Experimental dermatology Original article

CED
Clinical and Experimental Dermatology

Role of autologous mesenchymal stem cells associated with platelet-rich plasma on healing of cutaneous wounds in diabetic mice
N. M. Argolo Neto, R. J. Del Carlo,* B. S Monteiro, N. B. Nardi, P. C. Chagastelles, A. F. S. de Brito* and A. M. S. Reis*
Department of Veterinary Medicine, Federal University of Piau, Teresina, Brazil, *Department of Veterinary Medicine, Federal University of Vicosa, Vicosa, Brazil, and Department of Genetics Federal University of Rio Grande do Sul, Porto Alegre, Brazil
doi:10.1111/j.1365-2230.2011.04304.x

Summary

Background. Chronic cutaneous lesions affect 15% of human patients with diabetes, and the associated risk of limb amputations is 1546 times greater than that of people with normal glycaemia. It is estimated that half of these limb amputations could be avoided by opportune treatment with somatic stem cells or platelet-rich plasma (PRP). Methods. We evaluated the effects of autologous transplant of mesenchymal stem cells (MSCs) with or without combination with autologous PRP in the re-epithelialization of cutaneous lesions induced in diabetic mice. Results. Animals treated with MSCs alone showed a similar level of re-epithelialization of cutaneous lesions to those treated with MSC plus PRP, and no signicant difference was found between the two treatments. Conclusion. Both treatments gave better results than daily cleaning of the cutaneous lesions with saline or covering of the lesions with semipermeable adherent bandage. a wide array of mesodermal and nonmesodermal tissues.1316 Use of autologous MSCs for the repair of cutaneous lesions is an important therapeutic option that might be of benet to patients with diabetes or patients with re-epithelialization disorders.5,14,17 PRP is widely used in tissue repair, and promotes a strong re-epithelialization stimulus.7,18 To date, seven different growth factors (GFs) present in PRP, which signicantly contribute to the re-epithelialization process, have been identied.6,8,18,19 PRP is inexpensive and easy to produce, and does not require special equipment.7,19 The aim of this study was to evaluate the use of MSCs alone or in combination with autologous PRP in the repair of cutaneous lesions in diabetic mice.

Introduction
Diabetes mellitus (DM) is a healthcare challenge worldwide.1 Chronic cutaneous lesions deriving from endothelial dysfunction are one of the main complications of this disease, and can result in amputation.2,3 It is estimated that half of these amputations could be avoided by early detection of diabetes3,4 and appropriate treatment of cutaneous lesions [e.g. by cell therapy and the use of somatic stem cells (SSCs)]5,6 or platelet-rich plasma (PRP)].7,8 Mesenchymal stem cells (MSCs) are a type of SSC9 that can be isolated from several organs, and are easy to culture.1012 They are capable of differentiating into

Correspondence: Dr Napoleao Martins Argolo Neto, Department of Veter inary Medicine, UFPI Laboratorio de Pesquisas Morfologicas em Ciencia Animal, Centro de Ciencias Agrarias Campus Agrcola da Socopo, Univer sidade Federal do Piau, S N, Teresina Piau 64049-550, Brazil E-mail: argolo_napoleao@hotmail.com Conict of interest: none declared. Accepted for publication 15 September 2011

Methods
The study was approved by the Ethics Committee for Animal Experiments (CEEA) of the Federal University of Vicosa (UFV), according to statement number 43 2007, in accordance with the regulations of the Brazilian College of Animal Experiment (COBEA).

544

The Author(s) CED 2012 British Association of Dermatologists Clinical and Experimental Dermatology, 37, 544553

 Role of autologous MSCs associated with PRP on re-epithelialization in diabetic mice N. M. Argolo Neto et al.

Animals

For this study, we used 40 male C57BL 6 mice, which are negative for gfp gene expression; 28 of these 40 mice were used for clinical studies, and 12 for the histopathological study. A further ve C57BL 6 mice were used as blood donors to obtain the PRP. The age of all mice used in this study was 3 1.2 weeks (mean SD), with a weight of 30 2.4 g). The mice were fed with commercial chow and kept in individual cages, with controlled light dark cycles, temperature and humidity for 30 consecutive days.
Induction of type I diabetes mellitus

trypsin was inactivated by the addition of PBS, the solution separated by centrifugation, and the supernatant discarded. Cells were resuspended in 3.5 mL of culture medium, and transferred into 25 cm3 culture asks, then incubated at 37 C with 5% CO2. The culture medium was changed every 4 days until a cell conuence of 80% was obtained. Cells were then washed, treated with trypsin, transferred into 75 cm3 asks, and incubated at 37 C with 5% CO. Once a minimum cell concentration of 3 107 cells mL was reached, the solution of suspended MSCs in PBS was transported in round-bottomed polypropylene centrifuge tubes (TPP-US, St Louis, MO, USA) for immediate transplantation into the C57BL6 mice.

