LUC BOUDREAU

CONTRLE PHYSIOLOGIQUE ET
PHARMACOLOGIQUE DE LA BIOSYNTHSE DES
LEUCOTRINES









Thse prsente
la Facult des tudes suprieures et postdoctorales de lUniversit Laval
dans le cadre du programme de doctorat en microbiologie-immunologie
pour lobtention du grade de Philosophiae Doctor (Ph D)









DPARTEMENT DE MDECINE
FACULT DE MDECINE
UNIVERSIT LAVAL
QUBEC




2012





Luc Boudreau, 2012

ii
Rsum
Linflammation est un processus normal de dfense du corps humain contre les
pathognes. Bien que la rponse immunitaire soit normalement favorable au corps
humain, elle peut tre aussi trs nfaste. En fait, une rponse inflammatoire excessive non
contrle (ex : inflammation chronique) contribue la persistance de pathologies
chroniques, telles que lasthme, lathrosclrose et larthrite rhumatode. Une enzyme qui
joue un rle important dans ces maladies inflammatoires est la 5-lipoxygnase (5-LO). La
5-LO est responsable de la biosynthse de puissant mdiateurs lipidiques nomms
leucotrines. Le rle biologique des leucotrines implique la chimiotaxie, la
brochoconstriction ainsi que laugmentation de la permabilit vasculaire. Cette thse
cette thse a pour but de mieux comprendre certains aspects de la rgulation
physiologique et pharmacologique de la 5-lipoxygnase, soit par lentremise de
molcules endognes ou de nouveaux composs pharmacologiques.

Un aspect intressant du gnome humain est le phnomne de lpissage alternatif. Il est
trs impressionnant de constater quenviron 70-80% de tous les gnes humains peuvent
subir de lpissage alternatif. Nous avons donc valu si le gne ALOX5, qui code pour la
protine 5-LO, est susceptible lpissage alternatif. Nous avons identifi et caractris
la prsence de nouvelles isoformes protiques de la 5-LO chez les neutrophiles humains
ainsi que chez les lignes cellulaires leucocytaires Raji (lymphocytes B), THP-1 (cellules
monocytaires), Reh (lymphocytes non B et non T) et TA (lymphocytes B).

Dans la seconde partie de mes tudes, nous avons valu les proprits anti-
inflammatoires dun compos actif provenant de la propolis de ruches dabeille, soit
lester dacide cafique phnthyle (CAPE). Nous avons aussi synthtis de nouveaux
analogues de CAPE dont certains ont dmontr une activit anti-inflammatoire. Certains
de ces composs, tels que le CAPE et son analogue amide, ont dmontr une capacit
inhibitrice de la 5-LO quipotente ou suprieur au seul inhibiteur actuellement utilis en
clinique, soit le zileuton.


iii
Il est important de continuer la recherche de nouveaux inhibiteurs de la 5-LO, car le
zileuton, bien quil soit trs efficace dans le traitement de lasthme, peut causer une
certaine toxicit au niveau du foie.




















iv
Abstract
Inflammation is a natural process of the human bodys defence against pathogens.
Although the immune response is primarily favourable to the human body, it can also be
very harmful. In fact, an uncontrolled and excessive inflammatory response (e.g. chronic
inflammation) can result in chronic pathologies such as asthma, atherosclerosis and
rheumatoid arthritis. One enzyme that plays an important role in certain chronic
inflammatory pathologies is the 5-lipoxygenase (5-LO), which is responsible for the
biosynthesis of powerful lipid mediators called leukotrienes. The biological role of
leukotrienes includes chemotaxis, bronchoconstriction and vascular permeability. The
present thesis focuses at better understanding the physiological and pharmacological
regulation of 5-LO, either with natural endogenous molecules or with novel anti-
inflammatory drugs.

One particularly intriguing aspect of the human genome is the alternative splicing
phenomenon. Indeed, it is estimated that between 70-80% of all human genes undergo
alternative splicing. Therefore, we investigated if the ALOX5 gene, which codes for the
5-LO protein, underwent alternative splicing. We identified novel isoforms of the 5-LO
protein in leukocyte Raji (B cells), THP-1 (monocytes), Reh (non B non T) and TA (B
cells). In the second part of my studies, we investigated the anti-inflammatory and
antioxidant properties of an active component from propolis of honeybee hives, known as
caffeic acid phenethyl ester (CAPE). We also synthesized analogues of CAPE, some of
which possess anti-inflammatory properties. Some of these compounds such as CAPE
and its amid analogue, are novel 5-LO inhibitors that are either equipotent or more potent
than the only clinically approved and commercially available 5-LO inhibitor zileuton.

Since some adverse effects result from the clinical use of zileuton in some patient (liver
toxicity), it is clear that there is room for improvement in regards to current 5-LO
inhibitors.



v
Avant-propos

Cette thse constitue le fruit de mes efforts durant les 4 dernires annes de mon passage
au doctorat. Bien que je sois trs content davoir termin mes tudes, je garde
dexcellents souvenirs de mes tudes gradus.

Jaimerais dabord remercier les membres de mon comit dvaluation, les Dr Patrick
Provost, Dr David Marsolais, Dr Dieter Steinhilber, Dr Nicolas Flamand et Dr Marc
Surette. Merci de prendre le temps dvaluer ma thse, vos commentaires seront
fortement apprcis.

Jaimerais remercier le Dr Marc Surette, mon premier mentor, qui a su me transmettre sa
passion pour la recherche ds le dbut de mes tudes gradues. Marc fut une influence
des plus importantes concernant mon choix de carrire et jen suis trs reconnaissant. Sa
passion pour la science est contagieuse et son dsir de vouloir transmettre ses
connaissances aux tudiants est une leon exemplaire pour tout jeune chercheur comme
moi. Merci pour tout Marc!

Jaimerais aussi remercier mon deuxime mentor, le Dr Nicolas Flamand, pour son aide
tout au long du doctorat. Il a toujours su maider dans mes travaux, ce qui est grandement
apprci. Ses commentaires constructifs ont dfinitivement fait de moi un meilleur
chercheur.

Un trs grand merci tous mes collgues de laboratoire. Ils ne sont pas que des collgues
ou de trs bon chercheurs (es) mais aussi de trs bons amis (es). Merci Sam, Phil, Jean-
Luc, Nat, Jacques, Eric et Eric, Max, Anissa et Gisle, en souhaitant continuer nos
collaborations dj bien tablies dans le future, mais surtout ne perdons pas contact!
Merci tous mes collgues du dpartement de chimie-biochimie de lUniversit de
Moncton.


vi
Je tiens remercier particulirement ma famille. mes parents, Hector et Rachel, mon
frre, Eric et ma sur, Christine, je vous remercie infiniment pour le support dont jai
reu de votre part! Finalement vous pourrez dire que votre fils/frre a fini ses tudes!

ma petite famille, mon pouse, Monic; tu mas aid traverser ces 4 annes de hauts et
de bas. Ton support dans mon choix de carrire a toujours t sans quivoque. Un jour
nous serons rcompenss. mon fils Alex, tu as t ma plus grande source inspiration
lors de lcriture de cette thse.

Contribution en tant quauteur :

Chapitre III : Boudreau LH, Bertin J, Robichaud PP, Laflamme M, Ouellette RJ,
Flamand N et Surette ME. (2011) Novel 5-lipoxygenase isoforms affect the biosynthesis
of 5-lipoxygenase products. FASEB J 25: 1097-1105. (contribution larticle:
conceptualisation du projet, manipulation exprimental, analyse des rsultats et rdaction
de larticle)

Chapitre IV : Boudreau LH, Picot N, Doiron J, Villebonet B, Surette ME, Robichaud
GA et Touaibia M. (2009) Caffeoyl and cinnamoyl clusters with anti-inflammatory and
anti-cancer effects. Synthesis and structureactivity relationship. New J. Chem. 33:
1932-1940. (contribution larticle: conceptualisation du projet, manipulation
exprimental, analyse des rsultats et rdaction de larticle)

Chapitre V : Boudreau LH, Maillet J,LeBlanc LM, Jean-Franois J, Touaibia M,
Flamand N, Surette ME (2012) Caffeic acid phenethyl ester and its amide analogue are
potent inhibitors of leukotriene biosynthesis in human blood and isolated poly-
morphonuclear leukocytes. PloS ONE, epub (contribution larticle: conceptualisation du
projet, manipulation exprimental, analyse des rsultats et rdaction de larticle)




vii

mon pouse Monic et mon fils Alex













































viii
Table des matires

Rsum....ii
Abstract..iv
Avant-propos..v
Liste des figures.xi
Liste des tableeauxiii
Abrviationsxiv
Chapter I: Introduction.1
1.1. General introduction..1
1.2. Arachidonic acid.1
1.2.1. General description...1
1.2.2. Dietary source of arachidonic acid...2
1.2.3. Arachidonic acid release..2
1.3. Leukotrienes...3
1.3.1. Biosynthesis of leukotrienes3
1.3.2. Leukotriene receptors..4
1.4. Role of leukotrienes in inflammatory diseases7
1.4.1. Asthma.7
1.4.2. Cardiovascular diseases...8
1.4.3. Arthritis9
1.5. 5-lipoxygenase...10
1.5.1. 5-Lipoxygenase gene structure and regulation...10
1.5.2. 5-Lipoxygenase protein structure...11
1.5.3. Role of calcium in the activation of 5-lipoxygenase .14
1.5.4. Phosphorylation of 5-lipoxygenase....14
1.5.5. Role of ATP in the activation of 5-lipoxygenase...17
1.6. Other proteins associated with LT biosynthesis...17
1.6.1. Five-lipoxygenase activating protein (FLAP)....17

ix
1.6.2. Coactosin-like protein (CLP).18
1.7. Unidentified protein bands in Western blot..19
1.8. Alternative splicing..20
1.8.1. Defining alternative splicing..20
1.8.2. Alternative splicing and diseases...21
1.9. 5-Lipoxygenase inhibitors...24
1.9.1. The 5-lipoxygenase inhibitor zileuton24
1.9.2. Redox-active inhibitors..25
1.9.3. Iron ligand inhibitors..25
1.9.4. Nonredox-type inhibitors...26
1.9.5. Diverse classes of 5-lipoxygenase inhibitors.27
1.10. Other inhibitors of leukotrienes biosynthesis27
1.10.1. FLAP inhibitors..27
1.10.2. cPLA
2
o inhibitors..28
1.10.3. 5-LO/CLP complex inhibitors?..28
1.10.4. Leukotriene receptor antagonists...29
1.11. Caffeic acid phenethyl ester29

Chapter II: Research hypothesis and objectives...31
Chapter III: Novel 5-lipoxygenase isoforms affect the biosynthesis of 5-lipoxygenase
products33
3.1. Rsum...34
3.2. Abstract..35
3.3. Introduction36
3.4. Materials and Methods...37
3.5. Results42
3.6. Discussion..50
3.7. Supplemental data..54
3.8. Acknowledgements54
3.9. References..55

x
Chapter IV: Caffeoyl and cinnamoyl clusters with anti-inflammatory and anti-
cancer effects. Synthesis and structure-activity relationship...61
4.1. Rsum...62
4.2. Abstract..63
4.3. Introduction64
4.4. Experimental..65
4.5. Results and discussion67
4.6. Conclusions77
4.7. Reference79
4.8. Acknowledgements82
4.9. Annexe...82
Chapter V: Caffeic acid phenethyl ester and its amide analogue are potent
inhibitors of leukotriene biosynthesis in human blood and isolated poly-
morphonuclear leukocytes..92
5.1. Rsum...93
5.2. Abstract..94
5.3. Introduction95
5.4. Methods..96
5.5. Results..100
5.6. Discussion and conclusion...112
5.7. Acknowledgements..115
5.8. Abbreviations...115
5.9. References116
Chapter VI: Discussion.122
6.1 Discovery of novel 5-LO isoforms...122
6.2 The anti-inflammatory effects of caffeic acid phenethyl ester.126
Chapter VII: Perspective and conclusions..128
Rfrences...130



xi
Liste des figures
Figure 1.1: Biosynthesis of leukotrienes through the 5-LO pathway....4
Figure 1.2: Crystal structure of the 5-LO.....12
Figure 1.3: Representation of the 5-LO structure composed of a C2-like domain and a
catalytic domain.16
Figure 1.4: Biosynthesis of leukotrienes at the cellular level...19
Figure 1.5: Western blot analysis of leukocyte and neutrophil protein extracts.......20
Figure 1.6: Some examples of alternative splicing...21
Figure 1.7: Molecular structure of the caffeic acid and its analogues, CAPE..30
Figure 3.1: 5-LO transcript expression profiles in peripheral blood PMN and in Raji,
TA, Reh, and THP-1 cells......44
Figure 3.2: Representation of identified human 5-LO isoforms...46
Figure 3.3: Immunodetection of 5-LO isoforms with anti-5-LO following separation by
SDS-PAGE47
Figure 3.4: Stimulated biosynthesis of 5-LO products.49
Supplemental figure 3.1: Typical HPLC chromatograms of standards...54
Figure 4.1: 5-LO activity in cell lysates preincubated with the different test
compounds.73
Figure 4.2: Zileuton structure...74
Figure 4.3: 5-LO activity in intact cells preincubated with the different test
compounds.75
Figure 4.4: Relative growth rates of the non-cancerous breast epithelial cell line
MCF10A incubated with different test compounds...76
Figure 4.5: Relative growth rates of the cancerous breast epithelial cell line MCF7
incubated with different test compounds...77
Figure 5.1: Molecular structures of CAPE 1 and zileuton96
Figure 5.2: Summary of the synthesis of CAPE and its analogues..97
Figure 5.3: Biosynthesis of 5-LO products by thapsigargin-stimulated PMNL in the
presence of various compounds...102
Figure 5.4: Impact of CAPE 1, compound 9 and zileuton on the synthesis of 5-LO
products in cell lysates.104

xii
Figure 5.5: Impact of CAPE 1, compound 9 and zileuton on AA release by stimulated
PMNL..106
Figure 5.6: Impact of CAPE 1, compound 9 and zileuton on the biosynthesis of 5-LO
products in stimulated whole blood.108
Figure 5.7: Free radical scavenging and antioxidant activities of various test
compounds...110
Figure 6.1: Possible inhibitory mechanism of LT biosynthesis by the 5-LO
isoforms....124
























xiii
Liste des tableaux
Table 1.1: Biosynthesis of leukotrienes and receptor profiling..7
Table 1.2: Role of leukotrienes in asthma and cardiovascular diseases.9
Table 1.3: Various GFP constructs of various regions of the 5-lipoxygenase
demonstrating the importance of the C2-like domain and catalytic domain.....13
Table 1.4: List of proteins resulting from alternative slicing in different types of
cancer.................................................23
Table 3.1: List and sequence of oligonucleotide primers.39
Table 5.1: IC
50
values for the inhibition of the synthesis of 5-LO products of test
compounds in the different assays...105
Table 5.2: IC
50
values of test compounds as free radical scavengers and antioxidants..111





















xiv
Liste des abrviations


1o,25(OH)
2
vitamin D
3
Calcitriol
5-HETE 5-hydroxyeicosatetraenoic acid
5-HpETE 5S-hydroperoxy-6E,8Z,11Z,14Z-eicosatetraenoic acid
5-LO 5-Lipoxygenase
5-OxoETE 5-oxo-6E,8Z,11Z,14Z-eicosatetraenoic acid
AA Arachidonic acid
ApoE Apolipoprotein E
ATP Adenosine triphosphate
BLT
1
Leukotriene B
4
receptor 1
BLT
2
Leukotriene B
4
receptor 2
CAPE Caffeic acid phenethyl ester
CLP Coactosin-like protein
COX Cyclooxygenase
cPLA
2
o Cytosolic phospholipase A
2
group IV
CysLTs Cysteinyl leukotrienes
CysLT
1
Type 1 cysteinyl leukotriene receptor
CysLT
2
Type 2 cysteinyl leukotriene receptor
CysLT
E
Leukotriene E receptor
FLAP Five-lipoxygenase activating protein
GPCR G protein-coupled receptor
GM-CSF Granulocyte/macrophage colony-stimulating factor
LDLR Low-density lipoprotein receptor
LTA
4
Leukotriene A
4
LTA
4
H Leukotriene A
4
hydrolase
LTB
4
Leukotriene B
4

LTC
4
Leukotriene C
4
LTC
4
S Leukotriene C
4
synthase
LTD
4
Leukotriene D
4

LTE
4
Leukotriene E
4

LTs Leukotrienes
mRNA Messenger ribonucleic acid
NLS Nuclear localization sequence
PGs Prostaglandins
PLAT Polycystin-1, Lipoxygenase, o-Toxin
PPARs Peroxisome proliferator-activated receptors
TGF| Transforming growth factor-|
WT Wild-type

1
CHAPTER I: Introduction
1.1. General introduction
The human body is equipped with a complex immune system capable of defending it
against infections (bacteria, virus or parasites) or aggressions of physical (extreme heat),
chemical (polluants) or biological nature (toxins, allergens). The immune system
becomes activated when the natural barrier of the host, such as the skin, is impaired by
these aggressions. This typically results in the presence of the five cardinal signs of
inflammation; dolor (pain), calor (heat), rubor (redness), tumor (swelling) and functio
laesa (loss of function). This response is mediated in large parts by the innate immune
system, which is primarily composed of phagocytes, such as neutrophils and
monocytes/macrophages. The inflammatory response also implicates multiple
intercellular signaling lipid mediators, known as eicosanoids. These potent biological
compounds are involved in processes, such as the maintenance of normal homeostasis
and host defense. Amongst these eicosanoids are five well-known families; leukotrienes,
prostaglandins, thromboxanes, lipoxins and resolvins. Interestingly, the first four families
are all biosynthesized from the same precursor known as arachidonic acid (C20:4) while
resolvins are biosynthesized from precursors such as eicosapentaenoic acid (C20:5) or
docosahexaenoic acid (C22:6). Although inflammation is primarily favorable to the
defense of the human body, it can also be very harmful. In fact, an uncontrolled and
excessive inflammatory response (e.g. chronic inflammation) can result in well-known
pathologies, such as asthma, atherosclerosis and rheumatoid arthritis.

1.2. Arachidonic acid
1.2.1. General description
Since it was observed that linoleic acid (C18:2), a direct precursor of arachidonic acid
(AA), was essential to homeostasis maintenance in the rat (1), there has been a constantly
growing interest for lipid mediators. The subsequent structural elucidation of numerous
prostaglandins demonstrated that these autacoids were, in fact, derived from AA. The
importance of AA as a powerful precursor to a number of different bioactive lipid
mediators was confirmed with the discovery of a lipoxygenase activity from
polymorphonuclear neutrophils in rabbits (2).

2
AA, or 5Z,8Z,11Z,14Z-eicosatetraenoic acid, is a prominent member of the e-6 family of
polysaturated fatty acid. It is composed of 20 carbons and 4 double bonds. AA is found in
abundance at the sn-2 position of membrane phospholipids and is the precursor of
numerous of bioactive lipids, such as leukotrienes (LTs) and prostaglandins (PGs). LTs
are synthesized from AA following the catalytic action of the 5-lipoxygenase (5-LO)
enzyme (3). Biosynthesis of LTs will be further discussed in section 1.3.1.

1.2.2. Dietary source of arachidonic acid
AA is not considered an essential fatty acid, since it can be synthesized from linoleic acid
by the -6 desaturase followed by an elongation step. It does however become essential if
there is a deficiency in linoleic acid or if an ability to convert linoleic acid to AA is
present. From a diet point of view, food that contains a relatively good amount of AA
include beef, chicken, eggs, pork, turkey and tuna (4). Of interest, cats are not able to
desaturate essential fatty acid such as linoleic acid, making AA an essential polysaturated
fatty acid that has to be included in their nutrition (5).

1.2.3. Arachidonic acid release
As previously mentioned, AA is incorporated at the sn-2 position of membrane
phospholipids. A large family of enzymes called phospholipase A
2
(PLA
2
) performs the
cleavage of AA from membrane phospholipids, which result in its subsequent release. It
is well accepted that among the PLA
2
family, the group IVA PLA
2
(cPLA
2
o) plays a
pivotal role in AA release from membrane phospholipids, since transgenic deficient mice
are unable to generate LTs and other eicosanoids (6-8). cPLA
2
o was characterized upon
its purification from the U937 monocytic cell line, and molecular cloning revealed that
the protein is constituted of 748 amino acids (9, 10). Subsequently, a specific
phospholipase activity similar to the cPLA
2
o was eventually identified in neutrophils
(11). The cPLA
2
o is activated by calcium ions, resulting in its translocation to the
perinuclear membrane, which enables its activity (12-15).




3
1.3. Leukotrienes
LTs are potent lipid mediators that exert prominent inflammatory effects, such as
chemoattraction and activation of leukocytes (LTB
4
), brochoconstriction (LTC
4
) and
vascular permeability (LTC
4
, LTD
4
and LTE
4
) (16-19). Neutrophils are known as the best
producers of LTB
4
amongst leukocytes. Not surprisingly, the majority of leukocyte cells
express the receptor for LTB
4
, as shown in Table 1.1. The amount of LTs produced is
regulated in part by the amount of free AA released from membrane phospholipids by the
cPLA
2
o enzyme (6, 20).

1.3.1. Biosynthesis of leukotrienes
The initial limiting step in the biosynthesis of LTs is the cleavage of AA from membrane
phospholipids, in a calcium-dependent manner, by the cPLA
2
o. As shown in Figure 1.1,
the newly released AA is subjected to oxygenation of its 5
th
carbon by the 5-lipoxygenase
(5-LO), resulting in the formation of 5(S)-hydroperoxy-6E,8Z,11Z,14Z-eicosatetraenoic
acid (5-HpETE). The 5-LO subsequently dehydrates 5-HpETE, resulting in the formation
of an unstable allylic epoxide, LTA
4
(5(S),6(S)-oxido-7E,9E,11Z,14Z-eicosatetraenoic
acid). LTA
4
is further converted by LTA
4
hydrolase into LTB
4
(5(S),12(R)-dihydroxy-6Z,
8E,10E,14Z-eicosatetraenoic acid) (2, 21, 22). Finally, LTA
4
can also be conjugated to
glutathione by the leukotriene C
4
synthase to generate LTC
4
. The role of 5-LO in the
bioconversion of AA into lipid mediators is not restricted to the LT pathway. In fact,
5-HpETE can be reduced into 5-hydroxyeicosatetraenoic acid (5-HETE) or metabolized
into 5-oxo-6E,8Z,11Z,14Z-eicosatetraenoic acid (23) and lipoxins (24, 25).

4

Figure 1.1: Biosynthesis of leukotrienes through the 5-LO pathway.

1.3.2. Leukotriene receptors
Molecular identification of a LTB
4
receptor was first reported in 1997 in the human
myelocytic cell line HL-60 differentiated into granulocyte-like lineage (26), and the
following year in mice (27). Interestingly, this receptor was originally misidentified as a
purinergic receptor (28). The receptor was initially termed BLTR and subsequently
renamed BLT
1
, following the discovery of a second LTB
4
receptor named BLT
2
(29, 30),
which possesses a lower affinity for LTB
4
(31-34). The G protein-coupled receptor
(GPCR) BLT
1
is composed of 352 amino acids, that fold into seven transmembrane
domains, and mediate most of the chemotactic and pro-inflammatory activities of LTB
4
.
In contrast, activities of LTB
4
that are specific to BLT
2
receptors have not been fully
characterized yet (31). As demonstrated in Table 1.1, BLT
1
is expressed in the majority
of human and mouse leukocytes, but also in other tissues, such as the spleen, thymus and

5
bone marrow, as well as in nonmyeloid cells such as endothelial cells, vascular smooth
muscle cells, skeletal muscle satellite cells and neural stem cells. (26, 27, 35-39). In
binding experiments involving transfection of human BLT
1
in COS-7 and HEK293 cells,
[
3
H]LTB
4
binds to the receptor with a K
d
of 0.15 nM and 1.2 nM respectively (26, 40).
Interestingly, BLT
1
-deficient mice display a reduced leukocyte migration (41, 42). More
importantly, overexpression of human BLT
1
receptor leads to an increase in neutrophil
recruitment, function, 5-LO expression and LT biosynthesis in murine models of acute
skin inflammation, peritonitis and reperfusion-initiated second-organ injury (43). Double
knockout mice apoE and BLT
1
display smaller atherosclerotic lesions when compared to
apoE deficient mice, suggesting that LTB
4
may exacerbate atherosclerosis (44, 45).
Finally, BLT
1
deficient mice were protected from collagen or K/BxN serum-induced
arthritis (46, 47). In addition to LTB
4
, resolvins have been identified as partial BLT
1

ligands in leukocytes (48).

Also belonging to the GPCR family, the BLT
2
receptor is composed of 358 amino acids.
It is widely expressed amongst tissues and cells, such as the spleen, ovaries, liver,
intestine and leukocytes (29, 32-34). LTB
4
weakly binds to human BLT
2
receptor in
transfected HEK293 cell with a K
d
of 22.7 nM (33), which is 20 fold lower than the K
d
of
LTB
4
binding to BLT
1
in the same cell line (40). In fact, BLT
2
deficient mice exhibited a
more severe phenotype than wild-type mice (49). Interestingly, BLT
2
may signal anti-
inflammatory functions, as demonstrated in a mouse model of colitis (49). In addition to
LTB
4
, BLT
2
also binds 12(S)-HETE, 12(S)-HpETE, 15(S)-HETE and the thromboxane
synthase product 12(S)-hydroxy-5Z,8E,10E-heptadecatrienoic acid (40, 50). Although
less information is available regarding the role of BLT
2
in pathologies, as compared to
BLT
1
, its importance in mouse models of angiogenesis (51), colitis (49) and arthritis (47)
was demonstrated. On the other hand,, BLT
2
could also promote anti-inflammatory
actions, as demonstrated in a murine model of colitis where BLT
2
-/-
mice exhibited a
more severe phenotype than wild-type mice (49).

LTB
4
can act as a peroxisome proliferator-activated receptor (PPAR)-o agonist (52-54).
PPARs are ligand-activated nuclear transcription factors implicated in the regulation of

6
metabolism and inflammation (55). In fact, LTB
4
biosynthesis experiments in mice
lacking 5-LO have demonstrated that LTB
4
production in vivo up-regulates PPAR-o
activity (56).

As for the CysLTs, two different types of GPCR receptors were initially identified,
namely CysLT
1
and CysLT
2
(57, 58). CysLT
1
contains 336 amino acid residues and is
involved in bronchoconstriction, mucus secretion and edema in the airways (16, 58).
CysLT
1
is expressed by eosinophils, monocytes, macrophages as well as bronchial
smooth muscle cells (57-60). Preference in ligands for the CysLT
1
receptor is as
followed: LTD
4
> LTC
4
> LTE
4
(61).

CysLT
2
contains 345 amino acid residues. In contrast to CysLT
1
, experiments in mice
deficient or overexpressing CysLT
2
indicate that this receptor is not implicated in
brochoconstriction, but rather in vascular permeability and tissue fibrosis (62, 63).
Moreover, the overexpression of CysLT
2
has been linked to diseases, such as myocardial
ischemia (64). CysLT
2
is also expressed by eosinophils, monocytes, lung macrophages
and endothelial cells (65-67). CysLT
2
binds equally wells to LTC
4
and LTD
4
but barely
to the LTE
4
.

Interestingly, it has been recently reported that the pro-inflammatory effects of LTE
4
in
an asthmatic model are mediated by the P2Y
12
receptor (68). Apart from the P2Y
12

receptor, other receptors such as CysLT
E
and GPR17 are implicated in the CysLT effects
(69, 70). GPR17 is highly expressed in organs that can undergo ischemic-reperfusion
injuries, such as the brain, heart and kidney (70). Little is known regarding to the
CysLT
E
, although experiments involving LTE
4
intradermal injection in CysLT
1
/CysLT
2

deficient mice resulted in vascular leak (71). CysLT
E
remains to be cloned.






7
Table 1.1: Cell capacity of LT biosynthesis and receptor profiling. Adapted from
Peters-Golden, 2007 (16). Presence of receptors indicated as positive (+), negative (-) or
not determined (ND).


Type of Cell
Relative
Synthetic
Capacity

Receptor Expression
LTB
4
CysLT BLT
1
BLT
2
CysLT
1
CysLT
2

Neutrophil +++ - + +

Macrophage ++ ++ + + + +
Eosinophil - +++ + + + +
Basophil - +++ - - + +
Mast cell + +++ + + + +
B lymphocytes - - ND + + ND
CD4 T lymphocyte - - + + + ND
CD8 T lymphocyte - - + + ND ND
Dendritic cell ++ + + + + ND
Progenitor cell - - ND + + ND

1.4. Role of leukotrienes in inflammatory diseases
LTs play a very important role in the inflammatory response by recruiting and activating
pro-inflammatory cells to the affected site, and are thus involved in the development and
persistence of the inflammatory status observed in the affected organ(s)/tissue(s) (Table
1.2)

1.4.1. Asthma
One of the most studied LT-related an inflammatory disease is asthma. Once thought to
be a relatively simple disease of airway bronchoconstriction, asthma has since been
characterized as a more complex inflammatory disease (72). The pathology is
characterized by the infiltration of activated eosinophils, mast cells, macrophages and
lymphocytes in the airway mucosa and lumen (73). Since CysLT
1
receptors are mostly
localized on pulmonary smooth muscle cells, it is clear that CysLTs play an important
role in asthma. In fact, CysLTs are involved in most key features of asthma, such as
airway smooth muscle constriction (74, 75), vasodilation (76), mucus secretion (77) and
airway remodeling (78). Interestingly, CysLTs possess 100-1000 fold greater

8
bronchoconstrictive potency than histamine (79). However, the implication of LTs
involved in asthma is not limited to CysTLs. In fact, LTB
4
may also play a certain role in
asthma as overproduction of LTB
4
is observed in the airway of asthmatic and chronic
obstructive pulmonary disease patients and more importantly, correlates with the severity
of the asthma (80-82). However, the exact role of LTB
4
in pathology is still under
investigation. In fact, LTB
4
antagonist (LY293111) treatment for 7 days had no effect on
airway responses to allergen (83). Of note, LTs receptor antagonists, such as montelukast
(Singulair), zarfirlukast (Accolate), pranklukast (Onon) and the 5-LO inhibitor
zileuton (Zyflo) are efficient against asthma (84). The first three are CysLT
1

antagonists, as opposed to zileuton, which is a direct 5-LO inhibitor. The CysLT
1

antagonists are all administered orally and are well tolerated by patients. Although
zileutons effects are short lived, it efficiently blocks CysLT production, as demonstrated
in experiments in which zileuton was shown to attenuate allergen-induced nasal
congestion in patients (85). Unfortunately, its daily administration can lead to
hepatotoxicity, thus limiting its clinical use (16, 86). A more detailed review on various
LT inhibitors will be presented in section 1.8.

1.4.2 Cardiovascular diseases
Cardiovascular diseases, such as atherosclerosis, are a growing problem worldwide. LTs
can play an important role in atherosclerosis, as the LTB
4
biological roles include
promoting monocyte and T cell recruitment to the inflammatory site and increases in
vascular permeability. This results in the differentiation of monocytes into macrophages,
which are susceptible to foam cell transformation (87). Importantly, 5-LO expression
levels correlate with the severity of the atherosclerotic lesion and plaque instability (88,
89). In agreement with a role of human 5-LO in atherosclerosis, transplanting the bone
marrow from 5-LO
+/-
mice into low-density lipoprotein receptor (LDLR) deficient mice
significantly reduced the development of atherosclerosis (90). Expression of the BLT
1

receptor also plays an important role in the disease, as demonstrated in experiments
where BLT
1
receptor was treated for 35 days with the antagonist CP1055696, resulting in
a reduced progression of atherosclerosis and macrophage content in either ApoE
-/-
or
LDLR
-/-
mice (87).

9
1.4.3. Arthritis
Another pathology in which LTs (more specifically LTB
4
) have been demonstrated to be
active participants is inflammatory arthritis. An early study demonstrating the presence of
LTB
4
in the synovial fluid of rheumatoid arthritis patients suggested a probable role of 5-
LO in the disease (91). In a study involving the administration of arthritogenic K/BxN
serum in mice, which ultimately results in the induction of arthritis, neutrophils were
found to contribute to arthritis via LTB
4
production (46, 92). Furthermore, when a 5-LO
inhibitor (L-739,010) was administered orally, induction of arthritis was prevented. The
most interesting result was that 5-LO deficient mice are resistant to the development of
K/BxN serum-induced inflammatory arthritis thus identifying a critical requirement for
LTs in the establishment of the pathology. The importance of LTB
4
in the arthritogenic
model was demonstrated in experiments involving LTC
4
S and LTA
4
H-null mice, where
only the absence of LTA
4
H prevented the arthritis induction (92). Furthermore, in a
collagen-induced arthritis mouse model deficient in both BLT
1
and BLT
2
, complete
resistance to the development of the disease was observed (93).

Table 1.2: Role of LTs in pathologies such as asthma and cardiovascular diseases.
Adapted from Peters-Golden, 2007 (16). Arrows (|) represent an increase, NA (not
available).


Type of cell

Asthma

Cardiovascular disease
Leukocyte | recruitment of T cells,
eosinophils and mast cells
| monocytes and T-cell
recruitment; | macrophages
differentiation or foam cells
Dendritic cell | cell recruitment and
activation
NA
Epithelial cell | mucus release and goblet
cells
NA
Fibroblast or myofibroblast | collagen release NA
Smooth muscle cell | contractility and
profileration
| contractility and
proliferation
Endothelial cell | vascular permeability | vascular permeability
Malignant cell NA NA

10
1.5. 5-Lipoxygenase
The 5-LO is typically expressed in cells derived from the bone marrow, such as
monocytes/macrophages, eosinophils, neutrophils, basophils, mastocytes, dendritic cells
and as well in B-cell lymphocytes. In contrast, 5-LO is not found in endothelial cells,
platelets, erythrocytes and T cells. In resting cells, the enzyme is soluble and can be
found in the cytosolic and/or the nuclear compartment. The cytosolic or nuclear
localization of 5-LO is tightly regulated by nuclear import and nuclear export sequences
(94-97). With the exception of eosinophils, the nuclear localization of 5-LO is associated
with increased LT biosynthesis (98, 99). Interestingly, its phosphorylation on Ser-271 and
Ser-523 modulate the cell distribution of 5-LO (see section 1.5.4.)

1.5.1. 5-Lipoxygenase gene structure and regulation
The 5-LO gene, ALOX5, contains 14 exons and is located on the 10
th
chromosome. This
gene encodes for a protein of 673 amino acids (100, 101). Interestingly, the promoter
region typically resembles that of a housekeeping gene, as it does not contain TATA and
CAT boxes. Instead the promoter region is characterized by the presence of 8 GC boxes,
5 of which are set in tandem and are recognized by transcription factors Sp1 and Egr1
(102, 103). This GC-rich region is essential to regulating 5-LO gene expression, as
demonstrated in experiments investigating the expression of 5-LO expressed by Mono
Mac 6 cell line in the presence of a GC-box binding drug, mithramycin (104). As
demonstrated by DNase I footprinting experiments, mithramycin binds to the 5 GC-
boxes, decreasing 5-LO expression by directly interfering with its transcription (104).
DNA methylation of the core promoter of 5-LO also regulates 5-LO expression (105).
Indeed, a lack of 5-LO expression was associated with heavy DNA methylation of the 5-
LO core promoter in the myeloid cell lines U937 and HL-60TB. In sharp contrast, the 5-
LO core promoter was completely unmethylated in 5-LO-expressing HL-60 cells (parent
cell line of HL-60TB). More importantly, the authors found a complete loss of
transcriptional activity when the SssI methylase methylated the 5-LO core promoter
(105).


11
Another interesting fact about the 5-LO promoter is the presence of mutations in the Sp1-
binding site region. These mutations cause deletion of one or two Sp1-binding sites or
addition of one Sp1-binding site (106). Studies have demonstrated correlating patterns
between GC boxes mutation and inflammatory diseases, such as asthma and
atherosclerosis. In the case of asthma, mutation in the GC boxes causes less 5-LO
expression (107), whereas mutated GC boxes correlate with an increase in the intima-
media thickness in atherosclerosis (108).

The expression of 5-LO is also modulated by various cytokines and growth factors. One
example is how the 5-LO protein and mRNA expression undergoes extensive regulation
during differentiation of myeloid cell lines, as shown in an experiment studying the
differentiation of monocytes into macrophage in the lungs (109). Another well-studied
example is the differentiation of the HL-60 and Mono Mac 6 cell lines. In fact,
1o,25(OH)
2
vitamin D
3
(calcitriol) and transforming growth factor-| (TGF|) induce 5-
LO gene expression in HL-60 and Mono Mac 6 cell lines (110, 111). In the Mono Mac 6
cell line, treatment with TGF| and calcitriol results in an increase of the primary
transcripts, mature 5-LO mRNA, protein expression and 5-LO activity (111, 112). The
effects of TGF| and calcitriol are not mediated via the 5-LO promoter (113, 114), but
rather via Smad binding elements and TGF| responsive elements located in exon 10 and
intron 13 of the 5-LO gene (114). Interestingly, recent evidences of a vitamin D
responsive element in the intron 4, is considered to be the strongest of the human genome
(115). The exact function of the Smad and vitamin D receptor response elements,
however, is still unclear, but growing speculations have them implicated in 5-LO
transcript elongation and maturation (115-117). In other well-documented studies,
granulocyte/macrophage colony-stimulating factor (GM-CSF) was shown to increase
5-LO expression in human neutrophils (118, 119), although the mechanisms by which
this cytokine induces 5-LO expression remains unexplored.

1.5.2. 5-Lipoxygenase protein structure
The structure of the 5-LO has been recently crystallized (Figure 1.2) (120). Previous data
of the human 5-LO structure were primarily based on the similarity (~40%) between

12
rabbit 15-lipoxygenase and the human 5-LO (121, 122). Furthermore, a dimeric complex
of 5-LO protein has been recently reported (123). As demonstrated in Figure 1.2 and 1.3,
the 5-LO N-terminal domain (amino acids 1-114) is similar to a |-sandwich C2-like
domain and is favorable to Ca
2+
binding and membrane association (124). Residues in the
N-terminal region are not only suitable for Ca
2+
binding, but are also implicated in the
translocation of the 5-LO to membranes (125). The N-terminal domain is composed of
two anti-parallel |-sheets. This is a typical characteristic or members of the PLAT
(Polycystin-1, Lipoxygenase, o-Toxin) family (126, 127), which resembles a calcium-
dependent C2-like domain in relation to its ability to bind to phospholipids in a calcium-
dependent manner. Residues in the N-terminal |-sandwich region also bind to CLP (128)
and can associate with the RNase III Dicer (129).

Figure 1.2: Crystal structure of the 5-LO. Adapted from Gilbert et al, 2011 (120).

13
The C-terminal domain of the 5-LO (amino acids 121-673), composed of several
o-helices, is characterized by the presence of an iron atom anchored by amino acids His-
372, His-550 and Ile-673 (130, 131). Two other amino acids, Asn-554 and His-367, also
anchor in place the iron atom in a more flexible way (132).

The importance of the N-terminal C2-like domain and of the C-terminal catalytic domain
has been well documented by Chen and Funk (125). In their experiments, multiple
constructs of the 5-LO protein were generated, lacking either complete or parts of the N-
terminal or C-terminal domain. Retention of amino acids 1-116 in the N-terminal region
was clearly necessary for 5-LO protein translocation upon mobilization of intracellular
calcium. As shown in Table 1.3, intact N-terminal and C-terminal domains were required
for 5-LO catalytic activity (125). Moderate translocation of the 5-LO protein to the
perinuclear membrane was obtained with constructs retaining the first 114 amino acids of
the N-terminal region of the 5-LO lacking the enzyme catalytic activity.

