of cell uivision become mutateu.
The mutation may involve a change in the couing sequence of the piotein, so
that it is moie active than noimal, oi a change in the iegulation of its
expiession, so that it is piouuceu at highei levels than noimal, oi peisists in
the cell longei than noimal. uenes that aie a pait of the noimal iegulation of
cell uivision, but which aftei mutation contiibute to cancei, aie calleu H68#8C
8:78B":"%. 0nce a pioto-oncogene has been abnoimally activateu by
mutation, it is calleu an oncogene. Noie than 1uu genes have been uefineu as










0&B<6" '()T Stiuctuie of
the !"# piotein.
.
C a n c e i | '(CT


pioto-oncogenes. These incluue genes at almost eveiy step of the signaling
pathways that noimally inuuce cell to uiviue, incluuing giowth factois,
6"7"H#86%, %&B:$= #6$:%9<7"6%, anu tiansciiption factois.
!"# is an example of a pioto-oncogene. !"# acts as a switch within signal
tiansuuction pathways, incluuing the iegulation of cell uivision. When a
ieceptoi piotein ieceives a signal foi cell uivision, the ieceptoi activates !"#,
which in tuin activates othei signaling components, ultimately leauing to
activation of genes involveu in cell uivision. Ceitain mutations of the !"#
sequence causes it to be in a peimanently active foim, which can leau to
constitutive activation of the cell cycle. This mutation is uominant as aie most
oncogenes. An example of the iole of ias in ielaying a signal foi cell uivision in
the EuF pathway is shown in Figuie 1S.7.




0&B<6" '()U .&!H=&V&"9 6"H6"%":#$#&8: 8V #W" "H&9"6!$= B68X#W V$7#86 >4E0? %&B:$=&:B
H$#WX$G) In the panel on the left, the components aie shown in theii inactive foims, piioi
to stimulation of the pathway. The components incluue the soluble liganu, EuF, its ieceptoi
(EuFR, a tyiosine kinase), ias (a u piotein), seveial kinases (RAF, NEK, NAPK), anu a
tiansciiption factoi (TF). In the iight panel, the activate pathway is shown. Binuing of the
liganu to its ieceptoi leaus to autophosphoiylation of the ieceptoi. Thiough a seiies of
pioteins not shown heie, the phosphoipylateu simulates conveision of ias to its active, uTP-
bounu foim. The activateu ias then stimulates phosphoiylation of a seiies of kinases, which
ultimately activate tiansciiption factois anu the expiession of genes iequiieu foi cell
piolifeiation.
C a n c e i | '(CU
'()T 1NK25 .NPP54..25 E434.
Noie than Su genes aie classifieu as #<!86 %<HH6"%%86%. The noimal
functions of these genes incluue iepaii of BNA, inuuction of piogiammeu cell
ueath ($H8H#8%&%) anu pievention of abnoimal cell uivision. In contiast to
pioto-oncogenes, in tumoi suppiessois it is loss-of-function mutations that
contiibute to the piogiession of cancei. This means that tumoi suppiessoi
mutations tenu to be iecessive, anu thus both alleles must be mutateu in oiuei
to allow abnoimal giowth to pioceeu. It is peihaps not suipiising that
mutations in tumoi suppiessoi genes, aie moie likely than oncogenes to be
inheiiteu. An example is the tumoi suppiessoi gene, !"#$%, which is involveu
in BNA-iepaii. Inheiiteu mutations in $%&'( inciease a woman's lifetime iisk
of bieast cancei by up to seven times, although these heiitable mutations
account foi only about 1u% of bieast cancei. Thus, spoiauic iathei than
inheiiteu mutations aie the most common souices of both oncogenes anu
uisableu tumoi suppiessoi genes.

