JOURNAL OF VIROLOGY, Mar. 2008, p. 2741–2751 Vol. 82, No.

6
0022-538X/08/$08.00⫹0 doi:10.1128/JVI.01712-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Avian Influenza Virus A/HK/483/97(H5N1) NS1 Protein Induces

Apoptosis in Human Airway Epithelial Cells䌤
W. Y. Lam,1 Julian W. Tang,1 Apple C. M. Yeung,1 Lawrence C. M. Chiu,2
Joseph J. Y. Sung,3 and Paul K. S. Chan1,3*
Departments of Microbiology1 and Biology2 and Stanley Ho Centre for Emerging Infectious Diseases,3 The Chinese University of
Hong Kong, New Territories, Hong Kong Special Administration Region, People’s Republic of China
Received 7 August 2007/Accepted 26 December 2007

Avian H5N1 influenza virus causes a remarkably severe disease in humans, with an overall case fatality rate
of greater than 50%. Human influenza A viruses induce apoptosis in infected cells, which can lead to organ
dysfunction. To verify the role of H5N1-encoded NS1 in inducing apoptosis, the NS1 gene was cloned and
expressed in human airway epithelial cells (NCI-H292 cells). The apoptotic events posttransfection were
examined by a terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick-end-labeling assay, flow cy-
tometric measurement of propidium iodide, annexin V staining, and Western blot analyses with antibodies
specific for proapoptotic and antiapoptotic proteins. We demonstrated that the expression of H5N1 NS1
protein in NCI-H292 cells was sufficient to induce apoptotic cell death. Western blot analyses also showed that
there was prominent cleavage of poly(ADP-ribose) polymerase and activation of caspase-3, caspase-7, and
caspase-8 during the NS1-induced apoptosis. The results of caspase inhibitor assays further confirmed the
involvement of caspase-dependent pathways in the NS1-induced apoptosis. Interestingly, the ability of H5N1
NS1 protein to induce apoptosis was much enhanced in cells pretreated with Fas ligand (the time posttrans-
fection required to reach >30% apoptosis was reduced from 24 to 6 h). Furthermore, 24 h posttransfection, an
increase in Fas ligand mRNA expression of about 5.6-fold was detected in cells transfected with H5N1 NS1. In
conclusion, we demonstrated that the NS1 protein encoded by avian influenza A virus H5N1 induced apoptosis
in human lung epithelial cells, mainly via the caspase-dependent pathway, which encourages further investi-
gation into the potential for the NS1 protein to be a novel therapeutic target.

The first documented instance of human infection with avian
influenza A virus H5N1 occurred in Hong Kong in 1997. This
avian influenza virus caused a remarkably severe disease in
humans, with an overall case fatality rate of 33% (4, 57). Since
the reemergence of this virus in 2003, H5N1 infections have
reached the level of endemicity among poultry in multiple
regions of the world, particularly the Southeast Asian coun-
tries. As of June 2007, more than 315 human infections had
been reported to the World Health Organization (WHO), with
a mortality rate greater than 50% (10, 54). While lymphopenia,
hypercytokinemia, and hemophagocytosis have been the most
notable clinicopathological findings, the biological basis ac-
counting for the severity of H5N1 infection in humans remains
unknown (10, 51). In a recent study, apoptosis among the
alveolar epithelial cells of two patients who died of H5N1
infection was observed (53), suggesting that apoptosis may play
a role in H5N1 pathogenesis in humans.
Apoptosis, or programmed cell death, is a series of defined
cellular events that culminates in the efficient removal of the cell
and its contents. Apoptosis consists of three distinct phases: an
initiation phase, triggered by a variety of physiological agents,
which involves the activation of heterogeneous intracellular sig-
naling pathways; a commitment phase, during which the cells
* Corresponding author. Mailing address: Department of Microbi-
ology, 1/F Clinical Science Building, Prince of Wales Hospital, Shatin,
New Territories, Hong Kong Special Administrative Region, People’s
Republic of China. Phone: 852 2632 3333. Fax: 852 2647 3227. E-mail:
paulkschan@cuhk.edu.hk.
䌤
Published ahead of print on 16 January 2008.
become irreversibly committed to die; and an execution phase,
during which the characteristic morphological changes (mem-
brane blebbing, cell shrinkage, and the condensation of the chro-
matin) become obvious. It has been postulated previously that the
induction of apoptosis is a host defense mechanism, stopping the
replication and spread of viruses (19). Many viral infections result
in the apoptosis of host cells, whereas several viruses have evolved
mechanisms to inhibit apoptosis (45, 50), allowing continued viral
replication in infected host cells.
Influenza viruses are reported to induce apoptosis in numer-
ous cell types, both in vivo (28, 37, 39) and in vitro (12, 17, 26,
29, 41, 42, 44, 48, 49). The virus induces apoptosis in infected
cells as part of the mechanisms contributing to cellular and
organ dysfunction (38, 52). Apoptosis induction is multifacto-
rial and highly regulated. It has been shown previously that
influenza virus strains differ in their abilities to induce apop-
tosis, and this phenomenon is also cell type specific. This spec-
ificity may be due to the fact that different viral proteins from
different strains may vary in their abilities to modulate the
apoptotic response (3). Several viral proteins (neuraminidase,
M1, NS1, and PB1-F2) from different strains of human influ-
enza viruses have been shown to induce or inhibit apoptosis in
human cells (5, 6, 29, 46, 58, 59).
To date, whether and to what extent apoptosis contributes to
the highly virulent property of influenza (H5N1) viruses are
not clear. Moreover, the upstream signaling events and what
initiates the apoptotic cascade are not known. There are re-
ports showing that a poor-apoptosis-inducer strain can be con-
verted into a strong-inducer strain by the substitution of the
NS1 gene from a strong-inducer strain by a reverse-genetics

