Bio Chapter # Marker Assisted Selection (MAS) PDF

57
Iowa State University Extension and ISU Office of Biotechnology

Educators Lesson Module II Marker Assisted Selection
Marker Assisted
Selection (MAS)
PREFACE
Marker assisted selection (MAS) is a combined product
of traditional genetics and molecular biology. MAS
allows for the selection of genes that control traits of
interest. Combined with traditional selection tech-
niques, MAS has become a valuable tool in selecting
organisms for traits of interest, such as color, meat
quality, or disease resistance.
This module examines two cases in which mutations
called single nucleotide polymorphisms or SNPs
(pronounced snips) have been used for selection.
Students are asked to investigate and discuss the
economic impact that this selection technique could
have on producers and consumers.
BACKGROUND INFORMATION
MAS Introduction
Deoxyribonucleic acid (DNA) is a molecule made up of
pairs of building blocks called nucleotides. The four
kinds of nucleotides that make up DNA are adenine
(abbreviated as the single letter A), guanine (G),
cytosine (C), and thymine (T). The DNA molecule has
the shape of two intertwined spirals, referred to as a
double helix.
DNA is packaged into chromosomes that are located
within the nucleus of all cells. These chromosomes are
the same in every cell of an organism and together
make up the organisms genetic information, its
genome. Chromosomes contain stretches of DNA
called genes that code for amino acids that make
proteins. It is the proteins that are the foundation of life
for all organisms. The interaction and structure of
proteins determine the visible characteristics or
phenotype of an organism, while the genetic makeup of
an organism is called its genotype.
The sequence of nucleotides that make up a gene can
differ among individuals. The different forms of a gene
are called alleles. The alleles are the result of nucle-
otide differences in a gene that affect an amino acid
sequence of a protein. This can result in a change,
addition, or deletion of a protein that can affect
the phenotype.
All organisms receive one copy of each gene from their
mother and one from their father. The DNA sequence
of a gene inherited from each parent may be identical,
in which case the individual is said to be homozygous
for that trait. Or the sequence of the gene from one of
the parents may be different, in which case the
individual is said to be heterozygous. Allele variations
may differ in their DNA sequence by as little as a
single nucleotide.
Differences among alleles caused by a single nucleotide,
called SNPs, can be the basis of genotyping tests.
Genotyping means using laboratory methods to
determine the sequence of nucleotides in the DNA from
an individual, usually a specific gene. Genetic tests
based on SNPs utilize DNA derived from an individual
to determine the nucleotide in the gene of interest.
Marker assisted selection is the process of using the
results of DNA testing in the selection of individuals
to become parents for the next generations. The
information from the DNA testing, combined with the
observed performance records for individuals, is
intended to improve the accuracy of selection and
increase the possibility of identifying organisms
carrying desirable and undesirable traits at an earlier
stage of development.
Complex traits, including many of economic impor-
tance, are controlled by many genes and are influenced
by the environment. When an animal has a favorable
performance record for a certain trait, it means that
based on pedigree and phenotype, the animal has
inherited a greater than average number of good alleles
of each gene affecting that specific trait.
It is important to combine DNA results with perfor-
mance and phenotype information to maximize the
effectiveness of selection for traits of interest. Combin-
ing information from performance records and genetic
tests into the selection process will be better than using
performance, phenotype, and markers separately. The
challenge is to determine what emphasis marker
information should be given in the selection decision.
Molecular Markers
Until recently, researchers relied on information about
how animals, plants, and their relatives perform to
II
58
make observations about the genes they possess. Today,
researchers can use molecular markers to find genes of
interest that control how plants and animals perform.
Some molecular markers are pieces of DNA that have
no known function or impact on animal and plant
performance. Other markers may involve the gene of
interest itself.
Linked Markers
One type of molecular marker is called a linked marker.
Using well-designed experiments, scientists can find
molecular markers that are located very close to major
genes of interest. The molecular marker is said to be
linked to that gene. Linked markers are only near the
gene of interest on the chromosome and are not part of
the DNA of the gene of interest.