Streptozotocin (STZ; Sigma Chemical Co., St Louis, MO, USA) 120 mg kg was diluted in 0.5 mL of sodium citrate buffer 0.01 mol L pH 4.5, and given as a single intraperitoneal injection.20,21 Fasting blood glucose (after 12 h) was measured 7 days after injection, using a glucose meter (Accu-Chek Active; Roche Diagnostics Brazil Ltd, Sao Paulo, Brazil). Animals with blood glucose values of 250 mg dL and that exhibited polydipsia were considered diabetic. From this point, non-fasting blood glucose was also measured each morning until the end of the experiment (30 days). After 7 days, treatment for diabetes was started with subcutaneous injection of human isophane insulin 20 U kg (Novolin N; Novo Nordisk Pharmaceuticals Ltd, Monte Claros, Brazil), adjusted according to individual blood glucose levels.
Culture of mesenchymal stem cells

Fluorescence-activated cell sorting

Cells were treated with trypsin, collected, and incubated for 30 min at 4 C with phycoerythrin (PE)-conjugated or uorescein isothicyanate (FITC)conjugated antibodies against murine CD11b, CD29, CD44, CD45, CD49e and CD90.2 (Pharmingen, San Diego, CA, USA). Excess antibody was removed by washing. Detection of PE and FITC staining was accomplished by uorescence-activated cell sorting12 using a ow cytometer (FACScan; Becton Dickinson, Franklin Lakes, NJ, USA).

Platelet-rich plasma

MSCs were collected from the bone marrow of isogenic C57BL 6 mice, which are positive for gfp expression. The cells were separated by centrifugation at 22 C and 300 g for 10 min. The supernatant was discarded and the pellet resuspended in 0.5 mL of culture medium [DMEM pH 7.4, with 10% fetal bovine serum; Sigma Chemical Co.]. From this solution, an aliquot was removed and diluted in Trypan blue for cell counting using a Neubauer chamber. When a minimum cell concentration of 5 106 cells mL was obtained, the cells were incubated at 37 C in 5% CO2 and 95% humidity. The medium was changed weekly until a cell monolayer formed. The culture medium was then discarded, and the cell monolayer was washed with phosphate- buffered saline (PBS) pH 7.2, preheated at 37 C and treated with 1 mL of trypsinEDTA 0.25% (Sigma Chemical Co.). The

The blood donor mice were anaesthetized with isou rane (Isoforine; Cristalia, Itapira, Brazil) and the left ventricle punctured for collection of all circulating blood. Sodium citrate (Bioclin; Quibasa Qumica Basica Ltd, Belo Horizonte, Brazil) was added as anticoagulant, and the blood was spun in a centrifuge at 600 g for 5 min. The total plasma volume was measured, and plasma distributed into tubes. To 50 lL of plasma, we added 25 lL of sodium gluconate 10%. The tubes were then placed in a water-bath at 37 C until the plasma coagulated.18,19 Preparation of the plasma took place moments before it was to be used.
Formation of cutaneous wounds

Two weeks after DM was induced, the animals were anaesthetized with isourane (Virbaxil 2% injectable solution; Virbac Saude Animal, Sao Paulo, Brazil) and trichotomized in the dorsal region. Antimicrobial (Baytril 2.5% injectable solution; Bayer Saude Animal, Brazil) and analgesic (Dimorf injectable solution;

The Author(s) CED 2012 British Association of Dermatologists Clinical and Experimental Dermatology, 37, 544553

545

 Role of autologous MSCs associated with PRP on re-epithelialization in diabetic mice N. M. Argolo Neto et al.