2741
2742 LAM ET AL.
technique, and vice versa (31). It has also been shown previ-
ously that NS1 proteins encoded by different strains may have
different abilities to induce apoptosis (3, 30). Furthermore,
there are reports showing that the H5N1 NS1 gene can cir-
cumvent the host antiviral cytokine responses and contribute
to the virulence of H5N1 avian influenza viruses (25, 43).
In this study, we demonstrated the ability of the H5N1-
encoded NS1 protein to induce apoptosis in human bronchio-
lar epithelial cells (NCI-H292 cells).
MATERIALS AND METHODS
Virus growth and cell culture. Cells of the human bronchial epithelial cell line
NCI-H292 (ATCC CCL-1848) were grown as monolayers in RPMI 1640 medium
(Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitro-
gen) at 37°C in a 5% CO2 incubator (16). The cells were infected with an H5N1
virus isolated from a patient in Hong Kong in 1997, A/HK/483/97(H5N1), at a
multiplicity of infection of 1.
RNA extraction and construction of plasmids. Total RNA was extracted from
cell lysate using the QIAamp viral RNA mini kit (Qiagen, Hilden, Germany).
The full-length NS1 gene from A/HK/483/97(H5N1) was amplified using the
SuperScript III one-step reverse transcription-PCR (RT-PCR) system with Plat-
inum Taq high-fidelity polymerase (Invitrogen) and ligated into the linearized
pcDNA4/HisMaxTOPO vector according to the protocol of the vector manufac-
turer (Invitrogen) to produce the recombinant His-tagged construct pcDNA4-
NS1. This vector contains the cytomegalovirus promoter for the expression of an
NS1 protein with a six-histidine tag. Clones were screened for proper orientation
by PCR and sequence analysis using the version 3.1 BigDye Terminator ready
reaction cycle sequencing kit (Applied Biosystems, Foster City, CA). Competent
Escherichia coli TOP10 cells (Invitrogen) were transformed with the plasmids,
and the plasmids were amplified and purified using a high-purity plasmid puri-
fication kit (Invitrogen).
Transient transfection and protein expression system. Approximately 106 NCI-
H292 cells were transfected with 4 ␮g of pcDNA4-NS1 or control plasmids in a
six-well plate using Lipofectamine 2000 reagent according to the protocol of the
manufacturer (Invitrogen). Cells were then collected at 0, 6, 12, 18, 24, and 30 h
posttransfection, washed with phosphate-buffered saline (PBS), and trypsinized. The
cell pellet was then resuspended in 100 ␮l of lysis buffer (2% sodium dodecyl sulfate,
10% glycerol, 0.0625 M Tris-HCl [pH 8.0]), and the suspension was incubated on ice
for 30 min. After boiling for 10 min and centrifugation at 12,000 ⫻ g for 20 min, the
supernatant was collected for Western blot analysis.
TUNEL assay. At the late stage of apoptosis, the DNA of apoptotic cells is
cleaved into a population of multimers of 180- to 200-bp fragments through the
action of endogenous endonucleases, which then cause morphological changes in
the nuclei of apoptotic cells. The terminal deoxynucleotidyltransferase-mediated
dUTP-biotin nick-end-labeling (TUNEL) system could label this fragmented
DNA in situ. TUNEL staining for apoptotic nuclei was performed using the
DeadEnd colorimetric TUNEL system according to the instructions of the man-
ufacturer (Promega, Madison, WI). Briefly, cells were fixed in 4% paraform-
aldehyde for 25 min and then treated with permeabilization solution (0.2%
Triton X-100 solution in PBS) for 5 min at room temperature. Labeling reactions
were performed with 100 ␮l of reaction buffer for 60 min at 37°C in a humidified
chamber. Color development was accomplished with diaminobenzidine for 8
min. Positively stained apoptotic nuclei were observed microscopically. Apopto-
sis was evaluated as the average number of positively stained cells per field at
high-power magnification (⫻400).
PI staining and DNA content analysis by flow cytometry. The propidium
iodide (PI) flow cytometric assay is based on the principle that apoptotic cells are
characterized by DNA fragmentation and the consequent loss of nuclear DNA
content at the late phase of apoptosis. Briefly, cells (106) were washed with PBS
and fixed with 70% ethanol overnight at 4°C. The fixed cells were then stained
with 50 ␮g of PI (Sigma, St. Louis, MO)/ml with 1 ␮g of RNase A/ml at 4°C for
1 h. PI binds to DNA by intercalating between the bases, with no sequence
preference. The DNA contents of the cells were then analyzed with a flow
cytometer (XL-MCL; Beckman Coulter, Fullerton, CA). Cells at the late stage of
apoptosis, i.e., sub-G1 (hypodiploid) cells, will have DNA contents lower than
those of G1 cells. The proportions of these apoptotic cells, i.e., sub-G1 cells, at
different time points posttransfection were determined.
Annexin V-FITC staining of apoptotic cells and analysis by flow cytometry.
Cells were collected, washed with PBS, and stained with fluorescein isothiocya-
nate (FITC)-conjugated annexin V (BD Biosciences, Franklin Lakes, NJ) and PI
J. VIROL.
for 20 min at room temperature in the dark. The stained cells were then analyzed
by a flow cytometer (Beckman Coulter). FITC-conjugated annexin V binds to
surface phosphatidylserine translocated from the intra- to the extracellular
plasma membrane early in apoptosis. Cells were simultaneously stained with PI
to discriminate membrane-permeable necrotic cells from FITC-labeled apop-
totic cells. Apoptotic cells were identified as those with annexin V-FITC staining
only, and the results were expressed as the proportion of these cells among the
total number of cells analyzed.
Western blot analysis. Monolayers of cells transfected with DNA or untrans-
fected cells were lysed, and the total protein concentration was determined by
the bicinchoninic acid assay (Sigma). Proteins with equivalent concentrations
were heated for 5 min at 100°C in sample buffer containing ␤-mercaptoethanol
and were then resolved by 12% or 15% sodium dodecyl sulfate-polyacrylamide
gel electrophoresis. The resolved proteins were transferred onto a polyvinylidene
difluoride membrane (Bio-Rad, Richmond, CA) and blocked with 1% powdered
milk in Tris-buffered saline with 0.1% Tween 20 (Amersham Pharmacia, Upp-
sala, Sweden) for 1 h at room temperature. Mouse or rabbit antibodies were then
used to probe for His-tagged NS1 (Invitrogen) and poly(ADP-ribose) polymer-
ase (PARP), caspase-3, caspase-7, caspase-8, caspase-9, Bid, Bad, Bim, and
Bcl-xL (all from Cell Signaling Technology, Beverly, MA), with overnight incu-
bation at 4°C. The membrane was subsequently incubated for 1 h at room
temperature with 1:1,000 anti-rabbit or anti-mouse immunoglobulin G horserad-
ish peroxidase-linked whole secondary antibody (Amersham Pharmacia, Upp-
sala, Sweden). The membrane was also probed for glyceraldehyde-3-phosphate
dehydrogenase (GAPDH; Chemicon, Temecula, CA) as a loading control.
Caspase inhibition assays. The cell monolayers were treated with 50 ␮M
caspase-8 inhibitor (Ac-IETD-CHO), caspase-3 inhibitor (Ac-DEVD-CHO), or
general caspase inhibitor (Z-VAD-FMK) (all from BD Biosciences) 30 min
before the transfection and protein expression.
Effects of Fas ligands on NS1 induction of apoptosis. The effect of Fas ligands
(FasL) on the induction of the H5N1 NS1 death receptor pathway was also
studied. NCI-H292 monolayers were incubated in the absence and presence of
human FasL (2 ng/ml; Upstate Biotechnology, Lake Placid, NY) for 1 h before
transfection experiments were carried out as described above. Cells were also
examined by phase microscopy to evaluate the morphological characteristics of
apoptosis.
Quantification of mRNA by quantitative real-time RT-PCR. To study the
involvement of the Fas/CD95 cell surface death receptor in the induction of
apoptosis in cells transfected with H5N1 NS1, quantitative real-time RT-PCR
was used to compare the profiles of Fas and FasL mRNA expression following
transfection. DNase-treated total RNA was isolated by using the TRIzol total
RNA extraction kit according to the protocol of the manufacturer (Invitrogen).
The cDNA was synthesized from mRNA with poly(dT) primers and Superscript
III reverse transcriptase (Invitrogen) and quantified by real-time PCR analysis
with an ABI PRISM 7700 sequence detection system (Applied Biosystems). The
sense and antisense primers used for Fas were TCGGAGGATTGCTCAACAACC
and AAGAAGAAGACAAAGCCACCCC, respectively, which target a 564-bp
fragment (33). The sense and antisense primers used for FasL were AGGCAAGT
CCAACTCAAGGTCC and CATCTTCCCCTCCATCATCACC, respectively,
which target a 238-bp fragment (33). The PCR conditions were 95°C for 10 min,
followed by 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. PCRs were
performed in triplicate using the SYBR green PCR master mix (Applied Biosys-
tems). The expression of the beta-actin gene was also quantified in a similar way for
normalization of the results obtained for Fas and FasL. Sense and antisense primers
for the beta-actin gene were GCACGGCATCGTCACCAACT and CATCTTCTC
GCGGTGGCCT, respectively. Comparative threshold cycle methods were used to
analyze the results using beta-actin as the endogenous control, where expression
levels of Fas and FasL in untreated and untransfected cells were set at 1.
RESULTS
The expression of H5N1 NS1 protein induced apoptosis in
H292 cells. To assess the expression of NS1 protein in NCI-
H292 cells after transfection with the pcDNA4-NS1 plasmid,
the cells were collected at 0, 6, 12, 18, 24, and 30 h posttrans-
fection. Total proteins from the cell lysates were subjected to
Western blot analysis. The anti-His6 antibody specifically rec-
ognized a protein of about 26 kDa, corresponding to the pre-
dicted size of the H5N1 NS1 protein. The protein expression
VOL. 82, 2008 H5N1 NS1 INDUCES APOPTOSIS 2743