An impoitant tumoi suppiessoi gene is a tiansciiption factoi nameu HS(.
0thei pioteins in the cell sense BNA uamage, oi abnoimalities in the cell cycle
anu activate pSS thiough seveial mechanisms incluuing HW8%HW86G=$#&8:
(attachment of phosphate to specific site on the piotein) anu tianspoit into the
nucleus. In its active foim, pSS inuuces the tiansciiption of genes with seveial
uiffeient types of tumoi suppiessing functions, incluuing BNA iepaii, cell cycle
aiiest, anu apoptosis. 0vei Su% of human tumois contain mutations in pSS.
People who inheiit only one function copy of pSS have a gieatly incieaseu
inciuence of eaily onset cancei. Bowevei, as with the othei cancei ielateu
genes we have uiscusseu, most mutations in pSS aie spoiauic, iathei than
inheiiteu. Nutation of pSS, thiough foimation of pyiimiuine uimeis in the
genes following exposuie to 0v light, has been causally linkeu to squamous cell
anu basal cell caicinomas (but not melanomas, highlighting the vaiiety anu
complexities of mechanisms that can cause cancei).
0&B<6" '()Y pSS bounu to
its taiget site on a BNA
molecule.
.
C a n c e i | '(CY



S0NNARY:
Cancei is the name given to a class of uiffeient uiseases that shaie
common piopeities.
Nost canceis iequiie accumulation of mutations in seveial uiffeient
genes.
Nost cancei causing mutations aie spoiauic, iathei than inheiiteu, anu
most aie causeu by enviionmental caicinogens, incluuing
viius, iauiation, anu ceitain chemicals.
0ncogenes aie hypeiactivateu iegulatois of cell uivision, anu aie often
ueiiveu fiom gain-of-function mutations in pioto-oncogenes.
Tumoi suppiessoi genes noimal help to iepaii BNA uamage, aiiest cell
uivision, oi to kill ovei piolifeiating cells. Loss-of-function of
these genes contiibutes to the piogiession of cancei.
KEY TERNS:
metastasis
uysplasia
caicinogen
BPv
oncogene
ionizing
epiuemiology
pioto-oncogene
ieceptoi
signal tiansuuction
!"#
apoptosis
$%&('
pSS
tumoi suppiessoi
phosphoiylation

ST0BY Q0ESTI0NS:
'()' Why uo oncogenes tenu to be
uominant, but mutations in tumoi
suppiessois tenu to be iecessive.

'()D What tumoi suppiessing
functions aie contiolleu by pSS.
Bow can a single gene affect so
many uiffeient biological
pathways.

'()( Aie all caicinogens
mutagens. Aie all mutagens
caicinogens. Explain why oi why
not.
'()M Imagine that a laboiatoiy
iepoits that feeuing a chocolate to
laboiatoiy iats incieases the
inciuence of cancei. What othei
uetails woulu you want to know
befoie you stoppeu eating
chocolate.

'()S Bo all women with BPv get
cancei. Why oi why not. Bo all
women with mutations in $%&'(
get cancei. Why oi why not.