Table 1.3: GFP constructs of various regions of the 5-lipoxygenase demonstrating
the importance of the C2-like domain and catalytic domain. Adapted from Chen and
Funk, 2001 (125). N: nuclear, n: minimal nuclear, C: cytoplasmic, c: minimal
cytoplasmic. +++: 80-100% of activity or translocation, ++: above 50%, -: not detected.


GFP Construct

Cellular Localization

Translocation

5-LO Activity
5LO N +++ +++
5LO (1-166) C + n ++ -
5LO (1-127) N + c ++ -
5LO (1-114) N ++ -
5LO (1-80) N - -
5LO (N
6
deletion) C ++ -
5LO (N
17
deletion) C - -
5LO (81-673) C - -
5LO (115-673) C + n - -


14
1.5.3. Role of calcium in the activation of 5-lipoxygenase
The role of Ca
2+
in 5-LO activation has been well documented (133, 134). The activation
of 5-LO results from a calcium-dependent binding to the nuclear envelope. Early studies
demonstrated that the calcium ionophore A23187 activates LTs biosynthesis from
endogenous AA in human polymorphonuclear leukocytes (135). Cell activation involving
increased intra-cellular Ca
2+
concentrations will ultimately result in the translocation of
the cytosolic and nuclear 5-LO to the perinuclear membrane (98, 136-140). It is at the
peri-nuclear membrane that the bioconversion of AA to LTs occurs through the
interaction of 5-LO with the five-lipoxygenase activating protein (FLAP) and CLP

(Figure 1.4). Ca
2+
binds to the C2-like domain of 5-LO in a reversible manner with a K
d

of 6-9 M (124, 141, 142) which correlates well with the necessary Ca
2+
concentration
(1-2 M) required for complete activation of purified 5-LO (143). More specifically,
amino acids Asn-43, Asp-44 and Glu-46 form the binding site for Ca
2+
(142).

1.5.4. Phosphorylation of 5-lipoxygenase
Phosphorylation of 5-LO occurs in the N-terminal region of the protein, as Ser-271, Ser-
523 and Ser-663 can be phosphorylated by MAPKAP kinase 2 (LERQLS), protein kinase
A (RKSS) and ERK2 (YLSP), respectively (144-146) (Figure 1.3).

Although an increase in MAPKAPK-2 activity correlates with cell activation and LT
biosynthesis, phosphorylation of 5-LO on Ser-271 by this kinase does not modulate
enzyme activity (147). In sharp contrast, Ser-271 phosphorylation is constitutive in
transfected cells, such as NIH/3T3 and COS-1, and 5-LO phosphorylated on this residue
is exclusively found in the nucleus (148). This is best explained by the fact that Ser-271 is
located within a nuclear export sequence of the 5-LO, and its phosphorylation alters 5-LO
nuclear exportation, thereby resulting in a nuclear accumulation of the 5-LO enzyme (99,
148).

Located within another nuclear import sequence (NLS
518
), Ser-523 can be phosphorylated
by protein kinase A which negatively impacts the catalytic activity of the 5-LO.

15
Phosphorylation of Ser-523 decrease the nuclear importation of the 5-LO, resulting in the
accumulation of 5-LO in the cytoplasm (149), and a reduced biosynthesis of LTB
4
(146).

Very little is known about the physiological role of the phophorylated Ser-663, besides
the fact that polyunsaturated fatty acid, such as AA, promotes its phosphorylation (145).
Further characterization of this phosphorylation site is definitely required.

Finally, 5-LO could be phosphorylated by a tyrosine kinase. In fact, tyrosine kinase
inhibitors, such as herbimycin, tyrphostin, genistein and lavendustin all inhibited the
translocation of the 5-LO from the cytosol to the membranes. Interestingly, since tyrosine
kinase inhibitors inhibit the binding of ATP to tyrosine kinase and that 5-LO requires
ATP as a co-factor, the authors suggested that the effects observed could be attributed to
a reduced ATP binding to 5-LO (150, 151).





16

Figure 1.3: Representation of the 5-LO structure composed of a C2-like domain
(green) and a catalytic domain (white). Phosphorylation sites of 5-LO include Ser-271
(MAPKAP kinase 2: magenta), Ser-523 (Protein kinase A: red) and Ser-663 (ERK2:
yellow). Also present is an iron atom (orange) in the catalytic domain.



17
1.5.5. Role of ATP in the activation of 5-lipoxygenase
Originally shown to partially stimulate the enzyme activity of purified 5-LO extract
(152), ATP alone has no effect on 5-LO activation. In contrast, when calcium is present,
K
a
values for ATP range from 30-100 M (153-155). ATP can also activate purified 5-
LO in the absence of calcium, when phosphatidylcholine vesicles are present (156). The
maximal effect of ATP was independent of phosphatidylcholine concentration. Two
amino acids, Trp-75 and Trp-201, bound to ATP analogues, thereby suggesting a
potential role for these amino acids in 5-LO binding to ATP (130). Unfortunately, the
exact mechanism by which ATP activates 5-LO is not clear.

1.6. Other proteins associated with LT biosynthesis
1.6.1 Five-lipoxygenase activating protein (FLAP)
Following Ca
2+
mobilization, which results in the translocation to the perinuclear
membranes, 5-LO interacts with FLAP (Figure 1.4) (157-159). The discovery of the
FLAP protein was the result of studies investigating the effects of the compound MK-
886, an inhibitor of LTs biosynthesis that blocks the association of the 5-LO with the
cellular membrane (158, 160). The observation that MK-866 inhibited LT synthesis in
whole cells, but not in broken cell extract, led to the discovery of a novel 18-kDa
membrane protein termed FLAP (159). In the rat basophilic leukemia cell line RBL-2H3,
FLAP was found to be in mono-, di- and trimeric conformations (161). In human
neutrophils, FLAP is present in a monodimeric and dimeric configuration (162). Of
interest, FLAP is usually found expressed only in cells capable of synthesizing LTs (157,
160). However, the molecular mechanisms regulating this association remain unclear and
foster additional studies. Although FLAP is mainly associated with cellular membranes,
no study, as of today, has demonstrated a direct binding between FLAP and 5-LO at the
membrane site. One possible role of FLAP towards LT biosynthesis is that FLAP could
be to act as a potential anchor site for 5-LO and be involved in AA to the 5-LO (140, 158,
159, 163). Finally, FLAP is necessary for the production of LTs in cell stimulated with
calcium ionophore A23187 and endogenous AA (158, 164).



18
1.6.2. Coactosin-like protein (CLP)
CLP is a 16 kDa protein composed of 142 amino acid and similar to coactosin, a member
of the ADF/Cofilin group of actin-binding proteins (165). Protein association between
CLP and 5-LO was first discovered by a yeast two-hybrid experiment (166). CLP
associates with 5-LO in a 1:1 stoichiometry (128). The 5-LO/CLP interactions have been
extensively investigated in recent years (Figure 1.4). CLP Lys-131 is important for 5-LO
binding, as the CLP mutant K131A exhibited a reduced activity to interact with 5-LO
(128). From the 5-LO standpoint, 3 tryptophan residues (Trp-13, Trp-75 and Trp-102) in
the C2-like domain were deemed essential for CLP interaction (167). In vitro experiments
have demonstrated that the presence of CLP and phosphatidylcholine results in the
augmentation of 5-LO product formation, such as 5-HETE and LTA
4
, following Ca
2+
activation of the 5-LO (167). Although CLP can bind 5-LO in the absence of Ca
2+
, CLP
is unable to induce 5-LO activity by itself. Therefore, CLP functions as a scaffold for
Ca
2+
-induced 5-LO activity. Recent insights into CLP and 5-LO interaction have revealed
that only residue Trp-102 is implicated in binding to CLP, and that CLP might also
function as a stabilizing chaperone for 5-LO (168).

Evidence of 5-LO/CLP binding in vivo has been demonstrated in studies involving
human neutrophils. For instance, in a subcellular localization experiment, CLP and 5-LO
were both found in the cytosolic fraction of the resting cells. In contrast, when
neutrophils were stimulated with the Ca
2+
ionophore A23187, both CLP and 5-LO were
predominately found in the nuclear fraction (167). Co-localization of 5-LO and CLP in
resting and stimulated cells is common among cell lines and cell types, since a similar
observation was obtained from PMA-primed Mono Mac 6 cells (168). Interestingly, the
5-LO inhibitor hyperforin, a pharmacologically active constituent of St. Johns worth,
diminishes formation of LTs by inhibiting 5-LO (169), probably by disrupting the
interaction of 5-LO with CLP (170).


19

Figure 1.4: Biosynthesis of LTs at the cellular level. The 5-LO protein migrates to the
peri-nuclear membrane upon calcium mobilization. Following migration, 5-LO interact
with the FLAP protein and consequently initiates the bioconversion of AA into LTs.
Adapted from Murphy and Gijon, 2007 (171).

1.7 Unidentified protein bands in Western blot of 5-lipoxygenase extract
Interestingly, there are several unidentified protein bands in published 5-LO immunoblots
of leukocytes (172) and neutrophils (118) (Figure 1.5). The 5-LO antibody used at the
time (LO-32) was obtained by immunizing rabbits with purified 5-LO, thereby resulting
in a polyclonal anti-serum (172). Noticeable on the blots was the presence of two protein
bands of lower molecular weight (Figure 1.5). Explanations on the nature of these bands
were scarce. For instance, the authors suggested that the presence of one of the protein
band (~63 kDa) was the result of contamination of the enzyme preparation used during
the immunization of the rabbit. For the other protein band (~50 kDa), the authors
suggested that it might be the result of proteolytic degradation. This hypothesis was later
explored in B lymphocytic cells, in which caspase-mediated degradation of purified 5-LO
resulted in a protein band of ~60 kDa that did not correlate with the molecular weight of

20
the 5-LO bands observed in whole cell lysates (173). The latter discrepancy suggested
that perhaps additional processes might be involved in the generation of anti-5-LO
immunoreactive bands. One interesting possibility is that the 5-LO pre-mRNA is
undergoing alternative splicing, leading to the formation of 5-LO of different
functionality.


Figure 1.5: Left panel: Western blot of leukocyte extract. Adapted from Rouzer and
Kargman, 1988 (172). Right panel: Western blot of neutrophils extract. Adapted from
Pouliot et al, 1994 (118).

1.8. Alternative splicing
1.8.1. Defining alternative splicing
The majority of human genes (70-80%) undergo some sort of alternative splicing (174-
176). Of these genes, 75% were shown to encoding for a protein (177). Also, the
existence of alternative isoforms in other LO, such as the 15-LO, has been previously
reported (178, 179). When examining the literature on 5-LO, especially in the
immunoblots shown in Figure 1.5, we had reasons to believe that 5-LO alternative
isoforms could be present in certain cell types or cell lines. What would be the impact of
these potential isoforms on LT biosynthesis? A recapitulation of different types of
alternative splicing is shown in Figure 1.6. In brief, gene transcription occurs in the
nucleus of eukaryotic cells resulting in the formation of pre RNA messenger (pre-

21
mRNA). The pre-mRNA contains all exons (coding region) and introns (non-coding
region) of the gene. Removal of the introns by spliceosomes is a normal splicing process
of the pre-mRNA (174). This leads to the maturation of the pre-mRNA into mRNA,
which then undergoes methylation in the 5 region (5cap) and addition of a poly (A) tail
to the 3 region. There is an exception to the normal splicing process, which is called
alternative splicing. Some examples of alternative splicing include retention of introns,
absence of some exons or alternative 5 or 3 splice sites in the mature mRNA (180).


Figure 1.6: Some examples of alternative splicing. Adapted from Srebrow and
Kornblihtt, 2006 (180). Exons are represented by rectangles. Straight lines indicate
introns.

1.8.2. Alternative splicing and diseases
Research investigating the relationship between diseases and alternative splicing is still in
the early stages, but an increasing number of research articles citing examples of
alternative splicing associated with various diseases have been published over the last
decade. In this respect, cancer is raising a lot of interest. One example is the tumor

22
suppressor gene p53, which is involved in cell-cycle control, apoptosis and maintenance
of genetic stability. Incidence of p53 inactivation is frequently associated with human
cancer (181). The human p53 gene codes for three mRNA splice variants, including the
full-length p53, p53i9 (retention of intron 9 (182)) and A40p53 (deletion of the first 40
amino acids of p53 (183-185)). It was recently discovered that multiple isoforms
originated from the use of two separate and different promoters, including one internal
promoter in intron 4 (186, 187). The interesting aspect of their findings indicated that p53
alternative splice variants are expressed in a tissue-dependent manner, indicating that
their expression can be selectively regulated. However, the expression pattern is changed
in human breast cancer tumors MCF-7 (186).

Another example is the tumor suppressor KLF6 gene that inhibits cell growth by
activating p21, a cyclin-dependent kinase inhibitor (188). An isoform of KLF6 (KLF6-
SV1) is found by the use of an alternative 5-splice site in exon 2 and promotes cell
proliferation (189). Studies have demonstrated that the overexpression of the KLF6-SV1
isoform accelerates human and mouse prostate cancer progression (190).

Other examples of the evidence of a correlation between alternative splicing and proteins
promoting tumor development are listed in Table 1.4 (191).













23
Table 1.4: List of proteins resulting from alternative slicing in various types of
cancer. Adapted from Tazi et al., 2009 (191).

Gene Protein
property/function
Splice
variant
Isoform
expression in
cancer
Cancer type
Survivin Inhibitor of apoptosis Survivin 2B
with pro-
apoptotic
properties
Down regulated Breast carcinoma
and late stage or
metastatic gastric
cancer
VEGF
Cathepsin B
Role in angiogenesis
Role in the
development and
progression of cancers
Isoforms
lacking exon 6
Certain isoforms
Upregulated
Overrexpressed
Non-small cell
lung cancer
Colon cancer
FHIT Tumor suppressor Aberrant
transcripts
Aberrant
expression
Gastric, cervical,
thyroid and
testicular germ-
cell tumors
Actinin 4 Actin-binding protein Variant Va,
mutuallu
exclusive splice
variant where
exon 8 is
replaced by a
new exon of the
same size that
exists in intron 8
Aberrant
expression of the
splice isoform
Small cell lung
cancer
A1B1 Hormone coactivator Isoform lacking
exon 3
Aberrant
expression
Breast cancer
RON Tyrosine kinase
receptor
RonA165
RonA160
RonA155
Overexpressed Colorectal
carcinoma


Finally, as a non-cancer type of example, the LDLR splicing variant, caused by a single
nucleotide polymorphism present in exon 12 of the LDLR mRNA that promotes exon 12
skipping, increases the risk of hypercholesterolemia (192). Interestingly, the single
nucleotide polymorphism had no effect on men and post-menopausal women, and was
only observed in pre-menopausal women. Exon 12 skipping generates a truncated form of
the receptor preventing cholesterol uptake, which ultimately results in a sex-specific
hypercholesterolemia. A recent study has also linked the LDLR isoform with
Alzheimerss disease in males, but not in females (193).


24
Although evidence of a correlation between cancer and alternative splicing exists, the
precise implication of alternative splicing in carcinogenesis remains unknown. Very little
research data is provided linking inflammatory diseases and alternative splicing, and, to
our knowledge, no association between possible alternative splice variants of the ALOX5
gene and inflammatory diseases has been established or even studied.

1.9. 5-Lipoxygenase inhibitors
As previously mentioned, LTs are potent lipid mediators of the immune system
implicated in the inflammatory response. Although necessary for host defense against
bacteria and infections, uncontrolled or chronic inflammation can eventually lead to
inflammatory diseases such as asthma, arthritis and atherosclerosis. Although numerous
studies have demonstrated innovative and well-thought compounds with potent 5-LO
inhibition, very few drugs have entered the market. In fact, most of them are actually
antagonist of LTs receptors, not direct 5-LO inhibitors. Thus continues the search for the
perfect drug without the unwanted side effects.

1.9.1. The 5-lipoxygenase inhibitor zileuton
A prime target for the inhibition of LTs is of course the 5-LO enzyme. As previously
mentioned, there have been numerous potential 5-LO inhibitors studied over the last 25
years, but only the compound known as zileuton entered the market and is presently used
clinically as an anti-asthmatic drug (194). Its clinical use is however restricted due to
adverse effects such as liver toxicity (86, 195), resulting in the need of constant
monitoring of hepatic enzyme levels. Another inconvenience of the drug is its
pharmacokinetic profile, as up to four intakes of 600 mg of the drug is required daily
(194, 196). With the recent crystallization of the 5-LO structure (120) resulting in new
information in regards to drug design, an increasing number of potential 5-LO inhibitors
will certainly be developed in the years to come.

Of course, direct inhibition of the 5-LO enzyme continues to be an interesting research
area involving LTs regulation. Classes or types of 5-LO inhibitors can be divided into

25
four categories; redox-active inhibitors, iron ligand inhibitors, nonredox-type inhibitors
and a new class of inhibitors involving different mode of actions (197).

1.9.2. Redox-active inhibitors
5-LO inhibitors in the redoxactive category include natural plant-derived compounds
such as caffeic acid, coumarin, polyphenols, flavonoids and synthetic compound. These
compounds affect the iron in the C-terminal domain of the 5-LO enzyme by keeping it in
the ferrous state. Many of theses compounds with redox potential can act as alternative
substrates for the 5-LO either by 5-LO-induced oxidation of the native drug or by
oxidation of products resulting from metabolic reduction of a prodrug (198). Although
these compounds normally are potent inhibitors of LTs biosynthesis in vitro and in vivo,
most of these compounds possess poor selectivity for 5-LO and exert side effects due to
interference with other biological redox systems or by the production of reactive radical
species produced as by-products of the 5-LO inhibition (198). Amongst the side effects
observed with these types of 5-LO inhibitors, formation of methemoglobin in dog blood
was noted in the presence of 5-LO inhibitor L-615,919. Not only did the drug interfere
with the redox cycling of the 5-LO, it converts the iron of hemoglobin into the oxidized
Fe(III) (199). Compound L-651,392 was eventually developed and did not show
formation of methemoglobin in dog blood (200), but unfortunately showed poor
solubility and absorption. However, like the majority of the series of redox-active 5-LO
inhibitors developed in the 1980s or early 1990s, either the compounds were poorly
soluble and absorbed (200) or encountered problems in the toxicological evaluation (201,
202). The oral bioavailability and adverse side effects have considerably prevented these
compounds from entering clinical usage. Numerous redox-type 5-LO inhibitors have
been developed over the years. Among these are trimer or tretramer caffeoyl clusters of
caffeic acid derivatives. They demonstrated potent 5-LO inhibition in broken cells assays
(IC
50
= 0.66 to 0.79 M) compared to caffeic acid (IC
50
~ 25 M) (203).

1.9.3. Iron ligand inhibitors
The iron ligand class of inhibitors includes hydrozamic acids or N-hydroxyurea
derivatives that chelate the active site iron. This family compound includes the well-

26
known 5-LO inhibitor zileuton (IC
50
= 0.5-1 M (204)), previously mentioned above.
Zileuton directly blocks the physiological effects of the 5-LO enzyme by blocking
endogenous biosynthesis of LTB
4
and CysLTs by an estimated 26 to 86% (205). Of
course, one of the benefits of using an antileukotriene drug such as zileuton is the
decreased need for |
2
-agonists or glucocorticoids for the treatment of asthma in asthmatic
patients. In fact, antileukotriene drugs such as zileuton have additive benefit in patients
whose disease is not properly controlled by inhaled corticosteroids (206). Structural
optimization eventually lead to the synthesis of ABT-761 (VIA-2291), a 5-LO inhibitor
five times more potent than zileuton in animals models of bronchospasm and which
showed efficacy in exercise-induced bronchoconstristion in asthmatic patients (207, 208).
More recently, VIA-2291 (Atreleuton) successfully completed a phase II clinical study
involving coronary artery disease (209). Overall, the phase II clinical study demonstrated
potent inhibition of LTs by VIA-2291, as well as down-regulation of inflammatory genes
in unstable plaques. A non-invasive image technique observed a significant reduction in
non-calcified plaque volume and in the number of patients developing new coronary
lesions.

1.9.4. Nonredox-type inhibitors
The nonredox-type class of inhibitors consists of compounds that compete with the AA
substrate-binding cleft in the active site without the redox properties of binding to the
5-LO. The molecular mechanism of action by which these inhibitors act upon LTs
regulation is mostly unknown. Inhibitors in this category include the urea derivative RBx
7796. This novel type of 5-LO inhibitor was characterized as a competitive and selective
5-LO inhibitor with IC
50
values of 3.8 and 5 M for cell-free and cell-based models
respectively (210). Another example of a non-redox type inhibitor is compound
CJ-13,610 which was indentified as a potent 5-LO inhibitor with IC
50
values of 70 nM
and 230 nM in neutrophils and human whole blood assays respectively (211, 212).
Compound CJ-13,610 demonstrated efficacy in a number of preclinical models of pain as
the antihyperalgesic activity was associated with reduced LTs levels in the inflamed brain
(213).


27
1.9.5. Diverse classes of 5-lipoxygenase inhibitors
The last class of 5-LO inhibitors includes all the inhibitors that have a mechanism of
action not yet fully understood or that are not categorized as one of the previous three
types of inhibitors (redox-active, iron ligand or nonredox-type). Amongst these remaining
type of 5-LO inhibitors, novel dual 5-LO/cyclooxygenase (COX)-pathway inhibitors
seem to be the most exciting and promising ones. The logical thinking behind the
blockage of both LTs and PGs is the increase of the anti-inflammatory efficacy without
the associated gastric toxicity when compared with traditional COX-inhibitors (214).
Licofelone is one of the developed prototypes that inhibit both 5-LO and COX (215).
Although considered a dual 5-LO/COX inhibitor, licofelone does not interact with 5-LO
but with FLAP in the LTs biosynthesis pathway (216). This conclusion was made
possible in experiments comparing licofelone with the well-known FLAP inhibitor MK-
886 in regards to the following observations. It is interesting to note that licofelone and
MK-886 share structural and chemical similarities with one another (216). The authors
formulated their hypothesis based on the following observations: i) licofelone inhibit the
5-LO product biosynthesis in intact FLAP-expressing cells but was not as effective in
cell-free assays; ii) presence of exogenous AA impaired the potency of licofelone in
neutrophils, as previously observed with MK-866, which is competing for AA binding to
FLAP (217); iii) licofelone as well as MK-866 failed to inhibit cell stress-induced 5-LO
product biosynthesis; iv) addition of either licofelone or MK-886 to neutrophils prevented
5-LO translocation to the nuclear membranes; v) licofelone and MK-886 had modest
effects on cellular 5-LO activity in HeLa cells lacking FLAP. Potency of licofelone as a
LT biosynthesis inhibitor has been documented ex vivo with IC
50
values ranging from
0.23 to 3.8 M (218-220). Overall, this suggests that licofelone is probably a FLAP
inhibitor in the same manner as MK-886.

1.10. Other inhibitors of leukotrienes biosynthesis
1.10.1. FLAP inhibitors
A few inhibitors of FLAP have been tested over the years for treatment of inflammatory
diseases such as asthma, yet none have ever been brought to market. These include
MK-886, Bay-X 1005, MK-0591 and AM103 (221-224). MK-886 and Bay-X 1005 were

28
well tolerated but were not able to completely block blood and urinary LTs after 24
hours. MK-0591 did demonstrate good inhibition of LTs at a twice-daily dose of
125-250 mg (223). Although all these FLAP inhibitors were efficient in isolated
leukocytes, only AM103 generated potent results in clinical trials (224, 225). AM103 was
well tolerated at all doses and a dose-dependent inhibition of ex vivo calcium ionophore-
challenged blood LTB
4
was observed. LTE
4
, the stable metabolite of the CysLTs
measurable in the urine, is elevated in the asthmatics during allergen presence and
exercise challenge (226-228). Interestingly, dose-response experiments with AM103
inhibited urinary LTE
4
so well that complete inhibition was observed at 24 hour for all
doses (225). Since then, crystallization of the FLAP structure has been reported (229),
thus providing new information regarding drug design.

1.10.2. cPLA
2
o inhibitors
Targeting AA release from phospholipid membranes by inhibiting the action of cPLA
2

enzymes (more precisely the cPLA
2
o) is another interesting strategy that was beneficial
in experimental models of inflammation (230-233). Interestingly, the cPLA
2
o inhibitor
pyrroxyphene suppressed paw swelling, influx of inflammatory cells, pannus formation
and cartilage formation. A major concern over the use of cPLA
2
inhibitors is the
decreased biosynthesis of other lipid mediators such as PGs since the COXs substrate is
no longer available, ultimately resulting in a non-specific LTs biosynthesis inhibitor. Of
note, novel selective inhibitors of cPLA
2
o such as giripladib, efipladib, WAY-196025
and ecopladib that belongs to the indole class of compounds have recently been described
(234-236).

1.10.3. 5-LO/CLP complex inhibitors?
Finally, the relatively new player in the LTs biosynthesis is the CLP protein. There are
practically no studies mentioning the importance of blocking the CLP mode of action
within the LTs biosynthesis, although one might argue that hyperforin might eventually
be referred as a inhibitor of the 5-LO/CLP complex. Even though no clinical trials studies
have yet been initiated, hyperforin, a pharmacologically active constituent of St. Johns
worth, diminishes the formation of in vitro and in vivo LTs. It probably acts by abolishing

29
the 5-LO/CLP binding most likely by interfering in the 5-LO C2-like domain (170). This
hypothesis was in part due to an observation made in experiment involving neutrophils
incubated in the presence of hyperforin since the compound interrupted 5-LO and CLP
binding in vitro and prevented 5-LO nuclear membrane association. Furthermore,
mutation of three tryptophan residues in the C2-like domain of the 5-LO, that are
essential to CLP binding, provides 5-LO with a resistance to hyperforin. Interestingly, in
an animal model, hyperforin significantly decreased LTB
4
biosynthesis in pleural
exudates (170). It has not yet been determined if hyperforin binds on the 5-LO or CLP
enzyme, thus hyperforin cannot be considered a direct CLP inhibitor but only a potential
inhibitor. Since the recent characterization of the importance of the 5-LO/CLP complex
in LTs biosynthesis (128, 167, 168, 170), developing compounds capable of interfering
with the complex might therefore be an interesting possibility of LTs regulation.

1.10.4. Leukotriene receptor antagonists
Specific CysLT
1
antagonists such has montelukast, zarfirlukast and pranlukast are the
only clinically used and approved antileukotriene drugs other than the 5-LO inhibitor
zileuton. This class of antileukotriene known as the lukast family is widely used in
clinical management of asthma and allergic rhinitis (84). Preference of the usage of
antagonists of LT receptors is mainly based on the unpredictable effects of commonly
used anti-inflammatory medications such as nonsteroidal anti-inflammatory drugs and
corticosteroids. In fact, in exhaled breath condensate, a non-selective nonsteroidal anti-
inflammatory drug ibuprofen was shown to decrease prostaglandin E
2
but increase
production of LTB
4
biosynthesis (237). The authors suggest the COX inhibition results in
a redirection of the AA to the 5-LO pathway. In human neutrophils, corticosteroids such
as dexamethasone have actually increased BLT
1
expression (238).

1.11. Caffeic acid phenethyl ester
A number of naturally-occurring compounds have been investigated as potential
inhibitors of 5-LO and LT biosynthesis. Amongst these are polyhydroxylated products
such as caffeic acid and related compounds that are widely distributed in plants and
exhibit antioxidant (239-241) and anti-inflammatory properties (242, 243). Synthetic

30
caffeic acid analogues were recently shown to be promising 5-LO inhibitors (203, 242).
Interestingly, one of these is the naturally-occurring caffeic acid analogue, caffeic acid
phenethyl ester (CAPE) (Figure 1.7). CAPE, an active component of propolis from
honeybee hives, has shown the capacity to inhibit LTs production in mouse peritoneal
macrophages (242). Overall, CAPE has shown antioxidant, anti-inflammatory, anti-tumor
and anti-fungal activities (241, 243-245).

Although, CAPE has numerous therapeutic properties, including anti-inflammatory, a
closer examination of CAPEs direct effect on the 5-LO pathway is still unknown and
needs characterization.


Figure 1.7: Molecular structure of the caffeic acid and its analogues, CAPE.






31
CHAPTER II: Research hypothesis and objectives
LTs are potent lipid mediators involved in the normal homeostatis of the human body.
Their biological roles include chemoattraction, bronchoconstriction and vascular
permeability. 5-LO is a key enzyme implicated in the biosynthesis of LTs as it catalyzes
the first two-steps of the bioconversion of AA into LTs. The importance of regulating LT
biosynthesis has been well documented in inflammatory diseases such as asthma,
atherosclerosis and arthritis. In fact, inhibition of LT biosynthesis often inhibits or
considerably decreases the progression of these pathologies in experimental models
involving rodents. Therefore, we are interested in the physiological and pharmacological
regulation of LT biosynthesis.

It is evident that 5-LO is susceptible to a number of regulatory factors, as explained in
section 1.5.1. Upon analyzing numerous publications showing 5-LO immunoblots of
PMN or leukocytes, we noticed the presence of two unidentified protein bands of lower
molecular weight (approximately 63 kDa and 50 kDa). We hypothesized these
unidentified protein bands were actually isoforms of 5-LO resulting from alternative
splicing of the ALOX5 gene. This was based on the fact that between 70-80% of all
human genes undergo alternative splicing. Splicing variants of 5-LO could putatively
play a role in the regulation of immune cells if these alternative transcripts would give
rise to novel 5-LO proteins. In this respect, the first part of my thesis consisted at 1)
screening different leukocytic cell lines for the expression of 5-LO splicing variants; 2)
determining if these splicing variants could be translated; and 3) evaluating if the novel
isoforms displayed a catalytic activity, which could impact on LT biosynthesis ex vivo
and in vivo (chapter III).

Another way to control the biosynthesis of LTs is with compounds capable of inhibiting
5-LO activity, compounds that affect proteins associated with LTs biosynthesis (i.e.
cPLA
2
o, FLAP) or compounds that are potent antagonist of various LTs receptors as
demonstrated in sections 1.8-1.10. The well-known 5-LO inhibitor zileuton is the only
commercially and clinically available 5-LO inhibitor (section 1.9.1.). Unfortunately,
some adverse effects result from its daily use such as liver toxicity. Furthermore, the

32
usage of this drug is approved in the USA but not in Canada. Clearly, there is room for
improvement in terms of current available 5-LO inhibitors. Amongst new potential 5-LO
inhibitors gathering some interest are the polyhydroxylated products, such as caffeic acid
and its naturally occurring analogue caffeic phenetyl ester (CAPE), that are widely
distributed in plants and exhibit antioxidant and anti-inflammatory properties. Since
CAPE has demonstrated some anti-inflammatory properties, we hypothesized that CAPE
could act as a 5-LO inhibitor. In the second part of my thesis, our objective consisted at
synthesizing and investigating compounds, such as the caffeic acid, CAPE and its
analogues as potential 5-LO inhibitors and their effects on the LTs biosynthesis cascade
(chapter IV and V).






















33
CHAPTER III: Novel 5-lipoxygenase isoforms affect the
biosynthesis of 5-lipoxygenase products

Luc H. Boudreau, Jonathan Bertin, Philippe Pierre Robichaud, Mark Laflamme, Rodney
J. Ouellette, Nicolas Flamand, and Marc E. Surette

This article was published in the FASEB Journal. 2011 Mar;25(3):1097-105.
Reprinted with the authorization of the FASEB Journal

















Authors contributions
L.H.B., J.B. and P.P.R. contributed to experimental work. L.H.B., J.B., M.L., R.J.O. and
M.E.S. contributed to the experimental design. L.H.B., J.B., M.L., N.F. and M.E.S.
contributed to the data analysis. L.H.B., N.F. and M.E.S. wrote the manuscript.



34
3.1. Rsum
La 5-lipoxygenase (5-LO) est une enzyme essentielle implique dans la biosynthse des
leucotrines, de importants mdiateurs lipidiques de linflammation. La prsente tude
explore la possibilit de prsence de variants protiques de la 5-LO chez les leukocytes
humains. Des isoformes dARNm de la 5-LO consistant avec les patrons dpissage
alternatif furent identifis par RT-PCR. Toutes les types de cellules values exprimaient
lARNm contenant les 14 exons de la 5-LO, ainsi que les sites dpissage attendu. De
plus, de nouveaux ARNm de la 5-LO furent identifis, soit un maintenant la rtention de
lintron 10 (o-10), absence de lexon 13 (A-13), combinaison de labsence des exons 10
et 13 (A-10,13) ainsi quun transcrit dont les 96 nuclotides de lexon 10 tait absents
(A-p10). Des bandes immunoractives co-migrants avec des vecteurs dexpression
contenant des transcrits des isoformes o-10 et A-13 surexprims furent valu chez les
neutrophiles humains ainsi que la ligne cellulaire Raji. Lorsque co-exprim avec de la
5-LO de type sauvage chez la ligne cellulaire HEK293, ces protines alternatives ne
possdaient aucune activit catalytiques. Cependant, lorsque co-exprimes avec le
transcrit complet de la 5-LO, ces isoformes alternatives diminuaient de faon
significatives la biosynthse des produits de la 5-LO jusqu 44% suite des analyses par
RP-HPLC. Finalement, suite des stimulations de neutrophiles, la 5-LO complte se
retrouve dans la fraction nuclaire ainsi que la fraction non-nuclaire, comparativement
lisoforme A-13, dont la localisation cellulaire se limite la fraction nuclaire. Ces
isoformes alternatives de la 5-LO pourraient ainsi reprsenter un nouveau mcanisme de
rgulation de la biosynthse de mdiateurs lipidiques dans les cellules inflammatoires.










35
3.2. Abstract
5-lipoxygenase (5-LO) is the essential enzyme for the biosynthesis of leukotrienes,
important mediators of inflammation. This study investigated whether variants of 5-LO
exist in human leukocytes. 5-LO mRNA isoforms that are consistent with alternative
splicing were identified by RT-PCR in a cell-line or cell type-specific pattern. All
evaluated cells expressed mRNA containing

all 14 exons of 5-LO with the expected
splicing sites. Individual isoforms that retained intron 10 (o-10), lacked exon 13 (A-13),
lacked exons 10 and 13 (A-10,13) or that lacked the first 96 base pairs of exon 10 (A-p10)
were identified. Immunoreactive bands co-eluting with the cloned o-10 and A-13
isoforms were measured in primary neutrophils and in Raji cells. When expressed in
HEK293 cells, alternative proteins were without catalytic activity. However, when co-
expressed with the active full length 5-LO, alternative isoforms significantly decreased
the biosynthesis of 5-LO products by up to 44% as assessed by RP-HPLC analysis.
Additionally, in stimulated neutrophils the full-length active 5-LO was detected by
immunoblot in both nuclear and non-nuclear compartments while the A-13 isoform was
only detected in the nuclear fraction. These alternative 5-LO isoforms may represent a
new mechanism for the regulation of the 5-LO pathway and lipid mediator biosynthesis.















36
3.3. Introduction
The leukotrienes (LTs) are products of the 5-lipoxygenase (5-LO) pathway and are
important components in innate immunity. However, the 5-LO pathway also plays a
central role in inflammatory diseases has been the subject of intense investigation as a
therapeutic target (1-4). More recently 5-LO has emerged as an important player in
vascular disease (4-6), in the development of vascular embryonic stem cells (7) and as a
critical regulator for leukemia stem cells (8). 5-LO catalyses the conversion of
arachidonic acid (AA) to (5(S)-6-oxido-7,9-trans-11,14-cis-eicosatetraenoic acid (LTA
4
)
(9). This enzyme is expressed in a number of myeloid cells including B cells, monocytes,
granulocytes and mast cells. LTA
4
can then be converted to the potent chemoattractant
LTB
4
by LTA
4
hydrolase or to the powerful bronchoconstrictor and vasodilator LTC
4
by
LTC
4
synthase. Finally, 5-LO also catalyses essential reactions in the biosynthesis of a
genus of anti-inflammatory and pro-resolving lipid mediators (10).

5-LO is subject to a number of regulatory control mechanisms. In resting cells, this
enzyme is typically associated with the cytoplasm or the nucleoplasm depending on the
cell type, but translocates to the nuclear membrane in a calcium-dependent manner
following cell activation (11-13). Structurally, 5-LO is composed of a C-terminal
catalytic domain and an N-terminal C2-like domain that interacts with membrane
phospholipids (14). The translocation of 5-LO involves the N-terminal domain (15, 16)
and appears to implicate the cytoskeleton likely through the interaction of 5-LO with the
cytoskeleton-associated coactosin-like protein (CLP) that acts as a scaffold protein (17,
18). Once associated with the nuclear membrane, 5-LO interacts with the 5-lipoxygenase
activating protein (FLAP) in a poorly characterized fashion. FLAP appears to play a role
in the presentation of substrate to the 5-LO (19) but may also be involved in the
translocation process since FLAP inhibitors block agonist-induced translocation of 5-LO
(20). 5-LO activity is also regulated by phosphorylation that is associated with either a
redistribution of 5-LO within the cells and/or the modulation of enzyme activity (21, 22).

In humans, the gene coding for 5-LO, ALOX5, contains 14 exons (23). The proximal
promoter region contains numerous consensus binding sites for several known

37
transcription factors including a G+C-rich region containing 5 tandem binding motifs for
the zinc finger transcription factors Sp-1 and Egr-1 that has been termed the core
promoter region (21, 24). However, in Mono Mac 6 monocyte-like cells, the core
promoter region appears to be responsible for basal 5-LO expression whereas functional
elements for the TGF-b effectors smad3 and smad4 as well as Vitamin D response
elements located in intronic sequences and in the distal part of the 5-LO gene are
responsible for enhanced 5-LO expression following TGF-- and 1,25-dihydroxy-vitamin
D
3
-induced differentiation (25-28). The ALOX5 gene is also subject to regulation by
methylation of CpG motifs within the core promoter region since myeloid HL-60TB and
U-937 cell lines that do not express 5-LO possess a hypermethylated core promoter
region, and the methylation of 5-LO core promoter region constructs abolishes reporter
gene expression (29).

It is now accepted that most genes in the human genome can be subjected to alternative
splicing of pre-mRNA transcripts resulting in protein isoforms with altered biological
properties including changes in catalytic ability, subcellular localization or interactions
with other molecules (30, 31). Amongst genes involved in AA metabolism, isoforms of
cyclooxygenase-2, 15-LO and LTA
4
hydrolase that are the result of alternative gene
splicing have been described (32-34), although the exact function of these alternative
isoforms has not been fully elucidated. Until now, there have been no reports
characterizing alternatively spliced isoforms of the human ALOX5 gene transcripts. In
the present study we describe a number of alternatively spliced isoforms of 5-LO that
appear to be expressed in a cell type- or cell line-dependent manner. The expression of
these isoforms impacts on the capacity of cells to synthesize 5-LO products and may
represent a novel mechanism for the control of the 5-LO pathway.

3.4. Materials and Methods
Cell culture: Human Embryonic Kidney 293 (HEK293), THP-1 (human acute monocytic
leukemia) and Raji (Burkitts lymphoma) cells were purchased from American Type
Culture Collection (Manassas, VA). Reh cells (human acute lymphocytic leukemia cell
line, non-T, non-B) were kindly provided by Dr. Edward A. Clark (University of

38
Washington, Seattle) and the TA cell line derived from Epstein-Barr virus-immortalized
healthy mature human B cells was a gift from Dr. Andr Darveau (University Laval,
Qubec).