was detectable as early as 6 h and plateaued by 12 h posttrans-

FIG. 1. Time course of H5N1-NS1 protein expression in H292
cells. Anti-His6 antibodies were used to detect the NS1 protein as a
single protein band with a size of approximately 26 kDa in the Western
blot analysis of the protein lysate of NCI-H292 cells transfected with
pcDNA4-NS1. Approximately 25 ␮g of total cell lysate was loaded into
each lane. CC, whole-cell lysates prepared from untransfected control
cells; vector, whole-cell lysates prepared from cells transfected with
pcDNA4 empty vector; H5N1-NS1, whole-cell lysates prepared from
cells transfected with pcDNA4-NS1. GAPDH was detected as a load-
ing control. The results shown are representative of three independent
experiments.
fection (Fig. 1).
To examine whether apoptosis was initiated in the cells
transfected with pcDNA4-NS1, the cells were fixed and exam-
ined by TUNEL, an assay that detects DNA strand breakage,
which is a hallmark of apoptosis. The results showed that the
cells transfected with pcDNA4-NS1 exhibited TUNEL staining
in a time-dependent manner (Fig. 2A). The maximal TUNEL
staining occurred at 24 h posttransfection (Fig. 2B). In con-
trast, the untransfected cells and the cells that were transfected
with an empty vector were negative for TUNEL staining. As
expected, cells treated with the apoptosis-inducing agent stau-
rosporine showed positive TUNEL staining (Fig. 2A and B).
To further document the occurrence of apoptosis among
NS1 protein-expressing cells, PI staining and flow cytometry
were used to analyze cellular DNA content. The results re-
vealed the presence of a population of sub-G1 cells among the
NS1 protein-expressing cells, but not among control cells, from
6 to 30 h posttransfection (Fig. 3A). Apoptosis among stauro-
sporine-treated cells was observed, as expected (Fig. 3B).
These results suggested that the cells expressing NS1 protein
had an apoptotic loss of DNA content (Fig. 3C).

FIG. 2. Apoptosis detected by the TUNEL assay. (A) Representative photographs showing the control and transfected cells stained for the
detection of apoptotic nuclei by the TUNEL assay. The cells were harvested at 0, 6, 12, 18, 24, and 30 h posttransfection. Examples of apoptotic
cells as indicated by positively stained nuclei are marked with arrows. Apoptosis was evaluated by counting the number of positively stained cells
per field at a magnification of ⫻400. CC, untransfected control cells; vector, cells transfected with pcDNA4 empty vector; H5N1-NS1, cells
transfected with pcDNA4-NS1. (B) Representative photographs showing the untransfected control cells not treated (i) or treated with the
apoptosis-inducing agent staurosporine (0.5 ␮M) for 24 h (ii) and stained for the detection of apoptotic nuclei by the TUNEL assay. Examples of
positively stained apoptotic cells are indicated by arrows. ⫺, not treated; ⫹, treated. (C) Percentage of apoptotic cells detected at various time
points posttransfection using the TUNEL assay. Results are expressed as means ⫾ standard deviations (SD) of results from three independent
experiments.
2744 LAM ET AL. J. VIROL.

FIG. 3. Apoptosis detected by cellular DNA analysis using flow cytometry. (A) Representative DNA histograms showing the proportions of
apoptotic hypodiploid nuclei detected by flow cytometry. The proportion of apoptotic cells among the cells transfected with pcDNA4-NS1
increased in a time-dependent manner, but those among untransfected cells and cells transfected with empty vector did not. The percentage of
apoptotic cells detected at each time point is shown. CC, untransfected control cells; vector, cells transfected with pcDNA4 empty vector;
H5N1-NS1, cells transfected with pcDNA4-NS1. (B) NCI-H292 cells treated (⫹) or not treated (⫺) with the apoptosis-inducing agent stauro-
sporine (0.5 ␮M) for 24 h were included as a positive control for the experiment. (C) Proportions of apoptotic cells among the untreated control
cells, cells transfected with empty vector, and cells transfected with pcDNA4-NS1. Results are expressed as means ⫾ SD of results from three
independent experiments.