Cristalia Chemical and Pharmaceutical Products) drugs were administered before the surgical procedure. The trichotomized area was cleaned, and a round wound of 15 mm in diameter was created by removing the skin with a punch. The edges of the wound were sutured to the surrounding muscle with separate stitches using a nylon monolament thread, minimizing the effect on later analysis of retraction of the lesion edges.
Treatments

Clinical assessment

The 40 mice were separated randomly into four groups of 10 subjects. The control (saline) group comprised mice whose cutaneous lesions were treated with saline. The MSC group had the MSCs applied directly to the lesion immediately after the surgical procedure, and the lesion was then covered with a semipermeable adherent polyurethane dressing (Tegaderm; 3M Healthcare, St Paul, MN, USA) to keep the cells in place; the polyurethane dressing is permeable to gases and impermeable to liquids, retaining local humidity. The PRP group was treated in a similar way, with the PRP applied on top of the MSCs, and the dressing placed over the site as described above. The time taken to transfer the MSC solution (3.3 107 cells mL) and PRP (2 107 platelets lL) to the transplant site was 30 min. Finally, the polyurethane dressing (PD) group had the cutaneous lesions covered with the dressing without further treatment (Fig. 1).

For all animals, we assessed weight, water ingestion, blood glucose and food consumption. From 48 h after the surgical procedure, the cutaneous lesions of all the animals were inspected daily. The dressing was removed, the wounds were cleaned with humidied gauze in saline, then the dressings were replaced. The variables of lesion area (LA) and scarring time (ST) were analysed daily using digital photographs with standardized light intensity and camera height. The images were transferred and evaluated by computer (ImageLab Pro Plus, version 4.5; Media Cybernetics, Bethesda, MD, USA). For each mouse, the mean of the LA and ST variables was calculated, and from these, the group means were obtained.
Biopsy and histological procedures

On the 12th day of treatment, three animals from each group were randomly selected, weighed and killed with an overdose of isourane. An incisional biopsy was performed, with excision of the entire wound and a margin of intact skin. Skin samples were xed in buffered paraformaldehyde 10% for 24 h, then dehydrated in increasing concentrations of ethanol, cleared in xylene, embedded in parafn wax, and cut into sections 4 lm thick on a rotary microtome. Sections were mounted onto glass slides and stained with picrosirius (picric acid and Sirius red), for identication and quantication of type I and III collagen bres. For both of the treatment groups (MSC and MSCPRP), a fourth mouse was also weighed and killed, then the lesion was removed and histology carried out in the same way until the sections were mounted. These sections were then used for PCR.
Assessment of collagen bres

Figure 1 Cutaneous lesions, 15 mm in diameter, covered by a

semipermeable adherent polyurethane dressing on the backs of C57BL6 mice (blue arrows). The humidity resulted in lesions that were shiny and nonexudative 12 h after the surgical procedure (white arrows).

The picrosirius-stained sections were examined under a polarized light microscope connected to a computer equipped with image-capture software (version 3.5.9; Software Spot Basic; Diagnostic instruments Inc., USA). To assess the variation in collagen bres, three areas of the histological sections were randomly chosen and recorded, using a 10 objective, zoom of 1.5 and magnication of 37.5%. After capture, an image-analysis program (version 4.5; ImageLab Pro Plus) was used to assess the ratio of type I and III collagen bres. For this, a grid with 50 squares was

546

The Author(s) CED 2012 British Association of Dermatologists Clinical and Experimental Dermatology, 37, 544553

 Role of autologous MSCs associated with PRP on re-epithelialization in diabetic mice N. M. Argolo Neto et al.

used. Type I collagen bres appeared as orange or yellow dots and type III as green dots. Black indicated regions with no bres. The percentage of each colour for each individual histological slice was calculated and, from these, the mean values for the groups were obtained.
DNA extraction

corresponding sequences of the gfp gene deposited in the GenBank database.

Statistical analysis

Using a commercial kit (QIAamp DNA Mini Kit 250; Qiagen, Uniscience, Sao Paulo, Brazil), genomic DNA was extracted from the primary culture of MSCs positive for gfp (positive control), from fresh bone tissue of a C57BL6 mouse isogenic to the other mice used (negative control), and from a parafn wax-embedded sample (which was dewaxed and rehydrated) of an animal from the MSC group, in accordance with the manufacturers protocol.
PCR and sequencing

The results were analysed using SAEG software (System for Statistical Analysis; version 9.1, SAEG, Brazil). As they were normally distributed, the Kolmogorov Smirnov test was used to ascertain the distribution of the variables LA and ST, and ANOVA was used to analyse the differences between the independent groups. If a treatment effect was detected, the Tukey post hoc comparison was used. For LA, regression analysis was also used to assess the differences between the studied groups. P < 0.01 was considered signicant.

