Association of KIBRA rs17070145 polymorphism with episodic memory

in the early stages of a human neurodevelopmental disorder

Nora S. Vyas
a,b,c,n
, Kwangmi Ahn
b
, Daniel R. Stahl
d
, Paul Caviston
e
, Mima Simic
f
,
Siobhan Netherwood
g
, Basant K. Puri
h
, Yohan Lee
b
, Katherine J. Aitchison
c,i
a
Kingston University London, Department of Psychology, Kingston, Surrey KT1 2EE, UK
b
National Institutes of Health, National Institute of Mental Health, Child Psychiatry Branch, 10 Center Drive, Bethesda, MD 20892-1600, USA
c
Institute of Psychiatry, King's College London, MRC SGDP Centre, SE5 8AF, UK
d
NIHR Biomedical Research Centre for Mental Health and Institute of Psychiatry, King's College London, Department of Biostatistics, SE5 8AF, London, UK
e
North East London NHS Foundation Trust, Child and Adolescent Mental Health Services, Essex IG38XQ, UK
f
South London and Maudsley NHS Foundation Trust, CAMHS National and Specialist Services, London SE5 8AF, UK
g
South London and Maudsley NHS Foundation Trust, Croydon, CAMHS, CR0 1QG, UK
h
Imperial College London, Department of Medicine, Du Cane Road, W12 OHS, UK
i
University of Alberta, Department of Psychiatry, Edmonton, Alberta, T6G 2E1, Canada
a r t i c l e i n f o
Article history:
Received 25 September 2013
Received in revised form
9 July 2014
Accepted 13 July 2014
Keywords:
Adolescent
KIBRA
Schizophrenia
WWC1 protein
Memory
Polymorphism
a b s t r a c t
A common T/C polymorphism within the ninth intron of the KIBRA gene (rs17070145) is thought to
inuence memory in humans. Since cognitive impairment, including memory, is a core feature of
schizophrenia, we attempted to investigate this association in an independent sample of adolescent
patients with early-onset schizophrenia (EOS; onset before age 18) probands and their healthy siblings.
In a sample of 25 pairs of EOS proband-healthy full sibling, we sought to investigate the association of
KIBRA with memory performance. Episodic memory was measured using immediate and delayed recall
measures of the California Verbal Learning Test. EOS underperformed at immediate and delayed recall
compared with siblings. In a combined analysis (TT vs. TC/CC) assuming a C dominant model of
inheritance, we found a main effect of genotype where individuals with TT genotype outperformed non-
TT-carriers at immediate and delayed recall. A genotype by group interaction showed that EOS with TT
genotype did not show a memory advantage over siblings with TT or non-TT-carriers at immediate or
delayed recall. Siblings with TT genotype showed enhanced immediate recall (not delayed recall)
compared with non-TT-carriers. This study demonstrates an association between the KIBRA gene and
episodic memory (immediate free recall) and suggests a differential effect of this genetic variant in EOS
and healthy siblings.
& 2014 Elsevier Ireland Ltd. All rights reserved.
1. Introduction
KIBRA is a novel WWP repeating motif (WW domain) containing
cytoplasmic protein involved in the regulation of cellular functions and
processes such as neuronal growth and repair, differentiation and
neurotransmission (Schaper et al., 2007; Zhang et al., 2014). KIBRA
interacts with a substrate of Protein kinase C (PKC) and may play
a role in synaptic plasticity, human memory performance and cogni-
tion (Kremerskothen et al., 2003; Johannsen et al., 2008; Makuch et al.,
2011; Vogt-Eisele et al., 2014).
A common single nucleotide polymorphism (SNP), rs17070145
(GenBank accession number NM_015238) within intron nine of
the KIBRA or WWC1 gene (T-C substitution), yielding three
genotypes (TT, TC and CC) and mapped to chromosome 5q34-
5q35.2 (Kremerskothen et al., 2003), is associated with memory
performance. A landmark genome-wide association study (GWAS)
revealed an association between KIBRA rs17070145 and memory
processes in humans across age ranges 1880 (Passotiropoulos et
al., 2006). This study was subsequently supported by an investiga-
tion in middle-aged adults with a mean age of approximately 67,
examining age-dependent memory task performance, showing an
association between KIBRA and episodic memory but not verbal
uency, planning ability or visuospatial processing (Schaper et al.,
2007). Subsequently, a community Alzheimer's disease (AD)
population study reported an association between the rs17070145
T allele and increased age-dependent AD risk (Rodrguez-Rodrguez
Contents lists available at ScienceDirect
journal homepage: www.elsevier.com/locate/psychres
Psychiatry Research
http://dx.doi.org/10.1016/j.psychres.2014.07.024
0165-1781/& 2014 Elsevier Ireland Ltd. All rights reserved.
n
Corresponding author at: National Institutes of Health, National Institute of
Mental Health, Child Psychiatry Branch, 10 Center Drive, Building 10, Room 3N202,
Bethesda, MD 20892-1600, USA.
Tel: 1 301 402 9810; fax: 1 301 402 0296.
E-mail address: nora.vyas@nih.gov (N.S. Vyas).
Please cite this article as: Vyas, N.S., et al., Association of KIBRA rs17070145 polymorphismwith episodic memory in the early stages of a
human neurodevelopmental disorder. Psychiatry Research (2014), http://dx.doi.org/10.1016/j.psychres.2014.07.024i
Psychiatry Research ()
et al., 2007). Since the initial landmark study found an association of
the KIBRA gene with delayed recall in Caucasians, a study on
Japanese subjects demonstrated that T allele carriers have better
verbal memory, attention/concentration and delayed recall scores in
the Wechsler Memory Scale-Revised version, compared with C/C
carriers (Yasuda et al., 2010) However, there are some inconsisten-
cies in ndings and direct of effect. The largest independent
Duke and German European cohort study showed no association
between KIBRA and memory (Need et al., 2008), but a later study
reported an association between the KIBRA T allele and better
performance on immediate and delayed recall, but not mild
cognitive impairment in adults free of dementia (Almeida et al.,
2008). Another study showed that older adults with the CT/TT
genotype and subjective memory complaints underperformed on
long-term verbal memory tests compared to CC genotype indivi-
duals (Nacmias et al., 2008). A behavioral and fMRI study showed
that individuals with the T allele performed better at episodic
retrieval and also showed elevated hippocampal functioning com-
pared to non-carriers (Kauppi et al., 2011). A study on patients with
psychosis, their unaffected relatives and healthy volunteers showed
that individuals with the KIBRA T allele performed better on
immediate and delayed recall (Vassos et al., 2010). A recent meta-
analysis reported a signicant association between rs17070145 and
episodic and working memory (Milnik et al., 2012). The inconsistent
ndings across studied highlight the need to clarify the role of
KIBRA polymorphism on human memory performance.
