Page 1 of 15

Universidade do Algarve
Departamento de Cincias Biomdicas e Medicina
Mestrado Integrado em Medicina
Mdulo de Escolha do Estudante


Characterization of FOXO3a-mediated gene expression
following NPV-BEZ235 exposure: A novel role for
TRI B2







Laboratrio Wolfgang Link
Tutor: Richard Hill
Realizado por: Teresa Martins (a39062)



N de Palavras: 4311

Page 2 of 15

Characterization of FOXO3a-mediated gene expression following NPV-BEZ235 exposure: A novel
role for TRIB2

Abstract
Melanoma is an extremely aggressive cancer and concomitant to this aggressiveness, patient
prognosis is poor. As a result, novel therapies and cellular targets are desperately needed. At present the
chemical compound BEZ235 has demonstrated significant potential as an anti-cancer agent. BEZ235 is a
potent inhibitor of PI3Ks that are constitutively active in many cancers, including melanoma. This
deregulation results in the inactivation of the FOXO family of transcription factors, critical regulators of
the cell cycle and apoptosis. TRIB2, a gene that has been reported to be up-regulated in some cancers, has
also been implicated in the negative regulation of the FOXO signaling cascade, specifically the negative
regulation of FOXO3a. Consequently TRIB2 has been implicated in melanoma resistance to various
chemotherapeutics, including some PI3K inhibitors. Here we investigate how TRIB2 mediates PI3K
inhibitor resistance and the role(s) of FOXO3a in this response. Our finding implicate TRIB2 influencing
apoptosis (although not the cell cycle) and that this occurs at the level of transcription. Our findings also
indicate that the over expression of TRIB2 deregulates the cellular balance between p53 and MDM2.

Key words
Cancer, Melanoma, TRIB2, FOXO3a, p53, transcription.

Page 3 of 15

Introduction.
Cancer is the uncontrolled growth of cells in the body. Among the many types of cancers that can
rise in an organism, melanoma, originated in anomalous melanocytes, is considered one of the most
deadly forms of cancer due to the extreme aggressiveness and significant resistance to current
therapeutics
1, 2
. According to the World Health Organization, melanoma kills approximately 53,000
patients per year, worldwide. Of all cancers, melanoma is considered straightforward to diagnose due to
the presence of the melanin pigment that can be directly observed. Radiation therapy, surgical resection
and systemic therapy (interferon, dacarbazine or others), are some of the techniques used in the treatment
of melanoma
3-5
. Yet, since it is a disease that spreads quickly to surrounding tissues standard treatments
do not significantly increase patient survival. Aside from surgical resection, investigators still lack to find
a therapeutic modality that can enhance the likelihood of a curative outcome.
Over the last few years research has yielded important breakthroughs in our understanding of
melanoma particularly the molecular basis of the disease, the deregulated cellular processes essential for
continued cell growth, the metastatic process and mechanisms of melanoma resistance to
chemotherapeutics
2-4, 6-10
. However to date the only two co-adjuvant treatments approved by the United
States of America Food and Drug Administration are high-dose Interleukin-2 and dacabarzin. NPV-
BEZ235 (BEZ) is an imidazoquinoline that targets the phosphatedylinositol 3 kinase (PI3K) and the
mammalian target of rapamycin (mTOR), that has demonstrated significant potential antineoplastic
properties and is currently being tested I various active clinical trials
11-15
.
PI3Ks (the cellular target of the chemotherapeutic BEZ) are lipid kinases that play a central role in
the regulation of the cell cycle, apoptosis, DNA repair, senescence (terminal cell cycle arrest),
angiogenesis, cellular metabolism, and motility
16
. The deregulation that leads to diminished cell death and
increased growth and proliferation is driven by the accumulation of genetic and epigenetic alterations
within the cancer. The activation of PI3Ks has a noticeable relation with tumor growth, since it promotes
an increase in cellular mass, cell cycle entry, counteracts apoptosis, modulates and controls cytoskeletal
rearrangements and enhances cell migration and metastasis. PI3K activation leads to the production of
phosphatidylinositol 3,4,5-triphosphate, that activates Phosphoinositide-dependent kinase-1 (PDK1) and
Protein Kinase B (Akt)
17, 18
. The Akt kinase promotes cell survival by phosphorylating, and thereby
inactivating, pro-apoptotic factors, such as the FOXO transcription factor family. The FOXO proteins
(including FOXO3a) play an important role in longevity and tumor suppression by regulating a wide
range of genes involved in stress resistance, metabolism, cell cycle arrest and apoptosis
19-21
.
Previous studies have shown that BEZ treatment of malignant melanoma cells induces FOXO3a-
dependent gene expression following the inhibition of PI3K
1, 14
. Functional studies suggest that the tumor
suppressive role of was due to their inactivation, caused by constitutively active PI3K/Akt or Ras/
mitogen-activated protein kinase (MAPK)/ERK signaling. Activation of these pathways can directly
Page 4 of 15