Results
Mesenchymal stem cells

To detect the gfp gene, PCR was performed on the DNA extracted from the biopsy taken from the MSC-treated animal to amplify a product of 225 bp (primers shown in Table 1). The reaction was carried out in a nal volume of 25.0 lL, consisting of 7.0 lL DNA, 2.5 lL of each primer at 0.02 mmol L, 2.5 lL of each dNTP at 2.0 mmol L each, 2.5 lL 1 buffer, and 1 U Taq DNA polymerase (Invitrogen Corp., Carlsbad, CA, USA). PCR was performed with an initial denaturing step at 94 C for 5 min, followed by 40 cycles of denaturing at 94 C for 35 s, annealing at 58 C for 45 s and extension at 72 for 1 min, with a nal step at 72 C for 7 min. The PCR products were separated by electrophoresis in a 1.5% polyacrylamide gel, stained with ethidium bromide, and visualized on a transilluminator. The amplied material was puried (ExoSAP-IT; USB Corp., Cleveland, OH, USA), then prepared (Big Dye Terminator Cycle Sequencing Kit; Applied Biosystems Perkin Elmer, CA, USA) and sequenced on an automated sequencer (Sequencher 5.0; Gene Codes, Ann Arbor, MI, USA). The obtained sequences were analysed using BLAST to determine the similarity with other

The cultivated MSCs were at, broblast-like, and adherent to plastic. They were positive for CD29, CD44, CD49e and CD90.2, and negative for CD11b and CD45 (Fig. 2).
Lesion area and scarring time

Signicant differences (P < 0.01) were seen between the groups for LA and ST (Table 2). Both the MSC and MSCPRP treatments had lower values for LA and ST compared with the other treatments (saline and PD groups), and the Tukey post hoc test did not identify any differences (P < 0.01) between these two groups. The PD group (treated with dressing alone) had intermediate values, and the saline group had the highest values (Table 2). However, there was a signicant difference (P > 0.01) between the groups in the time taken for reepithelialization to occur, with the MSC and MSC-PRP groups showing faster re-epithelialization. Cubic regression analysis with adjusted determination coefcients conrmed these data (Fig. 3).
Collagen bres

Table 1 Primers used for PCR. Primer Sequence 5 3 Product size, bp

gfp-5C (forward) ACTTCAAGATCCGCCACAACAT 225 gfp-3C (reverse) TTACTTGTACAGCTCGTCCATGC

There were signicant differences (P < 0.01) between the treated groups in the mean percentage of type I and III collagen bres (Table 2). The rats treated with MSC and MSC-PRP had higher percentages of both, with no difference found between these two groups by the Tukey post hoc test. The PD group had intermediate values, and the saline group had the highest values (Table 2).

The Author(s) CED 2012 British Association of Dermatologists Clinical and Experimental Dermatology, 37, 544553

547

 Role of autologous MSCs associated with PRP on re-epithelialization in diabetic mice N. M. Argolo Neto et al.

(a)

CD45

(b)

CD11b

(c)

CD90.2

(d)

CD49e

(e)

CD29

(f)

CD44

Figure 2 Expression of surface markers by murine mesenchymal stem cells. Surface molecules (green lines) are plotted against controls

(black lines). (a) CD45, (b) CD11b, (c) 90.2, (d) CD49e, (e) CD29, (f) CD44.

PCR

Glucose

The expected band of 225 bp, identifying the gfp reporter gene, was seen in the agarose gel of the PCR assay of the mouse treated with MSCs, similar to the positive control (Fig. 4).

In total, 26 mice had a glucose level of > 250 mg dL (normal range 90120 mg dL)2224 7 days after the rst injection of STZ, and 14 more mice reached this level 7 days after the second injection of STZ. The mean

548

The Author(s) CED 2012 British Association of Dermatologists Clinical and Experimental Dermatology, 37, 544553

 Role of autologous MSCs associated with PRP on re-epithelialization in diabetic mice N. M. Argolo Neto et al.