Early onset schizophrenia (EOS; dened as onset of psychotic
symptoms by age 18) is a less frequent and, in some cases, more
severe variant of the disorder than its adult-onset counterpart
(Asarnow et al., 1994; Nicolson et al., 2000; Vyas et al., 2010a).
EOS shows diagnostic continuity with adult-onset schizophrenia
(Nicolson and Rapoport, 1999; Asarnow et al., 2001; Nicolson et al.,
1999, 2003; Gochman et al., 2004), but may be associated with
delay in crucial developmental stages, increased rate of cytoge-
netic anomalies, greater clinical severity and worse functional
outcome (Hollis, 2000; Fleischhaker et al., 2005; Vyas et al., 2007,
2012a; Rapoport et al., 2012; Vyas and Gogtay, 2012). Generalized
cognitive decits have been reported in adolescents with EOS
across a broad array of ability domains; the largest effect sizes
being reported in general intellectual ability, verbal learning and
memory, and executive function (Kenny et al., 1997; Roofeh et al.,
2006; Vyas et al., 2010b). Two meta-analyses (1639 relatives vs.
1380 healthy controls, and 2872 relatives vs. 2457 healthy con-
trols) of relatives of schizophrenia, in general (not EOS), show
cognitive abnormalities, albeit in an attenuated form (Sitskoorn et
al., 2004; Snitz et al., 2006). Therefore, genetic studies of EOS may
be particularly informative and enriched in markers of vulner-
ability by virtue of increased severity and familiarity (Vyas et al.,
2010b). Identication of quantitative trait loci of specic neuro-
cognitive measures, such as memory, may provide an advance in
detection of specic susceptibility genes for schizophrenia. There-
fore, the aim of this study was to investigate the association
between the KIBRA rs17070145 SNP and episodic memory in a
sample of EOS probands and their unaffected (healthy) siblings.
This is the rst genetic association study of its kind investigating
the impact of this SNP in adolescents with schizophrenia using an
EOS proband-full sibling pair design. Specically, we hypothesized
that EOS probands would underperform in the immediate and
delayed free recall test compared with healthy siblings of EOS
probands, and that independent of diagnosis, individuals with TT
genotype would perform better than individuals with the TC/CC
genotype. To investigate whether cognitive impairments are
endophenotypic markers or secondary to specic aspects of the
illness, we also investigated the effect of diagnosis and KIBRA gene
polymorphism in a population at high risk for schizophrenia,
specically close relatives, unaffected siblings of EOS probands,
where studies show cognitive impairments (Gochman et al., 2004;
Groom et al., 2008).
2. Methods
2.1. Participants
Fifty-three patients (29 boys, 24 girls) with EOS, diagnosed using the Structured
Clinical Interview for DSM-IV Axis I Disorders (SCID) (First et al., 2002a) were
recruited through clinicians' referrals in adolescent psychiatry services in South
London and North East London (mean age: (7S.D.) 17.371.3 years; age range:
14.121.2 years; mean illness duration: 23.5718.5 months; average number of
hospitalizations: 1.270.96). Forty of their biological siblings with no Axis I diagnosis
(healthy) also participated in the Vulnerability Indicators in Psychosis Study (VIPS).
The study protocol was approved by the Joint South London and Maudsley and
Institute of Psychiatry NHS Research Ethics Committee. Written informed consent
and/or assent, as appropriate, was obtained from all participants. Details of the VIPS
study are described elsewhere (Kumar et al., 2010; Vyas and Puri, 2012; Vyas et al.,
2012a). The exclusion criteria for EOS patients and biological relatives included: (a) a
history of neurological disorders or head injury resulting in a loss of consciousness
for more than 1 h; (b) family history (rst degree relatives and grandparents) of
hereditary neurological disorders; (c) full-scale IQ less than 70, and (d) DSM-IV
criteria for psychoactive substance abuse in the preceding 6 months or the presence
of co-morbid Axis I disorders.
2.2. Clinical evaluation
A total of 53 EOS probands and 40 full siblings were available in this study.
Twenty-ve EOS patients had at least one healthy full sibling (44% Caucasians, 24%
Africans, 24% south Asian, and 8% mixed race). Since the ancestries of EOS patients
were highly heterogeneous, healthy siblings from the respective EOS proband-full
sibling pair were selected for comparison based on the following criteria: 1)
siblings with the same sex if possible; 2) siblings with close age to probands; and 3)
oldest sibling. For complex (non-Mendelian) disorders, a proband-full sibling pair
design in discordant full siblings pairs has been demonstrated to be effective for
discriminating effects at quantitative trait loci (Risch and Zhang, 1995), and hence
we adopted this approach in the current study. Twenty-eight EOS probands
(17 probands did not have a healthy full sibling, 7 patients were excluded owing
to amplication failure, and 4 patients' biological siblings showed amplication
failure) and 15 full siblings (11 siblings in families with more than one sibling, and
4 siblings were excluded owing to allele dropout) were excluded. At the time of
assessment, 23 EOS probands were on atypical medication, and two were
unmedicated. First-degree relatives were assessed by personal interview using
the SCID I (non-patient research version) (First et al., 2002b). Information about age
of onset, number and type of previous episodes, number of hospital admissions and
current medication (type, dose and duration) were collected from medical notes.
Clinical symptoms were assessed by the Positive and Negative Syndrome Scale
(PANSS) (Kay et al., 1989) comprising positive, negative and general psychopathol-
ogy scores, and were relatively stable in all patients for a minimum period of
6 months. All participants were also assessed using the Global Assessment of
Functioning (GAF) Scale (APA, 1994). The GAF scores (mean7S.D.) for EOS patients
and healthy siblings were 56.13713.39 and 81.676.9, respectively.
2.3. Cognitive assessment
Short-term memory and long-term memory were measured using the Califor-
nia Verbal Learning Test (Delis et al., 1987; Paulsen et al., 1995), a standardized
clinical measure of episodic memory, which adjusts for age, gender and education.
Briey, the CVLT consists of two word lists. The rst (List A) is made up of 16
shopping items: four items in each of four categories (fruits, spices, tool, and
clothing). The participant is asked to recall List A ves times with immediate, free
recall after each presentation. After the ve learning trials with List A, an
interference list (List B; 16 items) is presented for one immediate, free recall trial.
This is followed by immediate free recall of List A. Following a 20-min interval
consisting of nonverbal testing, participants were asked to free recall List A.
Immediate free recall of List A and delayed free recall (20-min interval) was used
for the analysis.