HEK293 cells were cultured in DMEM supplemented with 10% FBS (PAA laboratories,
Etobicoke, ON, Canada) and penicillin/streptomycin (100 units/ml and 100 g/ml,
respectively). Raji, Reh, TA and THP-1 cells were cultured in RPMI medium
supplemented with 10% FBS and penicillin/streptomycin (100 units/ml and 100 g/ml,
respectively). All cells were maintained in a humidified environment at 37C and 5%
CO
2
.

Preparation of human neutrophils: Neutrophils were isolated from heparinized blood
obtained from healthy donors as previously described (35). Briefly, blood was
centrifuged at 200 x g for 10 min at room temperature, the platelet-rich plasma was
discarded and erythrocytes were removed following dextran sedimentation. Following
centrifugation on a lymphocyte separation medium cushion (density, 1.077 g/ml)
(Wisent, St-Bruno, Qc, Canada) at 900 x g for 20 min at room temperature, the
mononuclear cells were eliminated and neutrophils (>96%) were obtained from the pellet
after hypotonic hemolysis to eliminate the contaminating erythrocytes.

RNA extraction and PCR amplification: Total RNA was extracted from cells using
TRIzol reagent (Invitrogen, Burlington, Canada) according to manufacturers protocol
and dissolved in 30 l of DEPC-H
2
O containing 10 units of ribonuclease inhibitor
(Invitrogen). cDNA was prepared from the RNA using Superscript III (Invitrogen)
according to the manufacturers protocol using an oligo (dT)
12-18
primer (Invitrogen).
The cDNA preparation was then treated with RNase H (Invitrogen) for 20 min at 37
o
C
and was then amplified using Taq DNA polymerase (New England Biolabs, Pickering,
Canada) and the indicated primers (Table 3.1).

For amplification of the 5-LO cDNA, primers Exon 1F-out and Exon 14R-out were used.
PCR was also performed to obtain smaller fragments of the cDNA using the following

39
primer pairs: primer Exon 1F-in and Exon 5R; Exon 4F and Exon 10R; Exon 8F and
Exon 13R; Exon 9F and Exon 14F-in. FLAP cDNA was amplified with primers FLAP-F
and FLAP-R. All PCR reactions consisted of 25 cycles at 94 C for 30 sec, followed by
30 sec at 55 C and 1.5 min at 72C. The last cycle was followed by 5 min at 72C. PCR
products were visualized following gel electrophoresis on 1% agarose gels, using
SYBR Safe DNA gel stain (Invitrogen) under UV light. In some cases PCR products
(final amplification products spanning exon 9-14) were analyzed by microfluidic
separation using Experion DNA 1K Analysis Kits following the manufacturers protocol
(Bio-Rad, Mississauga, ON, Canada).


Table 3.1. List and sequence of oligonucleotide primers.

Primers Forward Reverse
Exon 1F-out, Exon 14R-
out
ATGCCCTCCTACACGGT CAATCTATGCAGTTCCCTGA
Exon 1F-in, Exon 5R ATCTACCTCAGCCTCGTG TGACCCGCTCAGAAATAG
Exon 4F, Exon 10R GATGCCAAATGCCACAAGG GGGAAAGCACAGGGAGGC
Exon 8F, Exon 13R CAGACCATCACCCACCTT CCACGATCTGCTCAATG
Exon 9F, Exon 14R-in CAGCTCATCTGCGAGTGTG AAATGGAAAGGTACTGGCCTCGG
A
FLAP-F, FLAP-R GGAGCCTGAAGCAAAC AGATGAGAACACCAACCC


Isoform screening and identification: Amplicons resulting from the amplification of the
5-LO cDNA were ligated into a pGEM-T Easy Vector (Promega, Nepean, On, Canada)
according to manufacturers protocol. Ligated vectors were then transformed into
DH5 Competent Cells (Invitrogen) following the manufacturers protocol. Screening
of the clones for the different 5-LO inserts was performed by PCR amplification using 5-
LO-specific primers (Table 3.1). Different 5-LO isoforms were identified by sequencing
at the Plateforme de squenage et de gnotypage (Quebec, Canada) using vector-specific
primers M13F and M13R and internal 5-LO-specific primers.


40
Construction of expression vectors and cell transfections: The different 5-LO cDNA
amplicons obtained using the primer pairs Exon 1F-out and Exon 14R-out were inserted
into a pre-treated CIP expression vector pcDNA3.1 cut with EcoRV (New England
Biolabs). FLAP cDNA was first inserted in a pGEM-T Easy Vector according to the
manufacturers protocol. The FLAP insert was then excised using NotI and ligated with
T4 DNA ligase into a pre-cut pBUDCE4.1 vector. Expression vector constructions were
sequenced to confirm integrity and direction of the inserts. HEK293 cells were
transfected using Polyfect reagent (QIAGEN, Mississauga, ON, Canada) according to the
manufacturers protocol. Briefly, cells were seeded in culture medium 24 hr before
transfections in 6 well plates at a density of 6 10
5
cells/ml. On the day of the
transfections, a total of 2 g of vector DNA was diluted with DMEM for a total volume
of 100 l and 20 l of Polyfect reagent was added to the diluted DNA. The mix was
added to the HEK293 cells and incubated for 24 h. Cells were then harvested following
trypsinization.

Cell stimulation and analysis of 5-LO products: For stimulation of HEK293 cells, one
day after transfections with appropriate vectors cells were collected following
trypsinization, washed, and the cell pellet was resuspended (10
7
cells/ml) in HBSS
containing 1.6 mM CaCl
2
and 0.1% BSA. Cells were then stimulated for 15 min at 37C
with the addition of 10 M calcium ionophore A23187 (Sigma-Aldrich) and 10 M
arachidonic acid (Cayman Chemical). In some experiments neutrophils (10
7
cells/ml)
were stimulated for 10 min at 37C using 1 mM thapsigargin (Sigma-Aldrich, Oakville,
On, Canada) as previously described (36). The lymphocyte cell lines Raji, Reh and TA
were stimulated as previously described with minor modifications (37). Briefly, cells
were suspended in HBSS containing 1 mM CaCl
2
and 0.1% BSA (10
7
cells/ml) at 37 C
and were stimulated with 20 M A23187 in the presence of 40 M AA and 20 M H
2
O
2

for 30 min. THP-1 cells were suspended in HBSS containing 1.6 mM CaCl
2
(10
7
cells/ml)
and stimulated for 15 min at 37C with 1 M calcium ionophore A23187 as previously
described (38).


41
All stimulations were stopped with the addition of 0.5 volumes of cold methanol
containing 50 ng of PGB
2
and samples were stored at -20 C. After centrifugations to
remove precipitated proteins, samples were added to a preconditioned octadecyl (C18)
column, were washed with 3 ml acidified water (0.1% acetic acid) and 5-LO products
were eluted with methanol. After evaporation of solvents with nitrogen, products were
suspended in 20% methanol and subjected to RP-HPLC analysis with diode array
detection as previously described (39).

To assay 5-LO activity in cell lysates, 10
6
cells were suspended in 600 l hypotonic
buffer (50 mM Tris-Cl pH 7.6, 150 mM NaCl and 2 mM EDTA) for 10 minutes at 4C.
Cells were then passed vigorously 5 times trough a 21 gauge needle and the supernatant
was collected after centrifugation at 1200 g for 5 minutes at 4C. A fraction of the
supernatant was used for protein quantification (40) and another fraction used to assay
5-LO activity as previously described with minor modifications (41). Briefly, 1 mM
ATP, 5 mM CaCl
2
and 40 M AA were added to the cell lysate supernatant and the mix
was incubated at 37C for 20 minutes. The reaction was stopped by the addition of 0.5
volumes of methanol and 50 ng of PGB
2
was added as internal standard. Samples where
then processed and 5-LO products were measured by HPLC as described above.

SDS-PAGE and Western blotting: Whole cells were centrifuged and lysis buffer
containing a cocktail of protease inhibitors (Roche, Laval, Qc, Canada) as well as
(leupeptin (10 g/l), aprotinin (10 g/l) and PMSF (1 g/l) (Sigma-Aldrich) was
added to the pellets (42). Following a quick vortex, an equal volume of 2X Laemmli
solution (Sigma-Aldrich) was added and samples were immediately denatured for 10 min
in a boiling water bath.

Following stimulation, neutrophils fractionation for the preparation of nuclear and non-
nuclear fractions was achieved by suspending cells in lysis buffer (0.1% NP-40, 10 mM
Tris-HCl, pH 7, 10 mM NaCl, 3 mM MgCl2, 1 mM EDTA) for 5 minutes at 4C
followed by centrifugation at 500 x g for 10 min at 4C to obtain a nuclear pellet and a
non-nuclear supernatant (36). Non-nuclear fractions were diluted with 2X Laemmli

42
solution while nuclei were resuspended in lysis buffer prior to the addition of 2X
Laemmli solution.

Whole cells as well as fractionated samples were subjected to SDS-PAGE on a 4-12 %
gel gradient, proteins were transferred onto a PVDF membrane and Western blotting was
performed using a rabbit polyclonal anti-5-LO (1:500) (Cayman Chemical, Ann Arbor,
MI) and a HRP-conjugated mouse anti-rabbit IgG. Membranes were washed and
developed using Super-signal West Femto Substrate (Pierce, Rockford, IL) with detection
using an Alpha Innotech Fluorchem imager (San Leandro, CA).

3.5. Results
Evaluation of expressed 5-LO mRNA species
Initial experiments investigated the expression of 5-LO transcripts in primary human
neutrophils and in human myeloid cells lines by RT-PCR. Primers that amplify different
regions of 5-LO transcripts of approximately 500 to 900 base pairs were designed (Table
3.1) and utilized to assure that small differences in amplicon size could be visualized on
agarose gels. Figure 3.1A shows the PCR products obtained for each cell type using
different pairs of primers. Distinct patterns were consistently observed for each of the
different cell types. In all cells evaluated, primer pairs that spanned exons 1-5 or exons
4-10 generated only one band of the size expected (607bp and 886bp, respectively) for a
5-LO mRNA that would have retained all exons. Conversely, when primer pairs that span
exons 9-14 were used to amplify the cDNA preparations, different patterns were obtained
that were cell type- or cell line-specific. All cells evaluated showed the expected band at
916bp where all exons would be retained. However, the human Burkitt lymphoma cell
line Raji and the EBV-transformed B cell line TA both showed an additional amplicon
that had a lower molecular weight (~750bp). Two PCR products were also found in
freshly-isolated human neutrophils: the expected 916bp band and a higher molecular
weight (~1100bp) amplicon. This doublet was also apparent when primers pairs spanning
exons 8 to 13 were utilized. Interestingly, we found these three amplicons in both the
acute lymphocytic leukemia cell line Reh and in the human monocyte-like THP-1.
Another faint amplicon of ~560bp was also detected in THP-1 cells (Fig 1A).

43

Another series of experiments was performed in which all the possible cDNA amplicons
of 5-LO were amplified by using the primers Exon 1F-out and exon 14R-out (Table 3.1).
Exon 1F-out recognizes sequences within the 5 untranslated region before the start
codon of 5-LO and primer Exon 14R-out recognizes a sequence in the 3 untranslated
region of exon 14. The obtained amplicons were ligated into a pGEM-T Easy vector
and then cloned in DH5a E coli. Individual clones prepared from the amplicons of each
cell lines and of human neutrophils were then screened by PCR. As expected, all tested
clones showed only one amplified band when evaluated with primers spanning exons 1 to
5 (607bp) or exons 4 to 10 (886bp). Essentially similar results to those shown in Figure
3.1A were obtained when the clones were screened using the primer pairs that span exons
9-14. Interestingly, some clones obtained using cDNA from neutrophils preparations had
additional amplicons that were approximately 750bp and 800bp. Each of these clones
represented approximately 5% of the total clones obtained from our neutrophils
preparations. Since bands of this size were not visualized on the agarose gels in Figure
3.1A, the RT-PCR products from neutrophils spanning exons 9 to 14 were analyzed using
the more sensitive Experion DNA 1K Analysis Kits. This methods has been used
successfully for the identification of multiple isoforms of the PAX5 gene (43). Figure
3.1B shows that using the Experion system two additional smaller RT-PCR products
were detected in neutrophils preparations that co-eluted with the cloned 750bp and 800bp
amplicons.

44

Figure 3.1: 5-LO transcript expression profiles in peripheral blood neutrophils
(PMN) and in Raji, TA, Reh, and THP-1 cells. A) The PCR amplification of 5-LO
transcripts from the indicated cell types spanning exons 1-5, 4-10, 8-13 and 9-14. B)
Analysis of PCR amplification of exons 9 to 14 from neutrophils transcripts using
microfluidics technology. Simulated gel representation (left panel) and electropherogram
(right panel) using the Experion software for microfluidic analysis of PCR products from
cDNA prepared from neutrophils. Blank control (Cont) with no added cDNA template is
also shown. The different peaks are labelled based on their co-elution with standards
obtained by PCR amplification of the individual cloned isoforms. Results are
representative of at least 7 independent experiments.

Sequencing of amplicons
DNA from individual clones containing the different size inserts was then sequenced.
Figure 3.2 summarizes the sequencing results. Clones with an amplicon size that would
be anticipated for the established 5-LO sequence possessed the expected full length 5-LO
sequence for exon 1 to exon 14 as previously reported (23). All clones originating from
Raji, TA, Reh and THP-1 cells with the smaller (~750bp) amplicon shown in Figure 3.1A

45
had a cDNA sequence in which all exons were retained except for the complete 171bp
from exon 13 (Genbank accession number HM592259;
http://www.ncbi.nlm.nih.gov/genbank/). This isoform was termed A-13. The sequence of
all individual clones that had the 1100bp amplicon shown in Figure 3.1A (neutrophils
(PMN), THP-1 and Reh cells) had a cDNA where all 14 exons of the ALOX5 gene are
retained as well as the complete 199bp from the 10
th
intron (or Intron J) (Genbank
accession number HM592260). This isoform was termed -10. The individual clones that
were isolated from THP-1 cells with the smallest amplicon (~560bp) showed the
sequence for a cDNA where all 179bp from exon 10 and all 171bp from exon 13 were not
retained (Genbank accession number HM592258). This isoform was termed A-10,13.
Finally, clones originating from neutrophils preparations containing the smaller (~750bp)
5-LO amplicons was also identified as a A-13 isoform, while the ~800bp clones were
identified as an isoform where the first 96bp of exon 10 were not retained (Genbank
accession number HM592261). This isoform that partially retained exon 10 was termed
A-p10. Upon analysis of the alternative 3splice site within exon 10, all three conserved
signals (44, 45) that would allow recognition of the pre-mRNA by the spliceosomes are
present: the 3splice site (3SS) AG, a CTGAC branch point (46) with the A located 27pb
upstream, and a polypyrimidine tract between the 3SS and the branch point.
Approximately 18% of alternative splicing in higher eukaryotes involves such use of an
alternative 3SS whereas exon skipping and intron retention represent approximately 40%
and less than 5% of alternative splicing events, respectively (44, 45).

Upon analysis of the reading frame of the sequences obtained from the different clones,
the retention of the 10
th
intron in the -10 isoform resulted in a premature TGA stop
codon within the first 4 base pairs coded by the intron sequence. This would result in
putative protein product with a molecular weight of approximately 56 kDa (Fig. 3.2).
The A-p10 and A-13 mRNA, where exon sequences are missing, do not result a reading
frame shift but code for putative proteins of approximately 76 kDa and 72 kDa,
respectively. The A-10,13 isoform includes a reading frame shift due to the loss of exon
10 (179bp) resulting in a TGA stop codon within the sequence of exon 14 that is 70 bp

46
before the regular stop codon for the full length 5-LO. This isoform would code for a
putative protein of approximately 62 kDa.

Figure 3.2: Representation of identified human 5-LO isoforms. Numbers indicate the
exon and the arrows show the location of the first stop codon for each transcript. The
putative molecular weight of the resulting translated protein is indicated as well as the
cell lines in which the transcripts were detected.

Protein expression
pcDNA3.1 expression vectors were constructed containing inserts of the A-13, the -10
and the A-p10 isoforms and were transfected into HEK293 cells to evaluate whether
protein products could be expressed. An anti-5-LO recognizing amino acids 130-149 was
utilized, since these residues are present in all identified isoforms. Figure 3.3A shows that
the full length 5-LO protein as well as the three alternatively-spliced isoforms (-10, 13
and A-p10) were expressed in these transfected HEK293 cells. When Raji cells were
evaluated for 5-LO protein expression by immunoblot analysis, immunoreactive bands
co-migrating with the cloned the A-13 and the full length isoforms expressed in HEK293
cells were detected (Fig. 3.3B). In neutrophils preparations immunoractive bands co-
migrated with the full length and the A-13 isoforms, while another band migrated at the
predicted molecular weight of the -10 isoform (Fig. 3.3C). Of note, the immunoreactive
band co-migrating with the A-13 isoform was not present in all neutrophils preparations
we tested.

47

The cellular location of 5-LO can vary depending on the cell type or the activation status
of the cell (21). When thapsigargin-stimulated human neutrophils were fractionated into
nuclear and non-nuclear fractions, the band corresponding to the full length 5-LO was
detected in the non-nuclear fractions, whereas the bands corresponding to both the full
length and the A-13 isoforms were detected in the nuclear fractions (Fig. 3.3D).

Figure 3.3: Immunodetection of 5-LO isoforms with anti-5-LO following separation
by SDS-PAGE. A) Expression of the indicated isoforms following transfection with
expression vectors in HEK293 cells. B) Detection of immunoractive bands in Raji cells
and in HEK293 cells transfected with the indicated isoforms. C) Detection of
immunoractive bands in neutrophils (PMN). D) Detection of immunoractive bands in
non-nuclear and nuclear fractions of thapsigargin-stimulated neutrophils. All results are
representative of 3 to 7 independent experiments.



48
5-LO activity
Upon stimulation, all three lymphocytic cell lines synthesized 5-LO products as did
thapsigargin-stimulated neutrophils (Fig. 3.4A); however, ionophore-stimulated THP-1
cells did not produce detectable 5-LO products, consistent with the limited capacity for
the biosynthesis of 5-LO products of this cell line (38). Since HEK293 cells do not
express FLAP (evaluated by RT-PCR), when these cell were transfected with the full
length 5-LO expression vector, very little 5-LO product synthesis was measured after cell
stimulation. However, the co-transfection of HEK293 cells with the FLAP expression
vector and the full length 5-LO expression vector resulted in cells capable of synthesizing
LTB
4
, its trans-isomers and 5-hydroxyeicosatetraenoic acid when stimulated (Fig. 3.4A
and Supplemental Fig 1). Consequently, all further experiments in HEK293 cells were
carried out in cells co-transfected with the FLAP expression vector. The capacity of the
different isoforms to synthesize of 5-LO products was then evaluated in HEK293 cells.
When cells were transfected with vectors expressing the A-13 or the A-p10 isoforms,
none were capable of detectable 5-LO product biosynthesis (Fig 3.4B); this is likely due
to the expected changes in the catalytic domain of 5-LO based on the sequence of these
isoforms. Most interestingly, when cells were co-transfected with the full length 5-LO
and an alternative isoform, the capacity to synthesize 5-LO products following cell
stimulation was significantly decreased compared to cells transfected with the full length
5-LO isoform alone. In sharp contrast, the co-transfection of HEK293 cells with vectors
expressing the alternative isoforms did not affect total 5-LO activity measured in cell
lysate assays. This indicates that the expression of alternative 5-LO isoforms results in a
decrease in the capacity for the stimulated whole-cell biosynthesis of 5-LO products that
was maintained when results were normalized for total 5-LO activity in the cell lysates
from the same cellular preparation (Fig. 3.4B). A representative immunoblot of these co-
transfection experiments is shown in Figure 3.4C.

49

Figure 3.4: Stimulated biosynthesis of 5-LO products. A) Biosynthesis of 5-LO
products by the indicated stimulated cells. HEK293 cells were transfected with
expression vectors for the full length 5-LO and FLAP. (n= 2 to 4 independent
experiments). B) Biosynthesis of 5-LO products by stimulated HEK293 cells transfected
with expression vectors for the indicated 5-LO isoforms. Values represent stimulated 5-
LO product biosynthesis (ng/10
6
cells) normalized with 5-LO activity (ng/mg protein) in
broken cell preparations (n= 3 or 4 independent experiments). Total 5-LO products
represent the sum of LTB
4
, 6-trans-LTB
4
, 12-epi-6-trans-LTB
4
, and 5-
hydroxyeicosatetraenoic acid. In neutrophils, 20-OH-LTB
4
and 20-COOH-LTB
4
were
also produced. C) Representative immunoblots from HEK293 cells co-transfected with
the indicated 5-LO isoforms in B). pc= control pcDNA3.1 vector with no 5-LO insert.
Data represent mean SEM. * Different from Full p<0.02, using a two-tailed one-sample
students t-test.




50
3.6. Discussion
In this study we identify novel isoforms of 5-LO whose mRNA sequences indicate that
the 5-LO gene transcript undergoes alternative splicing. Most importantly, these
alternative isoforms appear to play a role in the regulation of the biosynthesis of 5-LO
products. A number of human cell types known to express 5-LO were evaluated
including monocyte-like and lymphoid cell lines as well as primary peripheral blood
neutrophils. The expression pattern of these isoforms appears to be cell type or cell line
specific since each possessed its own pattern expressing some alternative isoforms but
not others. All cells expressed the full length 5-LO containing all 14 exons as well as at
least one other 5-LO transcript isoform whose sequence was consistent with alternative
mRNA splicing. Expression vectors for these isoforms were constructed and when
transfected in HEK293 cells the gene products were expressed. This was expected since
truncated 5-LO constructs have been previously expressed by others as tools to
investigate the function of 5-LO domains (15, 47). Importantly, cloned protein products
co-migrated on SDS-PAGE with appropriate immunoreactive bands from the different
cellular preparations at the predicted molecular weights indicating that these cell types
express the novel protein isoforms.

The predicted structure of the 5-LO enzyme, based on the crystal structure of the rabbit
reticulocyte 15-lipoxygenase (48), shows that the 5-LO protein contains two structural
domains. The C-terminal catalytic domain is mostly a helical structure which contains a
non-heme iron that is essential for the enzymes catalytic activity, while the N-terminal
C2-like domain is largely responsible for the translocation of the enzyme to perinuclear
membranes following cell activation (15). Interestingly, all alternative isoforms that were
identified would code for proteins that contain modifications in the catalytic domain,
while leaving the N-terminal C2-like domain (coded by exons 1-2) intact. Indeed, the
catalytic domain of the o-10 isoform is truncated due to an early stop signal within the
retained intronic sequence resulting in the loss of all amino acid residues from 484 to
673. This includes the key residues that are believed to form the 2-His-carboxylate facial
triad that anchors the non-heme iron in 5-LO (49). The excision of exon 13 in the A-13
isoform results in a message that codes for a protein product missing residues 559 to 615

51
that are adjacent to the critical His
550
and Asn
554
residues associated with iron chelation
within the catalytic site. Similarly, the A-p10 isoform identified in human neutrophils and
the A-10,13 isoform identified in THP-1 cells also lack amino acid sequences within the
catalytic domain. Consistent with these predicted modifications in the catalytic domain,
none of the constructs of alternative 5-LO isoforms possessed measurable catalytic
activity when expressed in HEK293 cells.

One of the more intriguing results obtained in the present study was that the alternative
isoforms inhibit the biosynthesis of 5-LO products when co-expressed with the full length
active 5-LO in HEK293 cells. Importantly, the alternative isoforms did not affect the
activity of the full length 5-LO in broken cell assays suggesting they might interfere with
the 5-LO activation process when intact cells are stimulated. However, the mechanisms
responsible for 5-LO translocation and activation are not yet fully understood, although it
appears that both the catalytic site and the C2-like domain are involved in this process
(15, 20) . Given that the N-terminal C2-like domain is intact in all alternative isoforms, it
is possible that these isoforms act as natural endogenous 5-LO inhibitors by competing
for interactions with other proteins; the N-terminal domain is largely involved in
regulating the catalytic domain of 5-LO since it is responsible for the proteins
interactions with other components of the biosynthetic machinery and 5-LOs ability to
translocate to the perinuclear membrane (15). The translocation-activation process
involves the interaction of 5-LO with CLP, an actin-binding protein likely acting as a
scaffold protein implicated in 5-LO activation (17, 18). This interaction of CLP with 5-
LO, as well as its ability to fully activate 5-LO, are dependent on three tryptophan
residues (Trp
13
, Trp
75
and Trp
102
) within the N-terminal domain of 5-LO (17, 18).
Similarly, optimal 5-LO activation and LT biosynthesis in stimulated cells requires the
presence of FLAP that is a membrane-bound protein. FLAP is active as a homodimer or
trimer (50, 51) that may enhance 5-LO product biosynthesis by presenting or transferring
AA to 5-LO; however, the nature of the interaction between FLAP and 5-LO is unclear.
The observation that the alternative 5-LO isoforms inhibit 5-LO activation suggests that
they may interfere with some associations between 5-LO and other components of its
activation process. In other words, these isoforms might act as natural antagonists, with

52
their N-terminal domain interfering with the association of the N-terminal domain of
active 5-LO with CLP, FLAP or some other component of the leukotriene biosynthetic
machinery.

Since alternative isoforms of 5-LO interfere with LT synthesis, the cellular distribution of
different isoforms was investigated in human neutrophils where 5-LO is primarily a
cytosolic protein that translocates to the nuclear membrane upon cell stimulation.
However, the subcellular distribution of the A-13 isoform did not parallel that of the full
length 5-LO in stimulated human neutrophils. While the full length 5-LO was found in
both the nuclear and non-nuclear fractions, the A-13 isoform was only detected in the
nuclear fraction suggesting that this isoform has a greater affinity for the nucleus or a
greater ability to translocate than that of the full length protein. This observation is
consistent with the much more rapid translocation of truncated N-terminal domain-
containing 5-LO constructs than that of full length 5-LO constructs previously reported
by Chen and Funk (15), and is also consistent with the suggestion that this isoform may
inhibit cellular 5-LO activation through competition for components of the 5-LO
activation mechanism.

While each cell type tested appears to express a distinctive set of isoforms, the
mechanisms responsible for these specific patterns are not known. Additionally, although
several different cell types were evaluated, no definitive pattern could be associated with
a stage of development or activation. Raji (Burkitts lymphoma) and TA cells, which are
respectively, in vivo and in vitro EBV-transformed B cells, present identical isoform
expression patterns whereas Reh cells (an immature non-B non-T cell lymphocytic
leukemia cell line), THP-1 cells (an acute monocytic leukemia cells line) and terminally-
differentiated peripheral blood human neutrophils expressed multiple mRNA isoforms.
At this stage, it remains unclear whether differentiation or stimulation states modulate the
expression patterns of 5-LO isoforms. However, the variable expression of the -13
isoform that we observed in our different neutrophils preparations suggests that the
relative expression of the different isoforms is likely regulated. While the 5-LO pathway
has long been associated with asthma, the more recent and very compelling evidence

53
regarding its role in vascular disease (4-6) and development (7) as well as in the
regulation of leukemia stem cells (8) underscores the importance of understanding the
mechanisms that control this pathway.

In summary, we have described the presence of alternatively spliced isoforms of 5-LO
that are expressed in primary human leukocytes and human myeloid cell lines. The
expression pattern of the novel isoforms is specific for each cell type or cell line studied.
Although the alternative protein products are catalytically inactive isomers of 5-LO, they
inhibit the biosynthetic capacity of 5-LO in whole cells but not in cell lysates, suggesting
that they might act as endogenous 5-LO inhibitors that are likely involved in the
regulation of LT biosynthesis in vivo. The mechanisms by which the inhibitory effect of
alternative 5-LO isoforms occurs and the potential modulation of the expression of the
different 5-LO isoforms under various conditions, including certain pathologies, require
further investigation.


























54
3.7. Supplemental data


Supplemental Figure 1: Typical HPLC chromatograms of standards (top panels),
stimulated HEK293 cells transfected with the full 5-LO + pc vectors (middle panels) and
stimulated HEK293 cells transfected with the vectors expressing the full 5-LO + the A-13
isoforms (bottom panels). The panels on the left show chromatograms obtained with
absorbance at 270nm and those on the right were obtained at 236nm. Peak area
integrations were utilized to calculate product quantities using PGB
2
as the internal
standard.

3.8. Acknowledgements
This work was supported by grants from the Canadian Institutes of Health Research
(M.E.S.) and the Heart and Stroke Foundation of Canada (M.E.S.). M.E.S. is supported
by the Canada Research Chairs Program. N.F. is the recipient of Scholarship awards from
the Canadian Arthritis Network and the Fonds de la Recherche en Sant du Qubec
(FRSQ). L.H.B is the recipient of a Scholarship for the Fonds de recherche sur larthrite
et les maladies rhumatismales de lUniversit Laval. L.H.B and J.B. contributed equally
to this study.

55
3.9. References
1. Leff, J. A., Busse, W. W., Pearlman, D., Bronsky, E. A., Kemp, J., Hendeles, L.,
Dockhorn, R., Kundu, S., Zhang, J., Seidenberg, B. C., and Reiss, T. F. (1998)
Montelukast, a leukotriene-receptor antagonist, for the treatment of mild asthma
and exercise-induced bronchoconstriction. N Engl J Med 339, 147-152.
2. Peters-Golden, M., and Henderson, W. R., Jr. (2007) Leukotrienes. N Engl J Med
357, 1841-1854.
3. Flamand, N., Mancuso, P., Serezani, C. H., and Brock, T. G. (2007) Leukotrienes:
mediators that have been typecast as villains. Cell Mol Life Sci 64, 2657-2670.
4. Tardif, J. C., L'Allier P, L., Ibrahim, R., Gregoire, J. C., Nozza, A., Cossette, M.,
Kouz, S., Lavoie, M. A., Paquin, J., Brotz, T. M., Taub, R., and Pressacco, J.
Treatment with 5-lipoxygenase inhibitor VIA-2291 (Atreleuton) in patients with
recent acute coronary syndrome. Circ Cardiovasc Imaging 3, 298-307
5. Helgadottir, A., Manolescu, A., Thorleifsson, G., Gretarsdottir, S., Jonsdottir, H.,
Thorsteinsdottir, U., Samani, N. J., Gudmundsson, G., Grant, S. F., Thorgeirsson,
G., Sveinbjornsdottir, S., Valdimarsson, E. M., Matthiasson, S. E., Johannsson,
H., Gudmundsdottir, O., Gurney, M. E., Sainz, J., Thorhallsdottir, M.,
Andresdottir, M., Frigge, M. L., Topol, E. J., Kong, A., Gudnason, V.,
Hakonarson, H., Gulcher, J. R., and Stefansson, K. (2004) The gene encoding 5-
lipoxygenase activating protein confers risk of myocardial infarction and stroke.
Nat Genet 36, 233-239
6. Dwyer, J. H., Allayee, H., Dwyer, K. M., Fan, J., Wu, H., Mar, R., Lusis, A. J.,
and Mehrabian, M. (2004) Arachidonate 5-lipoxygenase promoter genotype,
dietary arachidonic acid, and atherosclerosis. N Engl J Med 350, 29-37.
7. Finkensieper, A., Kieser, S., Bekhite, M. M., Richter, M., Mueller, J. P.,
Graebner, R., Figulla, H. R., Sauer, H., and Wartenberg, M. (2010) The 5-
lipoxygenase pathway regulates vasculogenesis in differentiating mouse
embryonic stem cells. Cardiovasc Res 86, 37-44
8. Chen, Y., Li, D., and Li, S. (2009) The Alox5 gene is a novel therapeutic target in
cancer stem cells of chronic myeloid leukemia. Cell Cycle 8, 3488-3492

56
9. Borgeat, P., Hamberg, M., and Samuelsson, B. (1976) Transformation of
arachidonic acid and homo-gamma-linolenic acid by rabbit polymorphonuclear
leukocytes. Monohydroxy acids from novel lipoxygenases. J Biol Chem 251,
7816-7820.
10. Serhan, C. N. Novel lipid mediators and resolution mechanisms in acute
inflammation: to resolve or not? Am J Pathol 177, 1576-1591
11. Brock, T. G., McNish, R. W., and Peters-Golden, M. (1995) Translocation and
leukotriene synthetic capacity of nuclear 5-lipoxygenase in rat basophilic
leukemia cells and alveolar macrophages. J Biol Chem 270, 21652-21658
12. Rouzer, C. A., and Samuelsson, B. (1987) Reversible, calcium-dependent
membrane association of human leukocyte 5-lipoxygenase. Proc Natl Acad Sci U
S A 84, 7393-7397.
13. Woods, J. W., Evans, J. F., Ethier, D., Scott, S., Vickers, P. J., Hearn, L., Heibein,
J. A., Charleson, S., and Singer, II (1993) 5-lipoxygenase and 5-lipoxygenase-
activating protein are localized in the nuclear envelope of activated human
leukocytes. J Exp Med 178, 1935-1946.
14. Allard, J. B., and Brock, T. G. (2005) Structural organization of the regulatory
domain of human 5-lipoxygenase. Curr Protein Pept Sci 6, 125-131.
15. Chen, X. S., and Funk, C. D. (2001) The N-terminal "beta-barrel" domain of 5-
lipoxygenase is essential for nuclear membrane translocation. J Biol Chem 276,
811-818.
16. Hammarberg, T., Provost, P., Persson, B., and Radmark, O. (2000) The N-
terminal domain of 5-lipoxygenase binds calcium and mediates calcium
stimulation of enzyme activity. J Biol Chem 275, 38787-38793.
17. Provost, P., Doucet, J., Hammarberg, T., Gerisch, G., Samuelsson, B., and
Radmark, O. (2001) 5-Lipoxygenase interacts with coactosin-like protein. J Biol
Chem 276, 16520-16527
18. Rakonjac, M., Fischer, L., Provost, P., Werz, O., Steinhilber, D., Samuelsson, B.,
and Radmark, O. (2006) Coactosin-like protein supports 5-lipoxygenase enzyme
activity and up-regulates leukotriene A4 production. Proc Natl Acad Sci U S A
103, 13150-13155

57
19. Abramovitz, M., Wong, E., Cox, M. E., Richardson, C. D., Li, C., and Vickers, P.
J. (1993) 5-lipoxygenase-activating protein stimulates the utilization of
arachidonic acid by 5-lipoxygenase. Eur J Biochem 215, 105-111
20. Flamand, N., Lefebvre, J., Surette, M. E., Picard, S., and Borgeat, P. (2006)
Arachidonic acid regulates the translocation of 5-lipoxygenase to the nuclear
membranes in human neutrophils. J Biol Chem 281, 129-136
21. Radmark, O., Werz, O., Steinhilber, D., and Samuelsson, B. (2007) 5-
Lipoxygenase: regulation of expression and enzyme activity. Trends Biochem Sci
32, 332-341.
22. Newcomer, M. E., and Gilbert, N. C. (2010) Location, Location, Location:
Compartmentalization of Early Events in Leukotriene Biosynthesis. J Biol Chem
13, 25109-25114
23. Funk, C. D., Hoshiko, S., Matsumoto, T., Rdmark, O., and Samuelsson, B. (1989)
Characterization of the human 5-lipoxygenase gene. Proc Natl Acad Sci U S A 86,
2587-2591.
24. Hoshiko, S., Radmark, O., and Samuelsson, B. (1990) Characterization of the
human 5-lipoxygenase gene promoter. Proc Natl Acad Sci U S A 87, 9073-9077.
25. Dishart, D., Schnur, N., Klan, N., Werz, O., Steinhilber, D., Samuelsson, B., and
Radmark, O. (2005) GC-rich sequences in the 5-lipoxygenase gene promoter are
required for expression in Mono Mac 6 cells, characterization of a novel Sp1
binding site. Biochim Biophys Acta 1738, 37-47
26. Sorg, B. L., Klan, N., Seuter, S., Dishart, D., Radmark, O., Habenicht, A.,
Carlberg, C., Werz, O., and Steinhilber, D. (2006) Analysis of the 5-lipoxygenase
promoter and characterization of a vitamin D receptor binding site. Biochim
Biophys Acta 1761, 686-697
27. Seuter, S., Sorg, B. L., and Steinhilber, D. (2006) The coding sequence mediates
induction of 5-lipoxygenase expression by Smads3/4. Biochem Biophys Res
Commun 348, 1403-1410
28. Seuter, S., Vaisanen, S., Radmark, O., Carlberg, C., and Steinhilber, D. (2007)
Functional characterization of vitamin D responding regions in the human 5-
Lipoxygenase gene. Biochim Biophys Acta 1771, 864-872

58
29. Uhl, J., Klan, N., Rose, M., Entian, K. D., Werz, O., and Steinhilber, D. (2002)
The 5-lipoxygenase promoter is regulated by DNA methylation. J Biol Chem 277,
4374-4379
30. Johnson, J. M., Castle, J., Garrett-Engele, P., Kan, Z., Loerch, P. M., Armour, C.
D., Santos, R., Schadt, E. E., Stoughton, R., and Shoemaker, D. D. (2003)
Genome-wide survey of human alternative pre-mRNA splicing with exon junction
microarrays. Science 302, 2141-2144
31. Ben-Dov, C., Hartmann, B., Lundgren, J., and Valcarcel, J. (2008) Genome-wide
analysis of alternative pre-mRNA splicing. J Biol Chem 283, 1229-1233
32. Roos, K. L., and Simmons, D. L. (2005) Cyclooxygenase variants: the role of
alternative splicing. Biochem Biophys Res Commun 338, 62-69
33. Kilty, I., Logan, A., and Vickers, P. J. (1999) Differential characteristics of human
15-lipoxygenase isozymes and a novel splice variant of 15S-lipoxygenase. Eur J
Biochem 266, 83-93.
34. Jendraschak, E., Kaminski, W. E., Kiefl, R., and von Schacky, C. (1996) The
human leukotriene A4 hydrolase gene is expressed in two alternatively spliced
mRNA forms. Biochem J 314, 733-737.
35. Boyum, A. (1968) Isolation of mononuclear cells and granulocytes from human
blood. Isolation of monuclear cells by one centrifugation, and of granulocytes by
combining centrifugation and sedimentation at 1 g. Scand J Clin Lab Invest Suppl
97, 77-89.
36. Flamand, N., Surette, M. E., Picard, S., Bourgoin, S., and Borgeat, P. (2002)
Cyclic AMP-mediated inhibition of 5-lipoxygenase translocation and leukotriene
biosynthesis in human neutrophils. Mol Pharmacol 62, 250-256.
37. Werz, O., Szellas, D., and Steinhilber, D. (2000) Reactive oxygen species released
from granulocytes stimulate 5-lipoxygenase activity in a B-lymphocytic cell line.
Eur J Biochem 267, 1263-1269
38. Ring, W. L., Riddick, C. A., Baker, J. R., Glass, C. K., and Bigby, T. D. (1997)
Activated lymphocytes increase expression of 5-lipoxygenase and its activating
protein in THP-1 cells. Am J Physiol 273, C2057-2064.