result in phosphorylation of FOXOs and their subsequent cytoplasmic sequestration and/or degradation
via the ubiquitin-proteasome pathway. When FOXO is activated by the inhibition of the PI3K/Akt
pathway, FOXOs promotes a wide range of effects including cell cycle arrest, cell differentiation,
autophagy and apoptosis via various mechanisms
22
.
Tribbles-2 (TRIB2) is a kinase-like protein with a role in cell division. Further TRIB2 has been
reported to be up-regulated in a subset of acute myeloid leukaemias. Members of tribbles family have
been reported to interact and modulate the activity of signal transduction pathways, including the
PI3K/Akt and the MAPK systems. Furthermore, TRIB2 has been implicated in the negative regulation of
FOXO3a
23, 24
. The FOXO family of proteins that are transcription factors regulating cell cycle arrest (for
example the cyclin-dependent kinase inhibitor 1B p27) and pro-apoptotic (e.g. Bcl-2 interacting mediator
of cell death Bim) gene transcription
22
. The restoration of FOXO proteins have been suggested as a
promising strategy to treat various types of cancer and accordingly, the forced expression of nuclear
FOXO has been shown to induce apoptosis in a wide range of in vitro cancer cell line models
24
. TRIB2
(that is highly expressed in metastatic melanoma cells) has been implicated in the resistance of various
cancers to a range of chemotherapeutics, including PI3K inhibitors that are under clinical trial. It is
hypothesized that this resistance is due to the repression of FOXO family members
21
.
Based on my groups previous and current research, my project was to elucidate some of the
mechanism(s) of action regarding how TRIB2 mediates PI3K inhibitor resistance and the role(s) of
FOXO3a in this response. To test this hypothesis I confirmed the inhibition effectiveness of our PI3K
inhibitor, confirmed the cellular phenotype following TRIB2 over expression and examined the
recruitment of FOXO3a the promoters of key cell cycle arrest or pro-apoptotic gene promoters.
Methods.
Tissue Culture
The cell lines used for this project were G631 (human melanoma) and the U2OS (human
Osteosarcoma). The cells were cultivated in 15 cm plates with 10% heat inactivated FCS (Sigma)
supplemented with Pen/Strep (Gibco). The U2OS cell line was previously transfected with a plasmid
containing the TRIB2. The G361 cell line was stably transfected with a TRIB2 shRNA expressing
plasmid. BEZ239 was used at 100 nM for all studies.
Imunnoblotting/Western Blotting
Total protein was extracted from each cell line For cellular extraction, the cells were collected from
the culture plates by first removing the growth medium and to then scrape the cells in 1 ml. This
suspension was then transferred into a clean Eppendorf and spinned at 1100 rpm for 5 min at 4C. The
PBS was removed from the pellet and RIPA buffer (Tris-HCL ph 7.4, NaCl, 10% Nonidet P-40, 10%
sodium deoxycholate, 100 mM EDTA, PIC, 200 mM NA-F, 100mM Na
3
VO
4
and protease inhibitors
cocktail) was added to the pellet. The pellet was resuspended in this total lysis buffer and incubated on ice
Page 5 of 15