2.4. Genotyping
DNA was extracted from buccal swabs from 93 participants using standard
procedures (Freeman et al., 1997, 2003). Genotype for rs17070145 was determined
by a TaqMan
s
SNP genotyping assay (assay ID C_33286269_10) (Applied Biosys-
tems, Foster City, CA, USA) (GCCAGCTGCTCCTTGATCCTGGACCT[C/T]AACTGTTCCT-
GAGCTTTCCTTTTAT). There were 11 (7 EOS probands, and 4 siblings) undetermined
genotypes due to amplication error. 10 ng of DNA was used in a 10 l reaction,
N.S. Vyas et al. / Psychiatry Research () 2
Please cite this article as: Vyas, N.S., et al., Association of KIBRA rs17070145 polymorphismwith episodic memory in the early stages of a
human neurodevelopmental disorder. Psychiatry Research (2014), http://dx.doi.org/10.1016/j.psychres.2014.07.024i
according to the manufacturers' instructions (Applied Biosystems, Warrington, UK).
End-point analysis was performed on an AB Prism 7900HT Sequence Detection
System (SDS), using a probability of greater than 95%. Genotype frequencies for
rs17070145 were 0.34 (TT), 0.18 (CC), and 0.48 (TC). The CC and TC genotype groups
of rs17070145 were combined since both genotype groups displayed a similar
verbal memory performance score (i.e. behaved consistent with a C dominant effect
on this phenotype). We provided additional analysis for single genotypes on
memory performance to allow comparison with previously published studies
(Passotiropoulos et al., 2006; Schaper et al., 2007). The genotypic distribution of
rs17070145 SNP in KIBRA for the entire sample (
2
0.77, P0.37) and 25 proband-
full sibling pairs (
2
0.25, P40.05) was in HardyWeinberg equilibrium. There
was no signicant difference between the distribution of alleles in the different
ethnicity groups (
2
2.12, d.f. 1, P0.14).
2.5. Statistical analysis
Statistical analyses were conducted using SPSS version 18 (SPSS Inc., Chicago,
IL). To study the effect of genotype and diagnosis on CVLT immediate and delayed
recalls we used a generalized estimating equation model. We used an exchangeable
within-subject working correlation matrix and robust standard errors to account
for familial inter-correlation between the EOS probands and their siblings (Nelder
and Wedderburn, 1972). The Hubert White sandwich estimator was used; it
provides standard errors that are robust to possible misspecication of the
correlation matrix. Unlike repeated measurement with ANOVA, a GEE allows for
several observations per case and uses a full case analysis in the presence of
missing data (Hardin and Hilbe, 2003). To explore the data further, we performed
Bonferroni post-hoc corrections for multiple testing for immediate and delayed
recall separately in the entire sample and after dividing the sample into EOS
probands and healthy siblings. A P-value of o0.05 was considered nominally
signicant. The magnitude of pairwise differences between EOS and siblings was
assessed using measures of effect size based on Cohen's d (Cohen, 1988).
3. Results
Twenty-ve pairs of EOS proband-healthy full sibling were
included in the analysis. There was no signicant difference in
gender distribution and age between the patient and healthy
sibling groups (P40.05). The demographic characteristics of the
participants, according to genotype, are presented in Table 1.
3.1. Genotype combined analysis
3.1.1. Short-term memory
There was a signicant main effect of diagnosis (Wald
2

31.33, d.f. 1, Po0.0001, d0.88). EOS probands recalled fewer list

A words at immediate recall compared with unaffected siblings
(Fig. 1 and Table 1). There was a main effect of genotype (Wald

2
8.01, d.f. 1, P0.005, d0.18). Independent of diagnosis,
overall, individuals with TT genotype outperformed TC/CC geno-
type (Table 1 and Fig. 2). There was a signicant genotype by group
interaction (Wald
2
4.21, d.f. 1, P0.04) (Table 3). EOS pro-
bands with TT genotype recalled fewer words than healthy siblings
with the same genotype (Po0.0001). Siblings with TT genotype
outperformed those with TC/CC genotype (P0.0004). There was
some weak evidence that siblings with TC/CC genotype outper-
formed EOS with the same genotype (P0.07) (Fig. 3). In EOS
probands, there was no difference between TT and TC/CC on short-
term recall (P0.69).
3.1.2. Long-term memory
There was a main effect of diagnosis (Wald
2
39.48, d.f. 1,
Po0.0001; d0.98). EOS probands underperformed in recalling
List A at delayed free recall in comparison with unaffected siblings
(Table 1). There was a signicant main effect of genotype (Wald

2
5.75, d.f. 1, P0.016; d0.39), where individuals with TT
genotype recalled overall more shopping list items compared with
TC/CC genotype (Table 2). There was a genotype by group
Table 1
Demographic characteristics and verbal learning and memory scores in EOS
probands and their unaffected siblings.
EOS (n25) Siblings (n25) P-statistic
Age, mean (S.D.) 17.34 (1.55) 18.1 (4.09) 0.613
Gender (M/F) 16/9 14/11 0.387
Education (y) 10.6 (1) 11.56 (1.66) 0.104
CVLT immediate free recall 6.92 (3.29) 9.68 (3) o0.001
CVLT delayed free recall 7.12 (3.24) 10.08 (2.78) o0.001
Fig. 1. Mean and standard error of the mean (SEM) scores of short term and long
term memory performance in EOS probands in comparison with healthy siblings.
Fig. 2. Association of KIBRA gene polymorphismwith immediate and delayed recall
(mean7SEM).
Fig. 3. KIBRA genotype by group interaction on short-term memory.
N.S. Vyas et al. / Psychiatry Research () 3
Please cite this article as: Vyas, N.S., et al., Association of KIBRA rs17070145 polymorphismwith episodic memory in the early stages of a
human neurodevelopmental disorder. Psychiatry Research (2014), http://dx.doi.org/10.1016/j.psychres.2014.07.024i
interaction (Wald
2
5.2, d.f. 1, P0.023) (Table 3). Bonferroni
pairwise comparisons showed that EOS probands with TT geno-
type underperformed on long-delayed recall compared with sib-
lings with the same genotype (Po0.0001). Healthy siblings with
TT outperformed TC/CC genotype (Po0.001). EOS probands with
TC/CC genotype underperformed at the delayed recall phase
compared with siblings with TC/CC genotype (P0.038) (Fig. 4).
EOS probands with TT were not signicantly different from those
with TC/CC genotype on delayed-recall performance (P0.66).
3.2. Single genotype analysis
Table 4 shows the sample size for the single genotype analysis
across both groups. Memory performance scores according to
genotype for each ethnicity are presented in Table 5. There was
a main effect of genotype on immediate free-recall (Wald

2
7.16, d.f. 2, P0.028) (Table 6). Post-hoc Bonferroni compar-
isons showed that the homozygous carriers of the C allele under-
performed at short-term memory compared with TT genotype
(P0.04), while there were no other signicant differences
between CC and TC (P0.27), or TT and TC (P0.187). There was
a signicant effect of group (Wald
2
13.90, d.f. 1, Po0.001).