Suppose that scientists are trying to locate a certain
gene in an animal species. Choosing animals randomly
from a population and studying them would give the
scientists no clues about whether a marker is associated
with the gene. However, if scientists studied the
progeny (offspring) of the mating of male and female
animals through many generations, they may determine
the presence of a useful molecular marker.
Direct Markers
A second kind of molecular marker is one that is part of
the gene of interest. Direct markers are easier to work
with after they are found, but they often are more
difficult to find than linked markers.
Marker-Assisted Selection
Three common technologies used as molecular
markers are: restriction fragment length polymor-
phisms, simple sequence repeats, and single
nucleotide polymorphisms.
Restriction Fragment Length Polymorphisms
(RFLPs)
Restriction fragment length polymorphisms (RFLPs)
were the first molecular markers used to diagnose
genetic variability in organisms. RFLP uses restriction
enzymes to digest (cut) the DNA molecule and identify
regions linked to a trait. The number of DNA frag-
ments generated by one restriction enzyme digest can
be in the millions, with many being several thousand
nucleotides long. This makes it difficult to determine
specific DNA fragments that are associated with the
trait of interest on an electrophoresis gel. To help
visualize specific DNA fragments, a technique called
Southern blotting was developed.
Southern blotting uses a porous membrane containing
specific radioactive DNA probes for one or more DNA
fragments. Probes are very short pieces of DNA used to
find specific sequences of A, C, T, and G in very long
pieces of DNA from a chromosome. The probe
hybridizes (attaches) to the membrane at a unique DNA
band on an electrophoresis gel. The membrane
containing the probe is developed on X-ray film and
analyzed. See Figure 1.
Simple Sequence Repeats or Microsatellites
Simple sequence repeats (SSRs), also called
microsatellites, are repeated units of two to six nucle-
otides that occur throughout an organisms genome.
The sequence ATATATAT is one example of a
microsatellite. The sequence GATGATGAT is another
example. SSRs are useful as molecular markers because
they are highly polymorphic (have many forms). SSRs
have been used successfully as markers in a wide range
of analysis, particularly those involving disease diagno-
sis and forensics.
1. The process begins with a
blood or cell sample from which
the DNA is extracted.
2. The DNA is cut into fragments
using a restriction enzyme. The
fragments are then separated into
bands by electrophoresis through
an agarose gel.
3. The DNA band pattern is
transferred to a nylon membrane.
4. A radioactive DNA probe is
introduced. The DNA probe binds
to specific DNA sequences on the
nylon membrane.
5. The excess probe material is
washed away leaving the unique
DNA band pattern.
6. The radioactive DNA pattern is
transferred to X-ray film by direct
exposure. When developed, the
resultant visible pattern is the
DNA FINGERPRINT.
THE PROCESS OF DNA FINGERPRINTING
Figure 1
59
Single Nucleotide Polymorphisms (SNPs)
On average, SNPs will occur in an organisms DNA
more than 1% of the time. Because only about 3% to
5% of an organisms DNA codes for proteins, most SNPs
are found outside the regions of genes of interest. SNPs
found in a gene of interest are of particular interest to
researchers because they are directly associated with a
desired trait. Because of the recent advances in technol-
ogy, SNPs are playing a greater role in selection and
diagnosis of genetic traits.
Advantage of Molecular Markers
The advantage of molecular markers for researchers
is that they can test for a particular trait as early as the
embryo stage in animals or in the seeds of plants before
they are planted. There is no longer a need for the
organism to develop to a stage at which the trait
can be observed, a wait that in some cases can take
many years.
The Role of PCR in MAS
Once a direct or linked marker has been located,
characterized, and sequenced, a method called poly-
merase chain reaction (PCR) can be used to make
copies of a specific region of DNA to produce enough
DNA to conduct a test. Figure 2 on the next two pages
summarizes the PCR process. Since its conception in
1983 by Kary Mullis, it has become one of the most
widely used techniques in molecular biology. It is a
rapid and simple means of producing a relatively large
amount of DNA from a very small amount of DNA.