for 30 minutes. After 30 minutes the lysed cells were spun 15 minutes at 13000 rpm (maximum speed).
The supernatant (containing our proteins) was collected and transferred to a fresh eppendorf prior to
quantification. All extracted proteins were stored at -80
O
C until required.
To determine the protein concentrations in each sample we used the Quick StratTM Bradford
Protein Assay (BioRad) and the NanoDrop 2000 UV-Vis Spectrophotometer (ThermoScientific)
following the manufacturers guidelines.
Our extracted protein samples protein were diluted in to 2x lammeli loading buffer (containing -
mercaptoethanol) and heatedat 95C for 5 minutes. Samples were loaded into our 10% SDS-PAGE gels.
Separated proteins within each gel were transferred on to nitrocellulose membranes (Amersham UK) and
were blocked with 5% BSA (in Tris-buffered-saline [TBS]) for 1 hour (preventing non-specific antibody
binding). After blocking membranes were immunoblotted with various primary antibodies for either 1
hour (at room temperature) or overnight at 4
O
C. The primary antibodies used were: p-AKT 1/2/3 (Ser
473)-R (Santa Cruz biotech, sc-7985-R), AKT1 (Santa Cruz biotech, sc-1618), p-FKHRL1 (Ser
253)(Santa Cruz biotech, sc-101683), FKHRL1 (N-16)(Santa Cruz biotech, sc-9813), Fas-L (C-
178)(Santa Cruz biotech, sc-6237), MDM2 (C-18)(Santa Cruz biotech, sc-812), p21 (Santa Cruz biotech,
sc-817), BIM (H-191)(Santa Cruz biotech, sc-11425), p53(DO-1)(Santa Cruz biotech, sc-126), TRIB2
(custom, Madrid), and Actin (I-19)( Santa Cruz biotech, sc-1616).
After incubation, membranes were washed (x3) with TBS 0.1% tween20. After washing matched
secondary antibodies (goat anti-rabbit IgG-HRP (sc-2004)/ donkey anti-goat IgG-HRP (sc-2020)/ donkey
anti-mouse IgG-HRP(sc-2314) from Santa Cruz Biotechnology) were added at room temperature for 1
hour. The membranes were washed (x3) times with TBS 0.1% tween20 and visualized using ECL+
Images were obtained using a Molecular Imager ChemiDoc XRS System (BioRad).
Co-Imunnoprecipitation (Co-IP)
The cells were washed with medium. Trypsin was added to the plate with the cultivated cells and
then the cells were scraped. The solution was collected to new Eppendorf tubes and centrifuged, and the
supernatant was collected to new tubes. The protein A/G-agarose beads (Sigma) were washed for 2 times
with PBS and a 50% protein A/G agarose working solution (in PBS) was made. Each indicated antibody
(FKHRL1 or p53 DO1) was added to the beads for 1 hour. After 1 hour the beads were washed (x2) with
PBS. 500 g of total protein lysate was added to each set of beads and incubated overnight at 4
o
C.
Samples were centrifuged (max speed), the pellet was kept, and washed with pre-chilled PBS (x3). SDS-
loading buffer was added to beads and the samples heated to 95
O
C for 5 minutes. Samples were extracted
and run on an appropriate percentage SDS-gel.
Chromatin Imunnoprecipitation (ChIP)
The plates were washed with medium, and a 1% formaldehyde/PBS solution was added to cross-
link proteins to DNA. The solution was removed, and the plates were washed with ice cold PBS (x3). The
Page 6 of 15