Photo anu Illustiation Cieuits

Ch Fig source author license
1

1 0 flickr eclectic echoes CC: AND
1 1 original unknown PD
1 2 original Deyholos CC: AN
1 3
J. Exp.
Med. 98:21,
1953 Austrian, Robert pending
1 4 original Deyholos CC: AN
1 5 Wikipedia Colm, Graham PD
1 6
Wikipedia
(modified) Adenosine, Deyholos CC: AS
1 7 original Deyholos CC: AN
1 8 original Deyholos CC: AN
1 9 original Deyholos CC: AN
1 11 Wikipedia Strck, Michael GFDL
1 12 original Deyholos CC: AN
1 13 original Deyholos CC: AN
1 13 flickr Westby, Max CC: ANS
1 13 flickr Joly, David CC: ANS
1 13 Wikipedia Altun, Zeynep F. CC: AS
1 13 Wikipedia Masur GFDL
1 13 Wikipedia Azul GFDL
1 13 Wikipedia unknown GFDL
2 1
flickr:
TheJCB
Zhang et al. (2007) J.
Cell Biol. 177:231-242. CC: ANS
2 2 Wikipedia Wheeler, Richard GFDL
2 3 unknown unknown pending
2 4 original Deyholos CC: AN
2 5 BMC unknown pending
2 6
PLoS
Genetics
Somma MP et al.
(2008) PLoS Genets
4(7): e1000126 PD
2 7 original Deyholos CC: AN
2 8
PLoS
Genetics
Chelysheva, L. et al
(2008) PLoS Genetics PD
2 9 original Deyholos CC: AN
2 10 original Deyholos CC: AN
2 11 Wikipedia NHGRI PD
2 12 Wikipedia Zephyris GFDL
2 13 flickr Bell, Darwin CC: AN
2 14 flickr Elissa Lei, Ph.D. @ NIH CC: A
3 1 flickr Guthier, Christian CC: A
3 2 Wikipedia Ruiz, Mariana PD
3 3 original Deyholos (Fireworks) CC: AN
3 4 original Deyholos CC: AN
3 5 original Deyholos CC: AN
3 6 original Deyholos CC: AN
3 7 original Deyholos CC: AN
3 8 original Deyholos CC: AN
3 9 Wikipedia PAR PD
4 1 flickr ecstaticist CC: ANS
4 2
PLoS
Biology
Zarbalis, K. et al
(2004) PLoS Biology PD
4 3 original Deyholos CC: AN
4 4 original Deyholos CC: AN
4 5 original Deyholos CC: AN
4 6 Wikipedia Zephyris GFDL
4 8 original Deyholos CC: AN
4 9 original Deyholos CC: AN
4 10 original Deyholos CC: AN
4 11 original Deyholos CC: AN
4 B1 original Deyholos CC: AN
5 1 Wikipedia en:User:Drgnu23 GFDL
5 2 original Deyholos CC: AN
5 3 original Deyholos CC: AN
5 4 original Deyholos CC: AN
5 5 Wikipedia Mrich CC: AS
5 6 original Deyholos CC: AN
5 7 Wikipedia
U.S. Air Force
photo/Staff Sgt Eric T.
Sheler PD
5 9 original Deyholos CC: AN
5 9 Wikipedia unknown PD
5 10 Wikipedia NASA PD
5 11 original Deyholos (Fireworks) CC: AN
5 12 flickr Stern, Zach CC: AND
6 1 flickr Gossamer1013 CC: AND
6 2 original Deyholos CC: AN
6 3 original Deyholos CC: AN
6 4 original Deyholos CC: AN
6 5 flickr Curley, John CC: AN
6 5 flickr Romans, Phil CC: AND
6 5 flickr Miss Chien CC: AND
6 6 original Deyholos CC: AN
6 7 flickr unknown CC: AD
6 8 original Deyholos CC: AN
6 9
cropwatch.u
nl.edu cropwatch.unl.edu pending
6 10 original Deyholos CC: AN
6 11 original Deyholos CC: AN
6 12 original Deyholos CC: AN
7 1 Wikipedia Abiyoyo CC: AS
7 2 original Deyholos CC: AN
7 3 original Deyholos CC: AN
7 4 Wikipedia Morgan PD
7 5 original Deyholos CC: AN
7 6 original Deyholos CC: AN
7 7 original Deyholos CC: AN
7 8 modified Deyholos /Wikipedia CC: AN
7 9 original Deyholos CC: AN
7 10 NCBI NIH PD
7 11 original Deyholos CC: AN
7 12 modified Deyholos /Wikipedia CC: AN
7 13 original Deyholos CC: AN
8 1 flickr estherase CC: ANS
8 2 original Deyholos CC: AN
8 3 original Deyholos CC: AN
8 4 Wikipedia madprime GFDL
8 5 original Deyholos CC: AN
8 6 Wikipedia madprime GFDL
8 7 NCBI -- PD
8 8 original Deyholos CC: AN
8 9 original Deyholos CC: AN
8 10 flickr DeathByBokeh CC: AN
8 11 flickr
457088634_585df11a
f5_o pending
8 12 Wikipedia Magnus Manske PD
8 13 Wikipedia Transcontrol GFDL
8 14 original Deyholos CC: AN
9 1 Wikipedia Pmx CC:AS
9 2 original Harrington CC:AN
9 3 original Harrington CC:AN
9 4 original Harrington CC:AN
9 5 original Harrington CC:AN
9 6 original Harrington CC:AN
9 7 original Harrington CC:AN
9 8 Wikipedia
Paola Cerruti
Mainardi CC:AN
9 9 Wikipedia Steffen Dietzel CC:AS
9 10 original Harrington CC:AN
9 11 original Harrington CC:AN
10 1 flickr Jaime Golombek CC: AND
10 2 original Deyholos CC: AN
10 3 original Deyholos CC: AN
10 4 original Deyholos CC: AN
10 5 original Deyholos CC: AN
10 6 original Deyholos CC: AN
10 7 original Deyholos CC: AN
10 9 original Deyholos CC: AN
10 10 original Deyholos CC: AN
11 1
Goodsell,
Scripps Goodsell, Scripps EDU
11 2 original Deyholos CC: AN
11 3 original Deyholos CC: AN
11 4 original Deyholos CC: AN
11 5 original Deyholos CC: AN
11 6 Wikipedia Abizar Lakdawalla PD
11 7 NCBI unknown PD
11 8 original Deyholos CC: AN
12 1 flickr frenquency CC: AND
12 2 original Deyholos CC: AN
12 3 original Deyholos CC: AN
12 4 original Deyholos CC: AN
12 5 original Deyholos CC: AN
12 6 original Deyholos CC: AN
12 7 original Deyholos CC: AN
12 8 original Deyholos CC: AN
12 9 original Deyholos CC: AN
12 10 original Deyholos CC: AN
12 11 Wikipedia Richard Wheeler GFDL
12 12 Wikipedia
based on Wood W.G.
1976 Br. Med. Bull.
32, 282 CC: AS
12 13 original Deyholos CC: AN
12 14 flickr Beardy Git CC: AND
12 12 original Deyholos CC: AN
13 1 flickr Uthman, Ed CC: AS
13 2 Wikipedia NIH PD
13 3 Wikipedia Hayman, J PD
13 4 Wikipedia unknown PD
13 5 flickr Uthman, Ed CC: AS
13 6 Wikipedia Mark 'AbsturZ' PD
13 7 Wikipedia
Splettstoesser,
Thomas based on
Cho et al. Science
265 pp. 346, 1994 CC: AS