Post-hoc comparisons showed that healthy siblings performed
better on immediate free recall than EOS probands (Po0.001).
There was a trend for a genotype by group interaction on
immediate recall measures (Wald
2
5.61, d.f. 2, P0.06).
There was no signicant effect of genotype on long-term free
recall (Wald
2
3, d.f. 2, P0.22). There was a signicant effect
of group on delayed recall (Wald
2
14.8, d.f. 1, Po0.001).
Similar to immediate free recall, post-hoc comparisons demon-
strated that healthy siblings recalled a greater number of words
after 20 min delay in comparison with EOS probands (Po0.001).
There was a signicant genotype by group interaction (Wald

2
10.99, d.f. 2, P0.004) on delayed recall, where healthy
siblings with TT genotype outperformed EOS probands with the
same genotype (Po0.05).
4. Discussion
We applied a schizophrenia-sibling pairing method to study
the impact of KIBRA C/T polymorphism (rs17070145) on episodic
memory performance in a sample of adolescents with early onset
schizophrenia and their unaffected (healthy) siblings. Using a
standardized measure of verbal learning and memory in a sample
of adolescents with schizophrenia and their healthy siblings, we
conrmed previous ndings demonstrating enhanced episodic
memory performance in KIBRA (SNP rs17070145) TT genotype
(Passotiropoulos et al., 2006; Schaper et al., 2007; Rodrguez-
Rodrguez et al., 2007; Bates et al., 2009; Vassos et al., 2010;
Yasuda et al., 2010; Kauppi et al., 2011) compared with non-TT-
carriers, regardless of diagnosis. A couple of previous studies have
reported an association between KIBRA and delayed recall but not
with immediate memory (Bates et al., 2009; Passotiropoulos et al.,
2006), while one study showed associations with unaffected
subjects in immediate and delayed logical memory (Vassos et al.,
2010). In the single genotype analysis, we found that KIBRA was
associated with immediate recall as opposed to delayed memory.
The combined analysis following post-hoc analyses revealed a
main effect of genotype on immediate and delayed memory,
which harmonize with Vassos's ndings (Vassos et al., 2010).
On a cellular level, KIBRA is connected to a novel Hippo signal
transduction pathway associated with memory performance, cell
migration and apoptosis (Kremerskothen et al., 2003; Xiao et al.,
2011; Bork and Sudol, 1994). The KIBRA protein modulates hippo-
campal activation during memory retrieval, and is particularly
enriched in brain regions with highest expression in the cerebellum,
cortex, hippocampus, pons, and amygdala (Buther et al., 2004). In
the present study, episodic memory was assessed using the CVLT, a
neuropsychological measure thought to reect the integrity of the
hippocampus, temporal lobe, and the frontal systems (Libon et al.,
Table 2
Demographic characteristics and verbal memory scores in EOS-full sibling pairing
comparing TT and TC/CC genotypes.
KIBRA SNP rs17070145 P-statistic
SNP TT
(n16)
SNP TC/CC
(n34)
Age, mean (S.D.) 17.59 (1.83) 18.21 (3.22) 0.5
Gender (M/F) 12/4 18/16 0.11
Education (y) 10.88 (1.05) 11.3 (1.62) 0.27
CVLT immediate free recall 9.55 (3.3) 7.69 (3.1) 0.005
CVLT delayed free recall 9.41 (3.5) 8.13 (3) 0.016
Note: S.D. standard deviation.
Table 3
Genotype by diagnosis interaction in EOS-full sibling pairing at verbal learning and memory.
Memory EOS proband EOS comparison P-statistic
n
Siblings Siblings comparison P-statistic
n
TT (n10) TC/CC (n15) TT (n6) TC/CC (n19)
CVLT immediate free recall 7 (2.4) 6.86 (3.7) 0.69 12.3 (1.6) 8.8 (2.87) o0.001
CVLT delayed free recall 6.5 (2.2) 7.53 (3.79) 0.66 12.6 (1.5) 9.2 (2.6) 0.0004
n
TT vs. TC/CC genotype.
Fig. 4. KIBRA genotype by group interaction in long delayed recall.
Table 4
Sample size across KIBRA genotypes for EOS and unaffected siblings.
TT (n16) TC (n23) CC (n11)
EOS probands 10 10 5
Healthy siblings 6 13 6
N.S. Vyas et al. / Psychiatry Research () 4
Please cite this article as: Vyas, N.S., et al., Association of KIBRA rs17070145 polymorphismwith episodic memory in the early stages of a
human neurodevelopmental disorder. Psychiatry Research (2014), http://dx.doi.org/10.1016/j.psychres.2014.07.024i
1998; Johnson et al., 2001; Joyce, 2005), which is well-suited to
measure the inuence of KIBRA on episodic memory related tasks.
The within-group analysis for patients with EOS revealed no
advantage of TT-carriers over non-TT-carriers, which may indicate
a differential KIBRA effect on memory in patients with early onset
schizophrenia. Alternatively, the nding may represent a oor
effect, where the cognitive impairment with TT-carriers was so low
in EOS that a lower effect with non-TT-carriers was not observable.
There is also the possibility of a type I error owing to the small
sample size. Our results also showed that EOS probands with TT
genotype performed less well at immediate and delayed recall than
unaffected siblings with the same genotype. A parsimonious expla-
nation appears to be that the adolescent period is a critical period of
signicant brain modeling (Gogtay et al., 2004), where the onset of
schizophrenia during this critical age window may offset the
positive effects of a protective variant of a memory-related gene.
Indeed schizophrenia susceptibility genes in adolescents are asso-
ciated with premorbid neurodevelopmental abnormalities
(Thompson et al., 2001; Addington and Rapoport, 2009; Vyas et
al., 2010a, 2010b). Our ndings could be interpreted as incorrect cell
polarity and migration led by postsynaptic cytoskeletal abnormal-
ities (Kremerskothen et al., 2003) via the brain-enriched postsynap-
tic protein dendrin, consistent with abnormal neuronal circuitry in
schizophrenia (Vyas et al., 2010a; Thompson et al., 2001; Gogtay et
al., 2012). In line with ndings from the NIMH COS imaging studies
(Gogtay et al., 2004, 2008), unintended apoptosis with white matter
loss may reect the differential effect of the SNP rs17070145 on
hippocampal-related memory measures in schizophrenia in com-
parison with unaffected siblings.