To complement our results, the cells expressing NS1 protein
were stained with annexin V-FITC and PI and were then an-
alyzed by flow cytometry (Fig. 4A and B). The results showed
that approximately 21% of the NS1 protein-expressing cells
were stained by annexin V-FITC, but not penetrated by PI, at
24 h posttransfection, compared to less than 4% of the control
cells (Fig. 4C). Collectively, all these data indicated that apop-
tosis was initiated in the NCI-H292 cells overexpressing NS1
protein.
Differential activation of caspases in NS1-expressing cells.
To delineate the apoptotic pathway, we first measured the
cleavage of caspase-activated PARP at 6, 12, 18, 24, and 30 h
posttransfection using Western blot analysis. There were in-
creases of about 1.6- and 2-fold in the levels of the cleaved
PARP fragment in NS1-expressing cells at 24 and 30 h postin-
fection, respectively, compared with the levels in cells trans-
fected with the empty vector or mock transfection controls
(Fig. 5A). PARP helps cells to maintain their viability; the
VOL. 82, 2008 H5N1 NS1 INDUCES APOPTOSIS 2745

FIG. 4. Apoptosis detected by annexin V and PI staining. (A) Representative dual-labeled quadrants of bivariant fluorescence dot plots
showing the induction of apoptosis in the NCI-H292 cells transfected with pcDNA4-NS1. Apoptotic cells that stained positive for annexin V but
not PI were identified in the right lower quadrant. Percentages shown are proportions of apoptotic cells detected at different time points, as
indicated. CC, untransfected control cells; vector, cells transfected with pcDNA4 empty vector; H5N1-NS1, cells transfected with pcDNA4-NS1.
(B) NCI-H292 cells treated (⫹) or not treated (⫺) with the apoptosis-inducing agent staurosporine (0.5 ␮M) for 24 h were included as a positive
control. (C) Bar chart showing the proportions of apoptotic cells at different time points posttransfection. Results are expressed as means ⫾ SD
of results from three independent experiments.

cleavage of PARP facilitates cellular disassembly and serves as
a marker of cells undergoing apoptosis. PARP is also one of
the cleavage targets of caspase-3 and caspase-7 in vivo. There-
fore, we further investigated the activities of caspase-3 and
caspase-7. Our results showed that the cleaved fragments of
caspase-3 and caspase-7 were detectable in NS1 protein-ex-
pressing cells at 24 h posttransfection (Fig. 5B and C).
To further delineate the caspase cascade pathway by which
NS1 protein might be involved in the induction of apoptosis,
we examined another important apoptotic marker, caspase-8.
Consistent with the caspase-3 findings, NS1 protein also in-
duced the degradation of procaspase-8 (1.3-fold reduction)
beginning at 24 h posttransfection (Fig. 5D).
Apoptosis can be activated through either the mitochondrion-
mediated (14) or the receptor-mediated (1) pathway. Commu-
nication between the two pathways can occur through the
2746 LAM ET AL. J. VIROL.

FIG. 5. Caspase pathway activation in NCI-H292 cells induced by the H5N1 NS1 protein. The total protein from cell lysates was harvested at different
time points posttransfection (lanes 1 to 5: 6, 12, 18, 24, and 30 h, respectively). Western blot analysis was performed to detect the cleavage of proapoptotic
proteins in untransfected control cells (CC), cells transfected with pcDNA4 empty vector (vector), and cells transfected with pcDNA4-NS1 (H5N1-NS1).
VOL. 82, 2008 H5N1 NS1 INDUCES APOPTOSIS 2747

FIG. 6. Expression of pro- and antiapoptotic proteins in NCI-H292 cells after transfection with H5N1 NS1. Cell lysates harvested at different
time points (6, 12, 18, 24, and 30 h) posttransfection were used for Western blot analysis to detect the expression of procaspase-9, Bid, Bad, Bim,
Bcl-xL, Bax, and Bak. CC, untransfected control cells; vector, cells transfected with pcDNA4 empty vector; H5N1-NS1, cells transfected with
pcDNA4-NS1. The results shown are representatives of triplicate experiments. The level of induction (n-fold) was calculated from density values
for protein bands relative to the corresponding GAPDH results.

caspase-8-mediated cleavage of Bid, a member of the Bcl-2
family, which induces the release of cytochrome c. Therefore,
we also studied the effect of NS1 protein on mitochondrion-
mediated apoptotic pathway-related protein expression, such
as that of Bid, Bim, Bad, Bcl-xL, and caspase-9. Our results
showed that NS1 protein expression did not affect the levels of
the Bcl-2 family proteins and caspase-9 (Fig. 6).
We further examined the pathway involved in NS1 protein-
induced apoptosis by treating the NCI-H292 cells with inhibi-
tors specific for caspase-3 and caspase-8 and a general inhibitor
of all caspases before transfection. Cells were collected for
analysis at 24 h posttransfection (Fig. 7). This time point was
selected based on the observation that NS1 protein was highly
expressed at 24 h posttransfection, and at this time point, both
the early and late apoptotic events were detected at high levels.
Following the inhibition by the caspase-3 inhibitor, the
caspase-8 inhibitor, and the general caspase inhibitor, apopto-
sis inhibition levels of 31%, 11%, and 49% were detected by PI
staining (Table 1). These results further suggested the induc-
tion of apoptosis by NS1 protein via the caspase-dependent
death receptor pathway.
Fas ligand (FasL) levels and effects of Fas ligands on NS1
induction of apoptosis. Interestingly, the ability of H5N1 NS1
protein to induce apoptosis in FasL-pretreated cells was much
enhanced compared to that in nonpretreated cells. Among
cells transfected with H5N1 NS1, the proportion of apoptotic
cells detected at 24 h posttransfection was 37.6%. However,
among FasL-pretreated cells, the proportion of apoptotic cells
achieved as early as 6 h posttransfection was 30.7% (Fig. 8).
These results showed that bronchial epithelial NCI-H292 cells
could respond to the FasL apoptotic stimulus and that this
stimulus also enhanced the apoptotic induction by the H5N1
NS1 protein.
At 6 h posttransfection, no significant difference in the levels
of Fas and FasL mRNAs in the FasL-pretreated, transfected
cells compared to those in the corresponding controls was
observed (Fig. 9A). However, at 24 h posttransfection, there
was a 5.6-fold increase in FasL expression in cells transfected
with H5N1 NS1 but not pretreated with FasL; in the cells
transfected with H5N1 NS1 and pretreated with FasL, there
was a 44.9-fold increase in FasL expression (Fig. 9B).
DISCUSSION
Most of the in vitro studies of influenza virus-induced apoptosis
have been carried out with monocyte/macrophage cell lines (3,
27). However, it should be noted that respiratory epithelial
cells rather than these immune cells are the primary target of
virus replication. Furthermore, these immune cells will not be
present in large numbers until they have been recruited into
the area at a later stage of infection. In fact, by using human
biopsy or brush samples, it has been shown previously that in
the normal healthy respiratory epithelium, immune cells typi-
cally make up less than 1% (bronchial epithelium) or 2%