59
39. Borgeat, P., Picard, S., Vallerand, P., Bourgoin, S., Odeimat, A., Sirois, P., and
Poubelle, P. E. (1990) Automated on-line extraction and profiling of lipoxygenase
products of arachidonic acid by high-performance liquid chromatography.
Methods Enzymol 187, 98-116.
40. Markwell, M. A., Haas, S. M., Tolbert, N. E., and Bieber, L. L. (1981) Protein
determination in membrane and lipoprotein samples: manual and automated
procedures. Methods Enzymol 72, 296-303
41. Werz, O., Tretiakova, I., Michel, A., Ulke-Lemee, A., Hornig, M., Franke, L.,
Schneider, G., Samuelsson, B., Radmark, O., and Steinhilber, D. (2005) Caspase-
mediated degradation of human 5-lipoxygenase in B lymphocytic cells. Proc Natl
Acad Sci U S A 102, 13164-13169
42. Flamand, N., Luo, M., Peters-Golden, M., and Brock, T. G. (2009)
Phosphorylation of serine 271 on 5-lipoxygenase and its role in nuclear export. J
Biol Chem 284, 306-313
43. Arseneau, J. R., Laflamme, M., Lewis, S. M., Maicas, E., and Ouellette, R. J.
(2009) Multiple isoforms of PAX5 are expressed in both lymphomas and normal
B-cells. Br J Haematol 147, 328-338
44. Keren, H., Lev-Maor, G., and Ast, G. (2010) Alternative splicing and evolution:
diversification, exon definition and function. Nat Rev Genet 11, 345-355
45. Matlin, A. J., Clark, F., and Smith, C. W. (2005) Understanding alternative
splicing: towards a cellular code. Nat Rev Mol Cell Biol 6, 386-398
46. Gao, K., Masuda, A., Matsuura, T., and Ohno, K. (2008) Human branch point
consensus sequence is yUnAy. Nucleic Acids Res 36, 2257-2267
47. Michel, A. A., Steinhilber, D., and Werz, O. (2008) Development of a method for
expression and purification of the regulatory C2-like domain of human 5-
lipoxygenase. Protein Expr Purif 59, 110-116
48. Hemak, J., Gale, D., and Brock, T. G. (2002) Structural characterization of the
catalytic domain of the human 5-lipoxygenase enzyme. J Mol Model 8, 102-112
49. Hegg, E. L., and Que, L., Jr. (1997) The 2-His-1-carboxylate facial triad--an
emerging structural motif in mononuclear non-heme iron(II) enzymes. Eur J
Biochem 250, 625-629

60
50. Plante, H., Picard, S., Mancini, J., and Borgeat, P. (2006) 5-Lipoxygenase-
activating protein homodimer in human neutrophils: evidence for a role in
leukotriene biosynthesis. Biochem J 393, 211-218.
51. Ferguson, A. D., McKeever, B. M., Xu, S., Wisniewski, D., Miller, D. K., Yamin,
T. T., Spencer, R. H., Chu, L., Ujjainwalla, F., Cunningham, B. R., Evans, J. F.,
and Becker, J. W. (2007) Crystal structure of inhibitor-bound human 5-
lipoxygenase-activating protein. Science 317, 510-512




































61
CHAPTER IV: Caffeoyl and cinnamoyl clusters with
anti-inflammatory and anti-cancer effects. Synthesis
and structure-activity relationship


Luc H. Boudreau, Nadia Picot, Jrmie Doiron, Benot Villebonnet, Marc E. Surette,
Gilles A. Robichaud and Mohamed Touaibia


This article was published in the New Journal of Chemistry. 2009, 33: 3188-96.
Reproduced by permission of The Royal Society of Chemistry (RSC) on behalf of the
Centre National de la Recherche Scientifique (CNRS) and the RSC.

Manuscript online link: http://pubs.rsc.org/en/content/articlelanding/2009/nj/b907878a











Authors contribution
L.H.B, N.P., J.D. and B.V. performed the experiments. M.E.S., G.A.R. and M.T.
designed the experiments. L.H.B., M.E.S., G.A.R. and M.T. analyzed the data. L.H.B.,
M.E.S., G.A.R. and M.T. wrote the manuscript.




62
4.1. Rsum
Dans le prsent article, la synthse de 12 composs caffoyl/cinnamyl possdant des
proprits anti-inflammatoires et anti-cancreuses furent valus. Leurs synthses furent
effectues dans le but de vrifier leurs effets inhibiteurs sur la 5-lipoxygnase (5-LO)
humaines, ainsi que sur la prolifration cellulaire dans un modle cancreux (cellules
MCF7) et non cancreux (cellules MCF10A) de ligns pithliales mammaire humaine.
Les composs dimrique 13, trimrique 17 ainsi que ttramrique 19 ont tous inhibs la
production de produits de la 5-LO dans un modle de lysat cellulaire avec des IC
50

variant entre 0.66 et 0.79 M. Ces composs ont surpass lactivit inhibitrice de lacide
cafique de 10 fois (IC
50
=25 M). Le compos monomrique 11 a provoqu une
inhibition denviron 95% de la formation produits de la 5-LO et a surpass le zileuton,
seul inhibiteur de la 5-LO utilis en clinique, dans un modle cellulaire. Les composs
trimriques 15, 17 et le ttramre 19 ont inhib la prolifration cellulaire des cellules
MCF7 par 36, 23 et 47% respectivement, mais nont eu aucun effet sur la prolifration
des cellules MCF10A.




















63
4.2. Abstract
The syntheses of twelve caffeoyl/cinnamoyl clusters and their anti -inflammatory and
anti-cancer effects are described. Azide or alkyne functionalized cinnamoyl or
caffeoyl moieties are attached to the selected core molecules to allow variation of the
introduced cinnamoyl or caffeoyl moieties in order to compare their effects on
5-lipoxygenase (5-LO) inhibition and on cell proliferation in cancerous (MCF7) and
non cancerous (MCF10A) human mammary epithelial cell lines. Caffeoyl dimer 13,
trimer 17, and tetramer 19, inhibited 5-LO product synthesis in a cell-free assay with
IC
50
values ranging from 0.66 to 0.79 M. These compounds surpassed the inhibitory
activity of caffeic acid by more than 10-fold. Monomer 11 caused almost 95 %
inhibition of 5-LO and surpassed the known 5-LO inhibitor zileuton in a cell-based
assay. Trimer compounds 15, 17 and tetramer 19 decreased proliferation rates of
MCF7 cells by 36, 23 and 47%, respectively, but had no effect on MCF10A
proliferation.


















64
4.3. Introduction
Strong efforts have been made within the past years to develop potent
pharmacological agents that interfere with leukotriene (LT) biosynthesis or action (1).
To achieve reduction of LT formation, reasonable targets include phospholipase A
2

(PLA
2
) enzymes, 5-lipoxygenase (5-LO), membrane-bound 5-LO activating protein
(FLAP), LTA
4
hydrolase and LTC
4
synthase, with 5-LO being the preferred target (2).
5-LO is the key enzyme in the conversion

of arachidonic acid (AA) to the bioactive
LTs (3).

LTs are potent vasoconstrictors, but also function as pro-inflammatory
mediators by acting as chemotactic and chemokinetic agents toward granulocytes (4) .


In addition to its pro-inflammatory effects, accumulating evidence suggests a role for
the 5-LO pathway in tumor cell proliferation and survival, implying that cancer may
become a novel indication for anti- LTs therapy (5).

5-LO is overexpressed not only
in cancer cell lines but also in tissue samples of patients suffering from prostate
adenocarcinoma (6), or esophageal (7), breast

(8) and pancreatic cancer (9). The
underlying molecular mechanism of how 5-LO expression is upregulated in
transformed cells is yet unknown; however, the 5-LO product 5(S)-HETE enhanced
the growth of human pancreatic cancer cells (10), breast cancer cells (11), lung cancer
cell lines (12), and protects human prostate cancer cells from apoptosis (13).

Similarly, numerous studies have shown that the chemopreventive effect of the anti-
Steroidal Anti-inflammatory drugs (NSAIDs) on several cancers is mediated through
inhibition of cell growth and induction of apoptosis (14). Understanding the link
between carcinogenesis, inflammation

and mediators of inflammation is of
considerable interest in

order to develop prevention or treatment strategies.

LT biosynthesis inhibitors are grouped into direct 5-LO inhibitors classified as redox-
active compounds, iron-ligand inhibitors, and nonredox-type inhibitors, and into
inhibitors of FLAP (15). Several modified caffeic acid derivatives were recently
demonstrated for anti-lipoxidation and exhibited more stable characteristics (16).
Furthermore, some caffeic acid amide analogues, such as N-caffeoyl--

65
phenethylamine were reported to have inhibitory effects on prostaglandin H synthase
and have potential for the inhibition of 5-LO (17). Finally, natural phenolic acids
including caffeic acid have also been shown to possess anti -tumor and anti-
proliferative properties (18).

Multivalent interactions have several advantages over monomeric ones and are often
used by nature to control a wide variety of cellular processes (19). Several attempts to
quantify the effects of multivalent presentation have been reported (19),

but the
detailed mechanism at the molecular level still remains unclear. Dam and Brewer
recently described the potential source of the increased binding using entropic
arguments and the bind and slide model (20). Thus, we anticipated that clusters
bearing caffeic acid moieties will lead to compounds of biomedical importance.

Here we present the design and synthesis of novel caffeoyl and cinnamoyl clusters that
were recently shown to be potent inhibitors of human 5-LO (21). The compounds were
evaluated and compared for the inhibition of 5-LO activity in both a cell-free assay
utilizing crude recombinant human 5-LO expressed in HEK293 cells and a cell-based test
system using inflammatory stimulated intact HEK293 cells. Additionally, the effects of
the compounds on cell proliferation of cancerous (MCF7) and non-cancerous (MCF10A)
breast epithelial cell lines were measured.

4.4. Experimental
General: Flash chromatography was performed using Merck silica gel 60 (0.04020.063
mm, 2302400 mesh). TLC was performed on Kieselgel 60 F254 plates from Merck.
Detection was carried out under UV light or by spraying with 20% ethanolic sulfuric acid
or molybdate solution followed by heating. Infrared spectra were recorded on a Perkin-
Elmer 1600 FTIR instrument. NMR spectra were measured with a Varian 300 MHz and
Bruker Ac200 MHz spectrometers. Accurate mass measurements were performed on a
LC-MSD-TOF instrument in positive electrospray. Either protonated ions (M+nH)
n+
or
sodium adducts (M+Na)
n+
were used for empirical formula confirmation.

66
5-LO inhibition in a cell-free assay: Following lysis of HEK293 cells, 5 mM of CaCl
2

was added to cell lysates which were then preincubated with each of the test compounds
at the indicated concentration for 5 min at 37C. The 5-LO reaction was initiated with the
addition of 1 mM ATP and 40 M arachidonic acid followed by incubation at 37 C for
20 min (35). Reactions were stopped with addition of 0.5 volumes of cold
methanol:acetonitrile (1:1) and 50 ng of PGB
2
as internal standard. Samples were stored
at -20C for a minimum of 3 hours. After centrifugation to remove cell debris, samples
were then added to a preconditioned octadecyl (C18) column, were washed with 3 ml
acidified water (0.1% acetic acid) and 5-LO products were eluted with methanol. After
evaporation of solvents with nitrogen, products were resuspended in 20% methanol and
quantification of 5-LO products (5-HETE, LTB
4
and its trans isomers) by RP-HPLC with
UV detection was performed as previously described (32).

5-LO inhibtion if a cell-based assay: HEK293 cells were co-transfected with a
pcDNA3.1 vector expressing 5-LO and a pBUDCE4.1 vector expressing 5-lipoxygenase
activating protein (FLAP) using Polyfect reagent (QIAGEN, Mississauga, ON, Canada)
according to the manufacturers protocol. Stable transfections of HEK293 cells were
obtained following cell culture in the presence of Geneticin and Zeocin (Invitrogen,
Burlington, ON, Canada). For cell stimulation of 5-LO products, transfected HEK293
cells were collected following trypsinization, washed and the cell pellet was resuspended
in HBSS containing 1.6 mM CaCl
2
at a concentration of 5 x 10
5
cells/ml. Cells were pre-
incubated with each compound at the indicated concentration for 5 min at 37C. Cells
were then stimulated for 15 minutes at 37C with the addition of 10 M calcium
ionophore A23187 (Sigma-Aldrich, Oakville, ON, Canada) and 10 M arachidonic acid
(Cayman Chemical, Ann Arbor, MI). Stimulations were stopped and processed on
RP-HPLC as described in the cell-free assay.

Cell proliferation assays: Non-cancerous (MCF10A) and cancerous (MCF7) human
mammary epithelial cell lines were obtained from the American Type Culture Collection
(Rockville, MD, USA). Cell lines were maintained in DMEM media supplemented with
10% fetal bovine serum (FBS; Hyclone Laboratories, Logan, UT, USA), L-glutamine (2

67
mM), penicillin G (100 U/ml), and streptomycin (100 g/ml) (Invitrogen). Cells were
either left untreated or were incubated with 0.1 M of synthesized compounds for 4 days
prior to analysis of cell proliferation.

Cell proliferation assays were performed on seeded cells (4x104 cells/well) in 96 well
plates and analyzed for cellular viability using a multiplexed assay of CellTiter Blue
(Promega, Madison,WI) kits according to the manufacturers instructions. Briefly, 20
l of the CellTiter Blue substrate was added to 100 l of cell suspension and
incubated for 1 hour at room temperature on a plate shaker. Thereafter, the plate was
subjected to a colorimetric analysis and read on a fluorescence microplate reader
(560Ex/590Em).
4.5. Results and discussion
Strategy
A fundamental approach to synthetic, potent, and multivalent clusters bearing ligands
is the attachment of biologically active moieties to structurally simple hyper-branched
molecules. Several studies have described examples of cluster and dendrimer
syntheses using multivalent scaffolds (22). Our synthesis strategy was based on the
preparation of triazole-bearing clusters via the copper(I)-catalyzed modern version of
the classical Huisgen 1,3-dipolar cycloaddition (23).

Since the hydroxyl groups within
the caffeic acid catechol moiety may also play an important role in the inhibitory
activity, we also examined the effect of the presence of these groups by the systematic
synthesis of the cinnamoyl cluster analogs.

Synthesis
As the design of smaller molecules with high inhibitory properties would be of value,
first we report herein the synthesis of two divalent clusters bearing one or two
cinnamic or caffeic moieties for comparison purposes. All divalent targets were
designed to share common structural similarities by using a triazole core which was
generated after copper(I)-catalyzed Huisgen 1,3-dipolar cycloaddition by the
propargyl 3, 5 and azido 4, 6 esters (scheme 1).

68

















Scheme 1: Reagents and conditions: (i) SOCl
2
, reflux, 4h, pyridine, benzene , rt, 12h, 3
(83%), 4 (78%), 5 (81%), 6 (76%); (ii) CuSO
4
, ascorbic acid, THF: H
2
O, rt, 12h, 7
(69%), 8 (80%), 10 (76%), 12 (78%); (iii) K
2
CO
3
in CH
2
Cl
2
/MeOH (1:1, v/v), rt, 4h, 9
(74%), 11 (78%), 13 (82%).

As shown in scheme 1, the novel 3, 4, 5, and 6 esters were synthesized from propargyl
alcohol or azidoethanol

(24) with cinnamic or acetylated caffeic acid, in presence of
SOCl
2
and pyridine, in good yields. The corresponding triazole linked derivatives 7,
8, 10, and 12 were then obtained after copper-catalyzed cycloaddition. De-O-
acetylation in 8, 10, 12 to afford 9, 11, 13 was accomplished under catalytic
transesterification conditions (Scheme 1).

HO
N
3
OH
OH
O
R
R
1 R = H
2 R = OAc
i i
O
O
R
1
R
1
O
O
N
3
R
2
R
2
+
O
O
R
1
R
1
O
O
R
2
R
2
N
N
N
3 R
1
= H
5 R
1
= OAc
4 R
2
= H
6 R
2
= OAc
7 (3 + 4) R
1
= R
2
= H
8 (3 + 6) R
1
= H, R
2
= OAc
9 R
1
= H, R
2
= OH
10 (5 + 4) R
1
= OAc, R
2
= H
11 R
1
= OH, R
2
= H
12 (5 + 6) R
1
= OAc, R
2
=OAc
13 R
1
= OH, R
2
= OH
ii
iii
iii
iii

69
The azide functionalised pentaerythritol core 14

(25) provided, as expected, a trimeric
cluster 15 or 16 according to scheme 2. Thus, copper(I)-catalyzed 1,3-dipolar
cycloaddition with triazide 14 and alkyne 3 or 5 provided trimeric clusters 15 or 16
after circular silica gel chromatography. De-O-acetylation of the ester protecting
groups in 16 under catalytic trans-esterification conditions gave fully deprotected
cluster 17.



























Scheme 2: Reagents and conditions: (i) CuSO
4
, ascorbic acid, THF: H
2
O, rt, 12h, 15
(80%), 16 (78%); (ii) K
2
CO
3
in CH
2
Cl
2
/MeOH (1:1, v/v), rt, 4h, 17 (69%).

It is worth noting that considering the multifunctional and commercial attributes of
the pentaerythrityl starting point, it is understandable that it has been employed in a
variety of roles related to dendritic materials. These include its use as a core
component for chiral

(26) and nonchiral

(27) constructs as well as its use for both a
core and/or branch junctures (28). Thus, copper(I)-catalyzed cycloaddition between
alkyne 3 or 5 and known tetraazide 18

(25) under standard conditions (Scheme 3)
provided fully protected tetramer clusters 19 and 20 in good yields.


O
O
R
1
R
1
3 R
1
= H
5 R
1
= OAc
i
N
3
N
3
N
3
HO
N
N
N
HO
N
N
N
N
N
N
O
O
R
1
R
1
O
O
R
1
R
1
O
O
R
1
R
1
+
14
16 R
1
= OAc
17 R
1
= OH
ii
15 R
1
= H

70





Scheme 3: Reagents and conditions: (i) CuSO
4
, ascorbic acid, THF: H
2
O, rt, 12h, 19
(82%), 20 (79%); (ii) K
2
CO
3
in CH
2
Cl
2
/MeOH (1:1, v/v), rt, 4h, 21 (72%).


As observed in scheme 3, it was remarkable that the efficiency of the copper(I)-
catalyzed modern version of the classical Huisgen 1,3-dipolar cycloaddition could
provide multiple alkyne attachments in a single step reaction. Finally, complete
deprotection of the acetyl ester protecting group in 20 to afford 21 was accomplished
under catalytic transesterification conditions using K
2
CO
3
.

A retrosynthetic analysis reveals two possibilities for the synthesis of our clusters
bearing 1,2,3-triazole linkages: the azide or the alkyne functions can be located on
either the pentaerythritol core or on the caffeic or cinnamic moiety. Thus, treatment
of known tetrakis(2- propynyloxymethyl)methane 22

(29) with azides 4 or 6 using the
same Cu(I) catalysed cycloadditions described above, provided tetramers 23 and 24 in
good yields. As shown in scheme 4, complete deprotection of protecting group in 24

71
to afford 25 was accomplished with standard catalytic transesterification conditions
(Scheme 4).





Scheme 4: Reagents and conditions: (i) CuSO
4
, ascorbic acid, THF: H
2
O, rt, 12h, 23
(82%), 24 (75%); (ii) K
2
CO
3
in CH
2
Cl
2
/MeOH (1:1, v/v), rt, 4h, 25 (69%).


The syntheses of new kinds of clusters that will open the route to novel libraries
exhibiting varied active molecules should offer new opportunities for a better
understanding of multivalent processes. In line with this idea, we report herein the
synthesis of hexameric clusters 27 and 29 assembled using hexaazide 26

(30) as
central core (Scheme 5).



72
























Sche
me
5:
Reag
ents and conditions: (i) CuSO
4
, ascorbic acid, THF: H
2
O, rt, 12h, 27 (82%), 28 (78%);
(ii) K
2
CO
3
in CH
2
Cl
2
/MeOH (1:1, v/v), rt, 4h, 29 (69%).


Introduction of the six cinnamoyl or caffeoyl groups was achieved by a multiple
copper(I)-catalyzed 1,3-dipolar cycloaddition, as described above, with azide 26 and
alkyne 3 or 5 to provide the hexameric clusters 27 and 28 in good yield. The
subsequent deacetylation conditions in cluster 28 gave the hexameric cluster 29.
(scheme 5).

The chemical structures of all intermediates and clusters were confirmed with NMR
(
1
H,
13
C) and HR-MS. As expected, integration of the triazole proton (7-8 ppm) was
always equal to the integral of the -carbonyl vinylic proton (5.5-6 ppm) in our
clusters which confirms the multiple alkyne or azide attachments.


O
O
R
1
R
1
+
3 R
1
= H
5 R
1
= OAc
O
N
3
N
3
N
3
N
3
N
3
N
3
i
O
N
N
N
N
N
N
N
N
N
N
N
N
N
N
N
N
N
N
O
O R
1
R
1
O
O R
1
R
1
O
O
R
1
R
1
O
O
R
1
R
1
O
O
R
1
R
1
O
O
R
1
R
1
28 R
1
= OAc
29 R
1
= OH
ii
27 R
1
= H
26

73
Inhibition of 5-LO
The clusters prepared in this study displayed some structural differences that are
governed by the pentaerythritol and bis-pentaerythritol scaffolds as well as by the
number of cinnamoyl/caffeoyl units and their relative orientation. These disparities
offer a unique opportunity to estimate and compare their 5-LO inhibitory activities in
both cell-free and cell-based assays. As previously described, measurement of 5-LO
activity in cell lysates showed that clusters bearing the cinnamic acid moiety 7, 15,
19, 23, and 27, showed less inhibitory activity than the corresponding clusters bearing
the caffeic acid moiety 9, 11, 13, 17, 21, 25, and 29 (Fig. 4.1) (21). This reinforces the
pharmacophoric contribution of the catechol entity to the mechanism of action against
5-LO activity.

Figure 4.1: 5-LO activity in cell lysates preincubated with the different test
compounds (1M)

In concentration-response studies, four selected compounds showed concentration-
dependent inhibition of 5-LO product synthesis with IC
50
values below 1 M (9: 0.68
M, 13: 0.74 M, 17: 0.79 M, 21: 0.66 M) (21), that were comparable to the
inhibitory activity of zileuton (fig. 4.2, IC
50
= 0.51 M (31)).

74




Figure 4.2: Zileuton structure

On the basis of corrected values on a per caffeoyl residue, dimer 13, trimer 17, and
tetramer 21, readily surpassed the activity of caffeic acid (IC
50
= 25 M) by more than
10-fold.

The inhibitory capacities of these compounds were then evaluated in intact HEK293
cells. Cells were pre-incubated with the prepared compounds, were then stimulated
and the resulting biosynthesis of 5-LO products was measured as described in the
experimental section. As shown in figure 4.3, compound 9 caused no inhibition of 5-
LO activity whereas the corresponding isomer 11 caused almost complete 5-LO
inhibition at 10 M, and was more effective than the known 5-LO inhibitor zileuton
(31). The main difference between the two compounds resides in the presence of a
single methylene between the caffeoyl moiety and the triazole core in 11 and the two
methylene bridge in 9. Possibly, the more flexibility in 9 causes a loss in the ability to
suppress cellular 5-LO product synthesis, which does not apply to 5-LO inhibition in
cell-free assays.



75

Figure 4.3: 5-LO activity in intact cells preincubated with the different test
compounds (10 M).

The dimer 13 and trimer 15 were approximately equivalent to zileuton and were more
effective inhibitors of 5-LO activity compared to caffeic acid itself. However, there
were some marked differences between the two assay systems used to evaluate 5-LO
inhibition. As shown in Figure 4.3, compound 17 was not effective in intact HEK293
cells but significantly suppressed 5-LO activity in cell-free assays (fig. 4.1). Such
differences in the potencies of 5-LO inhibitors depending on the assay conditions
and/or experimental settings are frequently observed (32). Inhibition tests with
diacetylated precursors of molecules 9 and 11 (8 and 10) resulted in the complete
inhibition of 5-LO metabolites in intact cells. These results could suggest that
molecules 8 and 10 infiltrate into intact cells more efficiently than 9 and 11, resulting
in a more efficient inhibition of 5-LO following esterase action, or a possible
interference with 5-LO associated proteins (e.g. coactosin-like protein or FLAP).


76
Cell proliferation assay
Commonly used mammary epithelial cell models were utilized to investigate anti-
proliferative properties of the prepared compounds as well as their potential
selectivity for cancerous cells compared to immortalized non-cancerous cells (Fig. 4.4
and 4.5). Cell proliferation of a breast cancer (MCF7) and a non-cancerous cell line
(MCF10A) were measured after incubation for 4 days in the presence or absence of
the prepared compounds. All compounds were without effect on the growth profiles
of the MCF10A non-cancerous cell line in relation to the untreated control. In
contrast, the MCF7 breast cancer cell line demonstrated more sensitivity to the
various treatments.

Figure 4.4: Relative growth rates of the non-cancerous breast epithelial cell line
MCF10A incubated with different test compounds (0.1 M).

Growth induction MCF7 was measured in response to caffeic acid and compounds 11
and 13. However, treatments with compounds 15, 17 and 19 decreased proliferation
rates by 36, 31 and 47%, respectively, in comparison to untreated MCF7 cells. All
other compounds tested did not have any significant effect on the viability of either

77
MCF10A or MCF7 cells. This result is highly encouraging since selective toxicity or
growth inhibition toward cancerous compared to non-cancerous cells is a crucial
characteristic of compounds in the development of anti-cancer drugs.


Figure 4.5: Relative growth rates of the cancerous breast epithelial cell line
MCF7 incubated with different test compounds (0.1 M).

4.6. Conclusions
In conclusion, we have synthesized and tested a series of new compounds for the
inhibition of 5-LO and for anti-proliferative activity. We showed that clusters with
one and four caffeic acid moieties act as novel and potent inhibitors of 5-LO product
synthesis in intact stimulated HEK293 cells. Although the biochemical mechanisms
by which these compounds suppress cellular 5-LO product biosynthesis are not
entirely clear. Previous studies have suggested that phenolic compounds possessing
the most potency in inhibiting 5-LO are those with catechol functions (33), The

78
mechanisms by which these compounds act have not been elucidated but could
include interception of the arachidonoyl peroxy radical, the binding of iron ions
and/or their reduction to the catalytically inactive ferrous form. Nevertheless, the
effectiveness of the present compounds in intact cells is promising and encourages
further investigations of their anti-inflammatory effects. In addition, trimer and
tetramer compounds were identified that present a significant effect on the viability of
the cancerous epithelial breast cell line MCF7, but which were without effect on the
viability of the non-cancerous breast cell line MCF10A. Although MCF7 cells have
been shown produce leukotrienes (34), it would be premature to suggest that the
inhibitory effects of these compounds on 5-LO are related to their anti-prolifertive
properties.















79
4.7. References
1. (a) I. M. Adcock, G. Caramori, and K. F. Chung, Lancet 2008, 372: 1073; (b) A.
W. Ford-Hutchinson, M. Gresser, and R. N. Young, Annu. Rev. Biochem. 1994,
63, 383.
2. (a) B. Samuelsson, S. E. Dahlen, J. A. Lindgren, C. A. Rouzer, and C. N. Serhan,
Science 1987, 237, 1171; (b) V. E. Steele, C. A. Holmes, E. T. Hawk, L.
Kopelovich, R. A. Lubet, J. A. Crowell, C. C. Sigman, and G. J. Kelloff, Cancer
Epidemiol. Biomarkers Prev. 1999, 8, 467.
3. O. Werz, Curr. Drug Targets Inflamm. Allergy 2002, 1, 23; (b) M. Peters-Golden,
and W. R. Henderson, N. Engl. J. Med. 2007, 357, 1841.
4. (a) R. Spanbroek, and A. Habenicht, J. Drug News Perspect. 2003, 16, 485; (b) H.
Hakonarson, J. R. Gulcher, and K. Stefansson, Nat. Genet. 2004, 36, 233; (c) M.
Romano, and J. Claria, FASEB J. 2003, 17, 1986. (d) A. L. Maycock, S. S. Pong,
J. F. Evans, and D. K. Miller, Biochemistry of the lipoxygenase pathways. In
Leukotrienes and Lipoxygenases; J. Rokach, , Ed.; Elsevier Science: New York,
1989; pp 143-208.
5. M. J. Thun, S. J. Henley, and C. Patrono, J. National Cancer Institute, 2002, 94,
252.
6. S. Gupta, M. Srivastava, N. Ahmad, K. Sakamoto , D. G. Bostwick, and H.
Mukhtar, Cancer 2001, 91, 737.
7. A. Hoque, S. M. Lippman, T. T. Wu, Y. Xu, Z. D. Liang, S. Swisher, H. Zhang,
L. Cao, J. A. Ajani, and X.-C. Xu Carcinogenesis 2005, 26, 785.
8. W. G. Jiang, A. G. Douglas-Jones, and R. E. Mansel, Prostaglandins Leukot
Essent Fatty Acids 2005, 74, 125.
9. R. Hennig, P. Grippo, X. Z. Ding, S. M. Rao, M.W. Buchler, H. Friess, M. S.
Talamonti, R. H. Bell, and T. E. Adrian, Cancer Res. 2005, 65, 6011.
10. (a) X. Z. Ding, P. Iversen, M. W. Cluck, J. A. Knezetic, and T. E. Adrian,
Biochem. Biophys. Res. Commun. 1999, 261, 218. (b) X. Z. Ding, W. G. Tong,
and T. E. Adrian, Oncology 2003, 65, 285.
11. I. Avis, S. H. Hong, A. Martinez, T. Moody, Y. H. Choi, J. Trepel, R. Das, M. J
ett, and J. L. Mulshine, FASEB J. 2001, 15, 2007.

80
12. I. M. Avis, M. Jett, T. Boyle, M. D. Vos, T. Moody, A. M. Treston, A. Martnez,
J. L. Mulshine, J. Clin. Invest., 1996, 97, 806.
13. (a) J. Ghosh, and C. E. Myers, Biochem. Biophys. Res. Commun. 1997, 235, 418;
(b) J. Ghosh, and C. E. Myers, Proc. Natl. Acad. Sci. U S A, 1998, 95, 13182.
14. (a) F. Guadagni, P. Ferroni, R. Palmirotta, G. Del Monte, V. Formica, and M.
Roselli, Anticancer resea., 2007, 27, 3147; (b) C. Siemes, L. E. Visser, J. W. W.
Coebergh, A. Hofman, A. G. Uitterlinden, and B. H. Ch. Stricker, Curr. Canc.
Drug Targ. 2008, 8, 753.
15. (a) S. E. Dahlen, Eur. J. Pharmacol. 2006, 533, 40; (b) B. D. Levy, N. W. Lukacs,
A. A. Berlin, B. Schmidt, W. J. Guilford, C. N. Serhan, and J. F. Parkinson,
FASEB J. 2007, 21, 3877; (c) M. Peters-Golden, and W. R. Jr. Henderson, N.
Engl. J. Med. 2007, 357, 1841.
16. P. Rajan, I. Vedernikova, P. Cos, D. V. Berghe, K. Augustyns, and
A. Haemers, Bioorg. Med. Chem. Lett. 2001, 11, 215.
17. C. F. Tseng, S. Iwakama, A. Mikajiri, M. Shibuya, F. Hanaoka, Y. Ebizuka, K.
Padmawinata, and U. Sankawa, Chem. Pharm. Bull. 1992, 40, 396.
18. (a) H. K. Obied, P. D. Prenzler, I. Konczak, A. U. Rehman, K. Robards, Chem.
Res. Toxicol. 2009, 22, 227.; (b) M. T. Huang, R. C. Smart, C. Q. Wong, A. H.
Conney, Cancer Res. 1988, 48, 5941; (c) T. W. Chung, S. K. Moon, Y. C. Chang,
J. H. Ko, Y. C. Lee, G. Cho, S. H. Kim, J. G. Kim, C. H. Kim, FASEB J. 2004,
18, 1670.
19. (a) M. Mammen, S .-K. Choi, and G . M. Whitesides, Angew. Chem. Int. Ed.
1998, 37, 2754; (b) L. L. Kiessling, J. E. Gestwicki, and L. E. Strong, Angew.
Chem. Int. Ed. 2006, 45, 2348.
20. T. K. Dam, and C. F. Brewer, Biochemistry 2008, 47, 8470.
21. J. Doiron, L. H. Boudreau, N. Picot, B. Villebonet, M. E. Surette, M. Touaibia,
Bioorg. Med. Chem. Lett. 2009, 19, 1118.
22. (a) D. Huang, U. Lthi, P. Kolb, K. Edler, M. Cecchini, S. Audetat, A. Barberis,
and A. Caflisch, J. Med. Chem., 2005, 48 5108; (b) B. Bayard, C. Bisbal, and B.
Lebleu, Biochemistry, 1986, 25 3730; (c) I. J. Majoros, T. P. Thomas, C. B.
Mehta, and J. R. Baker Jr., J. Med. Chem. 2005, 48, 5892; (d) T. P. Thomas, I. J.

81
Majoros, A. Kotlyar, J. F. Kukowska-Latallo, A. Bielinska, A. Myc, and J. R.
Baker Jr., J. Med. Chem., 2005, 48, 3729; (e) H. Xu, K. Baidoo, A. J. Gunn, C. A.
Boswell, D. E. Milenic, P. L. Choyke, and M. W. Brechbiel, J. Med. Chem., 2007,
50, 4759.; (f) M. Touaibia, and R. Roy, Mini-Reviews in Medicinal Chemistry,
2007, 7, 1270.
23. For recent reviews on the Huisgen 1,3-dipolar cycloaddition reaction see M.
Meldal, and C. W. Torne, Chem. Rev. 2008, 108, 2952.
24. R. H. Smith, A. F. Mehl, D. L. Shantz, G. N. Chmurny, and C. J. Michejda, J.
Org. Chem. 1988, 53, 1467.
25. (a) E. R. Wilson, and M. B. Frankel, J. Org. Chem. 1985, 50, 3211; (b) W. Hayes,
H. M. I. Osborn, S. D. Osborne, R. A. Rastall, and B. Romagnoli, Tetrahedron
2003, 59, 7983.
26. (a) V. Lellek, and I. Stibor, J. Mater. Chem. 2000, 10, 1061. (b) M. S.
Shchepinov, K. U. Mir, J. K. Elder, M. D. Frank- Kamenetskii, and E. M.
Southern, Nucleic Acids Res. 1999, 27, 3035.
27. (a) G. R. Newkome, B. D. Woosley, E. He, C. N. Moorefield, R. Gther, G.R.
Baker, G. H. Escamilla, J. Merrill, and H. Luftmann, Chem. Commun. 1996,
2737. (b) A. Halabi, and M. C. Strumia, J. Org. Chem. 2000, 65, 9210.
28. (a) A. B. Padias, H. K. Hall, D. A. Tomalia, and J. R. McConnell, J. Org. Chem.
1987, 52, 5305. (b) J.-J. Lee, W. T. Ford, J. A. Moore, and Y. Li, Macromolecules
1994, 27, 4632. (c) G. Jayaraman, Y.-F. Li, J. A. Moore, S. M. Cramer, J.
Chromatogr. A 1995, 702, 143.
29. S. E. Korostova, A. I. Mikhaleva, S. G. Shevchenko, L. N. Sobenina, V. D.
Feldman and N. I. Shishov, Zh. Prikl. Khim., 1990, 63, 234.
30. M. Touaibia, A. Wellens, T. C. Shiao, Q. Wang, S. Sirois, J. Bouckaert, and R.
Roy, ChemMedChem 2007, 2, 1190.
31. G. W. Carter, P. R. Young, D. H. Albert, J. Bouska, R. Dyer, R. L. Bell, J. B.
Summers, and D. W. Brooks, J. Pharmacol. Exp. Ther. 1991, 256, 929.
32. (a) O. Werz, Planta Med. 2007, 73, 1331; (b) O. Werz, D. Steinhilber, Biochem.
Pharmacol. 2005, 70, 327.

82
33. M. J. Laughton, P. J. Evans, M. A. Moroney, J. R. Hoult, and B. Halliwell,
Biochem. Pharmacol. 1991, 42, 1673.
34. A. Przylipiak, J. Hafner, J. Przylipiak, B. Runnebaum, T. Rabe and F. M. Khn,
Eur. J. Obstet. Gynecol. Reprod. Biol. 1998, 77, 61
35. (a) O. Werz, D. Szellas, and D. Steinhilber, Eur. J. Biochem. 2000, 267, 1263; (b)
P. Borgeat, S. Picard, P. Vallerand, S. Bourgoin,; A. Odeimat, P. Sirois, and P. E.
Poubelle, Methods Enzymol. 1990, 187, 98.
36. H. Akita, M. Nozawa, A. Mitsuda, and H. Ohsawa, Tetrahedron: Asymmetry
2000, 11, 1375.


4.8. Acknowledgements
This research was financially supported by the New Brunswick Innovation
Foundation, The Medical Research Fund of New Brunswick and the Canada Research
Chairs Program. L.H.B is a recipient of ``Fonds de recherches sur l'arthrite et les
maladies rhumatismales`` award from Universit Laval (Quebec).

4.9. Annexe
Syntheses
Procedure 1: ester derivatives sythesis. A mixture of cinnamic or diacetylcaffeic
acid,
36
5 mL of thionyl chloride, and two drops of DMF was heated at reflux for 4h.
The excess thionyl chloride was removed on a Rotovap, and the residue was dissolved
in 4 mL of dry benzene. To this solution was slowly added 1 mL of pyridine and the
approriate alcohol derivative (1.2 eq). The resulting mixture was stirred overnight at
room temperature. After removal of solvents, the residue was disolved in
dichloromethane (25 mL), the organic extract was washed with water (2 x 20 mL),
brine (2 x 20 mL), and then dried over MgSO
4
. The residue was then purified by silica
gel circular chromatography (chromatotron, model 7924, Harrison Research) to
afford the required ester derivative.


83
Procedure 2: click reaction catalyzed by CuSO
4
. To a magnetically stirred solution of
azide (1 eq) and propargyl derivative (1.2 eq), dissolved in a 1:1 mixture of water and
THF (3 mL), were sequentially added CuSO
4
(5% per azide), and ascorbic acid (5%
per azide). The mixture was stirred for about 12h until disappearance of the starting
material (TLC, 5% MeOH/CH
2
Cl
2
). After addition of water (15 mL), the crude
reaction was repeatedly extracted with ethyl acetate (4 x 10 mL). The combined
organic extracts were washed with saturated NH
4
Cl (2 x 20 mL), brine (2 x 20 mL),
and then dried over MgSO
4
. The residue was then purified by silica gel circular
chromatography (chromatotron, model 7924, Harrison Research) to afford the
required triazole derivative.

Procedure 3: de-O-acetylation. To a solution of acetylated triazole derivative in a 1:1
mixture of MeOH and CH
2
Cl
2
(5 mL) was added K
2
CO
3
(1.5 eq per OAc). The
reaction mixture was stirred for 5 h. After removal of solvents, the residue was
disolved in EtOAc (25 mL), washed with brine, dried over MgSO
4
, concentrated, and
purified by silica gel circular chromatography (chromatotron, model 7924, Harrison
Research) to afford the required free hydroxyl derivative.