Since neurocognitive impairment is a core feature of schizo-
phrenia, and a putative endophenotype (Heinrichs and Zakzanis,
1998; Aleman et al., 1999; Sitskoorn et al., 2004; Snitz et al., 2006;
Gur et al., 2007; Vyas et al., 2010c; Vyas et al., 2012b; Schaefer et
al., 2013), we attempted to independently investigate the associa-
tion of KIBRA gene polymorphism with episodic memory using the
CVLT in individuals with EOS. Episodic memory impairments have
consistently been reported in relatives of patients with schizo-
phrenia, which constitutes a familial, high specicity, and possible
heritable risk for schizophrenia (Egan et al., 2001; Sitskoorn et al.,
2004). Our ndings showed that EOS probands demonstrate
impairments at immediate and delayed recall on verbal memory
in comparison with their biological siblings. Several EOS studies
utilizing the CVLT have reported verbal learning and memory
impairments between 1 and 2 standard deviations below the
normative mean at immediate recall (Hill et al., 2004; Roofeh et
al., 2006) and delayed recall (Roofeh et al., 2006; Hill et al., 2004;
Oie and Rund, 1999; McClellan et al., 2004; Brickman et al., 2004).
A meta-analytic review of 37 studies showed a large mean
difference in verbal memory performance between relatives and
normal comparison subjects with a weighted effect size of d0.54
(Sitskoorn et al., 2004). Subsequent meta-analysis on relatives of
patients with schizophrenia have reported similar ndings with
impairments in immediate recall conditions of the verbal memory
domain (Snitz et al., 2006; Trandar et al., 2006). Memory
impairments were found in our study in both early-onset patients
with schizophrenia and their unaffected biological siblings, sug-
gesting that episodic memory may be considered an endopheno-
typic marker for schizophrenia.
There are several limitations of this study. First, our patient
sample size is small for a genetic association study, so we were
unpowered to perform a transmission disequilibrium test. How-
ever, we studied an enriched population of patients with EOS and
siblings, given that EOS is considered a more severe and rare form
of the illness (EOS comprises approximately 4% of all cases of
schizophrenia) (Cannon et al., 1999; Gogtay et al., 2011; Rapoport
et al., 2012; Remschmidt, 2002; Vyas et al., 2010a). Second,
although our EOS probands were on medication at the time of
assessment, which may have inuenced the results, a quantitative
meta-analysis reviewing 34 studies demonstrated no correlations
between symptomatology (rating scales) or medication dose and
cognition (Mishara and Goldberg, 2004). Third, there is a potential
problem of bias from population stratication. Unfortunately, the
sample sizes of all groups were not sufciently high to allow for
retrospective population strata weighting adjustments. However,
if this study were to be repeated with larger numbers, then
appropriate stratied analysis should be undertaken. There are
additional confounding effects of treatment and symptom severity,
with a minority of patients being treatment-nave.
However, despite the above limitations, this study provides data
consistent with previous ndings regarding cognitive dysfunction as
an endophenotypic marker for schizophrenia and indicates a role for
KIBRA in such dysfunction. Specically, decits in episodic memory,
which may be indexed by KIBRA genotype, function as an endophe-
notypic marker in early onset schizophrenia.
Conict of interest
Dr. KJ Aitchison has been on the Advisory Board for the Bristol-
Myers Squibb and Otsuka Pharmaceuticals Ltd., and in addition
received consultancy fees including payment for lectures and
educational presentations from the same company. She was
previously a member of various advisory boards, receiving con-
sultancy fees and honoraria, and has received research grants from
various companies including Lundbeck and GlaxoSmithKline. Dr.
NS Vyas was supported by a grant from Johnson and Johnson
Research and Development held by Dr. KJ Aitchison during the
period of data collection; however, Johnson and Johnson had no
role in the study design, conduct, data analysis, or its interpreta-
tion. All other authors report no conict of interest.
Table 5
Memory performance according to genotype and ethnicity.
KIBRA SNP rs17070145
Caucasian South Asian African-Caribbean Mixed
TT (n11) TC (n9) CC (n2) TT (n4) TC (n5) CC (n 3) TT TC (n6) CC (n6) TT (n1) TC (n3) CC
Immediate recall 9.5 (2.9) 9.66 (1.73) 1272.8 8.25 (4.9) 11.2 (1.48) 5 (5) 5.83 (3.43) 6.5 (1.87) 6 5 (2)
Delayed recall 8.9 (3.36) 9.77 (1.48) 13.570.7 9.5 (4.79) 10 (2) 6 (5.29) 6.5 (3.72) 8.5 (2.42) 5 5.3 (2.3)
Table 6
Association of SNP rs17070145 with verbal learning and memory performance.
KIBRA SNP rs17070145 P-statistic
TT (n16) TC (n23) CC (n11)
CVLT immediate free recall 9 (3.4) 8.39 (3.21) 7.09 (3.72) o0.001
CVLT delayed free recall 8.81 (3.63) 8.39 (2.96) 8.72 (3.92) 0.22
N.S. Vyas et al. / Psychiatry Research () 5
Please cite this article as: Vyas, N.S., et al., Association of KIBRA rs17070145 polymorphismwith episodic memory in the early stages of a
human neurodevelopmental disorder. Psychiatry Research (2014), http://dx.doi.org/10.1016/j.psychres.2014.07.024i
Acknowledgment
We would like to extend our thanks to patients and their families
who participated in the VIPS project. This work was supported by a
departmental fund at the Institute of Psychiatry, King's College
London, London, UK. Dr. NS Vyas was supported during the time of
data collection by Johnson and Johnson Research and Development,
more recently by a Fulbright Distinguished Scholar Award from the
US-UK Fulbright Commission and latterly by a Lindemann Trust
Fellowship of the English-Speaking Union. Dr. KJ Aitchison holds an
Alberta Centennial Addiction and Mental Health Research Chair,
funded by the Government of Alberta.
References
Addington, A.M., Rapoport, J.L., 2009. The genetics of childhood-onset schizophre-
nia: when madness strikes the prepubescent. Current Psychiatry Report 11,
156161.
Aleman, A., Hijman, R., de Haan, E.H.F., Kahn, R.S., 1999. Memory impairment in
schizophrenia: a meta-analysis. American Journal of Psychiatry 156,
13581366.
Almeida, O.P., Schwab, S.G., Lautenschlager, N.T., Morar, B., Greenop, K.R., Flicker, L.,
Wildenauer, D., 2008. KIBRA genetic polymorphism inuences episodic mem-
ory in later life, but does not increase the risk of mild cognitive impairment.
Journal of Cellular and Molecular Medicine 12, 16721676.
Asarnow, R.F., Asamen, J., Granholm, E., Sherman, T., Watkins, J.M., Williams, M.E.,
1994. Cognitive/neuropsychological studies of children with a schizophrenic
disorder. Schizophrenia Bulletin 20, 647669.
Asarnow, R.F., Nuechterlein, K.H., Fogelson, D., Subotnik, K.L., Payne, D.A., Russell, A.
T., Asamen, J., Kuppinger, H., Kendler, K.S., 2001. Schizophrenia and
schizophrenia-spectrum personality disorders in the rst-degree relatives of
children with schizophrenia: the UCLA family study. Archives of General
Psychiatry 58, 581588.