1
License uetails:
CC: AB Cieative Commons Attiibution-No Beiivative Woiks 2.u ueneiic
CC: AN Cieative Commons Attiibution-Noncommeicial 2.u ueneiic
CC: ANB Cieative Commons Attiibution-Noncommeicial-No Beiivative Woiks 2.u ueneiic
CC: AS Cieative Commons Attiibution-Shaie Alike 2.u ueneiic
EB0 Euucational use explicitly alloweu by authoi, who ietains copyiight
uFBL Peimission is gianteu to copy, uistiibute anuoi mouify this uocument unuei the teims of the uN0
Fiee Bocumentation License
PB Public Bomain because it was cieateu by a 0S goveinment agency oi because the authoi has explicity
ieleaseu it into the public uomain.
BIBLI0uRAPBY

Albeits, B. et al. 2uu4. "Noleculai Biology of the Cell, fouith euition". uailanu Science, New Yoik

uiiffiths, A. }. F. et al. 2uuS. "Intiouuction to uenetic Analysis, eighth euition." W. B. Fieeman anu
Company, New Yoik

Banahan, B., Weinbeig, R.A. 2uuu. The Ballmaiks of Cancei. Cell. 1uu, S7-7u.

NenuelWeb.
R. B. Blumbeig, {Septembei 1, 2u11}. Woilu Wiue Web 0RL: www.menuelweb.oig

0nline Nenuelian Inheiitance in Nan, 0NIN.
NcKusick-Nathans Institute of uenetic Neuicine, }ohns Bopkins 0niveisity (Baltimoie, NB),
{Septembei 1, 2u11}. Woilu Wiue Web 0RL: http:omim.oig

Pecoiino, L. 2uu8. "Noleculai Biology of Cancei, seconu euition". 0xfoiu, New Yoik

Reece , }.B. et al.2uu9. "Campbell Biology, 9
th
eu.".Benjamin Cummings, New Yoik.

Watson, }. B. et al. 2uu8. "Noleculai Biology of the uene, sixth euition" Peaison Euucation, Inc., San
Fianciso

Youi uenes, Youi Bealth
Bolan BNA Leaining Centei Colu Spiing Baiboi Laboiatoiy, {Septembei 1, 2u11}. Woilu Wiue Web
0RL: www.ygyh.oig