cells were scraped from the plates with 1M Tris-HCl with 10mM DTT, and transferred to Eppendorf
tubes. After centrifugation, the pellets were washed with Buffer I and II. After centrifugation, the pellet
was resuspended in lysis buffer (made fresh with PIC). The cells were sonicated (6 times for 10 sec each
sample) on ice, to shear DNA to an average fragment size of 200-500 base pairs. After centrifugation (at
max speed for 15 minutes) to pellet cell debris, the supernatant was transferred into a new eppendorf. 300
l of Buffer D and PIC were added to each sample. 100 l input samples were removed at this stage. The
input samples were heated overnight at 65C.
To the remaining sample (after the inputs were removed), we added sheared salmon sperm DNA,
the antibody of interest and protein G-fast flow beads (Sigma) and Buffer D. After incubation overnight at
4
o
C, the beads were pulled down and washed with TSE I, II and III. Afterwards the beads were washed
with ice cold TE. The DNA was extracted with three washes with a solution of NaCHO
3
and SDS. Once
extracted the samples were transferred to a fresh eppendorf and heated overnight at 65
O
C. Our input and
the ChIP samples were loaded into Sigma-PCR clean-up columns and after washing our
immunoprecipitated DNA eluted with 30 l dH
2
O. Samples were stored at -20
o
C
Quantitative Real Time PCR (qRT-PCR).
The primers used for PCR analyses were:
p21_ChIP_Fwd CTGGACTGGGCACTCTTGTC,
p21_ChIP_Rev CTCCTACCATCCCCTTCCTC
p27_ChIP_Fwd GTCCCTTCCAGCTGTCACAT
p27_ChIP_Rev GGAAACCAACCTTCCGTTCT
Bim_ChIP_Fwd
AGCAAGCAGAGTTACTCCGGTAAACA
Bim_ChIP_Rev CCCGCTCCTACGCCCAATCA
MDM2_ChIP_Fwd
AACCAGCAACTTTCCACCAC
MDM2_ChIP_Rev GAAAAGTTCCGCTCACAAGC
The qRT-PCR reagent used was the SsoFast
TM
EvaGreen

Supermix (BioRad, USA) and the qPCR
analyses were performed using a BIO Rads CFX96 RT-PCR system (BioRad) following the
manufacturers guidelines and the thermal profile is shown on the previous image.
Fluorescent activated cell scanning (FACS).
Cells were grown to 60% confluence. BrdU was added to the medium 2 hours prior to PI3K inhibition.
Samples were run on a Fluorescence Activated Cell Scanner (FACS) after propidium iodide (2.5 mg mL-
1) was added to the fixed, stained cells prior to analysis. 50,000 total events were scored per study from
triplicate studies. Data was analyzed using FACS-express 3 (De Novo software, US).

Figure 1 RT-PCR thermal profile
Page 7 of 15

Results
TRIB2 over expression correlates with significant resistance to apoptosis via the inhibition of
FOXO3a regulated gene expression.
The first thing we questioned was the phenotype of TRIB2 over expressing cells versus matched
control cells. We note that following BEZ exposure that U2OS empty cells display significant caspase-3
cleavage (Figure 1A, page 8) consistent with the cell morphology and cell detachment observed post-
treatment. Strikingly cells that over express TRIB2 show significantly reduced caspase-3 cleavage that is
consistent with the resistance to BEZ treatment (as well as other PI3K inhibitors). We confirmed that our
stable transfected TRIB2 cells expressed significant amounts of this protein and that by probing for actin,
that an equivalent amount of protein was loaded per lane. Interestingly, we note that the BEZ treatment of
U2OS-TRIB2 cells resulted in an increase in the total level of TRIB2 protein. We hypothesize that this is
independent of any transcriptional changes as the TRIB2 gene in this cell line is driven by a CMV
promoter thus is robustly and consistently expressed independently of the PI3K signaling
Having observed stable TRIB2 transfection and a clear TRIB2 dependent phenotype following
BEZ exposure we questioned what other phenotypic changes BEZ was inducing. Prior to BEZ exposure,
there was no significant difference in terms of cell cycle distribution between either cell line. 48 hours
post 100 nM BEZ treatment we note that in U2OS-Empty cells that there is the complete loss of the G
2