Compound 3: procedure 1. Cinnamic acid (2.17 g, 0.014 mol, 1 eq), thionylchloride
(5 mL), pyridine (1 mL), propargyl alcohol (0.98 g, 0.017 mol), and benzene (10 mL)
were used. Ester 3 (2.26 g, 0.012 mol, 83%) was obtained after silica gel circular
chromatography (2% EtOAc-Hex) as a colorless oil ;
1
H NMR (CDCl
3
): 7.75 (d,
1H, J = 18.6 Hz, =CHCar), 7.60-7.51 (m, 2H, H
ar
), 7.48-7.35 (m, 3H, H
ar
), 6.45 (d,
1H, J = 18.6 Hz, =CHCO), 4.82 (d, 2H, J = 2.3 Hz, CH
2
CCH), 2.53 (t, 1H, J = 2.3
Hz, CH
2
CCH);
13
C NMR (CDCl
3
): 166.0, 145.4, 134.2, 130.6, 128.9, 128.2, 117.0,
77.8, 74.9, 52.0; HRMS m/z calcd for C
12
H
10
O
2
+ (H
+
): 187.0759; found: 187.0754.

Compound 4: procedure 1. Cinnamic acid (500 mg, 3.37 mmol, 1 eq),
thionylchloride (5 mL), pyridine (1 mL), 2-azidoethanol (353 mg, 4.05 mol), and
benzene (10 mL) were used. Ester 4 (570 mg, 2.63 mmol, 78%) was obtained after
silica gel circular chromatography (2% EtOAc-Hex) as a yelow oil ; IR (cm
-1
) :

84
2110.9 (N
3
);
1
H NMR (CDCl
3
) : 7.53 (d, 1H, J = 19.1 Hz, =CHC
ar
), 7.45 (m, 5H,
H
ar
), 6.45 (d, 1H, J = 19.1 Hz, = CHCO), 4.38 (t, 2H, J = 4.7 Hz, CH
2
OCO), 3.53 (t, J
= 4.7 Hz, 2H, CH
2
N
3
);
13
C NMR (CDCl
3
), 166.5, 145.8, 134.2, 130.5, 128.9, 128.2,
117.2, 63.1, 49.9 ; HRMS m/z calcd for C
11
H
11
O
2
N
3
+ (H
+
): 218.0929; found:
218.0922.

Compound 5: procedure 1. Diacetylcaffeic acid (1 g, 3.78 mmol, 1 eq),
thionylchloride (5 mL), pyridine (1 mL), propargyl alcohol (254.6 mg, 4.54 mmol),
and benzene (10 mL) were used. Ester 5 (923 mg, 3.05 mmol, 81%) was obtained
after silica gel circular chromatography (10% EtOAc-Hex) as a colorless oil
1
H NMR
(CDCl
3
): 7.68 (d, 1H, J = 18.7 Hz, =CHCar), 7.44-7.31 (m, 2H, H
ar
), 7.23 (d, 1H, J
= 6.1 Hz, H
ar
), 6.43 (d, 1H, J = 18.7 Hz, =CHCO), 4.78(d, 2H, J = 2.3 Hz, CH
2
CCH),
2.51 (t, 1H, J = 2.3 Hz, CH
2
CCH), 2.33 (s, 6H, 2 x OAc);
13
C NMR (CDCl
3
): 168.0,
167.9, 143.9, 142.5, 132.9, 126.5, 123.9, 122.8, 118.2, 86.4, 77.7, 52.1, 20.6 ; HRMS
m/z calcd for C
16
H
14
O
6
+ (H
+
): 303.0868; found: 303.0863.

Compound 6: procedure 1. Diacetylcaffeic acid (2 g, 7.57 mmol, 1 eq),
thionylchloride (5 mL), pyridine (1 mL), 2-azidoethanol (792 mg, 9.08 mmol), and
benzene (10 mL) were used. Ester 6 (1.91 g, 5.73 mmol, 76%) was obtained after
silica gel circular chromatography (10% EtOAc-Hex) as a white solid; mp 71-73
o
C ;
1
H NMR (CDCl
3
) : 7.7 (d, 1H, J = 19.1 Hz, =CHC
ar
), 7.52-7.38 (m, 2H, H
ar
), 7.24
(d, 1H, J = 8.6 Hz, H
ar
), 6.53 (d, , 1H, J = 19.1 Hz, =CHCO), 4.42 (t, 2H, J = 4.77 Hz,
CH
2
OCO), 3.56 (t, 2H, J = 4.77 Hz, CH
2
N
3
), 2.34 (s, 6H, 2 x OAc) ;
13
C NMR
(CDCl
3
), 168.0, 167.9, 166.1, 143.8, 143.7, 142.4, 133.0, 126.5, 123.9, 122.8, 118.4,
63.2, 49.8, 20.6,; HRMS m/z calcd for C
15
H
15
O
6
N
3
+ (H
+
): 334.1039; found:
334.1033.

Compound 7: procedure 2. Alkyne 3 (228 mg, 1.22 mmol, 1.2 eq), azide 4 (202 mg,
0.93 mmol, 1eq), CuSO
4
(11.6 mg, 0.05 mmol), ascorbic acid (8.2 mg, 0.05 mmol),
THF (1.5 ml), and H
2
O (1.5 ml) were used. Triazole derivative 7 (260 mg, 0.65 mmol,
69%) was obtained after silica gel circular chromatography (2% MeOH-CH
2
Cl
2
) as a

85
white solid; mp 104-105
o
C;
1
H NMR (CDCl
3
) : 7.77 (s, 1H, =CHN), 7.66 (d, 2H, J
= 19.1 Hz, =CHC
ar
), 7.60-7.25 (m, 10H, H
ar
), 6.45 (d, 2H, J = 19.1 Hz, =CHCO), 5.44
(s, 2H, CH
2
OCO), 4.72-4.70 (m, 2H, NCH
2
CH
2
O), 4.62-4.66 (m, 2H, NCH
2
CH
2
O);
13
C NMR (CDCl
3
) : 166.7, 166.2, 146.1, 145.5, 143.2, 134.2, 133.9, 130.6, 130.4,
128.9, 128.8, 128.2, 128.1, 124.6, 117.4, 116.7, 62.4, 57.6, 49.2; HRMS m/z calcd for
C
23
H
21
O
6
N
3
+ (H
+
): 404.1610; found: 404.1603.

Compound 8: procedure 2. Alkyne 3 (225 mg, 1.2 mmol, 1.2 eq), azide 6 (336 mg, 1
mmol, 1eq), CuSO
4
(12.5 mg, 0.05 mmol), ascorbic acid (8.8 mg, 0.05 mmol), THF
(1.5 ml), and H
2
O (1.5 ml) were used. Triazole derivative 8 (416 mg, 0.8 mmol, 80%)
was obtained after silica gel circular chromatography (5% MeOH-CH
2
Cl
2
) as a white
solid; mp 124-126
o
C;
1
H NMR (CDCl
3
) : 7.81ppm (s, 1H, =CHN), 7.73 (d, 1H, J =
19.1 Hz, =CHC
ar
), 7.64 (d, 1H, J = 19.1 Hz, =CHC
ar
), 7.50-7.32 (m, 7H, H
ar
), 7.21 (d,
1H, J = 9.1 Hz, H
ar
), 6.44 (d, 1H, J = 19.1 Hz, =CHCO), 6.36 (d, 1H, J = 19.1 Hz,
=CHCO), 5.48 (s, 2H, CH
2
OCO), 4.80-4.70 (m, 2H, NCH
2
CH
2
O), 5.20-5.10 (m, 2H,
NCH
2
CH
2
O), 2.30 (s, 6H, 2 x OAc);
13
C NMR (CDCl
3
) : 167.8, 166.7, 165.8, 145.6,
144.2, 143.8, 143.273, 142.5, 134.2, 132.8, 130.4, 128.1, 126.6, 124.6, 124.0, 122.9,
117.9, 117.4, 62.5, 57.6, 49.2, 20.6; HRMS m/z calcd for C
27
H
25
O
8
N
3
+ (H
+
):
520.1719; found: 520.1712.

Compound 9: procedure 3. Triazole 8 (200 mg, 0.38 mmol), K
2
CO
3
(160 mg, 1.15
mmol), MeOH (2.5 mL), and CH
2
Cl
2
(2.5 mL) were used. The free hydroxyl
derivative 9 (124 mg, 0.28 mmol, 74%) was obtained after silica gel circular
chromatography (10% MeOH-CH
2
Cl
2
) as a white solid; mp 144-146
o
C;
1
H NMR
(DMSO-d
6
) : 8.28 (s, 1H, =CHN), 6.68 (d, 1H, J = 19.1 Hz, =CHC
ar
), 7.55 (d, 1H, J =
19.1 Hz, =CHC
ar
), 7.52-7.28 (m, 5H, H
ar
), 7.21 (br s, 1H, H
ar
), 7.08 (d, 1H, J = 8.7
Hz, Har), 6.86 (d, 1H, J = 8.7 Hz, Har), 6.51 (d, 1H, J = 19.1Hz, =CHCO), 6.28 (d,
1H, J = 19.1 Hz, =CHCO), 5.29 (s, 2H, CH
2
OCO), 4.80 (t, 2H, J = 4.7 Hz,
NCH
2
CH
2
O), 4.60 (t, 2H, J = 4.7 Hz, NCH
2
CH
2
O);
13
C NMR (DMSO-d
6
): 166.9,
166.8, 148.9, 146.5, 146.3, 145.8, 143.5, 135.2, 131.2, 129.7, 129.0, 127.4, 125.8,
122.7, 118.5, 116.3, 115.3, 114.8, 63.1, 61.4, 58.2, 49.8; HRMS m/z calcd for

86
C
23
H
21
O
6
N
3
+ (H
+
): 436.1508; found: 436.1502.

Compound 10: procedure 2. Alkyne 5 (125 mg, 0.41 mmol, 1.2 eq), azide 4 (75 mg,
0.34 mmol, 1 eq), CuSO
4
(5 mg, 0.02 mmol), ascorbic acid (4 mg, 0.02 mmol), THF
(1.5 ml), and H
2
O (1.5 ml) were used. Triazole derivative 10 (136 mg, 0.26 mmol,
76%) was obtained after silica gel circular chromatography (5% MeOH-CH
2
Cl
2
) as a
white solid; mp 125-126
o
C;
1
H NMR (CDCl
3
) : 7.82 (s, 1H, =CHN), 7.68 (d, 1H, J
= 19.1 Hz, 1H, =CHC
ar
), 7.53 (d, 1H, J = 19.1 Hz, 1H, =CHC
ar
), 7.51-7.29 (m, 8H,
H
ar
), 6.47 (d, J = 19.1 Hz, 1H, HC=CH
ar
), 6.33 (d, J = 19.1 Hz, 1H, =CHCO), 5.37 (s,
2H, CH
2
OCO), 4.75-4.66 (m 2H, NCH
2
CH
2
O), 4.58-4.49 (m 2H, NCH
2
CH
2
O), 2.31
(s, 6H, 2 x OAc);
13
C NMR (CDCl
3
) : 168.0, 167.9, 166.3, 166.2, 146.1, 143.6,
143.5, 142.1, 133.4, 132.9, 130.9, 128.7, 128.9, 126.2, 124.3, 123.7, 122.9, 118.8,
116.6, 85.7, 62.4, 57.7, 49.2, 20.6, 20.5; HRMS m/z calcd for C
27
H
25
O
8
N
3
+ (H
+
):
520.1503; found: 520.1502.

Compound 11: procedure 3. Triazole 10 (102 mg, 0.19 mmol), K
2
CO
3
(81 mg, 0.6
mmol), MeOH (2.5 mL), and CH
2
Cl
2
(2.5 mL) were used. The free hydroxyl
derivative 11 (66.5 mg, 0.15 mmol, 78%) was obtained after silica gel circular
chromatography (10% MeOH-CH
2
Cl
2
) as a colorless oil;
1
H NMR (DMSO-d
6
) :
8.19 (s, 1H, NCH=C), 7.68 (d, 1H, J = 18.2 Hz, =CHC
ar
), 7.64 (d, 1H, J = 18.1 Hz,
=CHC
ar
), 7.60-7.38 (m, 5H, H
ar
), 7.22-7.18 (m, 1H, Har), 7.01 (d, 1H, J = 9.2 Hz,
H
ar
), 6.84 (d, 1H, J = 9.2 Hz, H
ar
), 6.55 (d, J = 19.1 Hz, 1H, =CHCO), 6.29 (d, J =
19.1 Hz, 1H, =CHCO), 5.29 (s, 2H, CH
2
OCO), 4.86 (t, J = 4.8 Hz, 1H, NCH
2
CH
2
O),
4.63 (t, J = 4.8 Hz, 1H, NCH
2
CH
2
O);
13
C NMR (DMSO-d
6
) : 167.2, 166.6, 148.9,
146.3,146.1, 143.8, 135.2, 131.3, 129.8, 129.1, 127.5, 125.7, 122.6, 118.3, 116.3,
115.2, 115.0, 63.3, 58.0, 49.8; HRMS m/z calcd for C
23
H
21
O
6
N
3
+ (H
+
): 436.1508;
found: 436.1500.

Compound 12: procedure 2. Alkyne 5 (138 mg, 0.45 mmol, 1.2 eq), azide 6 (127
mg, 0.38 mmol, 1eq), CuSO
4
(12.5 mg, 0.05 mmol), ascorbic acid (8.8 mg, 0.05
mmol), THF (1.5 ml), and H
2
O (1.5 ml) were used. Triazole derivative 12 (189 mg,

87
0.29 mmol, 78%) was obtained after silica gel circular chromatography (10% MeOH-
CH
2
Cl
2
) as a white solid; mp 152-154
o
C
1
H NMR (CDCl
3
) : 7.81 (s, 1H, =CHN),
7.65 (d, 2H, J = 19.1 Hz, =CHC
ar
), 7.46-7.28 (m, 4H, H
ar
), 7.25-7.12 (m, 2H, H
ar
),
6.39 (d, 2H, J = 19.1 Hz, =CHCO), 5.38 (s, 2H, CH
2
OCO), 4.72-4.70 (m, 2H,
NCH
2
CH
2
O), 4.60-4.64 (m, 2H, NCH
2
CH
2
O), 2.30 (s, 12H, 4 x OAc);
13
C NMR
(CDCl
3
), 168.0, 167.9, 166.3, 165.8, 144.1, 143.8, 143.6, 143.5, 143.0, 142.5, 142.4,
132.9, 132.7, 126.5, 126.4, 124.7, 124.0, 123.9, 122.9, 122.8, 118.6, 117.9, 62.5, 57.7,
49.2, 20.6, 20.5; HRMS m/z calcd for C
31
H
29
O
12
N
3
+ (H
+
): 636.1824; found:
636.1818.

Compound 13: procedure 3. Triazole 12 (185 mg, 0.29 mmol), K
2
CO
3
(240 mg,
1.74 mmol), MeOH (2.5 mL), and CH
2
Cl
2
(2.5 mL) were used. The free hydroxyl
derivative 13 (110 mg, 0.23 mmol, 82%) was obtained after silica gel circular
chromatography (16% MeOH-CH
2
Cl
2
) as a white solid; mp 102-105
o
C;
1
H NMR
(DMSO-d
6
) : 8.07 (s, 1H, =CHN), 7.56 (d, 2H, J = 19.1 Hz, =CHC
ar
), 7.25 (d, 2H, J
= 3.4 Hz, H
ar
), 6.93 (td, 2H, J = 8.7, 3.4 Hz, Har), 6.83 (d, 2H, J = 8.7 Hz, H
ar
), 6.30
(d, 2H, J = 19.1 Hz, =CHCO), 5.28 (s, 2H, CH
2
OCO), 4.79 (t, 2H, J = 4.7 Hz,
NCH
2
CH
2
O), 4.55 (t, 2H, J = 4.7 Hz, NCH
2
CH
2
O);
13
C NMR (DMSO-d
6
) : 167.2,
166.9, 148.9, 148.8, 146.5, 146.2, 143.7, 127.4, 125.7, 122.7, 122.6, 116.3, 115.3,
115.2, 115.1, 114.8, 63.1, 57.9, 49.8; HRMS m/z calcd for C
23
H
21
O
8
N
3
+ (H
+
):
468.1406; found: 468.1401.

Compound 15: procedure 2. Alkyne 3 (222 mg, 1.2 mmol, 1.2 eq), triazide 14 (70
mg, 0.33 mmol, 1eq), CuSO
4
(12.5 mg, 0.05 mmol), ascorbic acid (8.8 mg, 0.05
mmol), THF (1.5 ml), and H
2
O (1.5 ml) were used. Triazole derivative 15 (204 mg,
0.26 mmol, 80%) was obtained after silica gel circular chromatography (1.5% MeOH-
CH
2
Cl
2
) as a white solid; mp 90-92
o
C;
1
H NMR (CDCl
3
): 8.28 (s, 3H, =CHN), 7.64
(d, 3H, J = 18.6 Hz, =CHCar), 7.52-7.46 (m, 6H, H
ar
), 7.38-7.29 (m, 9H, H
ar
), 6.43 (d,
3H, J = 18.6 Hz, =CHCO), 5.36 (s, 6H, CH
2
OCO), 4.38 (s, 6H, NCH
2
), 3.22-3.11 (m,
2H, CH
2
OH);
13
C NMR (CDCl
3
): 166.5, 145.7, 143.0, 134.1. 130.5, 128.9, 128.2,
127.1, 117.3, 59.8, 57.4, 48.8, 47.12 ; HRMS m/z calcd for C
41
H
39
O
7
N
9
+ (H
+
):

88
770.3045; found: 770.3034.

Compound 16: procedure 2. Alkyne 5 (516 mg, 1.7 mmol, 1.2 eq), triazide 14 (100
mg, 0.47 mmol, 1eq), CuSO
4
(17.6 mg, 0.07 mmol), ascorbic acid (12.3 mg, 0.07
mmol), THF (1.5 ml), and H
2
O (1.5 ml) were used. Triazole derivative 16 (412 mg,
0.37 mmol, 78%) was obtained after silica gel circular chromatography (5% H
2
O-
CH
3
CN) as a white foam;
1
H NMR (CDCl
3
): 8.32 (s, 3H, =CHN), 7.74 (d, 3H, J =
19.1 Hz, =CHCar), 7.46-7.33 (m, 6H, H
ar
), 77.24 (d, 3H, J = 8.6 Hz, H
ar
), 6.47 (d, 3H,
J = 19.1 Hz, =CHCO), 5.42 (s, 6H, CH
2
OCO), 4.37 (s, 6H, NCH
2
), 3.78-3.61 (br s,
1H, OH), 3.25-3.04 (br s, 2H, CH
2
OH);
13
C NMR (CDCl
3
): 168.1, 167.9, 166.2,
143.7, 143.6, 142.9, 142.4, 133.0, 127.0, 126.5, 123.9, 122.8, 118.5, 59.8, 57.6, 48.6,
47.2, 20.6; HRMS m/z calcd for C
53
H
51
O
19
N
9
+ (H
+
): 1118.3374; found: 1118.3366.

Compound 17: procedure 3. Triazole 16 (117 mg, 0.1 mmol), K
2
CO
3
(130.3 mg, 0.9
mmol), MeOH (2.5 mL), and CH
2
Cl
2
(2.5 mL) were used. The free hydroxyl
derivative 17 (74.5 mg, 0.07 mmol, 69%) was obtained after silica gel circular
chromatography (5% H
2
O-CH
3
CN) as a yelow solid; mp 148-150
o
C;
1
H NMR
(DMSO-d
6
) : 8.34 (s, 3H, =CHN), 7.72 (d, 3H, J = 19.1 Hz, =CHC
ar
), 7.28 (br s, 3H,
H
ar
), 7.18 (d, 3H, J = 8.6 Hz, H
ar
), 6.89 (d, 3H, J = 8.6 Hz, Har), 6.29 (d, 3H, J =
19.1Hz, =CHCO), 5.38 (s, 6H, CH
2
OCO), 4.66 (s, 6H, NCH
2
), 3.34-3.29 (br s, 2H,
CH
2
OH);
13
C NMR (DMSO-d
6
): 166.2, 145.1, 143.2, 128.1, 121.6, 118.2, 117.3,
114.9, 61.4, 60.7, 51.2, 46.8; HRMS m/z calcd for C
41
H
39
O
13
N
9
- (H
+
): 864.2595;
found: 864.2487.

Compound 19: procedure 2. Alkyne 3 (265 mg, 1.4 mmol, 1.2 eq), azide 18 (70 mg,
0.3 mmol, 1eq), CuSO
4
(15 mg, 0.06 mmol), ascorbic acid (10 mg, 0.06 mmol), THF
(1.5 ml), and H
2
O (1.5 ml) were used. Triazole derivative 19 (238 mg, 0.24 mmol,
82%) was obtained after silica gel circular chromatography (5% MeOH-CH
2
Cl
2
) as a
white foam;
1
H NMR (CDCl
3
): 8.30 (s, 4H, =CHN), 7.72 (d, 4H, J = 18.7 Hz,
=CHC
ar
), 7.54-7.44 (m, 8H, H
ar
), 7.40-7.28 (m, 12H, H
ar
), 6.46 (d, 3H, J = 18.7 Hz,
=CHCO), 5.38 (s, 8H, COOCH
2
), 4.41 (s, 8H, NCH
2
);
13
C NMR (CDCl
3
): 166.5,

89
145.8, 142.7, 134.2, 130.5, 128.9, 128.2, 127.8, 117.2, 57. 4, 49.2, 46.4; HRMS m/z
calcd for C
53
H
48
O
8
N
12
+ (H
+
): 981.3791; found: 981.3785.

Compound 20: procedure 2. Alkyne 5 (246 mg, 0.81 mmol, 3 x 1.2 eq), azide 18 (40
mg, 0.17 mmol, 1eq), CuSO
4
(8.5 mg, 0.034 mmol), ascorbic acid (6 mg, 0.043
mmol), THF (1.5 ml), and H
2
O (1.5 ml) were used. Triazole derivative 20 (193 mg,
0.13 mmol, 79%) was obtained after silica gel circular chromatography (3% MeOH-
CH
2
Cl
2
) as a colorless oil;
1
H NMR (CDCl
3
): 8.30 (s, 4H, =CHN), 7.63 (d, 4H, J =
17.6 Hz, =CHCar), 7.35 (br s, 8H, Har), 7.20 (d, 4H, J = 8.2 Hz, Har), 6.41 (d, 4H, J
= 17.6 Hz, =CHCO), 5.38 (s, 8H, CH
2
O), 4.44 (s, 8H, CH
2
N), 2.25 (s, 24H, 8 x OAc);
13
C NMR (CDCl
3
): 168.0, 167.9, 166.1, 143.6, 142.43, 132.9, 132.4, 127.8, 126.5,
123.9, 122.8, 118.4, 86.1, 57.5, 49.2, 46.6, 20.6; HRMS m/z calcd for C
69
H
64
O
24
N
12
+
(H
+
): 1445.4234; found: 1445.4231.

Compound 21: procedure 3. Triazole 20 (62 mg, 0.043 mmol), K
2
CO
3
(36.6 mg,
0.26 mmol), MeOH (2.5 mL), and CH
2
Cl
2
(2.5 mL) were used. The free hydroxyl
derivative 21 (34 mg, 0.03 mmol, 72%) was obtained after silica gel circular
chromatography (5% H
2
O-CH
3
CN) as a yellow solid; mp 168-170
o
C;
1
H NMR
(DMSO-d
6
): 8.35 (s, 4H, =CHN), 7.60 (d, 4H, J = 18.6 Hz, =CHCar), 7.12 (br s,
8H, OH), 7.05 (m, 4H, Har), 6.85 (m, 8H, Har), 6.30 (d, 4H, J = 18.6 Hz, =CHCO),
5.30 (s, 8H, CH
2
O), 4.72 (s, 8H, CH
2
N);
13
C NMR (DMSO-d
6
): 166.3, 145.6, 143.2,
142.9, 142.5, 129.4, 127.5, 121.3, 118.2, 117.6, 115.3, 59.3, 50.2, 44.5; HRMS calcd
for C53H48O16N12 + (H
+
): 1109.3389; found: 1109.3367.

Compound 23: procedure 2. Alkyne 22 (80.7 mg, 0.28 mmol, 1 eq), azide 4 (292
mg, 1.34 mmol, 4 x 1.2 eq), CuSO
4
(12.5 mg, 0.05 mmol), ascorbic acid (8.8 mg, 0.05
mmol), THF (1.5 ml), and H
2
O (1.5 ml) were used. Triazole derivative 23 (265 mg,
0.2 mmol, 82%) was obtained after silica gel circular chromatography (5% MeOH-
CH
2
Cl
2
) as a white solid; mp 86-88
o
C ;
1
H NMR (CDCl
3
) : 7.69 (s, 4H, =CHN),
7.61 (d, 4H, J = 19.1 Hz, =CHC
ar
), 7.55-7.35 (m, 20H, H
ar
), 6.41 (d, 4H, J = 17.6 Hz,
=CHCO), 4.72-4.68 (m, 8H, CH
2
OCO), 4.61-4.66 (m, 8H, NCH
2
CH
2
OCO), 4.52 (s,

90
8H, OCH
2
C), 3.41 (s, 8H, CCH
2
O);
13
C NMR (CDCl
3
) : 166.3, 146.0, 145.4, 134.0,
130.6, 128.9, 128.2, 123.1, 116.9, 69.05, 64.8, 62.5, 49.1, 45.2; HRMS m/z calcd for
C
61
H
64
O
12
N
12
+ (2H
+
): 579.2456; found: 579.2456.

Compound 24: procedure 2. Alkyne 22 (230 mg, 0.8 mmol, 1 eq), azide 6 (1276 mg,
3.8 mmol, 4 x 1.2 eq), CuSO
4
(40 mg, 0.16 mmol), ascorbic acid (28 mg, 0.16 mmol),
THF (1.5 ml), and H
2
O (1.5 ml) were used. Triazole derivative 24 (969 mg, 0.6 mmol,
75%) was obtained after silica gel circular chromatography (15% MeOH-CH
2
Cl
2
) as a
white foam ;
1
H NMR (CDCl
3
) : 7.71 (s, 4H, =CHN), 7.59 (d, 4H, J = 19.1 Hz,
=CHC
ar
), 7.73-7.31 (m, 8H, H
ar
), 7.22 (d, 4H, J = 8.3 Hz, H
ar
), 6.37 (d, 4H, J = 17.6
Hz, =CHCO), 4.69-4.52 (m, 12H, CH
2
OCO, NCH
2
CH
2
OCO, OCH
2
C), 3.72 (s, 8H,
CCH
2
O);
13
C NMR (CDCl
3
) : 168.1, 167.9, 165.9, 145.3, 143.9, 143.7, 142.5,
132.8, 126.6, 123.9, 123.3, 122.8, 118.1, 69.1, 64.8, 62.6, 49.0, 45.1, 20.6; HRMS m/z
calcd for C
77
H
80
O
28
N
12
+ (2H
+
): 811.7691; found: 811.7690.

Compound 25: procedure 3. Triazole 24 (280 mg, 0.17 mmol), K
2
CO
3
(286.3 mg,
2.1 mmol), MeOH (2.5 mL), and CH
2
Cl
2
(2.5 mL) were used. The free hydroxyl
derivative 25 (152 mg, 0.12 mmol, 69%) was obtained after silica gel circular
chromatography (8% H
2
O-CH
3
CN) as a yellow foam;
1
H NMR (DMSO-d
6
) : = 8.12
(s, 4H, =CHN), 7.48 (d, 4H, J = 18.2 Hz, =CH
ar
), 7.10 (s, 4H, H
ar
), 7.02 (d, 4H, J =
8.3 Hz, H
ar
), 6.83 (d, 4H, J = 8.3 Hz, H
ar
), 6.25 (d, 4H, J = 18.2 Hz, =CHCO), 4.88-
4.75 (m, 8H, CH
2
OCO), 4.68-4.56 (m, 8H, NCH
2
CH
2
OCO), 4.47 (s, 8H, OCH
2
C),
3.41 (s, 8H, CCH
2
O);
13
C NMR (DMSO-d
6
) : = 167.0, 149.1, 146.6, 146.3, 145.8,
127.3, 124.7, 122.9, 116.4, 115.2, 114.7, 69.5, 65.3, 63.1, 49.9, 46.1; HRMS m/z
calcd for C
61
H
64
O
20
N
12
- (2H
+
): 642.2136; found: 642.2128.

Compound 27: procedure 2. Alkyne 3 (147.5 mg, 0.8 mmol, 6 x 1.2 eq), hexaazide
26 (47.5 mg, 0.1 mmol, 1eq), CuSO
4
(7.5 mg, 0.03 mmol), ascorbic acid (5.3 mg, 0.03
mmol), THF (1.5 ml), and H
2
O (1.5 ml) were used. Triazole derivative 27 (146.5 mg,
0.09 mmol, 82%) was obtained after silica gel circular chromatography (2% MeOH-
CH
2
Cl
2
) as a white solid; mp 104-105
o
C;
1
H NMR (CDCl
3
): 8.35 (s, 6H, =CHN),

91
7.73 (d, 6H, J = 18.7 Hz, =CHC
ar
), 7.50-7.41 (m, 12H, H
ar
), 7.39-7.28 (m, 18H, H
ar
),
6.44 (d, 6H, J = 18.7 Hz, =CHCO), 5.36 (s, 12H, CH
2
OCO), 4.38 (s, 12H, CH
2
N);
3.15 (s, 4H, CH
2
OC);
13
C NMR (CDCl
3
): 166.5, 145.7, 143.1, 134.1, 130.5, 128.9,
128.1, 127.3, 117.2, 67.3, 57.5, 48.9, 46.4 ; HRMS m/z calcd for C
82
H
76
O
13
N
18
+
(H
+
): 1521.5912; found: 15215.5914.

Compound 28: procedure 2. Alkyne 5 (376 mg, 1.25 mmol, 6 x 1.2 eq), hexaazide
26 (70 mg, 0.17 mmol, 1 eq), CuSO
4
(12.5 mg, 0.05 mmol), ascorbic acid (8.8 mg,
0.05 mmol), THF (1.5 ml), and H
2
O (1.5 ml) were used. Triazole derivative 28 (300
mg, 0.13 mmol, 78%) was obtained after silica gel circular chromatography (5%
MeOH-CH
2
Cl
2
) as a yellow solid; mp 110-111
o
C;
1
H NMR (CDCl
3
): 8.32 (s, 6H,
=CHN), 7.61 (d, 6H, J = 19.1 Hz, 6H, =CHC
ar
), 7.48-7.31 (m, 12H, H
ar
), 7.21 (d, 6H,
J = 8.1 Hz, H
ar
), 6.33 (d, J (H,H) =19.1 Hz, 6H, =CHCO), 5.38 (s, 12H, CH
2
OCO),
4.46 (s, 12H, CH
2
N); 3.19 (s, 4H, CH
2
OC), 2.29 (s, 36H, 6 x OAc);
13
C NMR
(CDCl
3
): = 168.1, 167.9, 166.1, 143.6, 142.4, 132.9, 126.5, 123.9, 122.8, 118.4,
68.3, 57.6, 49.1, 46.1, 29.7, 20.6, 20.5; HRMS m/z calcd for C
106
H
100
O
37
N
18
+ (2H
+
):
1109.8336; found: 1109.8332.

Compound 29: procedure 3. Triazole 28 (151 mg, 0.06 mmol), K
2
CO
3
(169.2 mg,
1.2 mmol), MeOH (2.5 mL), and CH
2
Cl
2
(2.5 mL) were used. The free hydroxyl
derivative 29 (80.3 mg, 0.05 mmol, 69%) was obtained after silica gel circular
chromatography (8% H
2
O-CH
3
CN) as a yellow solid; mp 161-162
o
C;
1
H NMR
(DMSO-d
6
) : = 8.40 (s, 6H, =CHN), 7.54 (d, 4H, J = 19.1 Hz, =CH
ar
), 7.18 (s, 6H,
H
ar
), 7.0 (d, 6H, J = 8.2 Hz, H
ar
), 6.81 (d, 6H, J = 8.2 Hz, H
ar
), 6.23 (d, 6H, J = 19.1
Hz, =CHCO), 5.38 (s, 12H, CH
2
OCO), 4.78 (s, 12H, CH
2
N), 3.36 (s, 8H, CH
2
OC);
13
C NMR (DMSO-d
6
) : 167.3, 148.6, 146.4, 146.2, 143.6, 128.1, 127.4, 122.8,
116.3, 115.2, 114.9, 68.1, 57.9, 50.8, 46.1; HRMS m/z calcd for C
82
H
76
O
25
N
18
-
(2H
+
): 855.2542; found: 855.2542.




92
CHAPTER V: Caffeic acid phenethyl ester and its
amide analogue are potent inhibitors of leukotriene
biosynthesis in human blood and isolated poly-
morphonuclear leukocytes



Luc H. Boudreau, Jacques Maillet, Luc M. LeBlanc, Jaques Jean-Franois, Mohamed
Touaibia, Nicolas Flamand and Marc E. Surette



This article was published in PLoS ONE on 09 Feb 2012 10.1371/journal.pone.0031833












Authors contribution
L.H.B, J.M., L.M.L. and J.J. performed the experiments. L.H.B., J.J., M.T. and M.E.S
designed the experiments. L.H.B., J.M., J.J., M.T., N.F. and M.E.S analyzed the data.
L.H.B, M.T., N.F. and M.E.S wrote the manuscript.




93
5.1. Rsum
La 5-lipoxygnase (5-LO) catalyse la transformation de lacide arachidonique (AA) en
leucotrines (LTs), qui reprsentent dimportants mdiateurs lipidiques. Les LTs sont
directement impliqus dans les maladies inflammatoires, telles que lasthme,
lathrosclrose ainsi que larthrite rhumatode. Il est donc vident que lune des
stratgies utilises pour contrer ces maladies vise linhibition des LTs. Des analogues de
lacide cafique, incluant son driv naturel, lester phnthyl dacide cafique (CAPE),
furent synthtiss et values dans leur habilet inhiber la 5-LO et la biosynthse des
LTs chez les leucocytes polymorphonuclaires humain (PMNL) ainsi que dans le sang
entier. Les activits anti-radicalaires ainsi quantioxydantes de ces composs furent aussi
valus. Lacide cafique ninhibe pas lactivit de la 5-LO ou la biosynthse des LTs
jusqu des concentrations de 10 M. Cependant, le CAPE inhibe lactivit de la 5-LO
(IC
50
0.13 M, 95% CI 0.08 - 0.23 M), et ce, plus efficacement que le seul inhibiteur de
la 5-LO utilis en clinique, soit le zileuton (IC
50
3.5 M, 95% CI 2.3 - 5.4 M). CAPE est
aussi un compos inhibiteur plus efficace que le zileuton chez les PMNL, mais leffet de
CAPE et du zileuton sont semblables dans le sang entier. Lactivit de lanalogue amide
du CAPE est aussi similaire au zileuton. Linhibition de la biosynthse des LTs par le
CAPE semble tre le rsultat dune combinaison de linhibition de lactivit de la 5-LO
ainsi quune inhibition de la libration de lAA. La structure du CAPE peut servir de
modle dans la synthse de futurs inhibiteurs de la biosynthse de LTs.












94
5.2. Abstract
5-lipoxygenase (5-LO) catalyses the transformation of arachidonic acid (AA) into
leukotrienes (LTs), which are important lipid mediators of inflammation. LTs have been
directly implicated in inflammatory diseases like asthma, atherosclerosis and rheumatoid
arthritis; therefore inhibition of LT biosynthesis is a strategy for the treatment of these
chronic diseases. Analogues of caffeic acid, including the naturally-occurring caffeic acid
phenethyl ester (CAPE), were synthesized and evaluated for their capacity to inhibit
5-LO and LTs biosynthesis in human polymorphonuclear leukocytes (PMNL) and whole
blood. Anti-free radical and anti-oxidant activities of the compounds were also measured.
Caffeic acid did not inhibit 5-LO activity or LT biosynthesis at concentrations up to 10
M. CAPE inhibited 5-LO activity (IC
50
0.13 M, 95% CI 0.08 - 0.23 M) more
effectively than the clinically-approved 5-LO inhibitor zileuton (IC
50
3.5 M, 95% CI 2.3
- 5.4 M). CAPE was also more effective than zileuton for the inhibition of LT
biosynthesis in PMNL but the compounds were equipotent in whole blood. The activity
of the amide analogue of CAPE was similar to that of zileuton. Inhibition of LT
biosynthesis by CAPE was the result of the inhibition of 5-LO and of AA release. Caffeic
acid, CAPE and its amide analog were free radical scavengers and antioxidants with IC
50

values in the low M range; however, the phenethyl moiety of CAPE was required for
effective inhibition of 5-LO and LT biosynthesis. CAPE is a potent LT biosynthesis
inhibitor that blocks 5-LO activity and AA release. The CAPE structure can be used as a
framework for the rational design of stable and potent inhibitors of LT biosynthesis.








95
5.3. Introduction
5-lipoxygenase (5-LO), expressed in a number of myeloid and lymphoid cells such as B
cells, monocytes, neutrophils, eosinophils and mast cells, is the key enzyme in the
bioconversion of arachidonic acid (AA) to leukotrienes (LTs) (1). LTs are important lipid
mediators of inflammation that are involved in various inflammatory diseases such as
atherosclerosis (2), asthma (3) and rheumatoid arthritis (4). Studies have also
demonstrated a potential role for 5-LO in cancer since its overexpression is observed in
tissue samples from patients with prostate carcinoma (5) and this enzyme is an important
regulator of leukemia stem cell development (6). Consequently, the inhibition of the 5-
LO pathway has been studied as a therapeutic target for a number of years (reviewed by
(7)). The anti-asthmatic drug zileuton (8) is the only 5-LO inhibitor approved and
commercially available for clinical use, but adverse effects including liver toxicity has
limited its use (9). Another inconvenience of the drug is its pharmacokinetic profile
requiring dosing of up to 600 mg four times a day (8, 10). Thus the search for alternative
and potent 5-LO inhibitors with fewer side effects continues.

A number of naturally-occurring compounds have been investigated as potential
inhibitors of 5-LO and LT biosynthesis. Amongst these are polyhydroxylated products
such as caffeic acid and related compounds that are widely distributed in plants and
exhibit anti-oxidant (11-13) and anti-inflammatory properties (14, 15). Synthetic caffeic
acid analogues were recently shown to be promising 5-LO inhibitors (14, 16, 17), while
caffeic acid and its naturally-occurring analogue, caffeic acid phenethyl ester (CAPE,
Figure 5.1), a component of propolis from honeybee hives, were reported to inhibit LT
production in mouse peritoneal macrophages (14).







96

Figure 5.1: Molecular structures of CAPE 1 and zileuton.

Since many known 5-LO inhibitors, including zileuton (18), function by reducing the
catalytically-active ferric form of 5-LO, we synthesized CAPE and some structural
analogues to investigate their structure-activity relationship as free radical scavengers,
antioxidants and 5-LO inhibitors. Both ester and amide analogues of CAPE were
designed with the rationale that esters may be more susceptible to chemical and
enzymatic degradation compared to the corresponding amide. Since the hydroxyl groups
within the catechol moiety were reported to play an important role in several biological
activities (19), cinnamoyl analogues were also synthesized to evaluate the effect of the
presence of these functional groups.

In this study, our results demonstrate that while these compounds are effective
antioxidants, certain structural features were required for effective inhibition of LT
biosynthesis.

5.4. Methods
Ethics: Blood was obtained from health volunteer subjects after having obtained written
consent. This research was approved by the Comit dthique de la recherche avec les
tres humains at Universit de Moncton.