Total proteins from NCI-H292 cells treated (⫹) and not treated (⫺) with the apoptosis-inducing agent staurosporine (0.5 ␮M) for 24 h were
included as a positive control. (A) The cleavage of PARP in cells transfected with pcDNA4-NS1 was detected by using anti-PARP antibody. (B)
Procaspase-3 (C3) activation in cells transfected with pcDNA4-NS1 was detected by using anti-caspase-3 antibody. (C) Procaspase-7 (C7)
activation in cells transfected with pcDNA4-NS1 was detected by using anti-caspase-7 antibody. (D) Procaspase-8 (C8) activation in cells
transfected with pcDNA4-NS1 was detected by using anti-procaspase-8 antibody. GAPDH was used as the loading control for each membrane
preparation from the untransfected control cells, the cells transfected with pcDNA4 empty vector, and the cells transfected with pcDNA4-NS1.
The results shown are representative of three separate experiments. The GAPDH results shown correspond to those for cells transfected with
pcDNA4-NS1. The level of induction (n-fold) was calculated from density values for protein bands relative to the GAPDH results corresponding
to the untransfected control cells, the cells transfected with pcDNA4 empty vector, or the cells transfected with pcDNA4-NS1
2748 LAM ET AL. J. VIROL.

FIG. 7. Effects of caspase inhibitors on NS1 protein-induced apoptosis in NCI-H292 cells. NCI-H292 cells (106/ml) were pretreated with a
caspase-3 inhibitor, a caspase-8 inhibitor, or a general caspase inhibitor before transfection. Cells were harvested at 24 h posttransfection and
stained with PI at 4°C for 1 h. Apoptotic hypodiploid nuclei were detected by fluorescence-activated flow cytometry analysis. The values in the lower
left corners indicate average percentages of apoptotic cells. The results shown are representatives of triplicate experiments. CC, untransfected
control cells; vector, cells transfected with pcDNA4 empty vector; H5N1-NS1, cells transfected with pcDNA4-NS1.

(nasal epithelium) of the cell population (9). Since apoptosis
was observed mainly in the alveolar epithelial cells of autopsy
specimens taken from patients who died of H5N1 infection
(52), it is important to use respiratory epithelial cells as a
model to study H5N1-induced apoptosis.
The reason why influenza virus induces apoptosis has been
hotly debated (31). It was thought previously that apoptosis is
primarily a host defense mechanism limiting virus replication
and that influenza virus overcomes this mechanism by rapid
multiplication before apoptosis occurs (23). However, there is
now evidence to show that the induction of apoptosis is essen-
tial for influenza virus mRNA synthesis, as well as for virus
propagation (46, 47, 54, 55). Furthermore, H5N1 viral RNA
was detected previously in the lungs and tracheas of infected
subjects, where apoptosis and inflammation were both promi-
nent. In contrast, only viral RNA was detected in the livers, but

TABLE 1. Percentages of apoptotic cells with respect to the caspase inhibitors addeda
% Of apoptotic cells among cells pretreated with:
Cell population General caspase
No inhibitor Caspase-3 inhibitor Caspase-8 inhibitor
inhibitor

Untransfected control cells 2.62 3.16 2.08 5.24

Cells transfected with pcDNA4 empty vector 4.01 5.36 4.10 2.96
Cells transfected with pcDNA4-NS1 56.96 26.37 46.08 7.84

% Inhibition of apoptosis relative to level of apoptosis with no inhibitor 30.59 10.88 49.12
a
Apoptotic cells were counted by PI staining at 24 h posttransfection.
VOL. 82, 2008 H5N1 NS1 INDUCES APOPTOSIS 2749

FIG. 8. Effect of Fas ligand (FasL) pretreatment on NS1 protein-induced apoptosis in NCI-H292 cells. NCI-H292 cells (106/ml) were pretreated
or not treated with FasL (2 ng/ml) for 1 h before transfection. Cells were harvested at 6 and 24 h posttransfection and stained with PI at 4°C for
1 h. Apoptotic hypodiploid nuclei were detected by fluorescence-activated flow cytometry. The values in the lower left corners indicate average
percentages of apoptotic cells. The results shown are a representative of triplicate experiments. CC, untransfected control cells; vector, cells
transfected with pcDNA4 empty vector; H5N1-NS1, cells transfected with pcDNA4-NS1.

apoptosis and inflammation were not observed. These findings
may suggest that apoptosis plays an important role in mediat-
ing inflammation and the subsequent tissue damage in severe
H5N1 infections (52).
NS1 is the only influenza virus protein that has been shown
to be both pro- and antiapoptotic in infected cells (18). It has
been shown previously that the H5N9 NS1 protein induces
apoptosis in MDCK and HeLa cells (41). However, another
study has reported that NS1 from H1N1 or H3N2 recombinant
viruses down-regulates apoptosis in MDCK and Vero cells (31,
58). Furthermore, NS1 from H5N1 has been shown previously
to reduce lymphoid depletion in an in vivo mouse model (18).
Recently, there has been a report showing that NS1 from
H1N1 mediates antiapoptotic signaling responses (11). At
present, it is still not certain whether the NS1 protein is pro-
apoptotic or antiapoptotic. The diverse observations may also
be a result of differences in influenza virus subtypes and strains,
as well as the host cell system being used in the experiments.
Therefore, a detail characterization of the protein and the
mechanisms involved in the induction of apoptosis is essential
for understanding the pathogenesis of influenza viruses, par-
ticularly H5N1 (22).
In the present study, the ability of H5N1 NS1 protein to
induce apoptosis in NCI-H292 cells was verified by several
apoptosis detection assays. These assays target different stages
of apoptosis. The annexin V staining assay detects the early
phase of apoptosis, whereas the TUNEL assay and PI staining
detect DNA fragmentation that occurs at a later stage of apop-
tosis. The annexin V staining results showed that the early stage
of apoptosis was most readily detectable at 24 h posttransfection,
whereas at 30 h posttransfection, DNA fragmentation was readily
detected by PI staining and the TUNEL assay.