(4N) population and a significantly increased sub-G
1
population (Figure1B). In contrast, the U2OS-
TRIB2 cell line shows a more distinct G
1
population with a small G
2
population evident (Figure 1B). In
addition, there is significantly less sub-G
1
cells, indicative of viable cells.
Our results at this stage suggest that the key difference is related to the sub-G1 cell death phase and
from our data shown in Figure 1A, that this population is apoptotic. As BEZ is a potent PI3K inhibitor
that regulates the FOXO family of proteins, we questioned what is there was a difference between FOXO
regulated proteins in empty versus TRIB2 over expressing U2OS cells. We note in U2OS-empty cells
following BEZ treatment that there is the rapid accumulation of both Bim and Fas-L (Figure 1C). In
contrast and supporting our previous data, there is a significantly attenuated accumulation of both Bim
and Fas-L in U2OS-TRIB2 expressing cells. This supports our groups previous data (not shown in this
report) that TRIB2 could inhibit FOXO as well as our results shown here in Figure 1A and 1B.
Having seen that the stable over expression of TRIB2 (following BEZ treatment) inhibits the
accumulation of both Bim and Fas-L, we questioned if this was at the level of transcription or post-
transcription. using qRT-PCR we measured the transcription of each gene in both cell lines up to 12 hours
post 100 nM BEZ treatment. For both Bim and Fas-L we note that TRIB2 over expressing cell lines show
significantly (P=<0.005) reduced transcription of each target (Figure 1D). In contrast, the FOXO3a-
regulated gene p27 showed no significant expression difference between either cell lines. For each set of
analysis, expression was normalized to GAPDH and all data was normalized using the 2
-CT

Page 8 of 15


Page 9 of 15

methodology. Based on these results, we hypothesized that the increased resistance to the PI3K inhibitor
BEZ was due to TRIB2-mediated inhibition of pro-apoptotic FOXO3a regulated genes.
100 nM BEZ239 potently inhibits Akt activation and downstream signaling.
Having observed that TRIB2 conferred resistance BEZ via the inhibition of FOXO3a mediated pro-
apoptotic gene expression; we wanted to confirm that our PI3K inhibitor was specifically blocking the
signaling cascade we were targeting, in this case Akt. To this end we treated either our U2OS
osteosarcoma or our human melanoma cell line G361 with 100 nM BEZ and evaluated the expression and
post-translational modifications of key PI3K regulated signaling proteins (Figure 2 shown below).
We note that as early as 30 minutes
post BEZ exposure that there is the rapid
loss of Ser473-phosphorylated Akt in
each cell line investigated. We were
concerned that this loss of phosphorylated
protein could be due to the loss of total
Akt and to address this concern we
evaluated the expression of total Akt
protein. In each cell line at all time points
investigated robustly and equivalently detect total Akt. As mentioned previously, FOXO3a is a
downstream target of Akt. Having observed the loss of phosphorylated Akt (and thus the inactivation of
Akt) we questioned if in U2OS and G361 cells, we could detect the activation (via de-phosphorylation) of
FOXO3a, consistent with Akt inhibition. We note that while the kinetics of de-phosphorylation was
slower than noted for Akt, that there was the complete loss of Ser253-phosphorylated FOXO3a in each
cell line following BEZ treatment by 6 hours post exposure. FOXO3a de-phosphorylation was slower in
G361 cells compared to U2OS although this was predicted due to the significantly higher level of
phosphorylated Akt in the G361 cells (compared to U2OS cells). From these studies we can conclude that
in each cell line model we are using that our PI3K inhibitor BEZ is highly effective and that while active
(as these are transformed cells) once inhibited, the de-phosphorylation (and thus activation) signal can be
transmitted to FOXO3a. This data strongly complements our results shown in Figure 1, clearly suggesting
that TRIB2 coonfers resistance to BEZ via the inhibition of FOXO3a mediated pro-apoptotic gene
expression.
TRIB2 over expressing cell lines show a de-regulated p53/MDM2 relationship.
We note that following BEZ exposure cells that do not over express TRIB2 show significant cell
apoptotic cell death compared to matched over expressing TRIB2 cells. This effect was mediated at the
level of pro-apoptotic gene expression, in particular Bim. This protein is a BH3-family member and other
members of this family include Bax and PUMA (the p53 upregulated modulator of apoptosis).
Page 10 of 15