Synthesis of CAPE-like analogues: The synthesis of CAPE and its analogues is
summarized in Figure 5.2. The ester and amide analogues were synthesized from 2-
phenylethanol or 2-phenylethanamine with cinnamic acid, 2, or acetylated caffeic acid, 6.
The conversion of 2 or 6 into the corresponding carboxylic chloride was achieved by the
Vilsmeier-Haack adduct (20) derived from thionyl chloride (SOCl
2
) and N,N-

97
dimethylformamide (DMF) as catalyst. Base-induced de-O-acetylation in 7 or 8 to afford
CAPE (1) and the amide analogue, 9, was accomplished with potassium carbonate in
methanol and dichloromethane (Figure 5.2). NMR and mass spectrometry analyses were
found to be identical to those reported (21-24).


Figure 5.2. Summary of the synthesis of CAPE and its analogues.

Isolation of PMNL from peripheral blood: PMNL were isolated from heparinized blood
obtained from healthy donors as previously described (25). Briefly, blood was
centrifuged at 300x g for 5 min at room temperature, plasma was collected and
erythrocytes were removed by dextran sedimentation. Following centrifugation on a
lymphocyte separation medium cushion (density, 1.077 g/ml) (Wisent, St-Bruno, Qc,
Canada) at 900x g for 20 min at room temperature, PMNL (>96%) were obtained from
the pellet after hypotonic lysis to remove residual erythrocytes.

5-LO activity in a cell-free assay: Investigation of compounds as 5-LO inhibitors was
performed as described previously with minor modifications (16). Briefly, HEK293 cells
(ATCC, Manassas, VA) (10
7
cells/ml) stably transfected with 5-LO were incubated in a
hypotonic buffer (50 mM Tris-HCl pH 7.6, 150 mM NaCl, and 2 mM EDTA) for 10 min
on ice. The cell mixture was then passed through a 21-gauge needle 10 times. Cell lysates
were vortexed and centrifuged at 3800x g for 5 min at 4C and the cell lysate supernatant
containing 5-LO was recuperated. Supernatants containing 5-LO and 5mM CaCl
2
were

98
then preincubated with each of the test compounds at the indicated concentrations (see
figure legends) for 5 min at 37C. The 5-LO reaction was initiated by the addition of 1
mM ATP and 40 M AA followed by incubation at 37C for 20 min. Reactions were
stopped by the addition of 0.5 volume of cold MeOH:CH
3
CN (1:1) containing 50 ng of
prostaglandin B
2
(PGB
2
) as internal standard and samples were stored at -20C overnight
to maximize protein denaturation. Samples were then centrifuged at 1000x g for 10 min,
the supernatant was diluted with 4 volumes of acidified water (acetic acid, 0.1% v/v) and
then applied onto a preconditioned octadecyl (C
18
) column. Columns containing samples
were washed with 2 ml acidified water and 5-LO products were eluted with 3 ml of
methanol. After evaporation of solvents with nitrogen, products were suspended in 20%
methanol and subjected to RP-HPLC analysis with diode array detection as previously
described (26). Total 5-LO products quantified represents the sum of LTB
4
, its trans
isomers, 20-COOH- and 20-OH-LTB
4
and 5-hydroxyeicosatetraenoic acid.

Stimulation of PMNL for 5-LO products: Isolated PMNL (10
7
cells/ml) suspended in
Hanks balanced salt solution (HBSS, Lonza, Walkerville, MD) were pre-incubated with
compounds for 5 min at 37 C in the presence of 1.6 mM CaCl
2
and 1U/ml of adenosine
deaminase (Sigma-Aldrich, Oakville, On, Canada). Cells were then stimulated for 15
min at 37C with 1 M thapsigargin (Sigma-Aldrich) with or without 10 M AA
(Cayman Chemical, Ann Arbour, MI) as previously described (27). Reactions were
stopped by the addition of 0.5 volume of cold MeOH:CH
3
CN (1:1) and 50 ng of PGB
2
as
internal standard and samples were stored at -20C until processing on octadecyl (C
18
)
columns and RP-HPLC analysis as indicated above.

Measurement of AA release: Isolated PMNL (10
7
cells/ml) were stimulated with 1 M
thapsigargin as above but in the presence of 0.1% of BSA to capture released AA and
with a stimulation time of 5 min. Stimulation was stopped by the addition of 2 volumes of
cold methanol, 300 ng octadeuterated-AA (Cayman Chemical) was added as an internal
standard and samples were stored at -20C overnight. Samples were centrifuged at 1000x
g for 10 min and supernatants were diluted with 8 volumes of acidified water for
processing on a preconditioned octadecyl (C
18
) as indicated above. Samples were eluted

99
with 3 ml of methanol, dryed under N
2
, and pentafluorobenzylesters were prepared by
adding 50 l N,N-diisopropylethylamine (20% in CH
3
CN)(Sigma-Aldrich) and 50 l
2,3,4,5,6-pentafluorobenzyl bromide (20% in CH
3
CN)(Sigma-Aldrich)(28). After heating
at 40C for 40 min, samples were dried under N
2
, resuspended in 100 l hexane and AA
was measured by negative ion chemical ionisation gas chromatography/mass
spectrometry using a TraceGC ultra column (Thermo, Waltham, MA) and a Polaris Q
mass spectrometer (Thermo).

Ex vivo whole blood stimulation: Zymosan stimulation of whole blood was performed as
previously described (29, 30) with minor modifications. Each compound or its diluent
(DMSO) was added to 1 ml heparinized blood obtained from healthy donors at the
indicated concentrations and incubated for 10 min at 37C in a water bath. Blood was
then stimulated with the addition of 125 l of 40 mg/ml

opsonised zymosan, gently
vortexed and incubated for 30 min at 37C. Samples were then centrifuged for 10 min at
960 x g at 4C. Plasma (350 l) was removed and added to tubes containing 1.2 ml of
CH
3
OH:CH
3
CN (1:1) and 50 ng of PGB
2
as internal standard. Samples were stored
overnight at -20C and then processed for RP-HPLC analysis of 5-LO products as
described above.

Determination of the antioxidant and radical scavenging activity of test compounds:
The antioxidant assay was performed as previously described (31). Briefly, a 5 mM
phosphate-buffered solution (pH 7.4) containing 0.05% Tween 20 (Sigma-Aldrich) and
0.16 mM linoleic acid (Cayman Chemical) was preheated at 40C. Test compounds or
their diluent (DMSO) were added to the mix at the indicated concentrations (see figure
legends). The oxidation reaction, performed under a constant temperature of 37C, was
initiated by adding 50 l of a 2,2-azobis(2-amidinopropane) dihydrochloride (AAPH)
solution (10 mg/ml) (Cayman Chemical) to 1 ml of the above solution. The rate of lipid
oxidation was determined by measuring the absorbance at 234 nm with a Thermo
Varioskan UV visible spectrophotometer every 5 min for 3 h. Inhibition of linoleic acid
oxidation was calculated as followed: (%) = (1 rate absorbance change with test
compound/rate of absorbance change with solvent control) x 100.

100

The free radical scavenging activity of test compounds was measured as previously
described using 2,2-Diphenyl-1-picrylhydrazyl (DPPH) as a stable radical (32, 33). 1 ml
of DPPH in ethanol (60 mM) was mixed with 1 ml of the test compounds at the indicated
concentrations or their diluent (ethanol). Each mixture was then shaken vigorously and
held in the dark for 30 min at room temperature. The absorbance of DPPH at 520 nm was
then measured. The radical scavenging activity was expressed in terms of % inhibition of
DPPH absorbance (%inhibition = [(Acontrol Atest)/Acontrol)] 100) where Acontrol
is the absorbance of the control (DPPH solution without test compound) and Atest is the
absorbance of the test sample (DPPH solution plus compound). Ascorbic acid was used
as a reference compound.

Statistical analysis: Statistical analysis and graph design were performed with GraphPad
Prism 5 software (GraphPad Software, San Diego, California). All data are expressed as
mean SEM. One sample t-tests were performed to determine significant difference
from controls. IC
50
values were calculated from a sigmoidal concentration-response
curve-fitting model.

5.5. Results
The biosynthesis of 5-LO products in stimulated human PMNL
A first series of experiments was performed in which PMNL were stimulated with 1 M
thapsigargin in presence or absence of 10 M AA. Under these conditions, the
biosynthesis of 5-LO products was 176 16 pmol/10
6
cells (mean SEM) and 357 33
pmol/10
6
cells (mean SEM) for thapsigargin and thapsigargin/AA, respectively. The
effect of a fixed concentration (1 M) of the various test compounds on the biosynthesis
of 5-LO products was then measured (Figure 5.3). Stimulation of PMNL in the presence
of exogenous AA excludes the possibility that the test compounds might affect LT
biosynthesis by blocking AA availability. In PMNL stimulated with thapsigargin in the
presence of exogenous AA, only CAPE 1 and zileuton significantly decreased production
of 5-LO products by 53% and 17%, respectively (Figure 5.3A). A more significant
decrease in the biosynthesis of 5-LO products was observed when PMNL were

101
stimulated in the absence of exogenous AA. Under these experimental conditions, 1 M
of CAPE 1, compound 9 and zileuton inhibited the biosynthesis of 5-LO products by
85%, 20% and 40%, respectively (Figure 5.3B). In concentration response experiments in
the absence of exogenous AA, CAPE 1 showed potent inhibition of the biosynthesis of
5-LO products with an IC
50
value of 0.52 M while its amide analogue compound 9 and
zileuton had IC
50
values of 1.70 M and 1.90 M, respectively (Figure 5.3C and Table
5.1).



102


103

Figure 5.3: Biosynthesis of 5-LO products by thapsigargin-stimulated PMNL in the
presence of various compounds. PMNL incubated with 1 M of the indicated
compounds or their diluent (Control, 0.5% DMSO) for 5 min were then stimulated with
thapsigargin (1 M) for 15 min in the presence (A) or absence (B) of exogenous
arachidonic acid (10 M). Dose-response of CAPE 1, compound 9 and zileuton for the
inhibition of the biosynthesis of 5-LO products (C). Reactions were stopped by the
addition of 0.5 volume of cold MeOH:CH
3
CN (1:1) and samples were processed for
measurement of 5-LO products by RP-HPLC. Total 5-LO products represent the sum of
LTB
4
, its trans isomers, 20-COOH- and 20-OH-LTB
4
and 5-hydroxyeicosatetraenoic
acid. *Different from control, P<0.05, #different from control, P<0.005. AA=cells
incubated without thapsigargin stimulus. Data are expressed as means SEM of 3 to 5
independent experiments, each performed in duplicate.

5-LO activity in a cell-free assay
Since CAPE 1 and compound 9 inhibited LT biosynthesis in stimulated whole cells, their
ability to inhibit 5-LO activity was investigated in a cell-free assay in HEK293 cells
stably transfected with 5-LO. 5-LO activity was effectively inhibited in the presence of
CAPE 1, compound 9 and zileuton. CAPE 1 was a more potent 5-LO inhibitor than
compound 9 and zileuton with a measured IC
50
value that was an order of magnitude
smaller (Figure 5.4 and Table 5.1).


104

Figure 5.4: Impact of CAPE 1, compound 9 and zileuton on the synthesis of 5-LO
products in cell lysates. HEK293 cell lysate supernatants were incubated with CAPE 1,
compound 9, zileuton or their diluent (Control, 0.5% DMSO). Synthesis of 5-LO
products was initiated by the addition of 40 M AA and 1 mM ATP. Reactions were
stopped after 20 min by the addition of 0.5 volume of cold MeOH:CH
3
CN (1:1) and
samples were processed for measurement of 5-LO products by RP-HPLC. Total 5-LO
products represent the sum of LTB
4
, its trans isomers, 20-COOH- and 20-OH-LTB
4
, and
5-hydroxyeicosatetraenoic acid. Values represent means SEM of three independent
experiments, each performed in duplicate.









105
Table 5.1. IC
50
values for the inhibition of the synthesis of 5-LO
products of test compounds in the different assays.
Compounds PMNL stimulation
IC
50
(M)
Cell lysate
IC
50
(M)
Whole blood
IC
50
(M)
1 Mean 0.52 0.13 1.79
CI 0.44 to 0.61

0.08 to 0.23 1.45 to 2.20
zileuton Mean 1.90 3.54 1.41
CI 1.48 to 2.42

2.34 to 5.38 1.22 to 1.63
9 Mean 1.70 2.38 4.93
CI 1.21 to 2.38

1.43 to 3.95 3.42 to 7.10
Values are means from 3 independent experiments, each performed in
duplicate. CI=95% confidence interval

AA release from stimulated human PMNL
The inhibition of LT biosynthesis by CAPE 1 and compound 9 was more effective in the
absence of exogenous AA. We therefore investigated if these compounds might partially
block LT biosynthesis by inhibiting the release of AA from membrane phospholipids,
thus limiting substrate availability. Since zileuton has been shown to inhibit AA release
from mouse peritoneal macrophages stimulated with zymosan (34), we investigated if our
test compounds could also impact on this key cellular event in the biosynthesis of 5-LO
products. When PMNL were pre-incubated with the test compounds (1 M), only CAPE
1 and zileuton inhibited AA release by 56% and 37%, respectively, compared to controls
(Figure 5.5).





106


Figure 5.5: Impact of CAPE 1, compound 9 and zileuton on AA release by stimulated
PMNL. PMNL were incubated with 1 M of the indicated compounds or their diluent
(Control, 0.5% DMSO) for 5 min and were then stimulated with thapsigargin (1 M) or
its diluent (-thaps) for 5 min. Stimulation was stopped by the addition of 2 volumes of
cold methanol containing octadeuterated-AA as an internal standard. Samples were stored
at -20C overnight, AA was extracted on octadecyl columns, pentafluorobenzylesters
were prepared and were measured by GC-MS. *Different from control, P<0.05. Data are
expressed as means SEM of three independent experiments, each performed in
duplicate.





107
Biosynthesis of 5-LO products in stimulated whole blood
To investigate the ability of the compounds that showed significant inhibition of LT
biosynthesis in isolated PMN to inhibit LT biosynthesis in a more complex and
physiologically relevant environment, LT biosynthesis was measured ex vivo in
stimulated human blood. When whole blood was stimulated with zymosan in the
presence of 1 M of the test compounds, CAPE 1 and the reference molecule zileuton
had similar effects, inhibiting LT biosynthesis by 32% and 37%, respectively (Figure
5.6A). Dose-response experiments confirmed the similar capacity of 5-LO pathway
inhibition by CAPE 1 (IC
50
=1.79 M) and zileuton (IC
50
=1.41 M) while compound 9
did inhibit 5-LO product biosynthesis at a higher concentrations (IC
50
=4.93 M) (Figure
5.6B and Table 5.1). Importantly, in addition to thapsigargin stimulation of isolated
PMNL, the use of opsonized zymosan in these whole blood experiments showed that the
test compounds inhibit leukotriene biosynthesis in leukocytes activated by different
stimuli.

108

Figure 5.6: Impact of CAPE 1, compound 9 and zileuton on the biosynthesis of 5-LO
products in stimulated whole blood. Whole blood incubated with 1 M of the indicated
compounds or their diluent (Control, 0.5% DMSO) for 5 min was then stimulated with
opsonised zymosan (5 mg/ml) for 30 min (A). Dose-response for the inhibition of 5-LO
products of test compounds in opsonised zymosan-stimulated whole blood (B). After
stimulation, blood was centrifuged, plasma was removed and added to 3.5 volumes of
cold MeOH:CH
3
CN (1:1) and samples were processed for measurement of 5-LO
products by RP-HPLC. Total 5-LO products represent the sum of LTB
4
, its trans isomers,
20-COOH- and 20-OH-LTB
4
and 5-hydroxyeicosatetraenoic acid. *Significantly
different from control, P<0.05, #Significant different from control P<0.005. Data are
expressed as means SEM of 3 independent experiments, each performed in duplicate.


109
Antioxidant and free radical scavenging activity
One mechanism by which 5-LO can be inhibited is through reductive inhibition of the
ferric non-heme iron of the enzyme. Compounds with anti-oxidant or free radical
scavenging activity can therefore be effective 5-LO inhibitors. An initial evaluation of the
reducing ability of the test compounds was determined by their interaction with the stable
free radical DPPH since free radical scavengers can pair its free electron causing a
stoichiometric decrease in absorbance at 520 nm. All catechol compounds tested, caffeic
acid 5, CAPE 1 and compound 9, were efficient free radical scavengers in with IC
50

values in the low M range as opposed to their non-catechol analogues, cinnamic acid 2,
compounds 3 and 4 that showed no scavenging activity at concentrations up to 100 M
(Figure 5.7A and Table 5.2). Zileuton was not a strong free radical scavenger with an
IC
50
value of >100 M while the reference compound ascorbic acid showed an IC
50

values of 75 M.

Since CAPE 1 and zileuton have documented antioxidant properties (13, 18), we
investigated if CAPE 1 and its amide analogue compound 9 were better antioxidants than
zileuton. As shown in Figure 5.7B and Table 5.2, CAPE 1, compound 9, Zileuton and
caffeic acid all demonstrated similar antioxidant properties.


110

Figure 5.7: Free radical scavenging and antioxidant activities of various test
compounds. (A) For free radical scavenging activity, 1 ml of DPPH (60 mM in ethanol)
was mixed with 1 ml of the test compounds or their diluent (DMSO) in ethanol. Solutions
were held in the dark for 30 min at room temperature and the absorbance was then
measured at 520 nm. The free radical scavenging activity was expressed in terms of %
inhibition of DPPH absorbance. (B) For antioxidant activity, test compounds or their
diluent (DMSO) were added to a solution containing 0.16 mM linoleic acid and the
oxidation reaction was initiated by adding 50 l AAPH solution (10 mg/ml) to 1 ml of the
above solution. The rate of lipid oxidation was determined by measuring the increase in
absorbance at 234 nm over a 3 h period. Values represent the mean SEM of 3
independent experiments, each performed in triplicate.

111
Table 5.2. IC
50
values of test compounds as free radical scavengers and
antioxidants.

Compounds
Free radical
scavenging
IC
50
(M)
Antioxidant
assay
IC
50
(M)
caffeic acid Mean 13.2 2.01
CI 9.76 to 17.9 1.68 to 2.42
cinnamic acid Mean n.i.* n.i.**
CI n.i.* n.i.**
1 Mean 21.9 1.09
CI 15.2 to 31.4 0.77 to 1.54
zileuton Mean >100 0.79
CI n.i.* 0.58 to 1.06
3 Mean n.i.* n.i.**
CI n.i.* n.i.**
4 Mean n.i.* n.i.**
CI n.i.* n.i.**
9 Mean 14.01 2.11
CI 9.95 to 19.7 1.76 to 2.54
ascorbic acid Mean 75.4 n.t.
CI 56.9 to 99.8 n.t.
Values are means from 3 independent experiments, each performed in duplicate
CI=95% confidence interval
n.i.= no inhibition at *100 M or **25 M
n.t.= not tested







112
5.6. Discussion and conclusion
In our ongoing effort to develop more potent inhibitors of leukotriene biosynthesis,
CAPE 1 and several of its analogues were synthesized and compared to the reference
molecule zileuton. The present study focused on the inhibition of 5-LO and LT
biosynthesis in human PMNL as these cells are important producers of the powerful
chemoattractant LTB
4
(35). CAPE 1 was a more potent inhibitor than zileuton of 5-LO
activity and of LT biosynthesis in stimulated human PMNL, although its inhibition of LT
biosynthesis in whole blood was similar to that of zileuton. CAPE 1 had been previously
reported to inhibit a plant lipoxygenase using linoleic acid as a substrate (13, 33).
Unfortunately, the authors reported this activity to be that of 5-LO. This was not the case
since linoleic acid with its 9, 12 cis double bond is not a 5-LO substrate and the product
of the plant lipoxygenase-catalyzed reaction, 9-hydroperoxy-10, 12-octadecadienoic acid,
is not a 5-LO product. 5-LO catalyzes the abstraction of a pro-S hydrogen at the C-7
position of substrates with 5, 8 cis double bonds, like arachidonic acid, followed by the
addition of molecular oxygen to form a 5-hydroperoxy-fatty acid (36). Therefore, the
present study is the first report of the inhibition of 5-LO activity by CAPE.

Several structural features of CAPE 1 were investigated for their importance in the
inhibition of LT biosynthesis and of 5-LO activity. The phenethyl ester group of the
molecule was essential for effective inhibition since caffeic acid and cinnamic acid did
not show significant activity at concentrations up to 10 M (data not shown), and as
previously reported in 5-LO-transfected HEK293 cells (16). This result in human
leukocytes is not consistent with that reported in ionophore-stimulated murine peritoneal
macrophages where both caffeic acid and CAPE show similar inhibition of leukotriene
synthesis (14); the reason for this difference is not apparent but the phenethyl moiety is
clearly required for the inhibition of both 5-LO activity and LT biosynthesis in human
cells. Similarly, the catechol moiety of the molecule appears to be essential for activity as
compounds 3 and 4 were without inhibitory activity at concentrations up to 10 M (not
shown). While compound 9 inhibited LT biosynthesis and 5-LO activity, the presence of
the amide linkage reduced its potency compared to the ester CAPE 1 by approximately 3-

113
fold for LT biosynthesis and by 18-fold for the inhibition of 5-LO activity in cell lysates
(Table 5.1).

Human PMNL were stimulated in the presence or in the absence of exogenous AA to
evaluate the inhibition of LT biosynthesis while bypassing the critical step of AA release
from phospholipids, or not. CAPE 1, zileuton and compound 9 were all more effective
inhibitors of LT biosynthesis in the absence of exogenous AA suggesting that all three
compounds inhibit the 5-LO catalyzed conversion of AA to LTs. A cell-free 5-LO assay
using HEK293 cells that were stably transfected with 5-LO confirmed that CAPE 1,
zileuton and compound 9 all inhibited the 5-LO-catalyzed conversion of AA to LTs,
where CAPE 1 (IC
50
=0.13 M) was 27-fold more active than zileuton for the inhibition
of 5-LO activity while compound 9 and zileuton showed similar inhibitory activities.

It is well documented that human PMNL spontaneously release significant amounts of
adenosine when they are cultured in vitro (37). This build up is usually not observed in
tissues and blood since stromal cells and erythrocytes rapidly transport adenosine into
their cytosol (37, 38). This adenosine acts through G-protein linked receptors to activate
adenylate cyclase and increase cellular cAMP levels (27, 39). In human PMNL, elevated
cAMP reduces numerous functional responses to agonist stimulation including oxygen
radical (superoxide) production, phagocytosis and leukotriene biosynthesis (27, 37, 38,
40-42). Therefore, freshly isolated human PMNL will quite rapidly (within minutes)
begin to lose their capacity to respond to agonists unless the accumulation of adenosine in
cell culture is prevented. We routinely add ADA to isolated PMNL incubations to prevent
the inhibitory constraint of adenosine (27, 42-47) and although the possibility exists that
added ADA may interact with and impact on the test compounds in the present study, this
is unlikely since the inhibition of 5-LO activity and LT biosynthesis were also measured
in broken cell preparations and in stimulated whole blood, two assay conditions that were
devoid of added ADA.

Since the 5-LO inhibitor zileuton was previously shown to also inhibit AA release from
membrane phospholipids in mouse peritoneal macrophages (34), the release of free AA

114
from PMNL phospholipids was also measured following cell stimulation. CAPE 1 (1
M) inhibited almost 55% of the AA released from membrane phospholipids of
stimulated human PMN compared to 35% of inhibition with zileuton and no effect of
compound 9. Since the group IVA phospholipase A
2
(cPLA
2
) is responsible for AA
release in stimulated human PMNL (47, 48), these results suggest that both CAPE 1 and
zileuton block LT biosynthesis in human PMN by inhibiting the activation of cPLA
2
as
well as that of 5-LO.

Many 5-LO inhibitors including zileuton (18) inhibit the enzyme by reducing the
catalytically-active ferric form of 5-LO. Catechols as a class of compounds are known
anti-oxidants and can potentially inhibit 5-LO as free radical scavengers and antioxidants.
When the test compounds were evaluated for anti-oxidant and free-radical scavenging
activity, their potency was not necessarily related to their ability to inhibit 5-LO. Not
surprisingly, cinnamic acid and its phenethyl ester and phenethyl amide derivatives,
compounds 3 and 4, showed no antioxidant or free radical scavenging activity at
concentrations up to 25 M and 100 M, respectively. However, caffeic acid, which
showed no inhibition of 5-LO, was as effective an antioxidant and free-radical scavenger
as CAPE 1 and compound 9. This suggests that catechols may not efficiently reduce the
ferric iron of 5-LO for enzyme inhibition without the contribution of a hydrophobic
moiety that may act as an anchor to more specifically target the non-heme iron of the 5-
LO protein. Zileuton was also an effective anti-oxidant as previously reported, but was
not a good free radical scavenger.

The rationale for synthesizing amide-linked analogues was that they may be more stable
than ester-linked compounds, like CAPE 1, which could be susceptible to hydrolysis by
esterases. Despite being much more potent than zileuton and compound 9 at inhibiting 5-
LO activity in broken cell assays, and despite inhibiting the release of AA from
stimulated cells, CAPE 1 was only moderately more effective than compound 9 at
inhibiting LT biosynthesis in stimulated human PMNL and in whole blood, and was not
different from zileuton in whole the blood assays. This suggests that while remaining a

115
potent inhibitor of LT biosynthesis, the suspected susceptibility of CAPE 1 to esterases
may reduce its potency in a physiological setting.

In summary, we characterized CAPE 1, a naturally occurring component of propolis from
honeybee hives, as a potent inhibitor of LT biosynthesis that acts as a dual inhibitor of 5-
LO activity and of AA release from membrane phospholipids. A continued effort for the
rational design of inhibitors of LT biosynthesis using the CAPE 1 structure as framework
may yield stable and potent inhibitors of LT biosynthesis. Such rational design efforts
will certainly be aided by the recent description of the crystal structure of the human
5-LO protein (49).

5.7. Acknowledgements
The authors would like to acknowledge the technical assistance of Natalie Levesque on
the mass spectrometer and Dany Desjardins for the synthesis of compound 9 precursors.

5.8. Abbreviations
5-LO, 5-lipoxygenase; AA, arachidonic acid; AAPH, 2,2-azobis(2-amidinopropane)
dihydrochloride; BSA, bovine serum albumin; CAPE, caffeic acid phenethyl ester;
cPLA
2
,

group IVA phospholipase A
2
; DDPH, 2,2-Diphenyl-1-picrylhydrazyl; DMF,
N,N-dimethylformamide; DMSO, dimethyl sulfoxide; HBSS, Hanks balanced salt
solution; LT, leukotriene; PGB
2
, prostaglandin B
2
; PMNL, polymorphonuclear
leukocytes.

116
5.9. References
1. Samuelsson, B., Leukotrienes: mediators of immediate hypersensitivity reactions
and inflammation. Science, 1983. 220(4597): p. 568-75.
2. Mehrabian, M., H. Allayee, J. Wong, W. Shi, X.P. Wang, et al., Identification of
5-lipoxygenase as a major gene contributing to atherosclerosis susceptibility in
mice. Circ Res, 2002. 91(2): p. 120-6.
3. Leff, J.A., W.W. Busse, D. Pearlman, E.A. Bronsky, J. Kemp, et al., Montelukast,
a leukotriene-receptor antagonist, for the treatment of mild asthma and exercise-
induced bronchoconstriction. N Engl J Med, 1998. 339(3): p. 147-52.
4. Chen, M., B.K. Lam, Y. Kanaoka, P.A. Nigrovic, L.P. Audoly, et al., Neutrophil-
derived leukotriene B4 is required for inflammatory arthritis. J Exp Med, 2006.
203(4): p. 837-42.
5. Gupta, S., M. Srivastava, N. Ahmad, K. Sakamoto, D.G. Bostwick, et al.,
Lipoxygenase-5 is overexpressed in prostate adenocarcinoma. Cancer, 2001.
91(4): p. 737-43.
6. Chen, Y., D. Li, and S. Li, The Alox5 gene is a novel therapeutic target in cancer
stem cells of chronic myeloid leukemia. Cell Cycle, 2009. 8(21): p. 3488-92.
7. Pergola, C. and O. Werz, 5-Lipoxygenase inhibitors: a review of recent
developments and patents. Expert Opin Ther Pat, 2010. 20(3): p. 355-75.
8. Berger, W., M.T. De Chandt, and C.B. Cairns, Zileuton: clinical implications of
5-Lipoxygenase inhibition in severe airway disease. Int J Clin Pract, 2007. 61(4):
p. 663-76.
9. Liu, M.C., L.M. Dube, and J. Lancaster, Acute and chronic effects of a 5-
lipoxygenase inhibitor in asthma: a 6-month randomized multicenter trial.
Zileuton Study Group. J Allergy Clin Immunol, 1996. 98(5 Pt 1): p. 859-71.
10. Garcia-Marcos, L., A. Schuster, and E.G. Perez-Yarza, Benefit-risk assessment of
antileukotrienes in the management of asthma. Drug Saf, 2003. 26(7): p. 483-518.
11. Parlakpinar, H., S. Tasdemir, A. Polat, A. Bay-Karabulut, N. Vardi, et al.,
Protective role of caffeic acid phenethyl ester (cape) on gentamicin-induced acute
renal toxicity in rats. Toxicology, 2005. 207(2): p. 169-77.

117
12. Gokalp, O., E. Uz, E. Cicek, H.R. Yilmaz, M.K. Ozer, et al., Ameliorating role of
caffeic acid phenethyl ester (CAPE) against isoniazid-induced oxidative damage
in red blood cells. Mol Cell Biochem, 2006. 290(1-2): p. 55-9.
13. Sud'ina, G.F., O.K. Mirzoeva, M.A. Pushkareva, G.A. Korshunova, N.V.
Sumbatyan, et al., Caffeic acid phenethyl ester as a lipoxygenase inhibitor with
antioxidant properties. FEBS Lett, 1993. 329(1-2): p. 21-4.
14. Mirzoeva, O.K. and P.C. Calder, The effect of propolis and its components on
eicosanoid production during the inflammatory response. Prostaglandins Leukot
Essent Fatty Acids, 1996. 55(6): p. 441-9.
15. Michaluart, P., J.L. Masferrer, A.M. Carothers, K. Subbaramaiah, B.S. Zweifel, et
al., Inhibitory effects of caffeic acid phenethyl ester on the activity and expression
of cyclooxygenase-2 in human oral epithelial cells and in a rat model of
inflammation. Cancer Res, 1999. 59(10): p. 2347-52.
16. Boudreau, L.H., N. Picot, J. Doiron, B. Villebonet, M.E. Surette, et al., Caffeoyl
and cinnamoyl clusters with anti-inflammatory and anti-cancer effects. Synthesis
and structureactivity relationship. New J. Chem., 2009. 33: p. 1932-1940.
17. Doiron, J., L.H. Boudreau, N. Picot, B. Villebonet, M.E. Surette, et al., Synthesis
and 5-lipoxygenase inhibitory activity of new cinnamoyl and caffeoyl clusters.
Bioorg Med Chem Lett, 2009. 19(4): p. 1118-21.
18. Chamulitrat, W., R.P. Mason, and D. Riendeau, Nitroxide metabolites from
alkylhydroxylamines and N-hydroxyurea derivatives resulting from reductive
inhibition of soybean lipoxygenase. J Biol Chem, 1992. 267(14): p. 9574-9.
19. Wang, X., S. Stavchansky, P.D. Bowman, and S.M. Kerwin, Cytoprotective effect
of caffeic acid phenethyl ester (CAPE) and catechol ring-fluorinated CAPE
derivatives against menadione-induced oxidative stress in human endothelial
cells. Bioorg Med Chem, 2006. 14(14): p. 4879-87.
20. Brckner, R., Advanced organic chemistry: reaction mechanisms.
Harcourt/Academic Press, 2002: p. 238-240.
21. Kunishima, M., C. Kawachi, J. Morita, K. Terao, F. Iwasaki, et al., 4-(4,6-
dimethoxy-1,3,5-triazin-2-yl)-4-methyl-morpholinium chloride: an efficient

118
condensing agent leading to the formation of amides and esters Tetrahedron,
1999. 55: p. 13159-13170.
22. Mahapatra, T., P. Amarendra, and A.K. Mitra, A green procedure for the
synthesis of cinnamate esters using Aliquat336. J Chem Res, 2005. 10: p. 629-
631.
23. Rajan, P., I. Vedernikova, P. Cos, D.V. Berghe, K. Augustyns, et al., Synthesis
and evaluation of caffeic acid amides as antioxidants. Bioorg Med Chem Lett,
2001. 11(2): p. 215-7.
24. Son, S., E.B. Lobkowsky, and B.A. Lewis, Caffeic acid phenethyl ester (CAPE):
synthesis and X-ray crystallographic analysis. Chem Pharm Bull (Tokyo), 2001.
49(2): p. 236-8.
25. Boyum, A., Isolation of mononuclear cells and granulocytes from human blood.
Isolation of monuclear cells by one centrifugation, and of granulocytes by
combining centrifugation and sedimentation at 1 g. Scand J Clin Lab Invest
Suppl, 1968. 97: p. 77-89.
26. Borgeat, P., S. Picard, P. Vallerand, S. Bourgoin, A. Odeimat, et al., Automated
on-line extraction and profiling of lipoxygenase products of arachidonic acid by
high-performance liquid chromatography. Methods Enzymol, 1990. 187: p. 98-
116.
27. Flamand, N., M.E. Surette, S. Picard, S. Bourgoin, and P. Borgeat, Cyclic AMP-
mediated inhibition of 5-lipoxygenase translocation and leukotriene biosynthesis
in human neutrophils. Mol Pharmacol, 2002. 62(2): p. 250-6.
28. Surette, M.E., J.D. Winkler, A.N. Fonteh, and F.H. Chilton, Relationship between
arachidonate--phospholipid remodeling and apoptosis. Biochemistry, 1996.
35(28): p. 9187-96.
29. Surette, M.E., A. Odeimat, R. Palmantier, S. Marleau, P.E. Poubelle, et al.,
Reverse-phase high-performance liquid chromatography analysis of arachidonic
acid metabolites in plasma after stimulation of whole blood ex vivo. Anal
Biochem, 1994. 216(2): p. 392-400.
30. Surette, M.E., I.L. Koumenis, M.B. Edens, K.M. Tramposch, and F.H. Chilton,
Inhibition of leukotriene synthesis, pharmacokinetics, and tolerability of a novel

119
dietary fatty acid formulation in healthy adult subjects. Clin Ther, 2003. 25(3): p.
948-71.
31. Liegeois, C., G. Lermusieau, and S. Collin, Measuring antioxidant efficiency of
wort, malt, and hops against the 2,2'-azobis(2-amidinopropane) dihydrochloride-
induced oxidation of an aqueous dispersion of linoleic acid. J Agric Food Chem,
2000. 48(4): p. 1129-34.
32. Hatano, T., R. Edamastu, A. Mori, Y. Fiujita, T. Yasahura, et al., Effects of the
interaction of tannins with co-existing substances. VI. Effects of tannins and
related polyphenols on superoxide anion radical and on 1,1-diphenyl-
picrylhydrazyl radical. Chem. Pharm. Bull., 1989. 37: p. 2016-2021.
33. Lin, C.F., T.C. Chang, C.C. Chiang, H.J. Tsai, and L.Y. Hsu, Synthesis of
selenium-containing polyphenolic acid esters and evaluation of their effects on
antioxidation and 5-lipoxygenase inhibition. Chem Pharm Bull (Tokyo), 2005.
53(11): p. 1402-7.
34. Rossi, A., C. Pergola, A. Koeberle, M. Hoffmann, F. Dehm, et al., The 5-
lipoxygenase inhibitor, zileuton, suppresses prostaglandin biosynthesis by
inhibition of arachidonic acid release in macrophages. Br J Pharmacol, 2010.
161(3): p. 555-70.
35. Walsh, C.E., B.M. Waite, M.J. Thomas, and L.R. DeChatelet, Release and
metabolism of arachidonic acid in human neutrophils. J Biol Chem, 1981.
256(14): p. 7228-34.
36. Radmark, O., Arachidonate 5-lipoxygenase. Prostaglandins Other Lipid Mediat,
2002. 68-69: p. 211-34.
37. Krump, E., S. Picard, J. Mancini, and P. Borgeat, Suppression of leukotriene B4
biosynthesis by endogenous adenosine in ligand-activated human neutrophils. J
Exp Med, 1997. 186(8): p. 1401-6.
38. Cronstein, B.N., Adenosine, an endogenous anti-inflammatory agent. J Appl
Physiol, 1994. 76(1): p. 5-13.
39. Thibault, N., C. Burelout, D. Harbour, P. Borgeat, P.H. Naccache, et al.,
Occupancy of adenosine A2a receptors promotes fMLP-induced cyclic AMP
accumulation in human neutrophils: impact on phospholipase D activity and

120
recruitment of small GTPases to membranes. J Leukoc Biol, 2002. 71(2): p. 367-
77.
40. Ham, E.A., D.D. Soderman, M.E. Zanetti, H.W. Dougherty, E. McCauley, et al.,
Inhibition by prostaglandins of leukotriene B4 release from activated neutrophils.
Proc Natl Acad Sci U S A, 1983. 80(14): p. 4349-53.
41. Fonteh, A.N., J.D. Winkler, T.J. Torphy, J. Heravi, B.J. Undem, et al., Influence
of isoproterenol and phosphodiesterase inhibitors on platelet-activating factor
biosynthesis in the human neutrophil. J Immunol, 1993. 151(1): p. 339-50.
42. Flamand, N., H. Plante, S. Picard, M. Laviolette, and P. Borgeat, Histamine-
induced inhibition of leukotriene biosynthesis in human neutrophils: involvement
of the H2 receptor and cAMP. Br J Pharmacol, 2004. 141(4): p. 552-61.
43. Surette, M.E., E. Krump, S. Picard, and P. Borgeat, Activation of leukotriene
synthesis in human neutrophils by exogenous arachidonic acid: inhibition by
adenosine A(2a) receptor agonists and crucial role of autocrine activation by
leukotriene B(4). Mol Pharmacol, 1999. 56(5): p. 1055-62.
44. Boudreau, L.H., J. Bertin, P.P. Robichaud, M. Laflamme, R.J. Ouellette, et al.,
Novel 5-lipoxygenase isoforms affect the biosynthesis of 5-lipoxygenase products.
FASEB J, 2011. 25(3): p. 1097-105.
45. Chouinard, F., J.S. Lefebvre, P. Navarro, L. Bouchard, C. Ferland, et al., The
endocannabinoid 2-arachidonoyl-glycerol activates human neutrophils: critical
role of its hydrolysis and de novo leukotriene B4 biosynthesis. J Immunol. 186(5):
p. 3188-96.
46. Flamand, N., J. Lefebvre, M.E. Surette, S. Picard, and P. Borgeat, Arachidonic
acid regulates the translocation of 5-lipoxygenase to the nuclear membranes in
human neutrophils. J Biol Chem, 2006. 281(1): p. 129-36.
47. Surette, M.E., N. Dallaire, N. Jean, S. Picard, and P. Borgeat, Mechanisms of the
priming effect of lipopolysaccharides on the biosynthesis of leukotriene B4 in
chemotactic peptide-stimulated human neutrophils. FASEB J, 1998. 12(14): p.
1521-31.

121
48. Flamand, N., S. Picard, L. Lemieux, M. Pouliot, S.G. Bourgoin, et al., Effects of
pyrrophenone, an inhibitor of group IVA phospholipase A2, on eicosanoid and
PAF biosynthesis in human neutrophils. Br J Pharmacol, 2006. 149(4): p. 385-92.
49. Gilbert, N.C., S.G. Bartlett, M.T. Waight, D.B. Neau, W.E. Boeglin, et al., The
structure of human 5-lipoxygenase. Science, 2011. 331(6014): p. 217-9.



