FIG. 9. Expression of Fas and Fas ligand (FasL) genes in NCI-H292 cells upon FasL pretreatment and H5N1 NS1 protein expression.
NCI-H292 cells were not treated or were pretreated with FasL (2 ng/ml) for 1 h before being transfected with H5N1 NS1 or pcDNA4 empty vector.
Six hours (A) and 24 h (B) posttransfection, the levels of Fas and FasL mRNAs were measured. FL, cells pretreated with FasL only;
FL-H5N1(NS1), FasL-pretreated cells transfected with H5N1 NS1; FL-vector, FasL-pretreated cells transfected with pcDNA4 empty vector;
H5N1-NS1, cells transfected with pcDNA4-NS1 without FasL pretreatment; vector only, cells transfected with pcDNA4 empty vector without FasL
pretreatment; control, untreated and untransfected control cells. Comparative threshold cycle methods were used to analyze the results using
beta-actin mRNA as the endogenous control. Results are expressed as means ⫾ SD of results from three independent experiments.
2750 LAM ET AL.
Our study of apoptotic protein activities and caspase inhibi-
tion effects confirmed that the apoptosis-inducing ability of
H5N1 NS1 protein was mediated mainly via the death receptor
signaling cascades (40). Our results also indicated that the
pretreatment of NCI-H292 cells with FasL greatly increased
the apoptosis-inducing property of the H5N1 NS1 protein.
This phenomenon may be explained by the homology be-
tween H5N1 NS1 protein and the cytoplasmic domain of the
proapoptotic Fas antigen (15, 17, 19). Apoptosis can occur
through the ligation of cell surface death receptors such as
Fas/CD95, a member of the tumor necrosis factor receptor
family (20, 24, 56). This event leads to the recruitment and
activation of an adapter protein, FADD (Fas-associated
death domain-containing protein), resulting in the activa-
tion of caspases that exist as inactive zymogens in normal
cells (8, 39). The apical target of FADD is caspase-8/FLICE
(2, 32). Activated caspase-8 is able to cleave additional
downstream caspases, including caspase-3, that mediate
apoptosis.
A recent study based on the infection of primary blood
macrophages with whole virus in vitro has also shown that
H5N1 can induce a delayed onset of apoptosis compared to
that induced by H1N1 (27). Similar to our findings, the caspase
cascade was also found to be involved in H5N1-induced apop-
tosis (27). Taken together, these data indicate that NS1 is one
of the key influenza virus-encoded proteins that trigger the
caspase cascade, resulting in apoptosis. However, whether the
NS1 proteins from different virus subtypes are associated with
different patterns of onset of apoptosis and, thus, different
implications for pathogenesis needs to be further investigated.
In addition, the apoptotic effects of the H5N1 NS1 protein may
also differ between human and nonhuman (e.g., avian and
mammalian) hosts.
The apoptotic nature of NS1 may also contribute to the
hypercytokinemic state of humans infected with H5N1. Evi-
dence is accumulating to support the idea that apoptosis and
inflammation are linked in influenza infection (3, 15, 35, 36, 51,
52). For example, it has been shown previously that a proin-
flammatory cytokine, interleukin-8, is secreted upon the induc-
tion of apoptosis in bronchiolar epithelial cells by Fas ligation
(7, 13, 15, 21).
The present study provides evidence that the NS1 protein
encoded by avian influenza A virus H5N1 can induce apoptosis
in human respiratory epithelial cells via the death receptor
caspase pathway. Since the apoptotic destruction of host cells
may contribute to severe disease, any drug that can prevent this
process may reduce disease severity and improve clinical out-
comes (34). Hence, if either the NS1 protein or the Fas ligand
plays a crucial role in inducing apoptosis, then blocking the
production or the action of either of these may have a thera-
peutic benefit for humans with H5N1 influenza infections. For
example, Fas and NS1 gene expression can be blocked by
specific small interfering RNAs, and the action of the Fas
ligand may be blocked using a Fas fusion protein. Therefore,
further investigations as to whether NS1 and/or the Fas ligand
may be worthwhile therapeutic targets for ameliorating the
outcome of avian influenza infection in humans should be
considered.
J. VIROL.
ACKNOWLEDGMENTS
This study was supported by the Research Fund for the Control of
Infectious Diseases from the Health, Welfare and Food Bureau of the
Hong Kong Special Administrative Region government. Part of the
work was performed at the Lo Kwee Cheong Research Laboratory.
REFERENCES
1. Ashkenazi, A., and V. M. Dixit. 1998. Death receptors: signaling and mod-
ulation. Science 281:1305–1308.
2. Balachandran, S., P. C. Roberts, T. Kipperman, K. N. Bhalla, R. W. Compans,
D. R. Archer, and G. N. Barber. 2000. Alpha/beta interferons potentiate virus-
induced apoptosis through activation of the FADD/caspase-8 death signaling
pathway. J. Virol. 74:1513–1523.
3. Brydon, E. W., S. J. Morris, and C. Sweet. 2005. Role of apoptosis and
cytokines in influenza virus morbidity. FEMS Microbiol. Rev. 29:837–850.
4. Chan, P. K. 2002. Outbreak of avian influenza A(H5N1) virus infection in
Hong Kong in 1997. Clin. Infect. Dis. 34(Suppl. 2):S58–S64.
5. Chanturiya, A. N., G. Basanez, U. Schubert, P. Henklein, J. W. Yewdell, and
J. Zimmerberg. 2004. PB1-F2, an influenza A virus-encoded proapoptotic
mitochondrial protein, creates variably sized pores in planar lipid mem-
branes. J. Virol. 78:6304–6312.