Considering the functional similarities between FOXO3a and p53 and the importance of p53 in many
types of human cancer, we wanted to investigate if BEZ exposure or the presence of TRIB2 impacted
p53. We carried out immunoblotting for p53 and the negative regulator of p53 MDM2 in our matched
U2OS cell line (Figure 3A). We note that
U2OS-empty cells show a gradual
increase in total p53 up to 12 hours post
BEZ treatment. In contrast, U2OS-TRIB2
cells show a significantly lower level of
p53 under non-treated conditions, an
initial increase 30 minutes post BEZ
exposure and then a noticeable decrease
up to 12 hours post BEZ incubation.
Strikingly, the exact opposite trend was
observed for MDM2 raising the
hypothesis that in cells that over express
TRIB2, the p53/MDM2 regulatory
balance is disrupted. This supports our
preliminary data (not shown here) where
TRIB2 over expression confers cell line
resistance to various chemotherapeutics
(including gemcitabine and doxorubicin).
Even more interestingly, we note this p53/MDM2 deregulation in primary ex vivo melanoma samples
compared to control skin tissue (highlighted in Joo Manuel Cristvo rfo MEE report). This is a
focus of significant research within our group. Based on our results so far we wanted to address
if FOXO3a and p53 were binding to key gene promoters (p27 and Bim and p21 and MDM2
respectively). Before conducting chromatin immunoprecipitation assays, we wanted to confirm
that our antibodies could immunoprecipitate each protein. Immunoprecipitations (IP) were
carried out for each protein (Figure 3B) and as we would predict, we were able to IP either
FOXO3a or p53. Some faint bands could be observed in our control IgG lanes although this is
likely slight over-spill between lanes due to the amount of protein loaded per lane (500 g total
protein).
Chromatin immunoprecipitation reveals significant differences in FOXO3a and p53 recruitment to
gene promoters when TRIB2 is over expressed.
After we confirmed that each of our antibodies could IP their respective protein, we questioned if
both prior to PI3K inhibition and after BEZ treatment there were differences in either FOXO3a or p53
Page 11 of 15

promoter binding. We observe that under normal conditions, G361-empty (that have a high basal level of
TRIB2) show a subtle (although statistically significant) increase in FOXO3a binding to the p27 promoter
Page 12 of 15

compared to matched G361 cells with TRIB2 knocked down (by shRNA) (Figure 4A and 4B).
Interestingly G361-TRIB2 shRNA cells when treated with BEZ show a robust accumulation of FOXO3a
on the p27 promoter. In contrast, G361-empty cells show no accumulation of FOXO3a on the p27
promoter. This same pattern was noted on the Bim promoter. Even more striking, we see a similar p53
promoter recruitment profile on the p21 and MDM2 promoters; g361-TRIB2 shRNA cells show increased
p53 promoter binding. G361-empty cells (that have a high level of TRIB2) show significantly attenuated
p53 binding, suggesting a potential mechanism of action regarding the chemotherapeutic drug resistance
we have previous observed. These findings were confirmed in the matched U2OS-empty/U2OS-TRIB2
cell line model (Figure 4C and 4D). As we would have predicted, no FOXO3a protein was bound on
either the p21 or MDM2 promoters while p53 could not be observed binding to either p27 or Bim. From
these studies we can conclude that the ablated transcription on we show in Figure 1 is likely the result of
reduced binding of FOXO3a to key pro-apoptotic genes. This needs to be significantly expanded and is
considered in detail below. This deregulated promoter recruitment displayed by FOXO3a and p53 is
extremely interesting and is being very aggressively pursued in our group.
Discussion.
Recent findings by our group and others has highlighted that a significant obstacle in the effective
treatment of cancer is the over expression of the protein TRIB2 within tumours. How TRIB2 can direct
this chemo-resistance is unknown although some of the work presented here has begun to address this
important issue. In this study we show that TRIB2 over expressing cells show significantly less caspase-3
cleavage and phenotypically characterized by a significantly reduced Sub-G
1
population of cells
following BEZ treatment compared to matched non-TRIB2 over expressing cells. Interestingly, our
FACS analysis demonstrated that prior to BEZ exposure; there was no significant difference at all
between TRIB2 over expressing cells and our empty vector control cells, suggesting that the TRIB2
phenotype we (and others) have observed is independent of the cell cycle. Clearly this needs to be more
robustly confirmed. This findings show that the over expression of TRIB2 has no influence on the cell
cycle, and promotes chemo-resistance by the inhibition of PI3K, a major regulator of the transcription
factor FOXO3a. Our data indicates that cells that over express TRIB2, following BEZ treatment have a
significantly lower accumulation of both Bim and Fas-L (two key pro-apoptotic proteins regulated by
FOXO3a) compared to our matched control cell line. Analyzing the nature of this decrease, with
quantification methods, it was possible to understand that the decrease was due to a diminution of the
transcription of each of these genes within the TRIB2 cell line, suggesting that TRIB2 may inhibit
transcription. We confirmed that this was more specific as the transcriptional analysis of the FOXO3a
regulated gene p27 showed no significant difference between our TRIB2 cell line and the matched control
cell line, suggesting that TRIB2 was specifically affecting FOXXO3a-dependent pro-apoptotic gene
expression, a conclusion further supported by our FACS analysis. We confirmed in our cell line models
that BEZ was functioning specifically, examining the expression and post-translational modifications of
Page 13 of 15