American Psychiatric Association, 1994. Diagnostic and Statistical Manual of Mental
Disorders (DSM-IV). 4th edition American Psychiatric Association, Washington,
DC.
Bates, T.C., Price, J.F., Harris, S.E., Marioni, R.E., Fowkes, F.G., Stewart, M.C., Murray, G.
D., Whalley, L.J., Starr, J.M., Seary, I.J., 2009. Association of KIBRA and memory.
Neuroscience Letters 458, 140143.
Bork, P., Sudol, M., 1994. The WW domain: a signaling site in dystrophin? Trends in
Biochemical Sciences 12, 531533.
Brickman, A.M., Buchsbaum, M.S., Bloom, R., Bokhoven, P., Paul-Odouard, R.,
Haznedar, M.M., Dahlman, K.L., Hazlett, E.A., Aronowitz, J., Heath, D., Shiha-
buddin, L., 2004. Neuropsychological functioning in rst-break, never-
medicated adolescents with psychosis. The Journal of Nervous and Mental
Disease 192, 615622.
Buther, K., Plaas, C., Barnekow, A., Kremerskothen, J., 2004. KIBRA is a novel
substrate for protein kinase C zeta. Biochemical and Biophysical Research
Communications 317, 703707.
Cannon, M, Jones, P., Huttunen, M.O., Tanskanen, A., Huttunen, T., Rabe-Hesketh, S.,
Murray, R.M., 1999. School performance in Finnish children and later develop-
ment of schizophrenia: a population-based longitudinal study. Archives of
General Psychiatry 56, 457463.
Cohen, J., 1988. Statistical Power Analysis for the Behavioral Sciences, 2nd ed.
Lawrence Earlbaum Associates, Hillsdale, New Jersey.
Delis, D.C., Kramer, J.H., Kaplan, E., Ober, B.A., 1987. The California Verbal Learning
Test (CVLT) Manual. The Psychological Corporation, San Antonio, Texas.
Egan, M.F., Goldberg, T.E., Gscheidle, T., Weirich, M., Rawlings, R., Hyde, T.M,
Bigelow, L., Weinberger, D.R., 2001. Relative risk for cognitive impairments in
siblings of patients with schizophrenia. Biological Psychiatry 50, 98107.
First, M.B., Spitzer, R.L., Gibbon, M., Williams, J.B.W., 2002a. Structured Clinical
Interview for DSM-IV-TR Axis I Disorders, Research Version, Patient Edition.
(SCID-I/P). Biometrics Research, New York State Psychiatric Institute, New York.
First, M.B., Spitzer, R.L., Gibbon, M., Williams, J.B.W., 2002b. Structured Clinical
Interview for DSM-IV-TR Axis I Disorders, Research Version, Non-patient
Edition. (SCID-I/NP). Biometrics Research, New York State Psychiatric Institute,
New York.
Fleischhaker, C., Schulz, E., Tepper, K., Martin, M., Hennighausen, K., Remschmidt,
H., 2005. Long-term course of adolescent schizophrenia. Schizophrenia Bulletin
31, 769780.
Freeman, B., Powell, J., Ball, D., Hill, L., Craig, I., Plomin, R., 1997. DNA by mail: an
inexpensive and noninvasive method for collecting DNA samples from widely
dispersed populations. Behavior Genetics 27, 251257.
Freeman, B., Smith, N., Curtis, C., Huckett, L., Mill, J., Craig, I.W., 2003. DNA from
buccal swabs recruited by mail: evaluation of storage effects on long-term
stability and suitability for multiplex polymerase chain reaction genotyping.
Behavior Genetics 33, 6772.
Gochman, P., Greenstein, D., Sport, A., Gogtay, N., Nicolson, R., Keller, A., Lenane, M.,
Rapoport, J.L., 2004. Childhood onset schizophrenia: familial neurocognitive
measures. Schizophrenia Research 71, 4347.
Gogtay, N., Hua, X., Stidd, R., Boyle, C.P., Lee, S., Weisinger, B., Chavez, A., Giedd, J.N.,
Clasen, L., Toga, A.W., Rapoport, J.L., Thompson, P.M., 2012. Delayed white
matter trajectory in young nonpsychotic siblings of patients with childhood-
onset schizophrenia. Archives of General Psychiatry 69, 875884.
Gogtay, N., Lu, A., Leow, A.D., Klunder, A.D., Lee, A.D., Chavez, A., Greenstein, D.,
Giedd, J.N., Toga, A.W., Rapoport, J.L., Thompson, P.M., 2008. Three-dimensional
brain growth abnormalities in childhood-onset schizophrenia visualized by
using tensor-based morphometry. Proceedings of the National Academy of
Sciences of the United States of America 105, 1597915984.
Gogtay, N., Giedd, J.N., Lusk, L., Hayashi, K.M., Greenstein, D., Vaituzis, A.C., Nugent
3rd, T.F., Herman, D.H., Clasen, L.S., Toga, A.W., Rapoport, J.L., Thompson, P.M.,
2004. Dynamic mapping of human cortical development during childhood
through early adulthood. Proceedings of the National Academy of Sciences of
the United States of America. 101, 81748179.
Gogtay, N., Vyas, N.S., Testa, R., Wood, S.J., Pantelis, C., 2011. Age of onset of
schizophrenia: perspectives from structural neuroimaging studies. Schizophre-
nia Bulletin 37, 504513.
Groom, M.J., Jackson, G.M., Calton, T.G., Andrews, H.K., Bates, A.T., Liddle, P.F., Hollis,
C., 2008. Cognitive decits in early-onset schizophrenia spectrum patients and
their non-psychotic siblings: a comparison with ADHD. Schizophrenia Research
99, 8595.
Gur, R.E., Nimgaonkar, V.L., Almasy, L., Calkins, M.E., Ragland, J.D., Pogue-Geile, M.F.,
Kanes, S., Blangero, J., Gur, R.C., 2007. Neurocognitive endophenotypes in a
multiplex multigenerational family study of schizophrenia. American Journal of
Psychiatry 164, 813819.
Hardin, J., Hilbe, J., 2003. Generalized Estimating Equations. Chapman and Hall,
London.
Heinrichs, R.W., Zakzanis, K.K., 1998. Neurocognitive decits in schizophrenia: a
quantitative review of the evidence. Neuropsychology 12, 426445.
Hill, S.K., Beers, S.R., Kmiec, J.A., Keshavan, M.S., Sweeney, J.A., 2004. Impairment of
verbal memory and learning in antipsychotic-nave patients with rst-episode
schizophrenia. Schizophrenia Research 68, 127136.
Hollis, C., 2000. Adult outcomes of child-and adolescent-onset schizophrenia:
diagnostic stability and predictive validity. American Journal of Psychiatry
157, 16521659.