6. Chen, W., P. A. Calvo, D. Malide, J. Gibbs, U. Schubert, I. Bacik, S. Basta,
R. O’Neill, J. Schickli, P. Palese, P. Henklein, J. R. Bennink, and J. W.
Yewdell. 2001. A novel influenza A virus mitochondrial protein that induces
cell death. Nat. Med. 7:1306–1312.
7. Cheung, C. Y., L. L. Poon, A. S. Lau, W. Luk, Y. L. Lau, K. F. Shortridge, S.
Gordon, Y. Guan, and J. S. Peiris. 2002. Induction of proinflammatory
cytokines in human macrophages by influenza A (H5N1) viruses: a mecha-
nism for the unusual severity of human disease? Lancet 360:1831–1837.
8. Chinnaiyan, A. M., K. O’Rourke, M. Tewari, and V. M. Dixit. 1995. FADD,
a novel death domain-containing protein, interacts with the death domain of
Fas and initiates apoptosis. Cell 81:505–512.
9. Danel, C., S. C. Erzurum, N. G. McElvaney, and R. G. Crystal. 1996.
Quantitative assessment of the epithelial and inflammatory cell populations
in large airways of normals and individuals with cystic fibrosis. Am. J. Respir.
Crit. Care Med. 153:362–368.
10. de Jong, M. D., and T. T. Hien. 2006. Avian influenza A (H5N1). J. Clin.
Virol. 35:2–13.
11. Ehrhardt, C., T. Wolff, S. Pleschka, O. Planz, W. Beermann, J. G. Bode, M.
Schmolke, and S. Ludwig. 2007. Influenza A virus NS1 protein activates the
PI3K/Akt pathway to mediate antiapoptotic signaling responses. J. Virol.
81:3058–3067.
12. Fesq, H., M. Bacher, M. Nain, and D. Gemsa. 1994. Programmed cell death
(apoptosis) in human monocytes infected by influenza A virus. Immuno-
biology 190:175–182.
13. Fujimoto, I., T. Takizawa, Y. Ohba, and Y. Nakanishi. 1998. Co-expression
of Fas and Fas-ligand on the surface of influenza virus-infected cells. Cell
Death Differ. 5:426–431.
14. Gustafsson, A. B., and R. A. Gottlieb. 2007. Bcl-2 family members and
apoptosis, taken to heart. Am. J. Physiol. Cell Physiol. 292:C45–C51.
15. Hagimoto, N., K. Kuwano, M. Kawasaki, M. Yoshimi, Y. Kaneko, R. Kunitake,
T. Maeyama, T. Tanaka, and N. Hara. 1999. Induction of interleukin-8 secretion
and apoptosis in bronchiolar epithelial cells by Fas ligation. Am. J. Respir. Cell
Mol. Biol. 21:436–445.
16. Hierholzer, J. C., E. Castells, G. G. Banks, J. A. Bryan, and C. T. McEwen.
1993. Sensitivity of NCI-H292 human lung mucoepidermoid cells for respi-
ratory and other human viruses. J. Clin. Microbiol. 31:1504–1510.
17. Hinshaw, V. S., C. W. Olsen, N. Dybdahl-Sissoko, and D. Evans. 1994.
Apoptosis: a mechanism of cell killing by influenza A and B viruses. J. Virol.
68:3667–3673.
18. Hyland, L., R. Webby, M. R. Sandbulte, B. Clarke, and S. Hou. 2006.
Influenza virus NS1 protein protects against lymphohematopoietic patho-
genesis in an in vivo mouse model. Virology 349:156–163.
19. Ito, T., Y. Kobayashi, T. Morita, T. Horimoto, and Y. Kawaoka. 2002.
Virulent influenza A viruses induce apoptosis in chickens. Virus Res. 84:
27–35.
20. Itoh, N., S. Yonehara, A. Ishii, M. Yonehara, S. Mizushima, M. Sameshima,
A. Hase, Y. Seto, and S. Nagata. 1991. The polypeptide encoded by the
cDNA for human cell surface antigen Fas can mediate apoptosis. Cell 66:
233–243.
21. Julkunen, I., K. Melen, M. Nyqvist, J. Pirhonen, T. Sareneva, and S. Mati-
kainen. 2000. Inflammatory responses in influenza A virus infection. Vaccine
19(Suppl. 1):S32–S37.
22. Krug, R. M., W. Yuan, D. L. Noah, and A. G. Latham. 2003. Intracellular
warfare between human influenza viruses and human cells: the roles of the
viral NS1 protein. Virology 309:181–189.
23. Kurokawa, M., A. H. Koyama, S. Yasuoka, and A. Adachi. 1999. Influenza
virus overcomes apoptosis by rapid multiplication. Int. J. Mol. Med. 3:527–
530.
24. Lehmann, C., H. Sprenger, M. Nain, M. Bacher, and D. Gemsa. 1996.
VOL. 82, 2008
Infection of macrophages by influenza A virus: characteristics of tumour
necrosis factor-alpha (TNF alpha) gene expression. Res. Virol. 147:123–130.
25. Li, Z., Y. Jiang, P. Jiao, A. Wang, F. Zhao, G. Tian, X. Wang, K. Yu, Z. Bu,
and H. Chen. 2006. The NS1 gene contributes to the virulence of H5N1 avian
influenza viruses. J. Virol. 80:11115–11123.
26. Lowy, R. J., and D. S. Dimitrov. 1997. Characterization of influenza virus-
induced death of J774.1 macrophages. Exp. Cell Res. 234:249–258.
27. Mok, C. K., D. C. Lee, C. Y. Cheung, M. Peiris, and A. S. Lau. 2007.
Differential onset of apoptosis in influenza A virus. J. Gen. Virol. 88:1275–
1280.
28. Mori, I., T. Komatsu, K. Takeuchi, K. Nakakuki, M. Sudo, and Y. Kimura.
1995. In vivo induction of apoptosis by influenza virus. J. Gen. Virol. 76:
2869–2873.
29. Morris, S. J., G. E. Price, J. M. Barnett, S. A. Hiscox, H. Smith, and C.
Sweet. 1999. Role of neuraminidase in influenza virus-induced apoptosis.
J. Gen. Virol. 80:137–146.
30. Morris, S. J., H. Smith, and C. Sweet. 2002. Exploitation of the herpes
simplex virus translocating protein VP22 to carry influenza virus proteins
into cells for studies of apoptosis: direct confirmation that neuraminidase
induces apoptosis and indications that other proteins may have a role. Arch.
Virol. 147:961–979.
31. Morris, S. J., K. Nightingale, H. Smith, and C. Sweet. 2005. Influenza A
virus-induced apoptosis is a multifactorial process: exploiting reverse genet-
ics to elucidate the role of influenza A virus proteins in virus-induced apop-
tosis. Virology 335:198–211.
32. Muzio, M., A. M. Chinnaiyan, F. C. Kischkel, K. O’Rourke, A. Shevchenko,
J. Ni, C. Scaffidi, J. D. Bretz, M. Zhang, R. Gentz, M. Mann, P. H. Krammer,
M. E. Peter, and V. M. Dixit. 1996. FLICE, a novel FADD-homologous
ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death-