DNA replication in natural systems requires:
a source of the nucleotides adenine (A), cytosine (C),
thymine (T), and guanine (G);
the DNA polymerase (DNA synthesis enzyme);
a short RNA molecule (primer);
a DNA strand to be copied;
and proper reaction conditions (pH, temperature).
The DNA is unwound enzymatically, the RNA molecule
is synthesized, the DNA polymerase attaches to the
RNA, and a complementary DNA strand is synthesized.
Use of PCR in the laboratory involves the same compo-
nents and mechanisms of the natural system, but there
are three primary differences:
(1) DNA primers are used instead of the RNA primer
found in the natural system. DNA primers are
usually 18-25 nucleotide bases long and are
designed so that they attach to both sides of the
region of DNA to be copied.
(2) Magnesium ions that play a role in DNA replication
are added to the reaction mixture.
(3) A DNA polymerase enzyme that can withstand
high temperatures, such as Taq, is used.
(4) A reaction buffer is used to establish the correct
conditions for the DNA polymerase to work.
The DNA primers are complementary (match up) to
opposite strands of the DNA to be copied, so that both
strands can be synthesized at the same time. A and T
match, and C and G match. Because the reaction
mixture contains primers complementary to both
strands of DNA, the products of the DNA synthesis can
themselves be copied with the opposite primer.
The length of the DNA to be copied is determined by
the position of the two primers relative to the targeted
DNA region. The DNA copies are a defined length and
at a specific location on the original DNA. Because
DNA replication starts from the primers, the new
strands of DNA include the sequence of the primers.
This provides a sequence on the new strands to which
the primers can attach to make additional DNA copies.
Over the years, the PCR procedure has been simplified
and the results made uniform as a result of two impor-
tant developments. The first was the isolation of a heat-
stable DNA polymerase, Taq polymerase. This enzyme
gets its name from the bacteria from which it was
isolated, Thermus aquaticus. This bacteria was discov-
ered living in the boiling water of hot springs. Until Taq
polymerase was discovered, the DNA polymerases
available to researchers were destroyed at 65C. The
Taq enzyme is not destroyed by the high temperature
required to denature the DNA template (pattern).
Therefore, using this enzyme eliminates the need to add
new enzyme to the tube for each new cycle of copying,
commonly done before Taqs discovery.
The PCR procedure involves three steps that make up a
cycle of copying. Each step allows the temperature of
the mixture to change to optimize the reaction. The
cycles are repeated as many times as necessary to obtain
the desired amount of DNA.
STEP 1 DENATURATION
The double-stranded DNA that is to be copied is heated
to ~95C so that the hydrogen bonds between the
complementary bases are broken. This creates two,
single stranded pieces of DNA.
60
Figure 2
The Polymerase Chain Reaction Process
(continued on next page)
1. Denaturation
The double-stranded DNA
containing the area of interest
(target DNA) is heated to about
95 C.
The hydrogen bonds between
the bases on the strand are
broken. This results in two
single-stranded pieces of DNA.
2. Annealing
The single-stranded pieces of
DNA are cooled to about 58 C.
The primers form hydrogen
bonds to attach themselves to
their complementary bases on
the single-stranded pieces of
DNA.
3. DNA Synthesis
The DNA pieces resulting from
step 2 are heated to about 72 C.
Polymerase enzyme, Taq,
attaches at each priming site
and extends by adding As, Ts,
Cs, and Gs, forming a new
DNA strand.
Cycle two begins by again
raising the temperature to
about 95 C. to denature the
DNA made in cycle 1. The
entire PCR cycle begins again.
95 C.
58 C.
72 C.
Cycle One
Target DNA
Taq
Taq
Primers
(4 bp)
61
4. Denaturation
Heating separates the DNA
strands from cycle one. The
original strands and the strands
made in cycle one each contain
the target DNA.
5. Annealing
The primers attach themselves
to the two original strands of
DNA and the two strands
produced in cycle one.