Table 2 Mean values found for lesion area,* scarring time,* and type I and type III collagen in C57BL6 mice in the three treatment groups and the control group. Mean lesion Mean scarring Mean type I Mean type III area, mm time, days collagen, % collagen, % 7.25a 2.36b 2.57b 3.78c 26.86a 14.71b 14.29b 18.29c 34.67a 45.50b 45.83b 37.67a 16.50a 22.34b 22.50b 18.67a

Groups Saline (control) MSC MSC-PRP PD

MSC, mesenchymal stem cell; PD, polyurethane dressing; PRP, platelet-rich plasma. *n = 28; n = 12. Values followed by different letters are signicantly different from each other (Tukey test, P < 0.01).
Figure 4 PCR results. Lanes 1 and 6 contain a standard marker of 100 bp. Lane 2, PCR product of cultured mesenchymal cells (MSCs) (positive control); lane 3, PCR product from cutaneous tissue sample of mice not treated with MSCs (negative control); lane 4, PCR product from cutaneous tissue sample of mice treated with MSCs; lane 5, PCR product from cutaneous tissue sample of mice treated with MSCs plus platelet-rich plasma.

glycaemic levels of the mice increased gradually, for 12 consecutive days, starting from the rst measurement (Fig. 5). Even after the start of the treatment with human isophane insulin, the postprandial glycaemia remained at > 250 mg dL.
Clinical appearance

Mice treated with saline had crusting of the lesions, which regressed slowly until there was loss of the supercial crust and re-epithelization. The lesions of the PG group
(a)

were moist and nonexudative, with a slight accumulation of broid material. The lesions in the MSC and MSC-PRP groups were also moist and nonexudative, but had more rapid re-epithelization from the edges of the lesion than did the PG group (Fig. 6).
Mesenchymal stem cell group

(b)

Witness group

Time (days)

Time (days)

(c)
Mesenchymal stem cell with PRP group

(d)
Polyurethane group Time (days)

Time (days)

Figure 3 Cubic regression analysis for lesion area in mice C57BL6 (n = 28) in groups treated with (a) saline, (b) autologous mesenchymal

stem-cell (MSC) transplant, (c) autologous MSC transplant plus autologous platelet-rich plasma, and (d) semipermeable adherent dressing for 30 consecutive days.

The Author(s) CED 2012 British Association of Dermatologists Clinical and Experimental Dermatology, 37, 544553

549

 Role of autologous MSCs associated with PRP on re-epithelialization in diabetic mice N. M. Argolo Neto et al.

Time (days)

Figure 5 Change in mean glycaemic values in mice C57BL6

(n = 28) from the rst application of streptozotocin, without treatment until day 19, followed by treatment with insulin, then monitored for 30 consecutive days.

Discussion
The characteristic morphology and the molecular level assessed by ow cytometry of MSCs cultivated in this study was the same as those described by other studies for identifying murine MSCs.11,12,25,26

Even though all the mice had the same deleterious effects of hyperglycaemia, those treated with MSCs and MSC-PRP has smaller mean lesion values (P < 0.01) than those that received the other treatments. The greater re-epithelialization of the lesions in these two groups can be attributed to the immunomodulation characteristics and plasticity of MSCs, and to the GFs present in the PRP, which encourage re-epithelialization. The molecular mechanisms involved in the immunomodulatory properties of MSCs have not been completely elucidated, but it is known that these cells produce a large number of soluble factors that interfere with the behaviour of inammatory cells.15,17,25,27 One of the main anti-inammatory soluble factors produced by MSCs is the indoleamine 2,3-dioxygenase (IDO),17,28 and it is possible that in our MSC and MSC-PRP groups, secretion of IDO contributed to reducing the inammatory phase of re-epithelialization. In addition, MSCs have the highest plasticity of all adult stem-cell lineages originating from mesodermal and nonmesodermal tissues that have been studied to date.1316 Hence, the MSCs used to treat the lesions in the MSC and MSC-PRP groups might have induced or stimulated the differentiation of cells involved with re-epithelialization, such as

Meean glycaemic value (mg/dL)

(a)

(b)

(c)

(d)

Figure 6 Cutaneous lesions of C57BL6 mice after 8 days. (a) In the mouse from the saline group, the lesion is erythematous and with a dry crust. (b,c) In the mice treated with (b) mesenchymal stem cells (MSCs), and (c) MSCs plus platelet-rich plasma, the lesion is humid and nonexudative, with marginal epithelization starting from the lesion edges (white and blue arrows, respectively). (d) In mouse treated with polyurethane dressing group, the lesion is also humid and nonexudative, and has accumulation of brinoid material.