inducing signaling complex. Cell 85:817–827.
33. Nakamura, M., G. Matute-Bello, W. C. Liles, S. Hayashi, O. Kajikawa, S. M.
Lin, C. W. Frevert, and T. R. Martin. 2004. Differential response of human
lung epithelial cells to Fas-induced apoptosis. Am. J. Pathol. 164:1949–1958.
34. Parrino, J., R. S. Hotchkiss, and M. Bray. 2007. Prevention of immune cell
apoptosis as potential therapeutic strategy for severe infections. Emerg.
Infect. Dis. 13:191–198.
35. Pirhonen, J., T. Sareneva, M. Kurimoto, I. Julkunen, and S. Matikainen.
1999. Virus infection activates IL-1␤ and IL-18 production in human mac-
rophages by a caspase-1-dependent pathway. J. Immunol. 162:7322–7329.
36. Pirhonen, J., T. Sareneva, I. Julkunen, and S. Matikainen. 2001. Virus
infection induces proteolytic processing of IL-18 in human macrophages via
caspase-1 and caspase-3 activation. Eur. J. Immunol. 31:726–733.
37. Price, G. E., H. Smith, and C. Sweet. 1997. Differential induction of cyto-
toxicity and apoptosis by influenza virus strains of differing virulence. J. Gen.
Virol. 78:2821–2829.
38. Roberts, N. J., Jr., and J. E. Nichols. 1989. Regulation of lymphocyte pro-
liferation after influenza virus infection of human mononuclear leukocytes.
J. Med. Virol. 27:179–187.
39. Roulston, A., R. C. Marcellus, and P. E. Branton. 1999. Viruses and apop-
tosis. Annu. Rev. Microbiol. 53:577–628.
40. Salvesen, G. S., and V. M. Dixit. 1997. Caspases: intracellular signaling by
proteolysis. Cell 91:443–446.
41. Schultz-Cherry, S., and V. S. Hinshaw. 1996. Influenza virus neuraminidase
activates latent transforming growth factor beta. J. Virol. 70:8624–8629.
42. Schultz-Cherry, S., N. Dybdahl-Sissoko, G. Neumann, Y. Kawaoka, and V. S.
Hinshaw. 2001. Influenza virus NS1 protein induces apoptosis in cultured
cells. J. Virol. 75:7875–7881.
H5N1 NS1 INDUCES APOPTOSIS 2751
43. Seo, S. H., E. Hoffmann, and R. G. Webster. 2004. The NS1 gene of H5N1
influenza viruses circumvents the host anti-viral cytokine responses. Virus
Res. 103:107–113.
44. Shan, B., and W. H. Lee. 1994. Deregulated expression of E2F-1 induces
S-phase entry and leads to apoptosis. Mol. Cell. Biol. 14:8166–8173.
45. Shen, Y., and T. E. Shenk. 1995. Viruses and apoptosis. Curr. Opin. Genet.
Dev. 5:105–111.
46. Stasakova, J., B. Ferko, C. Kittel, S. Sereinig, J. Romanova, H. Katinger, and
A. Egorov. 2005. Influenza A mutant viruses with altered NS1 protein func-
tion provoke caspase-1 activation in primary human macrophages, resulting
in fast apoptosis and release of high levels of interleukins 1beta and 18.
J. Gen. Virol. 86:185–195.
47. Stray, S. J., and G. M. Air. 2001. Apoptosis by influenza viruses correlates
with efficiency of viral mRNA synthesis. Virus Res. 77:3–17.
48. Takizawa, T., S. Matsukawa, Y. Higuchi, S. Nakamura, Y. Nakanishi, and R.
Fukuda. 1993. Induction of programmed cell death (apoptosis) by influenza
virus infection in tissue culture cells. J. Gen. Virol. 74:2347–2355.
49. Takizawa, T., C. Tatematsu, K. Ohashi, and Y. Nakanishi. 1999. Recruit-
ment of apoptotic cysteine proteases (caspases) in influenza virus-induced
cell death. Microbiol. Immunol. 43:245–252.
50. Teodoro, J. G., and P. E. Branton. 1997. Regulation of apoptosis by viral
gene products. J. Virol. 71:1739–1746.
51. To, K. F., P. K. Chan, K. F. Chan, W. K. Lee, W. Y. Lam, K. F. Wong, N. L.
Tang, D. N. Tsang, R. Y. Sung, T. A. Buckley, J. S. Tam, and A. F. Cheng.
2001. Pathology of fatal human infection associated with avian influenza A
H5N1 virus. J. Med. Virol. 63:242–246.
52. Tumpey, T. M., X. Lu, T. Morken, S. R. Zaki, and J. M. Katz. 2000.
Depletion of lymphocytes and diminished cytokine production in mice in-
fected with a highly virulent influenza A (H5N1) virus isolated from humans.
J. Virol. 74:6105–6116.
53. Uiprasertkul, M., R. Kitphati, P. Puthavathana, R. Kriwong, A. Kongchanagul,
K. Ungchusak, S. Angkasekwinai, K. Chokephaibulkit, K. Srisook, N. Vanpra-
par, and P. Auewarakul. 2007. Apoptosis and pathogenesis of avian influenza A
(H5N1) virus in humans. Emerg. Infect. Dis. 13:708–712.
54. World Health Organization. 25 June 2007, posting date. Cumulative number
of confirmed human cases of avian influenza A/(H5N1) reported to WHO.
World Health Organization, Geneva, Switzerland. http://www.who.int/csr
/disease/avian_influenza/country/cases_table_2007_06_25/en/index.html.
55. Wurzer, W. J., O. Planz, C. Ehrhardt, M. Giner, T. Silberzahn, S. Pleschka,
and S. Ludwig. 2003. Caspase 3 activation is essential for efficient influenza
virus propagation. EMBO J. 22:2717–2728.
56. Wurzer, W. J., C. Ehrhardt, S. Pleschka, F. Berberich-Siebelt, T. Wolff, H.
Walczak, O. Planz, and S. Ludwig. 2004. NF-kappaB-dependent induction of
tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and Fas/
FasL is crucial for efficient influenza virus propagation. J. Biol. Chem. 279:
30931–30937.
57. Yuen, K. Y., P. K. Chan, M. Peiris, D. N. Tsang, T. L. Que, K. F. Shortridge,
P. T. Cheung, W. K. To, E. T. Ho, R. Sung, and A. F. Cheng. 1998. Clinical
features and rapid viral diagnosis of human disease associated with avian
influenza A H5N1 virus. Lancet 351:467–471.
58. Zhirnov, O. P., A. L. Ksenofontov, S. G. Kuzmina, and H. D. Klenk. 2002.
Interaction of influenza A virus M1 matrix protein with caspases. Biochem-
istry (Moscow) 67:534–539.
59. Zhirnov, O. P., T. E. Konakova, T. Wolff, and H. D. Klenk. 2002. NS1 protein
of influenza A virus down-regulates apoptosis. J. Virol. 76:1617–1625.