6. DNA Synthesis
Four new DNA strands are
synthesized. Millions of copies
of the target DNA can be
produced within hours.
95 C.
58 C.
Cycle Two
72 C.
Target DNA
Taq
Taq
Taq
Taq
Original DNA
Copied DNA
Copied DNA
Original DNA
62
STEP 2 ANNEALING or HYBRIDIZATION
The temperature is lowered to ~58C so the DNA
primers can bind to the complementary sequence on
the single-stranded DNA by forming hydrogen bonds
between the bases of the template and the primers.
STEP 3 DNA SYNTHESIS or EXTENSION
During the replication step, the reaction solution is
heated to ~72C so the DNA polymerase incorporates
the nucleotide bases A, C, T, and G into the new copy
of DNA. The new DNA strand is formed by connecting
bases that are complementary to the template until it
comes to the end of the region to be copied.
To view simulations of the PCR process, go to
www.biotech.iastate.edu/publications/ed_resources/
Laboratory_protocols.html and find the PCR activity
and simulation links.
To view an animation of the PCR process, visit
www.dnalc.org/resources/BiologyAnimationLibrary.htm
and view or download the polymerase chain reaction.
DNA Sequencing
A technology used to detect molecular markers of DNA
is called DNA sequencing. DNA sequencing is the
process of determining the exact order of the bases A, T,
C, and G in a piece of DNA. The DNA to be sequenced
is used to generate a set of fragments that differ in
length from each other by one base pair. The fragments
are separated by size using electro-
phoresis. By reading the gel from the
bottom up, the sequence of DNA can
be determined.
The most commonly used method of
sequencing DNA was developed by
Frederick Sanger in 1977. He modified
the chemical structure of the normal
nucleotides used in PCR by replacing a
hydroxyl group (OH) with a hydrogen
(H) on the 3 carbon. The modified
molecule is referred to as a
dideoxynucleotide (ddNTP). This
chemical change in the nucleotide
causes the replication of the DNA
strand to terminate during the PCR
process. Four PCR reactions, each
containing a different ddNTP along
with the normal dNTPs, are conducted.
This generates many different sizes of
fragments in the reaction solution, each
ending with a specific nucleotide.
ddC ddT ddA ddG
Actual Fragment Sizes
CATTCGAATGCA
CATTCGAATGC
CATTCGAATG
CATTCGAAT
CATTCGAA
CATTCGA
CATTCG
CATTC
CATT
CAT
CA
C
Figure 3
The four reaction solutions are loaded into side-by-side
wells and electrophoresed in one of several gel matrixes.
The distance the fragment migrates is inversely propor-
tional to its size. The smallest fragment travels farther
and faster through the gel matrix than the larger
fragments, thus creating a ladder or pattern of bands
that can be read from the bottom to the top of the gel.
In the gel pictured in Figure 3, the size of the fragment
increases by one base pair relative to its position on the
gel. The DNA sequence for the gel is read as
CATTCGAATGCA.
To view a sequencing simulation, go to www.dnalc.org/
shockwave/cycseq.html or www.pbs.org/wgbh/nova/
genome/sequencer.html.
Part I
Sire Osborndale Ivanhoe:
The Story of Bovine Leukocyte Adhesion
Deficiency (BLAD)
By the year 1988, a genetic disease specific to Holstein
cattle was claiming an ever-increasing number of
animals. Because Holsteins are a major breed in milk
production throughout the world, the disease was
causing serious economic loss to the milk industry. The
disease, called bovine leukocyte adhesion deficiency or
BLAD, is characterized in young calves by their inability
63
to fight off common bacterial infections like pneumo-
nia. Death usually occurs at an early age.
BLAD is caused by a hereditary genetic mutation that
disrupts the function of a protein on white blood cells
called leukocytes. Leukocytes are part of the immune
system and help cattle fight disease. When a cow is
exposed to an infectious agent called an antigen, leuko-
cytes are attracted to the site of the infection by mole-
cules that appear on the walls of blood vessels closest to
the infected area. When the leukocytes reach the
infected area, they attach to the vessel walls, go through
the walls into the infected tissue, and destroy the
antigen. The mutation associated with BLAD changes
the leukocyte so it cannot attach to the vessel wall and
reach infected tissue.