Johannsen, S., Duning, K., Pavenstdt, H., Kremerskothen, J., Boeckers, T.M., 2008.
Temporal spatial expression and novel biochemical properties of the memory-
related protein KIBRA. Neuroscience 155, 11651173.
Johnson, S.C., Saykin, A.J., Flashman, L.A., McAllister, T.W., Sparling, M.B., 2001. Brain
activation of fMRI and verbal memory ability: functional neuroanatomic
correlates of CVLT performance. Journal of the International Neuropsychologi-
cal Society 7, 5562.
Joyce, E., 2005. Origins of cognitive dysfunction in schizophrenia: clues for age at
onset. British Journal of Psychiatry 186, 9395.
Kay, S.R., Opler, L.A., Lindenmayer, J.P., 1989. The Positive and Negative Syndrome
Scale (PANSS): rationale and standardization. British Journal of Psychiatry 7,
S5967.
Kauppi, K., Nilsson, L.G., Adolfsson, R., Eriksson, E., Nyberg, L., 2011. KIBRA
polymorphism is related to enhanced memory and elevated hippocampal
processing. Journal of Neuroscience 31, 1421814222.
Kenny, J.T., Friedman, L., Findling, R.L., Swales, T.P., Strauss, M.E., Jesberger, J.A.,
Schulz, S.C., 1997. Cognitive impairment in adolescents with schizophrenia.
American Journal of Psychiatry 154, 16131615.
Kumar, C.T.S., Christodoulou, T., Vyas, N.S., Kyriakopoulous, M., Corrigall, R., Reich-
enberg, A., Frangou, S., 2010. Decits in visual sustained attention differentiate
genetic liability and disease expression for schizophrenia from bipolar disorder.
Schizophrenia Research 124, 152160.
Kremerskothen, J., Plaas, C., Bther, K., Finger, I., Veltel, S., Matanis, T., Liedtke, T.,
Barnekow, A., 2003. Characterization of KIBRA. A novel WW domain-containing
protein. Biochemical and Biophysical Research Communications 300,
14611466.
Libon, D.J., Bogdanoff, B., Cloud, B.S., Skalina, S., Giovannetti, T., Gitlin, H.L., Bonavita,
J., 1998. Declarative and procedural learning, quantitative measures of hippo-
campus, and subcortical while alterations in Alzheimer's disease and Ischaemic
vascular dementia. Journal of Clinical and Experimental Neuropsychology 20,
3041.
Makuch, L., Volk, L., Anggono, V., Johnson, R.C., Yu, Y., Duning, K., Kremerskothen, J.,
Xia, J., Takamiya, K., Huganir, R.L., 2011. Regulation of AMPA receptor function
by the human memory-associated gene KIBRA. Neuron 71, 10221029.
McClellan, J., Prezbindowski, A., Breiger, D., McCurry, C., 2004. Neuropsychological
functioning in early onset psychotic disorders. Schizophrenia Research 68,
2126.
Milnik, A., Heck, A., Vogler, C., Heinze, H.J., de Quervain, D.J., Papassotiropoulos, A.,
2012. Association of KIBRA with episodic and working memory: a meta-
analysis. American Journal of Medical Genetics. Part B, Neuropsychiatric
Genetics 159B, 958969.
Mishara, A.L., Goldberg, T.E., 2004. A meta-analysis and critical review of the effects
of conventional neuroleptic treatment on cognition in schizophrenia: opening a
closed book. Biological Psychiatry 55, 10131022.
Nacmias, B., Bessi, V., Bagnoli, S., Tedde, A., Cellini, E., Piccini, C., Sorbi, S., Bracco, L.,
2008. KIBRA gene variants are associated with episodic memory performance in
subjective memory complaints. Neuroscience Letters 436, 145147.
Need, A.C., Attix, D.K., McEvoy, J.M.M., Cirulli, E.T., Linney, K.N., Wagoner, A.P.,
Gumbs, C.E., Giegling, I., Mller, H.J., Francks, C., Muglia, P., Roses, A., Gibson, G.,
Weale, M.E., Rujescu, D., Goldstein, D.B., 2008. Failure to replicate effect of kibra
N.S. Vyas et al. / Psychiatry Research () 6
Please cite this article as: Vyas, N.S., et al., Association of KIBRA rs17070145 polymorphismwith episodic memory in the early stages of a
human neurodevelopmental disorder. Psychiatry Research (2014), http://dx.doi.org/10.1016/j.psychres.2014.07.024i
on human memory in two large cohorts of European origin. American Journal
of Medical Genetics. Part B, Neuropsychiatric Genetics 147B, 667668.
Nelder, J., Wedderburn, R., 1972. Generalized linear models. Journal of the Royal
Statistical Society, Series A 135, 370384.
Nicolson, R., Brookner, F.B., Lenane, M., Gochman, P., Ingraham, L.J., Egan, M.F.,
Kendler, K.S., Pickar, D., Weinberger, D.R., Rapoport, J.L., 2003. Parental schizo-
phrenia spectrum disorders in childhood-onset and adult-onset schizophrenia.
American Journal of Psychiatry 160, 490495.
Nicolson, R., Rapoport, J.L., 1999. Childhood-onset schizophrenia: rare but worth
studying. Biological Psychiatry 46, 14181428.
Nicolson, R., Lenane, M., Hamburger, S.D., Fernandez, T., Bedwell, J., Rapoport, J.L.,
2000. Lessons from childhood-onset schizophrenia. Brain Research Reviews 31,
147156.
Oie, M., Rund, B.R., 1999. Neuropsychological decits in adolescent-onset schizo-
phrenia compared with attention decit hyperactivity disorder. American
Journal of Psychiatry 156, 12161222.
Passotiropoulos, A., Stephan, D.A., Huentelman, M.J., Hoerndli, F.J., Craig, D.W.,
Pearson, J.V., Huynh, K.D., Brunner, F., Corneveaux, J., Osborne, D., Wollmer, M.
A., Aerni, A., Coluccia, D., Hnggi, J., Mondadori, C.R., Buchmann, A., Reiman, E.
M., Caselli, R.J., Henke, K., de Quervain, D.J., 2006. Common Kibra alleles are
associated with human memory performance. Science 314, 475478.
Paulsen, J.S., Heaton, R.K., Sadek, J.R., Perry, W., Delis, D.C., Braff, D., Kuck, J., Zisook,
S., Jeste, D.V., 1995. The nature of learning and memory impairments in
schizophrenia. Journal of the International Neuropsychological Society 1,
8899.
Remschmidt, H., 2002. Early-onset schizophrenia as a progressive-deteriorating
developmental disorder: evidence from child psychiatry. Journal of Neural
Transmission 109, 101117.