122
CHAPTER VI: Discussion
6.1 Discovery of novel 5-LO isoforms
In the first part of my thesis, we investigated the potential existence of isoforms of the 5-
LO enzyme. Our hypothesis was primarily established on observations of unidentified
protein bands of lower molecular weight (~ 50 and 65 kDa) from previously published
anti-5-LO immunoblot (118, 172). Our results clearly demonstrate the existence of novel
isoforms of the 5-LO in human neutrophils, as well as in the cell lines THP-1, Raji, Reh
and TA. This is not surprising, since it is estimated that between 70 and 80% of all the
human genes undergo some type of alternative splicing (174-176). The 5-LO isoform o-
10 (retention of intron 10) was present in human neutrophils, Reh and THP-1 cells. Since
isoform 5-LO o-10 possess a premature termination codon induce by intron 10 retention,
this isoform may be susceptible to nonsensemediated mRNA decay based on the 50-55
nucleotide rule (246). Therefore, the potential expression of this isoform in cell may not
be as significant as the other isoforms, explaining why we did not evaluate the impact of
this isoform in our LTs biosynthesis model. Further studies will be needed to evaluate the
amount of o-10 isoforms protein expression in cells. The A-13 isoform (deletion of exon
13) was also found in neutrophils, Reh and THP-1 as well as in the Raji and TA cell
lines. Interestingly, 5-LO isoform A-10,13 (combination of the deletion of exon 10 and 13
in the same mRNA transcript) was only present in the THP-1 cell line, suggesting that
some of these 5-LO isoforms appears in a cell type- or cell line-specific manner.
Furthermore, the A-p10 isoform (deletion of the first 96 base pair of exon 10) was only
found in human neutrophils. A larger cell screening for alternative isoforms of the 5-LO
is needed to confirm that some isoforms are exclusively found in certain cell type or cell
line.

We also noticed that all the truncated novel 5-LO isoforms had modifications resulting
from alternative splicing only in their C-terminal domain, which is the catalytic domain
of the 5-LO enzyme (125), in part due to the presence of a iron atom (130, 131).
Unsurprisingly, when these truncated isoforms where inserted into a pcDNA3.1
expression vector and expressed in cells lacking 5-LO expression (HEK293 cells, in

123
presence of AA and calcium ionophore), no 5-LO activity (analyzed by RP-HPLC
profiling of AA derivatives) was detected. The lack of 5-LO activity observed is probably
the result of significant changes to the iron stability in the catalytic domain (C-terminal
region), since the iron atom is necessary for proper 5-LO activity. One of the most
intriguing results was observed when we coexpressed each of these novel 5-LO isoforms
with the full-length active 5-LO in HEK293 cells. Interestingly, the newly identified 5-
LO isoforms significantly inhibited LT synthesis. Furthermore, in broken cell assays, the
5-LO isoforms did not interfere with the full-length 5-LO in the biosynthesis of LTs. This
suggests that the 5-LO isoforms may compete with full-length active 5-LO for proteins
important in LT biosynthesis, such as CLP or FLAP.

Since the N-terminal C2-like domain plays an important part in the 5-LOs translocation
to the perinuclear membranes upon cell stimulation (125), one potential protein
implicated in this regulatory effect could be CLP. Given that the N-terminal C2-like
domain is still intact in all of these novel 5-LO isoforms, and that CLP is well known to
bind the 5-LO on the Tryp-102 of the N-terminal domain (128, 167, 168), one could
speculate that the inhibition mechanism may involve CLP. In fact, the 5-LO isoforms
could bind CLP and therefore translocate to the perinuclear membrane where it could
interact with FLAP. Since these novel isoforms are deprived of any catalytic activity,
their presence at the perinuclear membrane would results in a steric hindrance, putatively
limiting the translocation of the the full-length 5-LO and its subsequent interaction of
with FLAP (Figure 6.1). Overall, these isoforms might act as natural endogenous
regulators of 5-LO by interfering with the 5-LO/CLP associations.










124
A


B

Figure 6.1: Possible inhibitory mechanism of LT biosynthesis by the 5-LO isoforms.
A) 5-LO wild-type (WT) and CLP co-translocation to the perinuclear membrane upon
calcium mobilization resulting in LTs biosynthesis. B) Perinuclear blockage of the 5-LO
WT by 5-LO isoforms, thus preventing LTs biosynthesis.

Another interesting observation is the subcellular localization of the 5-LO isoform A-13
when compared to the full-length 5-LO in human neutrophils. The A-13 isoform was

125
found exclusively in the nuclear fraction of the cells. In contrast, the full-length 5-LO was
distributed evenly in the non-nuclear and nuclear fraction. This phenomenon was also
observed in transfected HEK293 cells with the A-13 isoform and the full-length 5-LO
(unpublished results). The full-length 5-LO was located evenly in the non-nuclear and
nuclear fraction of the anti-5-LO blots. In contrast, the A-13 isoform was found only in
the nuclear fraction of the anti-5-LO immunoblots, suggesting a potential role for the
A-13 isoform in resting cells. One role could be that since these isoforms are catalytically
inactive, their presence at the nuclear would prevent resting cells from biosynthesizing
LTs (as demonstrated in figure 6.1). Furthermore, the nuclear The specific subcellular
localization of the A-13 isoform was also confirmed by immunofluorescence assay in
which A-13 isoform and FLAP co-localized (unpublished results). Unfortunately, except
for the A-13 isoform, the subcellular localization of the remaining 5-LO isoforms has not
been evaluated yet.

As previously mentioned, the A-13 isoform is predominantly found in the nuclear
compartment of transfected HEK293 cells and human neutrophils; therefore its potential
interaction with the FLAP should be investigated. We think that the 5-LO isoforms
interact with FLAP at the perinuclear membrane of resting cells. One-way to confirm this
would be the use of a FLAP inhibitor, since FLAP inhibitors prevent translocation of the
full-length 5-LO to the perinuclear membrane (140, 158, 160). An observation of
cytosolic A-13 following FLAP inhibitors treatment would suggest a possible interaction
between A-13 and FLAP.

Finally, other studies investigating 5-LO isoforms expression are needed. Our current
data regarding possible protein expression is limited to co-migrating bands in Raji and
neutrophils. Experiments involving immunoprecipitation of 5-LO isoforms followed by
mass spectrometry analysis would help to confirm that 5-LO isoforms are actually
expressed and present in specific subcellular compartments and that the observation of
smaller protein bands (~ 50 and 65 kDa) in neutrophils is not the result of protease-
mediated degradation of the 5-LO, as seen in B lymphocytic cells (173), where 5-LO was
cleaved by caspase. Furthermore, with the recent characterization of 5-LO dimers (123),

126
it would be interesting to investigate if the 5-LO isoforms also exist in dimeric complexes
with other isoforms or full-length 5-LO.

6.2 The anti-inflammatory effects of caffeic acid phenethyl ester
In the second part of my thesis, we evaluated natural occurring 5-LO inhibitors such as
caffeic acid and its derivative, CAPE and compared them to the zileuton. Caffeic acid and
its derivatives have demonstrated anti-inflammatory (242, 243), antioxidant (239-241),
anti-tumor and anti-proliferative properties (247-249). The regulation of the LT
biosynthesis is crucial during normal homeostatis of the human body but can also be
harmful to the host as demonstrated in chronic inflammatory diseases such as
atherosclerosis (87, 90), asthma (74, 75, 80) and arthritis (92, 93) in which LTs are
thought to play a pivotal role.

More than one protein can be targeted to decrease LT biosynthesis. For example, FLAP
inhibitors such as MK-886, Bay-X 1005, MK-0591 and AM103 (221-224), cPLA
2
o
inhibitors such as pyrroxyphene (232), LTA
4
inhibitors, and 5-LO inhibitors such as
zileuton (194) are all potent LT biosynthesis inhibitors. Unfortunately, of all the
inhibitors mentioned above, only zileuton has entered the market despite some mild liver
toxicity has resulted from its daily usage (86, 195). It is clear that there is room for
improvement regarding potent 5-LO inhibitors.

Overall, the second part of my thesis consisted of a small structure-activity relationship
study of derivatives originating from the caffeic acid and cinnamic acid. Since the
hydroxyl groups within the catechol moiety were reported to play an important role in
several biological activities (250), cinnamoyl analogues were also synthesized to evaluate
the effects of the presence of these functional groups. In addition, both ester and amide
analogues of CAPE were designed with the rationale that those esters may be more
susceptible to chemical and enzymatic degradation compared to the corresponding amide.

Interestingly, CAPE was found to be a more potent LT biosynthesis inhibitor than
zileuton in stimulated human neutrophils and 5-LO broken cell assays but was equipotent

127
in whole blood stimulation. Furthermore, LT biosynthesis inhibition by CAPE is the
consequence of multiple mechanisms of action: 1) 5-LO inhibition as seen in broken cell
assays; 2) antioxidant properties of CAPE since the 5-LO enzyme is susceptible to
antioxidant compounds; and 3) inhibition of AA release from membrane phospholipids.
The inhibitory effect of CAPE on AA release was investigated since zileuton, the
reference molecule, was recently shown to inhibit this release (251). Unfortunately,
CAPEs amide analogue, the compound 9, had either a equipotent or worse inhibitory
activity than CAPE in broken cell assays, stimulated human neutrophils or whole blood
stimulation. Furthermore, compound 9 did not significantly inhibit the AA release from
phospholipid membranes, in contrast to CAPE. Since CAPE has previously demonstrated
potent inhibition of COX products (243, 252), we think CAPE should be classified as a
dual 5-LO/COX-pathway inhibitor in the same category as the licofelone drug (218).
Although compound 9 was not as potent as CAPE and zileuton to inhibit LT biosynthesis
ex vivo, we should not discard compound 9 for future testing. In fact, since compound 9 is
the amide analogue of CAPE, it may be less prone to esterase breakdown, which could
result in a more stable compound in vivo.

Another interesting observation was that caffeic acid was unable to inhibit LT
biosynthesis at all in our experiments models. It had been previously reported that caffeic
acid inhibits LT biosynthesis (242). Our results clearly contradict those observations. In
fact, our structure-relationship experiments demonstrated that order to obtain an
inhibition of LT biosynthesis, the catechol moiety and a functional group attached to the
carboxylic acid function of caffeic was necessary.

Finally, it is important to note that CAPE was previously reported to inhibit plant
lipoxygenase using linoleic acid as a substrate (241, 253). Unfortunately, the authors
reported this activity as one of a 5-LO substrate. This was incorrect since linoleic acid is
not a 5-LO substrate and the product of the plant lipoxygenase-catalyzed reaction,
9-hydroperoxy-10,12-octadecadienoic acid, is not a 5-LO product. Therefore, our study
clarifies the literature regarding 5-LO inhibition by CAPE as we are the first to report
inhibition of the 5-LO by CAPE and its amide analogue, compound 9.

128
CHAPTER VII: Perspectives and Conclusions
In terms of perspectives, in regards to the existence of 5-LO isoforms, numerous
questions needs to be answered, such as: 1) What are the regulation factors for these
isoforms? 2) Are they overexpressed in presence of anti-inflammatory mediators, which
would result in a decreased LT biosynthesis? 2) What is the biological role and types of
5-LO isoforms found in inflammatory diseases, such as atherosclerosis, arthritis and
asthma? 4) What are the molecular mechanisms by which 5-LO isoforms inhibit LT
biosynthesis? 5) Do the isoforms interact with full-length 5-LO, CLP and/FLAP? All
these questions remain unanswered at this time and foster additional studies, since we
have only scratch the surface of the role and purpose of 5-LO isoforms.

Since we demonstrated that these 5-LO isoforms exhibit anti-inflammatory properties (in
particular A-13 and A-p10), it would be interesting to investigate that potential regulation
of the alternative splicing of ALOX5 in cells during various stages of the inflammation
process. In fact, protein and mRNA expression of these novel 5-LO isoforms might be
upregulated during the resolution stages of the inflammatory response.

As for the 5-LO inhibitor CAPE, the next logical step would definitely involve in vivo
experiments. It would be interesting to evaluate CAPEs potential in terms of protecting
murine models from inflammatory diseases such as atherosclerosis or arthritis. Of course,
since we know that the catechol moiety and the phenethyl group are necessary for potent
LTs biosynthesis inhibition, structural design of new compounds can be envisioned based
on these observations. As previously developed 5-LO inhibitors have shown, toxicology
and bioavailability tests will also be of crucial importance in the next phase of testing of
this 5-LO inhibitor.

In conclusion, we bring new and innovative information to the physiological and
pharmacological control of 5-LO. Our approach consisted of targeting regulation of the
pro-inflammatory effects of the 5-LO. The discovery of novel 5-LO isoforms provides
new insights, particularly in regards to the resolution of inflammation. Interestingly, the

129
existence of natural occurring compounds as a potent 5-LO inhibitor, such as CAPE, a
clear example that we are exposed to pharmacological compounds in our everyday life.





















130
Rfrences

1. Crawford, M.A., Background to essential fatty acids and their prostanoid
derivatives. Br Med Bull, 1983. 39(3): p. 210-3.
2. Borgeat, P., M. Hamberg, and B. Samuelsson, Transformation of arachidonic
acid and homo-gamma-linolenic acid by rabbit polymorphonuclear leukocytes.
Monohydroxy acids from novel lipoxygenases. J Biol Chem, 1976. 251(24): p.
7816-20.
3. Samuelsson, B., Leukotrienes: mediators of immediate hypersensitivity reactions
and inflammation. Science, 1983. 220(4597): p. 568-75.
4. Taber, L., C.H. Chiu, and J. Whelan, Assessment of the arachidonic acid content
in foods commonly consumed in the American diet. Lipids, 1998. 33(12): p. 1151-
7.
5. Rivers, J.P., A.J. Sinclair, and M.A. Craqford, Inability of the cat to desaturate
essential fatty acids. Nature, 1975. 258(5531): p. 171-3.
6. Uozumi, N., K. Kume, T. Nagase, N. Nakatani, S. Ishii, et al., Role of cytosolic
phospholipase A2 in allergic response and parturition. Nature, 1997. 390(6660):
p. 618-22.
7. Bonventre, J.V., Z. Huang, M.R. Taheri, E. O'Leary, E. Li, et al., Reduced fertility
and postischaemic brain injury in mice deficient in cytosolic phospholipase A2.
Nature, 1997. 390(6660): p. 622-5.
8. Hirabayashi, T., T. Murayama, and T. Shimizu, Regulatory mechanism and
physiological role of cytosolic phospholipase A2. Biol Pharm Bull, 2004. 27(8): p.
1168-73.
9. Clark, J.D., N. Milona, and J.L. Knopf, Purification of a 110-kilodalton cytosolic
phospholipase A2 from the human monocytic cell line U937. Proc Natl Acad Sci
U S A, 1990. 87(19): p. 7708-12.
10. Clark, J.D., L.L. Lin, R.W. Kriz, C.S. Ramesha, L.A. Sultzman, et al., A novel
arachidonic acid-selective cytosolic PLA2 contains a Ca(2+)-dependent
translocation domain with homology to PKC and GAP. Cell, 1991. 65(6): p.
1043-51.

131
11. Ramesha, C.S. and D.L. Ives, Detection of arachidonoyl-selective phospholipase
A2 in human neutrophil cytosol. Biochim Biophys Acta, 1993. 1168(1): p. 37-44.
12. Glover, S., M.S. de Carvalho, T. Bayburt, M. Jonas, E. Chi, et al., Translocation
of the 85-kDa phospholipase A2 from cytosol to the nuclear envelope in rat
basophilic leukemia cells stimulated with calcium ionophore or IgE/antigen. J
Biol Chem, 1995. 270(25): p. 15359-67.
13. Schievella, A.R., M.K. Regier, W.L. Smith, and L.L. Lin, Calcium-mediated
translocation of cytosolic phospholipase A2 to the nuclear envelope and
endoplasmic reticulum. J Biol Chem, 1995. 270(51): p. 30749-54.
14. Leslie, C.C., Properties and regulation of cytosolic phospholipase A2. J Biol
Chem, 1997. 272(27): p. 16709-12.
15. Evans, J.H., D.M. Spencer, A. Zweifach, and C.C. Leslie, Intracellular calcium
signals regulating cytosolic phospholipase A2 translocation to internal
membranes. J Biol Chem, 2001. 276(32): p. 30150-60.
16. Peters-Golden, M. and W.R. Henderson, Jr., Leukotrienes. N Engl J Med, 2007.
357(18): p. 1841-54.
17. Henderson, W.R., Jr., The role of leukotrienes in inflammation. Ann Intern Med,
1994. 121(9): p. 684-97.
18. Henderson, W.R., Jr., Role of leukotrienes in asthma. Ann Allergy, 1994. 72(3):
p. 272-8.
19. Austen, K.F., A. Maekawa, Y. Kanaoka, and J.A. Boyce, The leukotriene E4
puzzle: finding the missing pieces and revealing the pathobiologic implications. J
Allergy Clin Immunol, 2009. 124(3): p. 406-14; quiz 415-6.
20. Henderson, W.R., Jr., E.Y. Chi, J.G. Bollinger, Y.T. Tien, X. Ye, et al.,
Importance of group X-secreted phospholipase A2 in allergen-induced airway
inflammation and remodeling in a mouse asthma model. J Exp Med, 2007.
204(4): p. 865-77.
21. Rouzer, C.A., T. Matsumoto, and B. Samuelsson, Single protein from human
leukocytes possesses 5-lipoxygenase and leukotriene A4 synthase activities. Proc
Natl Acad Sci U S A, 1986. 83(4): p. 857-61.

132
22. Radmark, O. and B. Samuelsson, Regulation of 5-lipoxygenase enzyme activity.
Biochem Biophys Res Commun, 2005. 338(1): p. 102-10.
23. Powell, W.S., S. Gravel, and F. Halwani, 5-oxo-6,8,11,14-eicosatetraenoic acid is
a potent stimulator of L-selectin shedding, surface expression of CD11b, actin
polymerization, and calcium mobilization in human eosinophils. Am J Respir Cell
Mol Biol, 1999. 20(1): p. 163-70.
24. Serhan, C.N., M. Hamberg, and B. Samuelsson, Lipoxins: novel series of
biologically active compounds formed from arachidonic acid in human
leukocytes. Proc Natl Acad Sci U S A, 1984. 81(17): p. 5335-9.
25. Rowley, A.F., P. Lloyd-Evans, S.E. Barrow, and C.N. Serhan, Lipoxin
biosynthesis by trout macrophages involves the formation of epoxide
intermediates. Biochemistry, 1994. 33(4): p. 856-63.
26. Yokomizo, T., T. Izumi, K. Chang, Y. Takuwa, and T. Shimizu, A G-protein-
coupled receptor for leukotriene B4 that mediates chemotaxis. Nature, 1997.
387(6633): p. 620-4.
27. Huang, W.W., E.A. Garcia-Zepeda, A. Sauty, H.C. Oettgen, M.E. Rothenberg, et
al., Molecular and biological characterization of the murine leukotriene B4
receptor expressed on eosinophils. J Exp Med, 1998. 188(6): p. 1063-74.
28. Akbar, G.K., V.R. Dasari, T.E. Webb, K. Ayyanathan, K. Pillarisetti, et al.,
Molecular cloning of a novel P2 purinoceptor from human erythroleukemia cells.
J Biol Chem, 1996. 271(31): p. 18363-7.
29. Yokomizo, T., K. Kato, K. Terawaki, T. Izumi, and T. Shimizu, A second
leukotriene B(4) receptor, BLT2. A new therapeutic target in inflammation and
immunological disorders. J Exp Med, 2000. 192(3): p. 421-32.
30. Yokomizo, T., T. Izumi, and T. Shimizu, Leukotriene B4: metabolism and signal
transduction. Arch Biochem Biophys, 2001. 385(2): p. 231-41.
31. Tager, A.M. and A.D. Luster, BLT1 and BLT2: the leukotriene B(4) receptors.
Prostaglandins Leukot Essent Fatty Acids, 2003. 69(2-3): p. 123-34.
32. Tryselius, Y., N.E. Nilsson, K. Kotarsky, B. Olde, and C. Owman, Cloning and
characterization of cDNA encoding a novel human leukotriene B(4) receptor.
Biochem Biophys Res Commun, 2000. 274(2): p. 377-82.

133
33. Wang, S., E. Gustafson, L. Pang, X. Qiao, J. Behan, et al., A novel
hepatointestinal leukotriene B4 receptor. Cloning and functional
characterization. J Biol Chem, 2000. 275(52): p. 40686-94.
34. Kamohara, M., J. Takasaki, M. Matsumoto, T. Saito, T. Ohishi, et al., Molecular
cloning and characterization of another leukotriene B4 receptor. J Biol Chem,
2000. 275(35): p. 27000-4.
35. Okuno, T., T. Yokomizo, T. Hori, M. Miyano, and T. Shimizu, Leukotriene B4
receptor and the function of its helix 8. J Biol Chem, 2005. 280(37): p. 32049-52.
36. Back, M., D.X. Bu, R. Branstrom, Y. Sheikine, Z.Q. Yan, et al., Leukotriene B4
signaling through NF-kappaB-dependent BLT1 receptors on vascular smooth
muscle cells in atherosclerosis and intimal hyperplasia. Proc Natl Acad Sci U S
A, 2005. 102(48): p. 17501-6.
37. Qiu, H., A.S. Johansson, M. Sjostrom, M. Wan, O. Schroder, et al., Differential
induction of BLT receptor expression on human endothelial cells by
lipopolysaccharide, cytokines, and leukotriene B4. Proc Natl Acad Sci U S A,
2006. 103(18): p. 6913-8.
38. Sun, R., X. Ba, L. Cui, Y. Xue, and X. Zeng, Leukotriene B4 regulates
proliferation and differentiation of cultured rat myoblasts via the BLT1 pathway.
Mol Cells, 2009. 27(4): p. 403-8.
39. Wada, K., M. Arita, A. Nakajima, K. Katayama, C. Kudo, et al., Leukotriene B4
and lipoxin A4 are regulatory signals for neural stem cell proliferation and
differentiation. FASEB J, 2006. 20(11): p. 1785-92.
40. Yokomizo, T., K. Kato, H. Hagiya, T. Izumi, and T. Shimizu,
Hydroxyeicosanoids bind to and activate the low affinity leukotriene B4 receptor,
BLT2. J Biol Chem, 2001. 276(15): p. 12454-9.
41. Tager, A.M., J.H. Dufour, K. Goodarzi, S.D. Bercury, U.H. von Andrian, et al.,
BLTR mediates leukotriene B(4)-induced chemotaxis and adhesion and plays a
dominant role in eosinophil accumulation in a murine model of peritonitis. J Exp
Med, 2000. 192(3): p. 439-46.
42. Haribabu, B., M.W. Verghese, D.A. Steeber, D.D. Sellars, C.B. Bock, et al.,
Targeted disruption of the leukotriene B(4) receptor in mice reveals its role in

134
inflammation and platelet-activating factor-induced anaphylaxis. J Exp Med,
2000. 192(3): p. 433-8.
43. Chiang, N., K. Gronert, C.B. Clish, J.A. O'Brien, M.W. Freeman, et al.,
Leukotriene B4 receptor transgenic mice reveal novel protective roles for lipoxins
and aspirin-triggered lipoxins in reperfusion. J Clin Invest, 1999. 104(3): p. 309-
16.
44. Subbarao, K., V.R. Jala, S. Mathis, J. Suttles, W. Zacharias, et al., Role of
leukotriene B4 receptors in the development of atherosclerosis: potential
mechanisms. Arterioscler Thromb Vasc Biol, 2004. 24(2): p. 369-75.
45. Heller, E.A., E. Liu, A.M. Tager, S. Sinha, J.D. Roberts, et al., Inhibition of
atherogenesis in BLT1-deficient mice reveals a role for LTB4 and BLT1 in smooth
muscle cell recruitment. Circulation, 2005. 112(4): p. 578-86.
46. Kim, N.D., R.C. Chou, E. Seung, A.M. Tager, and A.D. Luster, A unique
requirement for the leukotriene B4 receptor BLT1 for neutrophil recruitment in
inflammatory arthritis. J Exp Med, 2006. 203(4): p. 829-35.
47. Mathis, S.P., V.R. Jala, D.M. Lee, and B. Haribabu, Nonredundant roles for
leukotriene B4 receptors BLT1 and BLT2 in inflammatory arthritis. J Immunol,
2010. 185(5): p. 3049-56.
48. Arita, M., T. Ohira, Y.P. Sun, S. Elangovan, N. Chiang, et al., Resolvin E1
selectively interacts with leukotriene B4 receptor BLT1 and ChemR23 to regulate
inflammation. J Immunol, 2007. 178(6): p. 3912-7.
49. Iizuka, Y., T. Okuno, K. Saeki, H. Uozaki, S. Okada, et al., Protective role of the
leukotriene B4 receptor BLT2 in murine inflammatory colitis. FASEB J, 2010.
24(12): p. 4678-90.
50. Okuno, T., Y. Iizuka, H. Okazaki, T. Yokomizo, R. Taguchi, et al., 12(S)-
Hydroxyheptadeca-5Z, 8E, 10E-trienoic acid is a natural ligand for leukotriene
B4 receptor 2. J Exp Med, 2008. 205(4): p. 759-66.
51. Kim, G.Y., J.W. Lee, S.H. Cho, J.M. Seo, and J.H. Kim, Role of the low-affinity
leukotriene B4 receptor BLT2 in VEGF-induced angiogenesis. Arterioscler
Thromb Vasc Biol, 2009. 29(6): p. 915-20.

135
52. Devchand, P.R., H. Keller, J.M. Peters, M. Vazquez, F.J. Gonzalez, et al., The
PPARalpha-leukotriene B4 pathway to inflammation control. Nature, 1996.
384(6604): p. 39-43.
53. Krey, G., O. Braissant, F. L'Horset, E. Kalkhoven, M. Perroud, et al., Fatty acids,
eicosanoids, and hypolipidemic agents identified as ligands of peroxisome
proliferator-activated receptors by coactivator-dependent receptor ligand assay.
Mol Endocrinol, 1997. 11(6): p. 779-91.
54. Lin, Q., S.E. Ruuska, N.S. Shaw, D. Dong, and N. Noy, Ligand selectivity of the
peroxisome proliferator-activated receptor alpha. Biochemistry, 1999. 38(1): p.
185-90.
55. Brown, J.D. and J. Plutzky, Peroxisome proliferator-activated receptors as
transcriptional nodal points and therapeutic targets. Circulation, 2007. 115(4): p.
518-33.
56. Narala, V.R., R.K. Adapala, M.V. Suresh, T.G. Brock, M. Peters-Golden, et al.,
Leukotriene B4 is a physiologically relevant endogenous peroxisome proliferator-
activated receptor-alpha agonist. J Biol Chem, 2010. 285(29): p. 22067-74.
57. Sarau, H.M., R.S. Ames, J. Chambers, C. Ellis, N. Elshourbagy, et al.,
Identification, molecular cloning, expression, and characterization of a cysteinyl
leukotriene receptor. Mol Pharmacol, 1999. 56(3): p. 657-63.
58. Lynch, K.R., G.P. O'Neill, Q. Liu, D.S. Im, N. Sawyer, et al., Characterization of
the human cysteinyl leukotriene CysLT1 receptor. Nature, 1999. 399(6738): p.
789-93.
59. Mellor, E.A., A. Maekawa, K.F. Austen, and J.A. Boyce, Cysteinyl leukotriene
receptor 1 is also a pyrimidinergic receptor and is expressed by human mast
cells. Proc Natl Acad Sci U S A, 2001. 98(14): p. 7964-9.
60. Sjostrom, M., P.J. Jakobsson, M. Juremalm, A. Ahmed, G. Nilsson, et al., Human
mast cells express two leukotriene C(4) synthase isoenzymes and the CysLT(1)
receptor. Biochim Biophys Acta, 2002. 1583(1): p. 53-62.
61. Brink, C., S.E. Dahlen, J. Drazen, J.F. Evans, D.W. Hay, et al., International
Union of Pharmacology XXXVII. Nomenclature for leukotriene and lipoxin
receptors. Pharmacol Rev, 2003. 55(1): p. 195-227.

136
62. Beller, T.C., A. Maekawa, D.S. Friend, K.F. Austen, and Y. Kanaoka, Targeted
gene disruption reveals the role of the cysteinyl leukotriene 2 receptor in
increased vascular permeability and in bleomycin-induced pulmonary fibrosis in
mice. J Biol Chem, 2004. 279(44): p. 46129-34.
63. Hui, Y., Y. Cheng, I. Smalera, W. Jian, L. Goldhahn, et al., Directed vascular
expression of human cysteinyl leukotriene 2 receptor modulates endothelial
permeability and systemic blood pressure. Circulation, 2004. 110(21): p. 3360-6.
64. Jiang, W., S.R. Hall, M.P. Moos, R.Y. Cao, S. Ishii, et al., Endothelial cysteinyl
leukotriene 2 receptor expression mediates myocardial ischemia-reperfusion
injury. Am J Pathol, 2008. 172(3): p. 592-602.
65. Kanaoka, Y. and J.A. Boyce, Cysteinyl leukotrienes and their receptors: cellular
distribution and function in immune and inflammatory responses. J Immunol,
2004. 173(3): p. 1503-10.
66. Sjostrom, M., A.S. Johansson, O. Schroder, H. Qiu, J. Palmblad, et al., Dominant
expression of the CysLT2 receptor accounts for calcium signaling by cysteinyl
leukotrienes in human umbilical vein endothelial cells. Arterioscler Thromb Vasc
Biol, 2003. 23(8): p. e37-41.
67. Lotzer, K., R. Spanbroek, M. Hildner, A. Urbach, R. Heller, et al., Differential
leukotriene receptor expression and calcium responses in endothelial cells and
macrophages indicate 5-lipoxygenase-dependent circuits of inflammation and
atherogenesis. Arterioscler Thromb Vasc Biol, 2003. 23(8): p. e32-6.
68. Paruchuri, S., H. Tashimo, C. Feng, A. Maekawa, W. Xing, et al., Leukotriene
E4-induced pulmonary inflammation is mediated by the P2Y12 receptor. J Exp
Med, 2009. 206(11): p. 2543-55.
69. Paruchuri, S., Y. Jiang, C. Feng, S.A. Francis, J. Plutzky, et al., Leukotriene E4
activates peroxisome proliferator-activated receptor gamma and induces
prostaglandin D2 generation by human mast cells. J Biol Chem, 2008. 283(24): p.
16477-87.
70. Ciana, P., M. Fumagalli, M.L. Trincavelli, C. Verderio, P. Rosa, et al., The
orphan receptor GPR17 identified as a new dual uracil nucleotides/cysteinyl-
leukotrienes receptor. EMBO J, 2006. 25(19): p. 4615-27.

137
71. Maekawa, A., Y. Kanaoka, W. Xing, and K.F. Austen, Functional recognition of
a distinct receptor preferential for leukotriene E4 in mice lacking the cysteinyl
leukotriene 1 and 2 receptors. Proc Natl Acad Sci U S A, 2008. 105(43): p.
16695-700.
72. Holgate, S.T. and A.J. Frew, Choosing therapy for childhood asthma. N Engl J
Med, 1997. 337(23): p. 1690-2.
73. Lewis, R.A., K.F. Austen, and R.J. Soberman, Leukotrienes and other products of
the 5-lipoxygenase pathway. Biochemistry and relation to pathobiology in human
diseases. N Engl J Med, 1990. 323(10): p. 645-55.
74. Drazen, J.M., Comparative contractile responses to sulfidopeptide leukotrienes in
normal and asthmatic human subjects. Ann N Y Acad Sci, 1988. 524: p. 289-97.
75. Bisgaard, H., S. Groth, and F. Madsen, Bronchial hyperreactivity to leucotriene
D4 and histamine in exogenous asthma. Br Med J (Clin Res Ed), 1985.
290(6480): p. 1468-71.
76. Walch, L., X. Norel, J.P. Gascard, and C. Brink, Functional studies of leukotriene
receptors in vascular tissues. Am J Respir Crit Care Med, 2000. 161(2 Pt 2): p.
S107-11.
77. Marom, Z., J.H. Shelhamer, M.K. Bach, D.R. Morton, and M. Kaliner, Slow-
reacting substances, leukotrienes C4 and D4, increase the release of mucus from
human airways in vitro. Am Rev Respir Dis, 1982. 126(3): p. 449-51.
78. Holgate, S.T., M. Peters-Golden, R.A. Panettieri, and W.R. Henderson, Jr., Roles
of cysteinyl leukotrienes in airway inflammation, smooth muscle function, and
remodeling. J Allergy Clin Immunol, 2003. 111(1 Suppl): p. S18-34; discussion
S34-6.
79. Cheng, H., J.A. Leff, R. Amin, B.J. Gertz, M. De Smet, et al., Pharmacokinetics,
bioavailability, and safety of montelukast sodium (MK-0476) in healthy males and
females. Pharm Res, 1996. 13(3): p. 445-8.
80. Lee, E., T. Lindo, N. Jackson, L. Meng-Choong, P. Reynolds, et al., Reversal of
human neutrophil survival by leukotriene B(4) receptor blockade and 5-
lipoxygenase and 5-lipoxygenase activating protein inhibitors. Am J Respir Crit
Care Med, 1999. 160(6): p. 2079-85.

138
81. Tager, A.M., S.K. Bromley, B.D. Medoff, S.A. Islam, S.D. Bercury, et al.,
Leukotriene B4 receptor BLT1 mediates early effector T cell recruitment. Nat
Immunol, 2003. 4(10): p. 982-90.
82. Islam, S.A., S.Y. Thomas, C. Hess, B.D. Medoff, T.K. Means, et al., The
leukotriene B4 lipid chemoattractant receptor BLT1 defines antigen-primed T
cells in humans. Blood, 2006. 107(2): p. 444-53.
83. Evans, D.J., P.J. Barnes, S.M. Spaethe, E.L. van Alstyne, M.I. Mitchell, et al.,
Effect of a leukotriene B4 receptor antagonist, LY293111, on allergen induced
responses in asthma. Thorax, 1996. 51(12): p. 1178-84.
84. Drazen, J.M., E. Israel, and P.M. O'Byrne, Treatment of asthma with drugs
modifying the leukotriene pathway. N Engl J Med, 1999. 340(3): p. 197-206.
85. Knapp, H.R., Reduced allergen-induced nasal congestion and leukotriene
synthesis with an orally active 5-lipoxygenase inhibitor. N Engl J Med, 1990.
323(25): p. 1745-8.
86. Beierschmitt, W.P., J.D. McNeish, R.J. Griffiths, A. Nagahisa, M. Nakane, et al.,
Induction of hepatic microsomal drug-metabolizing enzymes by inhibitors of 5-
lipoxygenase (5-LO): studies in rats and 5-LO knockout mice. Toxicol Sci, 2001.
63(1): p. 15-21.
87. Aiello, R.J., P.A. Bourassa, S. Lindsey, W. Weng, A. Freeman, et al., Leukotriene
B4 receptor antagonism reduces monocytic foam cells in mice. Arterioscler
Thromb Vasc Biol, 2002. 22(3): p. 443-9.
88. Spanbroek, R., R. Grabner, K. Lotzer, M. Hildner, A. Urbach, et al., Expanding
expression of the 5-lipoxygenase pathway within the arterial wall during human
atherogenesis. Proc Natl Acad Sci U S A, 2003. 100(3): p. 1238-43.
89. Qiu, H., A. Gabrielsen, H.E. Agardh, M. Wan, A. Wetterholm, et al., Expression
of 5-lipoxygenase and leukotriene A4 hydrolase in human atherosclerotic lesions
correlates with symptoms of plaque instability. Proc Natl Acad Sci U S A, 2006.
103(21): p. 8161-6.
90. Mehrabian, M., H. Allayee, J. Wong, W. Shi, X.P. Wang, et al., Identification of
5-lipoxygenase as a major gene contributing to atherosclerosis susceptibility in
mice. Circ Res, 2002. 91(2): p. 120-6.

139
91. Klickstein, L.B., C. Shapleigh, and E.J. Goetzl, Lipoxygenation of arachidonic
acid as a source of polymorphonuclear leukocyte chemotactic factors in synovial
fluid and tissue in rheumatoid arthritis and spondyloarthritis. J Clin Invest, 1980.
66(5): p. 1166-70.
92. Chen, M., B.K. Lam, Y. Kanaoka, P.A. Nigrovic, L.P. Audoly, et al., Neutrophil-
derived leukotriene B4 is required for inflammatory arthritis. J Exp Med, 2006.
203(4): p. 837-42.
93. Shao, W.H., A. Del Prete, C.B. Bock, and B. Haribabu, Targeted disruption of
leukotriene B4 receptors BLT1 and BLT2: a critical role for BLT1 in collagen-
induced arthritis in mice. J Immunol, 2006. 176(10): p. 6254-61.
94. Christmas, P., J.W. Fox, S.R. Ursino, and R.J. Soberman, Differential localization
of 5- and 15-lipoxygenases to the nuclear envelope in RAW macrophages. J Biol
Chem, 1999. 274(36): p. 25594-8.
95. Hanaka, H., T. Shimizu, and T. Izumi, Nuclear-localization-signal-dependent and
nuclear-export-signal-dependent mechanisms determine the localization of 5-
lipoxygenase. Biochem J, 2002. 361(Pt 3): p. 505-14.
96. Jones, S.M., M. Luo, A.M. Healy, M. Peters-Golden, and T.G. Brock, Structural
and functional criteria reveal a new nuclear import sequence on the 5-
lipoxygenase protein. J Biol Chem, 2002. 277(41): p. 38550-6.
97. Jones, S.M., M. Luo, M. Peters-Golden, and T.G. Brock, Identification of two
novel nuclear import sequences on the 5-lipoxygenase protein. J Biol Chem,
2003. 278(12): p. 10257-63.
98. Woods, J.W., M.J. Coffey, T.G. Brock, Singer, II, and M. Peters-Golden, 5-
Lipoxygenase is located in the euchromatin of the nucleus in resting human
alveolar macrophages and translocates to the nuclear envelope upon cell
activation. J Clin Invest, 1995. 95(5): p. 2035-46.
99. Luo, M., S.M. Jones, M. Peters-Golden, and T.G. Brock, Nuclear localization of
5-lipoxygenase as a determinant of leukotriene B4 synthetic capacity. Proc Natl
Acad Sci U S A, 2003. 100(21): p. 12165-70.

