Scribd Logo
Upload

Welcome to Scribd!

  • Because This Is Written in My Genes

    Uploaded by

    Luel Dalina Panes
    6 views1 page

    Original Title

    Because This is Written in My Genes

    Copyright

    © © All Rights Reserved

    Available Formats

    DOCX, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    Report this Document

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Flag for inappropriate content
    6 views1 page

    Because This Is Written in My Genes

    Uploaded by

    Luel Dalina Panes

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Flag for inappropriate content
    of 1

    Because this is written in my genes..

    to the DNA level..


    5'ATGGCGCACGCACTTAAGATCACCGCTTAG3'
    3'TACCGCGTGCGTGAATTCTAGTGGCGAATC5'

    to the RNA level..
    5'AUGGCGCACGCACUUAAGAUCACCGCUUAG3'

    to the polypeptide level..
    M A H A L K I T A Stop

    You might also like