key proteins regulated by PI3K. BEZ treatment directed the loss of phosphorylated Akt, causing its
inactivation, and since FOXO3a is a downstream target of Akt, we note FOXO3a activation. This
suggests that TRIB2 confers resistance to BEZ through the inhibition of FOXO3a mediated pro-apoptotic
gene expression.
Since p53 and FOXO3a are similar transcription factors controlling the same processes questioned
if TRIB2 and BEZ impacted the p53 pathway. To this end, p53 and MDM2 (the negative regulator of
p53) were tested. We demonstrate that in our non-over expressing TRIB2 cell line, that there is an
increase in the accumulation of p53, while TRIB2 cells display a deregulated p53 response, characterized
by significantly elevated MDM2 and reduced overall p53. Again this highlights that the over expression
of TRIB2 could promote chemo-resistance.
Knowing that FOXO3a and p53 are recruited to many key gene promoters (such as p27, Bim, p21
or MDM2, respectively) we conducted ChIP assays. In non-treated G631 cells (that have high endogenous
TRIB2 protein expression), FOXO3a recruitment to the p27 promoter was higher than G361 with TRIB2
knocked down (by shRNA), Following BEZ treatment, the knock down of TRIB2 resulted in an
accumulation of FOXO3a on the p27 (and Bim) promoters, and an accumulation of p53 on the p21 and
MDM2 promoters. Once again, the inability of cancer cells to correctly regulate these responses (possibly
due to the presence of TRIB2) might be in the basis for the chemo-resistance we have observed. Finally,
it is possible to conclude that the knock out of the transcription is due to a decrease in the binding of
FOXO3a to key pro-apototic genes.
As for future directions, there are several experiments that could be performed to corroborate this
findings, such as ChIP assay for RNA-Pol II (to address if the loss of Bim and Fas-L is due to a failure for
RNA-Pol II to be recruited to these gene promoters), ChIP assays for active RNA-Pol II (ser2/ser5) (to
address if RNA-Pol II is recruited, if it is active and will transcribe each gene), ChIP assays for more
FOXO3a regulated genes and ChIP assay for more p53 genes. We will expand our studies to investigate
more PI3K inhibitors, testing more potent and newly developed compounds. Our work will also be
expanded to include additional melanoma cell lines, based on the screening the Joo carried out and to
evaluate FOXO3a and p53 promoter binding from ex vivo clinical samples.
Acknowledgements.
I would like to first thank Dr. Wolfgang Link for the yes on joining the lab, and Dr. Richard Hill, for
guidance, support and research ideas during my times within the lab. Thank you to my dear friends and
lab partners Laura Colao and Ricardo Brando, for passing me their knowledge, and to Joo Orfo, my
MIM colleague.