140
100. Matsumoto, T., C.D. Funk, O. Radmark, J.O. Hoog, H. Jornvall, et al., Molecular
cloning and amino acid sequence of human 5-lipoxygenase. Proc Natl Acad Sci U
S A, 1988. 85(1): p. 26-30.
101. Dixon, R.A., R.E. Jones, R.E. Diehl, C.D. Bennett, S. Kargman, et al., Cloning of
the cDNA for human 5-lipoxygenase. Proc Natl Acad Sci U S A, 1988. 85(2): p.
416-20.
102. Hoshiko, S., O. Radmark, and B. Samuelsson, Characterization of the human 5-
lipoxygenase gene promoter. Proc Natl Acad Sci U S A, 1990. 87(23): p. 9073-7.
103. Silverman, E.S., J. Du, G.T. De Sanctis, O. Radmark, B. Samuelsson, et al., Egr-1
and Sp1 interact functionally with the 5-lipoxygenase promoter and its naturally
occurring mutants. Am J Respir Cell Mol Biol, 1998. 19(2): p. 316-23.
104. Dishart, D., N. Schnur, N. Klan, O. Werz, D. Steinhilber, et al., GC-rich
sequences in the 5-lipoxygenase gene promoter are required for expression in
Mono Mac 6 cells, characterization of a novel Sp1 binding site. Biochim Biophys
Acta, 2005. 1738(1-3): p. 37-47.
105. Uhl, J., N. Klan, M. Rose, K.D. Entian, O. Werz, et al., The 5-lipoxygenase
promoter is regulated by DNA methylation. J Biol Chem, 2002. 277(6): p. 4374-9.
106. In, K.H., E.S. Silverman, K. Asano, D. Beier, A.R. Fischer, et al., Mutations in
the human 5-lipoxygenase gene. Clin Rev Allergy Immunol, 1999. 17(1-2): p. 59-
69.
107. Drazen, J.M., C.N. Yandava, L. Dube, N. Szczerback, R. Hippensteel, et al.,
Pharmacogenetic association between ALOX5 promoter genotype and the
response to anti-asthma treatment. Nat Genet, 1999. 22(2): p. 168-70.
108. Dwyer, J.H., H. Allayee, K.M. Dwyer, J. Fan, H. Wu, et al., Arachidonate 5-
lipoxygenase promoter genotype, dietary arachidonic acid, and atherosclerosis. N
Engl J Med, 2004. 350(1): p. 29-37.
109. Covin, R.B., T.G. Brock, M.B. Bailie, and M. Peters-Golden, Altered expression
and localization of 5-lipoxygenase accompany macrophage differentiation in the
lung. Am J Physiol, 1998. 275(2 Pt 1): p. L303-10.
110. Brungs, M., O. Radmark, B. Samuelsson, and D. Steinhilber, On the induction of
5-lipoxygenase expression and activity in HL-60 cells: effects of vitamin D3,

141
retinoic acid, DMSO and TGF beta. Biochem Biophys Res Commun, 1994.
205(3): p. 1572-80.
111. Brungs, M., O. Radmark, B. Samuelsson, and D. Steinhilber, Sequential induction
of 5-lipoxygenase gene expression and activity in Mono Mac 6 cells by
transforming growth factor beta and 1,25-dihydroxyvitamin D3. Proc Natl Acad
Sci U S A, 1995. 92(1): p. 107-11.
112. Harle, D., O. Radmark, B. Samuelsson, and D. Steinhilber, Transcriptional and
posttranscriptional regulation of 5-lipoxygenase mRNA expression in the human
monocytic cell line Mono Mac 6 by transforming growth factor-beta and 1,25-
dihydroxyvitamin D3. Adv Exp Med Biol, 1999. 469: p. 105-11.
113. Sorg, B.L., N. Klan, S. Seuter, D. Dishart, O. Radmark, et al., Analysis of the 5-
lipoxygenase promoter and characterization of a vitamin D receptor binding site.
Biochim Biophys Acta, 2006. 1761(7): p. 686-97.
114. Seuter, S., B.L. Sorg, and D. Steinhilber, The coding sequence mediates induction
of 5-lipoxygenase expression by Smads3/4. Biochem Biophys Res Commun,
2006. 348(4): p. 1403-10.
115. Seuter, S., S. Vaisanen, O. Radmark, C. Carlberg, and D. Steinhilber, Functional
characterization of vitamin D responding regions in the human 5-Lipoxygenase
gene. Biochim Biophys Acta, 2007. 1771(7): p. 864-72.
116. Harle, D., O. Radmark, B. Samuelsson, and D. Steinhilber, Calcitriol and
transforming growth factor-beta upregulate 5-lipoxygenase mRNA expression by
increasing gene transcription and mRNA maturation. Eur J Biochem, 1998.
254(2): p. 275-81.
117. Radmark, O. and B. Samuelsson, 5-Lipoxygenase: mechanisms of regulation. J
Lipid Res, 2009. 50 Suppl: p. S40-5.
118. Pouliot, M., P.P. McDonald, L. Khamzina, P. Borgeat, and S.R. McColl,
Granulocyte-macrophage colony-stimulating factor enhances 5-lipoxygenase
levels in human polymorphonuclear leukocytes. J Immunol, 1994. 152(2): p. 851-
8.

142
119. Stankova, J., M. Rola-Pleszczynski, and C.M. Dubois, Granulocyte-macrophage
colony-stimulating factor increases 5-lipoxygenase gene transcription and protein
expression in human neutrophils. Blood, 1995. 85(12): p. 3719-26.
120. Gilbert, N.C., S.G. Bartlett, M.T. Waight, D.B. Neau, W.E. Boeglin, et al., The
structure of human 5-lipoxygenase. Science, 2011. 331(6014): p. 217-9.
121. Gillmor, S.A., A. Villasenor, R. Fletterick, E. Sigal, and M.F. Browner, The
structure of mammalian 15-lipoxygenase reveals similarity to the lipases and the
determinants of substrate specificity. Nat Struct Biol, 1997. 4(12): p. 1003-9.
122. Choi, J., J.K. Chon, S. Kim, and W. Shin, Conformational flexibility in
mammalian 15S-lipoxygenase: Reinterpretation of the crystallographic data.
Proteins, 2008. 70(3): p. 1023-32.
123. Hafner, A.K., M. Cernescu, B. Hofmann, M. Ermisch, M. Hornig, et al.,
Dimerization of human 5-lipoxygenase. Biol Chem, 2011. 392(12): p. 1097-111.
124. Hammarberg, T., P. Provost, B. Persson, and O. Radmark, The N-terminal domain
of 5-lipoxygenase binds calcium and mediates calcium stimulation of enzyme
activity. J Biol Chem, 2000. 275(49): p. 38787-93.
125. Chen, X.S. and C.D. Funk, The N-terminal "beta-barrel" domain of 5-
lipoxygenase is essential for nuclear membrane translocation. J Biol Chem, 2001.
276(1): p. 811-8.
126. Bateman, A. and R. Sandford, The PLAT domain: a new piece in the PKD1
puzzle. Curr Biol, 1999. 9(16): p. R588-90.
127. Allard, J.B. and T.G. Brock, Structural organization of the regulatory domain of
human 5-lipoxygenase. Curr Protein Pept Sci, 2005. 6(2): p. 125-31.
128. Provost, P., J. Doucet, T. Hammarberg, G. Gerisch, B. Samuelsson, et al., 5-
Lipoxygenase interacts with coactosin-like protein. J Biol Chem, 2001. 276(19):
p. 16520-7.
129. Dincbas-Renqvist, V., G. Pepin, M. Rakonjac, I. Plante, D.L. Ouellet, et al.,
Human Dicer C-terminus functions as a 5-lipoxygenase binding domain. Biochim
Biophys Acta, 2009. 1789(2): p. 99-108.
130. Zhang, Y.Y., T. Hammarberg, O. Radmark, B. Samuelsson, C.F. Ng, et al.,
Analysis of a nucleotide-binding site of 5-lipoxygenase by affinity labelling:

143
binding characteristics and amino acid sequences. Biochem J, 2000. 351 Pt 3: p.
697-707.
131. Hammarberg, T., Y.Y. Zhang, B. Lind, O. Radmark, and B. Samuelsson,
Mutations at the C-terminal isoleucine and other potential iron ligands of 5-
lipoxygenase. Eur J Biochem, 1995. 230(2): p. 401-7.
132. Hammarberg, T., S. Kuprin, O. Radmark, and A. Holmgren, EPR investigation of
the active site of recombinant human 5-lipoxygenase: inhibition by selenide.
Biochemistry, 2001. 40(21): p. 6371-8.
133. Rouzer, C.A., T. Shimizu, and B. Samuelsson, On the nature of the 5-
lipoxygenase reaction in human leukocytes: characterization of a membrane-
associated stimulatory factor. Proc Natl Acad Sci U S A, 1985. 82(22): p. 7505-9.
134. Rouzer, C.A. and B. Samuelsson, Demonstration of multiple regulatory factors
for purified human leukocyte 5-lipoxygenase. Adv Enzyme Regul, 1987. 26: p.
133-44.
135. Borgeat, P. and B. Samuelsson, Arachidonic acid metabolism in
polymorphonuclear leukocytes: effects of ionophore A23187. Proc Natl Acad Sci
U S A, 1979. 76(5): p. 2148-52.
136. Peters-Golden, M. and R.W. McNish, Redistribution of 5-lipoxygenase and
cytosolic phospholipase A2 to the nuclear fraction upon macrophage activation.
Biochem Biophys Res Commun, 1993. 196(1): p. 147-53.
137. Brock, T.G., R. Paine, 3rd, and M. Peters-Golden, Localization of 5-lipoxygenase
to the nucleus of unstimulated rat basophilic leukemia cells. J Biol Chem, 1994.
269(35): p. 22059-66.
138. Pouliot, M., P.P. McDonald, E. Krump, J.A. Mancini, S.R. McColl, et al.,
Colocalization of cytosolic phospholipase A2, 5-lipoxygenase, and 5-
lipoxygenase-activating protein at the nuclear membrane of A23187-stimulated
human neutrophils. Eur J Biochem, 1996. 238(1): p. 250-8.
139. Peters-Golden, M. and T.G. Brock, Intracellular compartmentalization of
leukotriene synthesis: unexpected nuclear secrets. FEBS Lett, 2001. 487(3): p.
323-6.

144
140. Flamand, N., J. Lefebvre, M.E. Surette, S. Picard, and P. Borgeat, Arachidonic
acid regulates the translocation of 5-lipoxygenase to the nuclear membranes in
human neutrophils. J Biol Chem, 2006. 281(1): p. 129-36.
141. Hammarberg, T. and O. Radmark, 5-lipoxygenase binds calcium. Biochemistry,
1999. 38(14): p. 4441-7.
142. Kulkarni, S., S. Das, C.D. Funk, D. Murray, and W. Cho, Molecular basis of the
specific subcellular localization of the C2-like domain of 5-lipoxygenase. J Biol
Chem, 2002. 277(15): p. 13167-74.
143. Percival, M.D., D. Denis, D. Riendeau, and M.J. Gresser, Investigation of the
mechanism of non-turnover-dependent inactivation of purified human 5-
lipoxygenase. Inactivation by H2O2 and inhibition by metal ions. Eur J Biochem,
1992. 210(1): p. 109-17.
144. Werz, O., J. Klemm, B. Samuelsson, and O. Radmark, 5-lipoxygenase is
phosphorylated by p38 kinase-dependent MAPKAP kinases. Proc Natl Acad Sci U
S A, 2000. 97(10): p. 5261-6.
145. Werz, O., E. Burkert, L. Fischer, D. Szellas, D. Dishart, et al., Extracellular
signal-regulated kinases phosphorylate 5-lipoxygenase and stimulate 5-
lipoxygenase product formation in leukocytes. FASEB J, 2002. 16(11): p. 1441-3.
146. Luo, M., S.M. Jones, S.M. Phare, M.J. Coffey, M. Peters-Golden, et al., Protein
kinase A inhibits leukotriene synthesis by phosphorylation of 5-lipoxygenase on
serine 523. J Biol Chem, 2004. 279(40): p. 41512-20.
147. Werz, O., D. Szellas, D. Steinhilber, and O. Radmark, Arachidonic acid promotes
phosphorylation of 5-lipoxygenase at Ser-271 by MAPK-activated protein kinase
2 (MK2). J Biol Chem, 2002. 277(17): p. 14793-800.
148. Flamand, N., M. Luo, M. Peters-Golden, and T.G. Brock, Phosphorylation of
serine 271 on 5-lipoxygenase and its role in nuclear export. J Biol Chem, 2009.
284(1): p. 306-13.
149. Luo, M., S.M. Jones, N. Flamand, D.M. Aronoff, M. Peters-Golden, et al.,
Phosphorylation by protein kinase a inhibits nuclear import of 5-lipoxygenase. J
Biol Chem, 2005. 280(49): p. 40609-16.

145
150. Denis, D., J.P. Falgueyret, D. Riendeau, and M. Abramovitz, Characterization of
the activity of purified recombinant human 5-lipoxygenase in the absence and
presence of leukocyte factors. J Biol Chem, 1991. 266(8): p. 5072-9.
151. Lepley, R.A., D.T. Muskardin, and F.A. Fitzpatrick, Tyrosine kinase activity
modulates catalysis and translocation of cellular 5-lipoxygenase. J Biol Chem,
1996. 271(11): p. 6179-84.
152. Ochi, K., T. Yoshimoto, S. Yamamoto, K. Taniguchi, and T. Miyamoto,
Arachidonate 5-lipoxygenase of guinea pig peritoneal polymorphonuclear
leukocytes. Activation by adenosine 5'-triphosphate. J Biol Chem, 1983. 258(9):
p. 5754-8.
153. Ueda, N., S. Kaneko, T. Yoshimoto, and S. Yamamoto, Purification of
arachidonate 5-lipoxygenase from porcine leukocytes and its reactivity with
hydroperoxyeicosatetraenoic acids. J Biol Chem, 1986. 261(17): p. 7982-8.
154. Aharony, D. and R.L. Stein, Kinetic mechanism of guinea pig neutrophil 5-
lipoxygenase. J Biol Chem, 1986. 261(25): p. 11512-9.
155. Furukawa, M., T. Yoshimoto, K. Ochi, and S. Yamamoto, Studies on
arachidonate 5-lipoxygenase of rat basophilic leukemia cells. Biochim Biophys
Acta, 1984. 795(3): p. 458-65.
156. Skorey, K.I. and M.J. Gresser, Calcium is not required for 5-lipoxygenase activity
at high phosphatidyl choline vesicle concentrations. Biochemistry, 1998. 37(22):
p. 8027-34.
157. Reid, G.K., S. Kargman, P.J. Vickers, J.A. Mancini, C. Leveille, et al.,
Correlation between expression of 5-lipoxygenase-activating protein, 5-
lipoxygenase, and cellular leukotriene synthesis. J Biol Chem, 1990. 265(32): p.
19818-23.
158. Dixon, R.A., R.E. Diehl, E. Opas, E. Rands, P.J. Vickers, et al., Requirement of a
5-lipoxygenase-activating protein for leukotriene synthesis. Nature, 1990.
343(6255): p. 282-4.
159. Miller, D.K., J.W. Gillard, P.J. Vickers, S. Sadowski, C. Leveille, et al.,
Identification and isolation of a membrane protein necessary for leukotriene
production. Nature, 1990. 343(6255): p. 278-81.

146
160. Rouzer, C.A., A.W. Ford-Hutchinson, H.E. Morton, and J.W. Gillard, MK886, a
potent and specific leukotriene biosynthesis inhibitor blocks and reverses the
membrane association of 5-lipoxygenase in ionophore-challenged leukocytes. J
Biol Chem, 1990. 265(3): p. 1436-42.
161. Mandal, A.K., J. Skoch, B.J. Bacskai, B.T. Hyman, P. Christmas, et al., The
membrane organization of leukotriene synthesis. Proc Natl Acad Sci U S A, 2004.
101(17): p. 6587-92.
162. Plante, H., S. Picard, J. Mancini, and P. Borgeat, 5-Lipoxygenase-activating
protein homodimer in human neutrophils: evidence for a role in leukotriene
biosynthesis. Biochem J, 2006. 393(Pt 1): p. 211-8.
163. Evans, J.F., A.D. Ferguson, R.T. Mosley, and J.H. Hutchinson, What's all the
FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory
diseases. Trends Pharmacol Sci, 2008. 29(2): p. 72-8.
164. Abramovitz, M., E. Wong, M.E. Cox, C.D. Richardson, C. Li, et al., 5-
lipoxygenase-activating protein stimulates the utilization of arachidonic acid by
5-lipoxygenase. Eur J Biochem, 1993. 215(1): p. 105-11.
165. de Hostos, E.L., B. Bradtke, F. Lottspeich, and G. Gerisch, Coactosin, a 17 kDa
F-actin binding protein from Dictyostelium discoideum. Cell Motil Cytoskeleton,
1993. 26(3): p. 181-91.
166. Provost, P., B. Samuelsson, and O. Radmark, Interaction of 5-lipoxygenase with
cellular proteins. Proc Natl Acad Sci U S A, 1999. 96(5): p. 1881-5.
167. Rakonjac, M., L. Fischer, P. Provost, O. Werz, D. Steinhilber, et al., Coactosin-
like protein supports 5-lipoxygenase enzyme activity and up-regulates leukotriene
A4 production. Proc Natl Acad Sci U S A, 2006. 103(35): p. 13150-5.
168. Esser, J., M. Rakonjac, B. Hofmann, L. Fischer, P. Provost, et al., Coactosin-like
protein functions as a stabilizing chaperone for 5-lipoxygenase: role of
tryptophan 102. Biochem J, 2010. 425(1): p. 265-74.
169. Albert, D., I. Zundorf, T. Dingermann, W.E. Muller, D. Steinhilber, et al.,
Hyperforin is a dual inhibitor of cyclooxygenase-1 and 5-lipoxygenase. Biochem
Pharmacol, 2002. 64(12): p. 1767-75.

147
170. Feisst, C., C. Pergola, M. Rakonjac, A. Rossi, A. Koeberle, et al., Hyperforin is a
novel type of 5-lipoxygenase inhibitor with high efficacy in vivo. Cell Mol Life
Sci, 2009. 66(16): p. 2759-71.
171. Murphy, R.C. and M.A. Gijon, Biosynthesis and metabolism of leukotrienes.
Biochem J, 2007. 405(3): p. 379-95.
172. Rouzer, C.A. and S. Kargman, Translocation of 5-lipoxygenase to the membrane
in human leukocytes challenged with ionophore A23187. J Biol Chem, 1988.
263(22): p. 10980-8.
173. Werz, O., I. Tretiakova, A. Michel, A. Ulke-Lemee, M. Hornig, et al., Caspase-
mediated degradation of human 5-lipoxygenase in B lymphocytic cells. Proc Natl
Acad Sci U S A, 2005. 102(37): p. 13164-9.
174. Keren, H., G. Lev-Maor, and G. Ast, Alternative splicing and evolution:
diversification, exon definition and function. Nat Rev Genet, 2010. 11(5): p. 345-
55.
175. Lander, E.S., L.M. Linton, B. Birren, C. Nusbaum, M.C. Zody, et al., Initial
sequencing and analysis of the human genome. Nature, 2001. 409(6822): p. 860-
921.
176. Wang, E.T., R. Sandberg, S. Luo, I. Khrebtukova, L. Zhang, et al., Alternative
isoform regulation in human tissue transcriptomes. Nature, 2008. 456(7221): p.
470-6.
177. Blencowe, B.J., Alternative splicing: new insights from global analyses. Cell,
2006. 126(1): p. 37-47.
178. Brash, A.R., W.E. Boeglin, and M.S. Chang, Discovery of a second 15S-
lipoxygenase in humans. Proc Natl Acad Sci U S A, 1997. 94(12): p. 6148-52.
179. Sigal, E., C.S. Craik, E. Highland, D. Grunberger, L.L. Costello, et al., Molecular
cloning and primary structure of human 15-lipoxygenase. Biochem Biophys Res
Commun, 1988. 157(2): p. 457-64.
180. Srebrow, A. and A.R. Kornblihtt, The connection between splicing and cancer. J
Cell Sci, 2006. 119(Pt 13): p. 2635-41.
181. Oren, M., Decision making by p53: life, death and cancer. Cell Death Differ,
2003. 10(4): p. 431-42.

148
182. Flaman, J.M., F. Waridel, A. Estreicher, A. Vannier, J.M. Limacher, et al., The
human tumour suppressor gene p53 is alternatively spliced in normal cells.
Oncogene, 1996. 12(4): p. 813-8.
183. Ghosh, A., D. Stewart, and G. Matlashewski, Regulation of human p53 activity
and cell localization by alternative splicing. Mol Cell Biol, 2004. 24(18): p. 7987-
97.
184. Yin, Y., C.W. Stephen, M.G. Luciani, and R. Fahraeus, p53 Stability and activity
is regulated by Mdm2-mediated induction of alternative p53 translation products.
Nat Cell Biol, 2002. 4(6): p. 462-7.
185. Courtois, S., G. Verhaegh, S. North, M.G. Luciani, P. Lassus, et al., DeltaN-p53,
a natural isoform of p53 lacking the first transactivation domain, counteracts
growth suppression by wild-type p53. Oncogene, 2002. 21(44): p. 6722-8.
186. Bourdon, J.C., K. Fernandes, F. Murray-Zmijewski, G. Liu, A. Diot, et al., p53
isoforms can regulate p53 transcriptional activity. Genes Dev, 2005. 19(18): p.
2122-37.
187. Rohaly, G., J. Chemnitz, S. Dehde, A.M. Nunez, J. Heukeshoven, et al., A novel
human p53 isoform is an essential element of the ATR-intra-S phase checkpoint.
Cell, 2005. 122(1): p. 21-32.
188. Benzeno, S., G. Narla, J. Allina, G.Z. Cheng, H.L. Reeves, et al., Cyclin-
dependent kinase inhibition by the KLF6 tumor suppressor protein through
interaction with cyclin D1. Cancer Res, 2004. 64(11): p. 3885-91.
189. Narla, G., A. Difeo, H.L. Reeves, D.J. Schaid, J. Hirshfeld, et al., A germline DNA
polymorphism enhances alternative splicing of the KLF6 tumor suppressor gene
and is associated with increased prostate cancer risk. Cancer Res, 2005. 65(4): p.
1213-22.
190. Narla, G., A. DiFeo, Y. Fernandez, S. Dhanasekaran, F. Huang, et al., KLF6-SV1
overexpression accelerates human and mouse prostate cancer progression and
metastasis. J Clin Invest, 2008. 118(8): p. 2711-21.
191. Tazi, J., N. Bakkour, and S. Stamm, Alternative splicing and disease. Biochim
Biophys Acta, 2009. 1792(1): p. 14-26.

149
192. Zhu, H., H.M. Tucker, K.E. Grear, J.F. Simpson, A.K. Manning, et al., A common
polymorphism decreases low-density lipoprotein receptor exon 12 splicing
efficiency and associates with increased cholesterol. Hum Mol Genet, 2007.
16(14): p. 1765-72.
193. Zou, F., R.K. Gopalraj, J. Lok, H. Zhu, I.F. Ling, et al., Sex-dependent association
of a common low-density lipoprotein receptor polymorphism with RNA splicing
efficiency in the brain and Alzheimer's disease. Hum Mol Genet, 2008. 17(7): p.
929-35.
194. Berger, W., M.T. De Chandt, and C.B. Cairns, Zileuton: clinical implications of
5-Lipoxygenase inhibition in severe airway disease. Int J Clin Pract, 2007. 61(4):
p. 663-76.
195. Liu, M.C., L.M. Dube, and J. Lancaster, Acute and chronic effects of a 5-
lipoxygenase inhibitor in asthma: a 6-month randomized multicenter trial.
Zileuton Study Group. J Allergy Clin Immunol, 1996. 98(5 Pt 1): p. 859-71.
196. Garcia-Marcos, L., A. Schuster, and E.G. Perez-Yarza, Benefit-risk assessment of
antileukotrienes in the management of asthma. Drug Saf, 2003. 26(7): p. 483-518.
197. Pergola, C. and O. Werz, 5-Lipoxygenase inhibitors: a review of recent
developments and patents. Expert Opin Ther Pat, 2010. 20(3): p. 355-75.
198. Ford-Hutchinson, A.W., M. Gresser, and R.N. Young, 5-Lipoxygenase. Annu Rev
Biochem, 1994. 63: p. 383-417.
199. Henderson, W.R., Jr., G.K. Chiang, Y.T. Tien, and E.Y. Chi, Reversal of
allergen-induced airway remodeling by CysLT1 receptor blockade. Am J Respir
Crit Care Med, 2006. 173(7): p. 718-28.
200. Guindon, Y., Y. Girard, A. Maycock, A.W. Ford-Hutchinson, J.G. Atkinson, et
al., L-651,392: a novel, potent and selective 5-lipoxygenase inhibitor. Adv
Prostaglandin Thromboxane Leukot Res, 1987. 17A: p. 554-7.
201. Rouzer, C.A., D. Riendeau, J.P. Falgueyret, C.K. Lau, and M.J. Gresser,
Inhibition of human leukocyte 5-lipoxygenase by a 4-hydroxybenzofuran, L-
656,224. Evidence for enzyme reduction and inhibitor degradation. Biochem
Pharmacol, 1991. 41(9): p. 1365-73.

150
202. Bruneau, P., C. Delvare, M.P. Edwards, and R.M. McMillan, Indazolinones, a
new series of redox-active 5-lipoxygenase inhibitors with built-in selectivity and
oral activity. J Med Chem, 1991. 34(3): p. 1028-36.
203. Doiron, J., L.H. Boudreau, N. Picot, B. Villebonet, M.E. Surette, et al., Synthesis
and 5-lipoxygenase inhibitory activity of new cinnamoyl and caffeoyl clusters.
Bioorg Med Chem Lett, 2009. 19(4): p. 1118-21.
204. Carter, G.W., P.R. Young, D.H. Albert, J. Bouska, R. Dyer, et al., 5-lipoxygenase
inhibitory activity of zileuton. J Pharmacol Exp Ther, 1991. 256(3): p. 929-37.
205. Dube, L.M., L.J. Swanson, and W. Awni, Zileuton, a leukotriene synthesis
inhibitor in the management of chronic asthma. Clinical pharmacokinetics and
safety. Clin Rev Allergy Immunol, 1999. 17(1-2): p. 213-21.
206. Laviolette, M., K. Malmstrom, S. Lu, P. Chervinsky, J.C. Pujet, et al.,
Montelukast added to inhaled beclomethasone in treatment of asthma.
Montelukast/Beclomethasone Additivity Group. Am J Respir Crit Care Med,
1999. 160(6): p. 1862-8.
207. Brooks, C.D., A.O. Stewart, A. Basha, P. Bhatia, J.D. Ratajczyk, et al., (R)-(+)-N-
[3-[5-[(4-fluorophenyl)methyl]-2-thienyl]-1-methyl- 2-propynyl]-N-hydroxyurea
(ABT-761), a second-generation 5-lipoxygenase inhibitor. J Med Chem, 1995.
38(24): p. 4768-75.
208. Lehnigk, B., K.F. Rabe, G. Dent, R.S. Herst, P.J. Carpentier, et al., Effects of a 5-
lipoxygenase inhibitor, ABT-761, on exercise-induced bronchoconstriction and
urinary LTE4 in asthmatic patients. Eur Respir J, 1998. 11(3): p. 617-23.
209. Tardif, J.C., L. L'Allier P, R. Ibrahim, J.C. Gregoire, A. Nozza, et al., Treatment
with 5-lipoxygenase inhibitor VIA-2291 (Atreleuton) in patients with recent acute
coronary syndrome. Circ Cardiovasc Imaging, 2010. 3(3): p. 298-307.
210. Shirumalla, R.K., K.S. Naruganahalli, S.G. Dastidar, V. Sattigeri, G. Kaur, et al.,
RBx 7,796: A novel inhibitor of 5-lipoxygenase. Inflamm Res, 2006. 55(12): p.
517-27.
211. Fischer, L., D. Steinhilber, and O. Werz, Molecular pharmacological profile of
the nonredox-type 5-lipoxygenase inhibitor CJ-13,610. Br J Pharmacol, 2004.
142(5): p. 861-8.

151
212. Mano, T., R.W. Stevens, K. Ando, M. Kawai, K. Kawamura, et al., Optimization
of imidazole 5-lipoxygenase inhibitors and selection and synthesis of a
development candidate. Chem Pharm Bull (Tokyo), 2005. 53(8): p. 965-73.
213. Cortes-Burgos, L.A., B.S. Zweifel, S.L. Settle, R.A. Pufahl, G.D. Anderson, et al.,
CJ-13610, an orally active inhibitor of 5-lipoxygenase is efficacious in preclinical
models of pain. Eur J Pharmacol, 2009. 617(1-3): p. 59-67.
214. Celotti, F. and S. Laufer, Anti-inflammatory drugs: new multitarget compounds to
face an old problem. The dual inhibition concept. Pharmacol Res, 2001. 43(5): p.
429-36.
215. Laufer, S., S. Tries, J. Augustin, and G. Dannhardt, Pharmacological profile of a
new pyrrolizine derivative inhibiting the enzymes cyclo-oxygenase and 5-
lipoxygenase. Arzneimittelforschung, 1994. 44(5): p. 629-36.
216. Fischer, L., M. Hornig, C. Pergola, N. Meindl, L. Franke, et al., The molecular
mechanism of the inhibition by licofelone of the biosynthesis of 5-lipoxygenase
products. Br J Pharmacol, 2007. 152(4): p. 471-80.
217. Mancini, J.A., M. Abramovitz, M.E. Cox, E. Wong, S. Charleson, et al., 5-
lipoxygenase-activating protein is an arachidonate binding protein. FEBS Lett,
1993. 318(3): p. 277-81.
218. Laufer, S.A., J. Augustin, G. Dannhardt, and W. Kiefer, (6,7-
Diaryldihydropyrrolizin-5-yl)acetic acids, a novel class of potent dual inhibitors
of both cyclooxygenase and 5-lipoxygenase. J Med Chem, 1994. 37(12): p. 1894-
7.
219. Tries, S., W. Neupert, and S. Laufer, The mechanism of action of the new
antiinflammatory compound ML3000: inhibition of 5-LOX and COX-1/2.
Inflamm Res, 2002. 51(3): p. 135-43.
220. Rotondo, S., G. Dell'Elba, K. Krauze-Brzosko, S. Manarini, N. Martelli, et al.,
Licofelone, a dual lipoxygenase-cyclooxygenase inhibitor, downregulates
polymorphonuclear leukocyte and platelet function. Eur J Pharmacol, 2002.
453(1): p. 131-9.
221. Gillard, J., A.W. Ford-Hutchinson, C. Chan, S. Charleson, D. Denis, et al., L-
663,536 (MK-886) (3-[1-(4-chlorobenzyl)-3-t-butyl-thio-5-isopropylindol-2-yl]-

152
2,2 - dimethylpropanoic acid), a novel, orally active leukotriene biosynthesis
inhibitor. Can J Physiol Pharmacol, 1989. 67(5): p. 456-64.
222. Hatzelmann, A., R. Fruchtmann, K.H. Mohrs, S. Raddatz, M. Matzke, et al.,
Mode of action of the leukotriene synthesis (FLAP) inhibitor BAY X 1005:
implications for biological regulation of 5-lipoxygenase. Agents Actions, 1994.
43(1-2): p. 64-8.
223. Depre, M., B. Friedman, A. Van Hecken, I. de Lepeleire, W. Tanaka, et al.,
Pharmacokinetics and pharmacodynamics of multiple oral doses of MK-0591, a
5-lipoxygenase-activating protein inhibitor. Clin Pharmacol Ther, 1994. 56(1): p.
22-30.
224. Lorrain, D.S., G. Bain, L.D. Correa, C. Chapman, A.R. Broadhead, et al.,
Pharmacology of AM803, a novel selective five-lipoxygenase-activating protein
(FLAP) inhibitor in rodent models of acute inflammation. Eur J Pharmacol, 2010.
640(1-3): p. 211-8.
225. Bain, G., C.D. King, M. Rewolinski, K. Schaab, A.M. Santini, et al.,
Pharmacodynamics and pharmacokinetics of AM103, a novel inhibitor of 5-
lipoxygenase-activating protein (FLAP). Clin Pharmacol Ther, 2010. 87(4): p.
437-44.
226. Kumlin, M., F. Stensvad, L. Larsson, B. Dahlen, and S.E. Dahlen, Validation and
application of a new simple strategy for measurements of urinary leukotriene E4
in humans. Clin Exp Allergy, 1995. 25(5): p. 467-79.
227. Taylor, G.W., I. Taylor, P. Black, N.H. Maltby, N. Turner, et al., Urinary
leukotriene E4 after antigen challenge and in acute asthma and allergic rhinitis.
Lancet, 1989. 1(8638): p. 584-8.
228. Smith, C.M., P.E. Christie, R.J. Hawksworth, F. Thien, and T.H. Lee, Urinary
leukotriene E4 levels after allergen and exercise challenge in bronchial asthma.
Am Rev Respir Dis, 1991. 144(6): p. 1411-3.
229. Ferguson, A.D., B.M. McKeever, S. Xu, D. Wisniewski, D.K. Miller, et al.,
Crystal structure of inhibitor-bound human 5-lipoxygenase-activating protein.
Science, 2007. 317(5837): p. 510-2.

153
230. Hegen, M., L. Sun, N. Uozumi, K. Kume, M.E. Goad, et al., Cytosolic
phospholipase A2alpha-deficient mice are resistant to collagen-induced arthritis.
J Exp Med, 2003. 197(10): p. 1297-302.
231. Magrioti, V. and G. Kokotos, Phospholipase A2 inhibitors as potential
therapeutic agents for the treatment of inflammatory diseases. Expert Opin Ther
Pat, 2010. 20(1): p. 1-18.
232. Tai, N., K. Kuwabara, M. Kobayashi, K. Yamada, T. Ono, et al., Cytosolic
phospholipase A2 alpha inhibitor, pyrroxyphene, displays anti-arthritic and anti-
bone destructive action in a murine arthritis model. Inflamm Res, 2010. 59(1): p.
53-62.
233. Hewson, C.A., S. Patel, L. Calzetta, H. Campwala, S. Havard, et al., Preclinical
evaluation of an inhibitor of cytosolic phospholipase A2alpha for the treatment of
asthma. J Pharmacol Exp Ther, 2012. 340(3): p. 656-65.
234. McKew, J.C., K.L. Lee, M.W. Shen, P. Thakker, M.A. Foley, et al., Indole
cytosolic phospholipase A2 alpha inhibitors: discovery and in vitro and in vivo
characterization of 4-{3-[5-chloro-2-(2-{[(3,4-
dichlorobenzyl)sulfonyl]amino}ethyl)-1-(dipheny lmethyl)-1H-indol-3-
yl]propyl}benzoic acid, efipladib. J Med Chem, 2008. 51(12): p. 3388-413.
235. Lee, K.L., M.A. Foley, L. Chen, M.L. Behnke, F.E. Lovering, et al., Discovery of
Ecopladib, an indole inhibitor of cytosolic phospholipase A2alpha. J Med Chem,
2007. 50(6): p. 1380-400.
236. Ramarao, M.K., M.W. Shen, E.A. Murphy, W. Duan, Y. Zhao, et al.,
Thermodynamic characterization of cytosolic phospholipase A2 alpha inhibitors.
Anal Biochem, 2008. 383(2): p. 217-25.
237. Montuschi, P., F. Macagno, P. Parente, S. Valente, L. Lauriola, et al., Effects of
cyclo-oxygenase inhibition on exhaled eicosanoids in patients with COPD.
Thorax, 2005. 60(10): p. 827-33.
238. Stankova, J., S. Turcotte, J. Harris, and M. Rola-Pleszczynski, Modulation of
leukotriene B4 receptor-1 expression by dexamethasone: potential mechanism for
enhanced neutrophil survival. J Immunol, 2002. 168(7): p. 3570-6.

154
239. Parlakpinar, H., S. Tasdemir, A. Polat, A. Bay-Karabulut, N. Vardi, et al.,
Protective role of caffeic acid phenethyl ester (cape) on gentamicin-induced acute
renal toxicity in rats. Toxicology, 2005. 207(2): p. 169-77.
240. Gokalp, O., E. Uz, E. Cicek, H.R. Yilmaz, M.K. Ozer, et al., Ameliorating role of
caffeic acid phenethyl ester (CAPE) against isoniazid-induced oxidative damage
in red blood cells. Mol Cell Biochem, 2006. 290(1-2): p. 55-9.
241. Sud'ina, G.F., O.K. Mirzoeva, M.A. Pushkareva, G.A. Korshunova, N.V.
Sumbatyan, et al., Caffeic acid phenethyl ester as a lipoxygenase inhibitor with
antioxidant properties. FEBS Lett, 1993. 329(1-2): p. 21-4.
242. Mirzoeva, O.K. and P.C. Calder, The effect of propolis and its components on
eicosanoid production during the inflammatory response. Prostaglandins Leukot
Essent Fatty Acids, 1996. 55(6): p. 441-9.
243. Michaluart, P., J.L. Masferrer, A.M. Carothers, K. Subbaramaiah, B.S. Zweifel, et
al., Inhibitory effects of caffeic acid phenethyl ester on the activity and expression
of cyclooxygenase-2 in human oral epithelial cells and in a rat model of
inflammation. Cancer Res, 1999. 59(10): p. 2347-52.
244. Liao, H.F., Y.Y. Chen, J.J. Liu, M.L. Hsu, H.J. Shieh, et al., Inhibitory effect of
caffeic acid phenethyl ester on angiogenesis, tumor invasion, and metastasis. J
Agric Food Chem, 2003. 51(27): p. 7907-12.
245. Pukkila-Worley, R., E. Holson, F. Wagner, and E. Mylonakis, Antifungal drug
discovery through the study of invertebrate model hosts. Curr Med Chem, 2009.
16(13): p. 1588-95.
246. Nagy, E. and L.E. Maquat, A rule for termination-codon position within intron-
containing genes: when nonsense affects RNA abundance. Trends Biochem Sci,
1998. 23(6): p. 198-9.
247. Obied, H.K., P.D. Prenzler, I. Konczak, A.U. Rehman, and K. Robards, Chemistry
and bioactivity of olive biophenols in some antioxidant and antiproliferative in
vitro bioassays. Chem Res Toxicol, 2009. 22(1): p. 227-34.
248. Chung, T.W., S.K. Moon, Y.C. Chang, J.H. Ko, Y.C. Lee, et al., Novel and
therapeutic effect of caffeic acid and caffeic acid phenyl ester on

155
hepatocarcinoma cells: complete regression of hepatoma growth and metastasis
by dual mechanism. FASEB J, 2004. 18(14): p. 1670-81.
249. Huang, M.T., R.C. Smart, C.Q. Wong, and A.H. Conney, Inhibitory effect of
curcumin, chlorogenic acid, caffeic acid, and ferulic acid on tumor promotion in
mouse skin by 12-O-tetradecanoylphorbol-13-acetate. Cancer Res, 1988. 48(21):
p. 5941-6.
250. Wang, X., S. Stavchansky, P.D. Bowman, and S.M. Kerwin, Cytoprotective effect
of caffeic acid phenethyl ester (CAPE) and catechol ring-fluorinated CAPE
derivatives against menadione-induced oxidative stress in human endothelial
cells. Bioorg Med Chem, 2006. 14(14): p. 4879-87.
251. Rossi, A., C. Pergola, A. Koeberle, M. Hoffmann, F. Dehm, et al., The 5-
lipoxygenase inhibitor, zileuton, suppresses prostaglandin biosynthesis by
inhibition of arachidonic acid release in macrophages. Br J Pharmacol, 2010.
161(3): p. 555-70.
252. Jung, W.K., I. Choi, D.Y. Lee, S.S. Yea, Y.H. Choi, et al., Caffeic acid phenethyl
ester protects mice from lethal endotoxin shock and inhibits lipopolysaccharide-
induced cyclooxygenase-2 and inducible nitric oxide synthase expression in RAW
264.7 macrophages via the p38/ERK and NF-kappaB pathways. Int J Biochem
Cell Biol, 2008. 40(11): p. 2572-82.
253. Lin, C.F., T.C. Chang, C.C. Chiang, H.J. Tsai, and L.Y. Hsu, Synthesis of
selenium-containing polyphenolic acid esters and evaluation of their effects on
antioxidation and 5-lipoxygenase inhibition. Chem Pharm Bull (Tokyo), 2005.
53(11): p. 1402-7.










156