Rodrguez-Rodrguez, E., Infante, J., Llorca, J., Mateo, I., Sanchez-Quintana, C., Garca
Gorostiaga, I., Snchez-Juan, P., Berciano, J., Combbarros, O., 2007. Age-
dependant association of KIBRA genetic variation and Alzheimer's disease risk.
Neurobiology of Aging 30, 322324.
Rapoport, J.L., Giedd, J.N., Gogtay, N., 2012. Neurodevelopmental model of schizo-
phrenia: update 2012. Molecular Psychiatry 17, 12281238.
Roofeh, D., Cottone, J., Burdick, K.E., Lencz, T., Gyato, K., Cervellione, K.L., Napolitano,
B., Kester, H., Anderson, B., Kumra, S., 2006. Decits in memory strategy use are
related to verbal memory impairments in adolescents with schizophrenia-
spectrum disorders. Schizophrenia Research 85, 201212.
Risch, N., Zhang, H., 1995. Extreme discordant sib pairs for mapping quantitative
trait loci in humans. Science 268, 15841589.
Schaefer, J., Giangrande, E., Weinberger, D.R., Dickinson, D., 2013. The global
cognitive impairment in schizophrenia: consistent over decades and around
the world. Schizophrenia Research 150, 4250.
Schaper, K., Kolsch, H., Popp, J., Wagner, M., Jessen, F., 2007. KIBRA gene variants are
associated with episodic memory in health elderly. Neurobiology of Aging 29,
11231125.
Sitskoorn, M.M., Aleman, A., Ebisch, S.J., Appels, M.C., Kahn, R.S., 2004. Cognitive
decits in relatives of patients with schizophrenia: a meta-analysis. Schizo-
phrenia Research 71, 285295.
Snitz, B.E., Macdonald 3rd, A.W., Carter, C.S., 2006. Cognitive decits in unaffected
rst-degree relatives of schizophrenia patients: a meta-analytic review of
putative endophenotypes. Schizophrenia Bulletin 32, 179194.
Thompson, P.M., Vidal, C., Giedd, J.N., Gochman, P., Blumenthal, J., Nicolson, R., Toga,
A.W., Rapoport, J.L., 2001. Mapping adolescent brain change reveals dynamic
wave of accelerated gray matter loss in very early-onset schizophrenia.
Proceedings of the National Academy of Sciences of the United States of
America 98, 1165011655.
Trandar, A., Mary, A., Schrhoff, F., Leboyer, M., Szke, A., 2006. Memory tests in
rst-degree adult relatives of schizophrenic patients: a meta-analysis. Schizo-
phrenia Research 81, 217226.
Vassos, E., Bramon, E., Picchioni, M., Walshe, M., Filbey, F.M., Kravariti, E., McDonald,
C., Murray, R.M., Collier, D.A., Toulopoulou, T., 2010. Evidence of association of
KIBRA genotype with episodic memory in families of psychotic patients and
controls. Journal of Psychiatric Research 44, 795798.
Vogt-Eisele, A., Krger, C., Duning, K., Weber, D., Spoelgen, R., Pitzer, C., Plaas, C.,
Eisenhardt, G., Meyer, A., Vogt, G., Krieger, M., Handwerker, E., Wennmann, D.
O., Weide, T., Skryabin, B.V., Klugmann, M., Pavenstdt, H., Huentelmann, M.J.,
Kremerskothen, J., Schneider, A., 2014. KIBRA (KIdney/BRAin protein) regulates
learning and memory and stabilizes Protein kinase M. Journal of Neurochem-
istry 123, 686700.
Vyas, N.S., Gogtay, N., 2012. Treatment of early onset schizophrenia: recent trends,
challenges and future considerations. Frontiers of Psychiatry 3, 29.
Vyas, N.S., Hadjulis, M., Vourdas, A., Byrne, P., Frangou, S., 2007. The Maudsley early
onset schizophrenia study: predictors of psychosocial outcome at 4-year
follow-up. European Child and Adolescent Psychiatry 16, 265270.
Vyas, N.S., Kumra, S., Puri, B.K., 2010a. What insights can we gain from studying
early-onset schizophrenia? The neurodevelopmental pathway and beyond.
Expert Review of Neurotherapeutics 10, 12431247.
Vyas, N.S., Patel, N.H., Puri, B.K., 2010b. Neurobiology and phenotypic expression in
early-onset schizophrenia. Early Intervention of Psychiatry 11, 314.
Vyas, N.S., Patel, N.H., Nijran, K.S., Al-Nahhas, A., Puri, B.K., 2010c. Can PET/CT
imaging advance our understanding of the neurobiology of schizophrenia?
Nuclear Medicine Communications 31, 9193.
Vyas, N.S., Lee, Y., Ahn, K., Ternouth, A., Stahl, D.R., Simic, M., Al-Chalabi, A., Powell,
J.F., Puri, B.K., 2012a. Association of a serotonin receptor 2A gene polymorphism
on visual sustained attention in early onset schizophrenia and their non-
psychotic siblings. Aging and Disease 3, 291300.
Vyas, N.S., Puri, B.K., 2012. Evidence of an association of Brain Derived Neurotrophic
Factor (BDNF) Val66Met gene polymorphism on general intellectual ability in
early-onset schizophrenia. The Israel Journal of Psychiatry and Related Sciences
49, 137142.
Vyas, N.S., Shamsi, S.A., Malhotra, A.K., Aitchison, K.J., Kumari, V., 2012b. Can
genetics inform the management of cognitive decits in schizophrenia? Journal
of Psychopharmacology 26, 334348.
Yasuda, Y., Hashimoto, R., Ohi, K., Fukumoto, M., Takamura, H., Iike, N., Yoshida, T.,
Hayashi, N., Takahashi, H., Yamamori, H., Morihara, T., Tagami, S., Okochi, M.,
Tanaka, T., Kudo, T., Kamino, K., Ishii, R., Iwase, M., Kazui, H., Takeda, M., 2010.
Association study of KIBRA gene with memory performance in a Japanese
population. World Journal of Biological Psychiatry 11, 852857.
Xiao, L., Chen, Y., Ji, M., Volle, D.J., Lewis, R.E., Tsai, M.Y., Dong, J., 2011. KIBRA protein
phosphorylation is regulated by mitotic kinase aurora and protein phosphatase
1. The Journal of Biological Chemistry 286, 3630436315.
Zhang, L, Yang, S, Wennmann, DO, Chen, Y, Kremerskothen, J, Dong, J., 2014. KIBRA:
in the brain and beyond. Cellular Signalling 26, 13921399.
N.S. Vyas et al. / Psychiatry Research () 7
Please cite this article as: Vyas, N.S., et al., Association of KIBRA rs17070145 polymorphismwith episodic memory in the early stages of a
human neurodevelopmental disorder. Psychiatry Research (2014), http://dx.doi.org/10.1016/j.psychres.2014.07.024i