550

The Author(s) CED 2012 British Association of Dermatologists Clinical and Experimental Dermatology, 37, 544553

 Role of autologous MSCs associated with PRP on re-epithelialization in diabetic mice N. M. Argolo Neto et al.

broblasts, increasing deposition of collagen in the lesion bed. Corroborating this hypothesis, the mice in the MSC and MSC-PRP groups had signicantly higher (P < 0.01) mean percentage values of type I and III collagens compared with the other groups (Table 2). The higher percentage of collagen in the lesions of mice in the MSC and MSC-PRP groups indicates intense broblastic action, and broblasts are one of the main cells involved in replacement of bronectin and proteoglycan, part of the extracellular matrix, which makes up the main component of scar tissue.29,30 Other authors have shown that cutaneous lesions in mice of these groups are in the advanced stages of re-epithelialization, characterized by the formation of stronger and more elastic connective tissue. The predominance of type I over type III collagen, seen in all four groups in our study (Table 2) was expected, because these collagens are present in the healthy dermis, and represent approximately 87% and 10%, respectively, of the dermal collagen in animals.29,30 However, it was not possible to determine whether the broblasts responsible for the increase in the collagen percentage in lesions of mice in the MSC and MSC-PRP groups originated from the transplanted autologous MSCs or were merely stimulated by them. The identication by PCR of the gfp gene in MSCs in the re-epithelialized cutaneous tissue in the MSC and MSC-PRP groups (Fig. 4) indicates that the MSCs (differentiated or not) were present in the tissue. In addition to the positive contribution of the immunomodulation and plasticity of MSCs, the GFs present in PRP may also have contributed to the re-epithelialization of the lesions in the animals in the MSC-PRP group. PRP is known to be rich in GFs,1820 and we believe that in this study, the platelets transplanted into the cutaneous lesions of the mice were activated by contact with the subendothelial collagen exposed in the lesions, releasing the GFs present in the a-granules, which in turn promoted re-epithelialization of the lesions. This mechanism has been described previously in vitro,1820 and is believed to be similar in animals. Mice in the MSC and MSC-PRP groups also had a signicant (P < 0.01) decrease in mean ST values compared with the other treatments (Table 2). For both LA and ST, these decreases can be explained by the immunomodulatory15,17,25,27 and plasticity characteristics of MSCs,13,14,16 and the promotion of reepithelialization by the GFs present in the PRP.6,8,18 In addition, the accentuated broblast induction, identied by the increase in collagen concentration within the

wound area, contributed to the reduction in ST in the MSC and MSC-PRP groups. There was a positive inuence of MSCs on the ST, and a signicant difference (P < 0.01) between the groups, with the MSC and MSCPRP groups having the shortest time, followed by PD and then saline (Fig. 3). The PD group had values for the LA and ST (Table 2) that were intermediate between the two MSC groups and the saline group (P < 0.01). The adherent bandages maintained humidity in the lesion bed, enabling cell migration from the edges to the centre of the lesion, as described previously.31,32 The humidity probably favoured the action of myobroblasts at the lesion edges, and contributed to the acceleration of the turnover of inammatory cells, events that favour tissue repair.29,33 In addition, the maintenance of hydration in the lesion tissue prevented tissue dissection and crust formation.33 However, no differences were identied (P < 0.01) between the PD and saline groups in the percentage of type I and III collagens, indicating that the dressing does not stimulate tissue broplasia (Table 2). Thus, the benets of using the polyurethane dressing seem to be related to the mechanical effects of maintaining humidity and thus maintaining MSC numbers within the lesion bed. Previous studies31,34 reported positive effects of several types of semipermeable adherent bandage, with an almost twofold increase in the cutaneous re-epithelialization process compared with exposed lesions. Similarly, in our study, the MSC and MSC-PRP groups would also have beneted from the maintenance of humidity in the lesion bed, as the lower values found for the LA and ST variables compared with the PD and saline groups showed that this provided an adequate environment for the development of MSCs. The persistent fasting hyperglycaemia, emaciation and polydipsia seen in the animals proves that DM was induced successfully, as described previously in rats, mice and dogs.2023 The persistence of hyperglycaemia during insulin treatment that we saw the present study, has also been described previously.20,23 Furthermore, the hyperglycaemia could have been responsible for the higher values found for LA in the saline and PD groups (Table 2), as LA has been implicated as the main factor responsible for the chronicity of cutaneous lesions in diabetic humans and in rodents treated with STZ.23,33,3537

Conclusions
In this study, we found that transplantation of autologous MSCs either alone or in association with

