has been sequenced in the year 2000 (Sequenceie!er" #$%). &'tensi(e genetic and )hysical ma)s of all 5 chromosomes (Ma)ie!er). # ra)id life cycle (about 5*+ !ee,s from germination to mature seed). -rolific seed )roduction and easy culti(ation in restricted s)ace. &fficient transformation methods utili.ing Agrobacterium tumefaciens. S%$n#/ 01*23# &')ress0 #rabido)sis $ene Ma))ing 1ool Mo(ing for!ard in re(erse: genetic technologies to enable genome*!ide )henomic screens in #rabido)sis 4ose M. #lonso5 and 4ose)h 6. &c,er (2007) 3ature Work Plan Screening of Arabidopsis mutants on MS plates
Planting mutant lines on Soil
DNA isolation
Amplify the flanking sequences of each insertion
(Using gene specific Primers)
omo!ygosity and etero!ygosity analysis for "# DNA through P$% Identification of interesting phenotype linked &ith homo!ygous "#DNA line
Amplification of 'ene from &ild type
$loning and Sequencing of gene
$onstruct designing into p(INA% e)pression *ector
"ransformation into hetero!ygous mutant plant
$omplementation of mutant phenotype
Germination of the different plant lines on MS medium 1he resistant )lants of mutant 175809 are germinated on MS ha(ing sulfadia.ine 1he resistant )lants of mutant 070807 are germinated on MS ha(ing sulfadia.ine 2escri)tion of the Mutant Phenotype of GABI mutant Disrupted gene: 1he disru)ted gene !as #t5g17:+0 genomic sequence length: 1701 nucleotides coding sequence length: 901 nucleotides. T-DNA Sequence AATCTGTGCGCGGGAATTATCGCATAAATTGGCTTTGGGATCCTCCC TATGGGAGC#$##$#;1;##;$;$#1#$#$#1#$;$####$##### ;;;$##$#$#;#;##111;11;1;#$#$1;11;##$##;#;;###1 1$1;#1$1#$111;1#;#1;##1##$##$;#1;1# Gene Annotation 1he gene #t5g17:+0 codes for a )utati(e 3#2-*de)endent o'idoreductase li,e )rotein Protein properties /ength : <11 amino acids molecular !eight : <452+.: 2a %soelectric )oint is 7.<2 Disrupted gene At4g29060 which has 4312 nucleotides for genomic DNA sequences and 262 nucleotides for coding sequences! T-DNA Sequence GGGTTCATACTCATTGCTGG1$1;1;1;;;;1$1$;1#11111#111;$1111 ;;;1;1;11$$1$$#1#$#$$#$#1##$#$1;11;###$#11#;1#;#$$1$# 11$1;11111;1;1;1;1;;1$;$;;#1;##$#;1;$#$;11;##1#1$$$;1 1#;$$$;11;#1#;1##$$;;;#1;##1#$;;1#1#1;$#1$1$###;1;;;; ;;;#$#;#11#;#1#$1#$;##1$;;1;;1111;#1$;1$$1;##111;11## 1###1;##1##$#$$;$1;$##;##$#;11#11;##;#1111#11#;1##$#$1 ;1####$#;111#$11111$#;;;1;;##$1;#1#;#$#1###$;;1#111#$# 1;11111;#1#11#1##1;#1#1$$1111$#;;AAAAAAAGAAAAACTTATGGT AAGATCATTCATGAGAGGAAAAAAGAATTGCCAAACGATGA TCTACCACTCTCCTCGTTTTCGCTTCGTGCTTATTTGTCAAACGCGAACATTTCA CCGAAACTTAGCGACTTTTCTCGCTTTACTCTTTCTGGGAGCAATTTCTCAGAG CATAGGCGAGCTTAAAGGTAGCTCCTTTTCTTAGCTTTGCTCAAATGGGTTTCT TAGTTACTCTTCTTATGTTTCCGTGATAAGATGGTTCGAAATTTACTATGGGAT CCTCCGTATAGTGAGGCGTTNTTACTAANNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNA#$#####$#$1$$1;;1111;11;#1#1$;111;#$#11#$ 1;1$1$11$11$1;1$#$$###$;11$1##1111$#;#$1$1$1##1$$111 1;1#1$1$1#$$1$#;#$11;11#$;1#1$$;1#;$#11#;#;;11;11;1#1 1#$;##1$;;1$$;1;#11;;1$$#$;11;1111#;1$1###$##$#$1$#1 1$11;;#1;###1$1# Gene Annotation #t4g2:070 codes for a )utati(e =uinone o'idoreductase li,e )rotein !hich functions in chain elongation during )oly)e)tide synthesis at the ribosome Protein Properties length : :5< amino acids Molecular !eight 10<9+2 2a %soelectric )oint : 4.:5 locali.ed in chloro)last and 6ibosome -;6 am)lification of small )ale green )lants !ith gene s)ecific for!ard and $>* /8 )rimer. Amplification and cloning of the At5g5!5" gene from #ol-" $ene(estigator database (https:$$%%%&gene'estigatorð(&ch) <.9>b <.9>b 6estriction digestion of the cloned #t5g5:750 and )$&M1 (ector <.9,b" !ith Sal*1 and ?ba*1 restriction en.ymes.