Page 14 of 15

References.
1. Dzwierzynski,W.W. Managing malignant melanoma. Plast. Reconstr. Surg. 132, 446e-460e (2013).
2. Liu,L.S. & Colegio,O.R. Molecularly targeted therapies for melanoma. Int. J. Dermatol. 52, 523-
530 (2013).
3. Friedlander,P. & Hodi,F.S. Advances in targeted therapy for melanoma. Clin. Adv. Hematol. Oncol.
8, 619-627 (2010).
4. Hersey,P., Watts,R.N., Zhang,X.D., & Hackett,J. Metabolic approaches to treatment of melanoma.
Clin. Cancer Res. 15, 6490-6494 (2009).
5. Velho,T.R. Metastatic melanoma - a review of current and future drugs. Drugs Context. 2012,
212242 (2012).
6. Bollag,G. et al. Vemurafenib: the first drug approved for BRAF-mutant cancer. Nat. Rev. Drug
Discov. 11, 873-886 (2012).
7. Kashani-Sabet,M. et al. A multi-marker assay to distinguish malignant melanomas from benign
nevi. Proc. Natl. Acad. Sci. U. S. A 106, 6268-6272 (2009).
8. Liu,L.S. & Colegio,O.R. Molecularly targeted therapies for nonmelanoma skin cancers. Int. J.
Dermatol. 52, 654-665 (2013).
9. Soengas,M.S. & Lowe,S.W. Apoptosis and melanoma chemoresistance. Oncogene 22, 3138-3151
(2003).
10. Thrift,A.P. & Whiteman,D.C. Can we really predict risk of cancer? Cancer Epidemiol. 37, 349-352
(2013).
11. Acquaviva,J. et al. Overcoming Acquired BRAF Inhibitor Resistance in Melanoma via Targeted
Inhibition of Hsp90 with Ganetespib. Mol. Cancer Ther.(2014).
12. Flaherty,K.T. et al. Combined BRAF and MEK inhibition in melanoma with BRAF V600 mutations.
N. Engl. J. Med. 367, 1694-1703 (2012).
13. Flaherty,L. et al. A single-arm, open-label, expanded access study of vemurafenib in patients with
metastatic melanoma in the United States. Cancer J. 20, 18-24 (2014).
14. Weber,J.S. et al. Safety, efficacy, and biomarkers of nivolumab with vaccine in ipilimumab-
refractory or -naive melanoma. J. Clin. Oncol. 31, 4311-4318 (2013).
15. Williams,J.R. et al. A quantitative overview of radiosensitivity of human tumor cells across
histological type and TP53 status. Int. J. Radiat. Biol. 84, 253-264 (2008).
16. Garcia-Echeverria,C. & Sellers,W.R. Drug discovery approaches targeting the PI3K/Akt pathway in
cancer. Oncogene 27, 5511-5526 (2008).
17. Carnero,A., Blanco-Aparicio,C., Renner,O., Link,W., & Leal,J.F. The PTEN/PI3K/AKT signalling
pathway in cancer, therapeutic implications. Curr. Cancer Drug Targets. 8, 187-198 (2008).
18. Engelman,J.A. Targeting PI3K signalling in cancer: opportunities, challenges and limitations. Nat.
Rev. Cancer 9, 550-562 (2009).
Page 15 of 15

19. Link,W. et al. Chemical interrogation of FOXO3a nuclear translocation identifies potent and
selective inhibitors of phosphoinositide 3-kinases. J. Biol. Chem. 284, 28392-28400 (2009).
20. You,H. et al. FOXO3a-dependent regulation of Puma in response to cytokine/growth factor
withdrawal. J. Exp. Med. 203, 1657-1663 (2006).
21. Zanella,F., Link,W., & Carnero,A. Understanding FOXO, new views on old transcription factors.
Curr. Cancer Drug Targets. 10, 135-146 (2010).
22. Fu,Z. & Tindall,D.J. FOXOs, cancer and regulation of apoptosis. Oncogene 27, 2312-2319 (2008).
23. Grandinetti,K.B. et al. Overexpression of TRIB2 in human lung cancers contributes to
tumorigenesis through downregulation of C/EBPalpha. Oncogene 30, 3328-3335 (2011).
24. Zanella,F. et al. Human TRIB2 is a repressor of FOXO that contributes to the malignant phenotype
of melanoma cells. Oncogene 29, 2973-2982 (2010).