The Author(s) CED 2012 British Association of Dermatologists Clinical and Experimental Dermatology, 37, 544553

551

 Role of autologous MSCs associated with PRP on re-epithelialization in diabetic mice N. M. Argolo Neto et al.

autologous PRP stimulated the re-epithelialization of cutaneous lesions in diabetic mice, and was more effective than daily cleaning of the cutaneous lesions with saline or covering of the lesions with semipermeable adherent bandage. The combination of MSCs and PRP did not seem to accelerate re-epithelialization compared with use of MSCs alone. We found that the autologous MSCs used to treat the cutaneous lesions remained within the cutaneous tissue after lesions re-epithelialized. Use of a semipermeable adherent polyurethane dressing resulted in the cutaneous lesions being more hydrated compared with lesions that were exposed to the environment, and that this stimulated re-epithelialization, with the MSCs remaining within the lesion bed, and thus reducing the average woundhealing time compared with saline.

Acknowledgements
We thank Dr N. B. Nardi, Laboratory of Immunogenetics at the Federal University of Rio Grande do Sul (UFRGS), and Dr J. H. Patarroyo Salcedo, Laboratory of Biology and Control of Vectors and Hematozoa BIOAGRO Federal University of Vicosa (UFV). This study was supported by the Research Foundation of the State of Minas Gerais (FAPEMIG), Technical Committee for the Improvement of Higher Education Personnel (CAPES), and and National Counsel of Technological and Scientic Development (CNPq).

References
1 Boyle JP, Honeycutt AA, Narayan KMV et al. Projection of diabetes burden through 2050. Diabetes Care 2001; 24: 193640. 2 Wajchenburg BL. [Endothelial dysfunction in type 2 diabetes mellitus] (in Portuguese). Arq Bras Endocrinol Metabol 2002; 46: 5149. 3 Rocha JLL, Baggio HCC, Cunha CA et al. [Relevant issues in the interaction between diabetes mellitus and infection] (in Portuguese). Arq Bras Endocrinol Metabol 2002; 46: 2219. 4 Hunt D. Using evidence in practice foot care in diabetes. Endocrinol Metab Clin North Am 2002; 31: 60311. 5 Shi C, Zhu Y, Su Y, Cheng T. Stem cells and their applications in skin cell therapy. Trends Biotechnol 2006; 24: 4852. 6 Del Carlo RJ, Monteiro BS, Argolo Neto MA. [Stem cells and growth factors in tissue repair] (in Portuguese). Cienc Vet Trop 2009; 11: 1679. 7 Villela DL. [Topical therapy for chronic leg ulcers with plateletrich plasma] (in Portuguese). Thesis. Sao Paulo: Universid ade Estadual de Sao Paulo, 2008; 85104.

8 Marx RE. Platelet rich plasma (PRP): evidence to support its use. J Oral Maxillofac Surg 2004; 62: 48996. 9 Fuchs E, Tumbar T, Guasch G. Socializing with the neighbors: stem cells and their niche. Cell 2004; 116: 76978. 10 Meirelles LS, Chagastelles PC, Nardi NB. Mesenchymal stem cells reside in virtually all post-natal organs and tissues. J Cell Sci 2006; 119: 220413. 11 Nardi NB, Meirelles LS. Mesenchymal stem cells. Isolation, in vitro expansion and characterization. Handb Exp Pharmacol 2006; 174: 24982. 12 Jiang Y, Vaessen B, Lenvik T et al. Multipotent progenitor cells can be isolated from postnatal murine bone marrow, muscle and brain. Exp Hematol 2002; 30: 896904. 13 Choi JB, Uchino H, Azuma K et al. Little evidence of transdifferentiation of bone marrow-derived stem cells into pancreatic beta cells. Diabetologia 2003; 46: 136674. 14 Herzog EL, Chai L, Krause DS. Plasticity of marrow-derived stem cells. Blood 2003; 102: 348393. 15 Morrison SJ, Spradling AC. Stem cells and niches: mechanisms that promote stem cell maintenance throughout life. Cell 2008; 132: 598611. 16 Verfaillie CM. Adult stem cells: assessing the case for pluripotency. Trends Cell Biol 2002; 12: 5028. 17 Nauta AJ, Fibbe WE. Immunomodulatory properties of mesenchymal stroma cells. Blood 2007; 110: 3499506. 18 Barbosa ALT, Del Carlo PJ, Gomes HC et al. [Platelet-rich plasma for the repair of bone defects in dogs] (in Portuguese). Cienc Rural 2008; 38: 133540. 19 Vendramim FS, Franco D, Nogueira CM et al. [Platelet-rich plasma and growth factors: processing technique and application in plastic surgery] (in Portuguese). Rev Col Bras Cir 2006; 33: 248. 20 Delfino VDA, Figueiredo JF, Matsuo T et al. [Streptozotocininduced diabetes mellitus: long-term comparison of two drug administration routes] (in Portuguese). Jl Braso Nefrola 2002; 24: 316. 21 Agarwal MK. Streptozotocin: mechanisms of action. FEBS Lett 1980; 120: 13. 22 Lerco MM, Spadella CT, MacHado JLM et al. [Characterization of an experimental model of diabetes mellitus, induced by alloxan in rats: clinical and laboratory studies] (in Portuguese). Acta Cirurg. Brasil 2003; 18: 13242. 23 Spadella CT, MacEdo CS, MacHado JLM et al. [Comparative study betweeb five different treatments on the clinical and laboratory changes in rats with alloxan-induced diabetes] (in Portuguese). Acta Cirurg Brasil 2005; 20: 4654. 24 Hedrich HJ, Bullock G, Petrusz P. The laboratory mouse. In: Handbook of Experimental Animals, (Hedrich HJ, Bullock G, Petrusz P eds). San Diego: Elsevier, 2004; 11536. 25 Kitano Y, Radu A, Shaaban A, Flake AW. Selection, enrichment and culture expansion of murine mesenchymal progenitor cells by retroviral transduction of cicling adherent bone marrow cells. Exp Hematol 2000; 28: 14609.

552

The Author(s) CED 2012 British Association of Dermatologists Clinical and Experimental Dermatology, 37, 544553

 Role of autologous MSCs associated with PRP on re-epithelialization in diabetic mice N. M. Argolo Neto et al.

26 Curi CC. [Analysis of mesenchymal stem cells in the bone marrow of Wistar rats subjected to cryopreservation] (in Portuguese). Thesis. Curitiba: Pontifcia Universidade , Catolica do Parana 2005; 3243. 27 Eming SA, Brachvogel B, Odorisio T, Koch M. Skin homeostasis during inflammation: a role for nerve growth factor. Histol Histopathol 2008; 23: 110. 28 Takahashi K, Tanabe K, Ohnuki M et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007; 131: 86172. 29 Balbino CA, Pereira LM, Curi R. [Mechanisms involved in wound healing] (in Portuguese). Rev. Bras. Cienc. Farm 2005; 41: 2751. 30 Scott DW, Miller WH, Griffin CE. In: [Mueller and Kirks Small Animal Dermatology] (in Portuguese), (Scott DW, Miller WH, Grifn CE, eds). Interlivros: Rio de Janeiro, 1996; 23546. 31 Chiari L, Niciporciukas MC, Campos JVM, Gesztesi J. [Evaluation of adhesive bandages on experimental incisional wounds] (in Portuguese). An Acad Bras 1988; 63: 1036.

32 Mandelbaum SH, Di Santis EP, Mandelbaum MH. [Cicatrization: current concepts and auxiliary resources Part I] (in Portuguese). An Acad Bra 2003; 78: 393410. 33 Schultz GS, Sibbald R, Falanga GV et al. Wound bed preparation: a systematic approach to wound management. Wound Rep Regen 2003; 11: 128. 34 Bradley M, Cullum N, Sheldon T. The debridement of chronic wounds: a systematic review. Health Technol Assess 1999; 3: 178. 35 Grossi SAA. [Prevention of leg ulcers in patients with diabetes] (in Portuguese). Rev Esc Enferm USP 1998; 32: 37785. 36 Cosson ICO, Ney-Oliveira F, Adan LF. [Evaluation of the knowledge of preventive measures for the diabetic foot in patients of Rio Branco, Acre] (in Portuguese). Arq Bras Endocrinol Metabol 2005; 49: 54856. 37 Angelis K, Schaan BD, Rodrigues B et al. Disfuncao [Cardiovascular autonomic dysfunction in experimental diabetes mellitus] (in Portuguese). Arq Bras Endocrinol Metabol 2007; 51: 18594.

The Author(s) CED 2012 British Association of Dermatologists Clinical and Experimental Dermatology, 37, 544553

553