BLAD is an autosomal (non-sex chromosome) recessive
disease. To suffer from the disease, calves must have
two defective alleles for the trait, one donated by
each parent.
Through an investigation of pedigrees of affected calves,
a common sire was determined. Osborndale Ivanhoe, a
Holstein bull, is now known to have had the largest
impact of any bull on the Holstein breed. It is estimated
that he sired over 79,000 daughters and over 1,200 sons
that produced additional female cows. By the time
BLAD was understood and a molecular test developed
in 1991, some estimates are that 28% of the Holstein
population tested positive as BLAD carriers, and an
estimated 16,000-20,000 calves were born with BLAD
each year in the United States.
How could one bull be responsible for a genetic disease
that spread through a large segment of the Holstein
breed? The answer lies in the way the dairy industry
breeds its cows for milk production. Bulls are selected
for breeding by evaluating the milk production of their
female offspring. When a bull has female offspring with
superior milk production, its sperm are collected for
use in artificial insemination (AI). The benefit of AI is
that one bull of superior genetics can improve the
performance of herds on many farms. One of the risks
of AI is that if a sire is a heterozygous carrier of an
undesirable recessive allele, that allele can be spread
undetected to many progeny.
Because bulls and cows with heterozygous alleles for
the trait are healthy, a recessive allele can spread
undetected for many generations. See the BLAD
pedigree, Figure 4.
When a heterozygous bull is crossed with a heterozy-
gous cow, there is a 25% chance the calf will be inflicted
with BLAD, and a 50% chance the calves will be
carriers. See Figure 5. Breeders needed a reliable test to
identify cattle that were heterozygous carriers. The test
that was developed was marker assisted selection.
Scientists found that the deleterious recessive allele for
BLAD had two mutations in the CD18 gene. One of the
mutations did not affect the amino acid sequence, but
the second mutation caused an incorrect amino acid to
be produced. In that second mutation, the nucleotide
guanine (G) replaced adenine (A) so the amino acid
glycine is produced instead of aspartic acid. See Figure
6. Figure 7 illustrates the DNA strands from each allele
Figure 4
BLAD Pedigree
II
I
III
IV
V
inbreeding
Osborndale Ivanhoe
64
B b
B B B b B
b b B b b
Figure 5
containing the site of the BLAD mutation during the
PCR process. When these PCR products are treated
with the restriction (cutting) enzyme TaqI, the enzyme
recognizes the TCGA sequence and cuts between the T
and C nucleotides. Each strand will generate DNA
fragments consistent with the presence or absence of
the restriction site TCGA on the strand. A normal DNA
sequence will contain a TaqI restriction site and
generate two fragments, one of 26 base pairs (bp) and
Cattle that have the Bb alleles are carriers of BLAD.
Affected cattle have two copies of the b allele.
the other 32 bp. In the case of the BLAD mutation, the
restriction site for TaqI is lost. Since there is no restric-
tion site for TaqI on the mutation, a single fragment of
58 bp (the size of the PCR product) remains. The
presence of the 26, 32 and 58 bp fragments indicate the
carrier. See Figure 8.
The protein with the amino acid change prevents
leukocytes from reaching and destroying the invading
antigen by interfering with their ability to adhere to the
blood vessel walls at the area of infection. This is why
calves with BLAD cannot fight infections and die early
in life.
Using molecular marker technology, it has been
possible to identify the heterozygous carriers of BLAD
and remove those individuals from the breeding stock.
As a result, the disease has been virtually eliminated
from the Holstein cattle breed.
The defective allele causing BLAD has not been found
in breeds other than Holsteins. However, a similar form
of the genetic disorder has been described in humans.
Figure 6
Protein Synthesis from the Normal CD18 Gene
DNA Strand 5ggc tac ccc atc gac ctg tac tac ctg 3
Amino Acids gly tyr pro lle asp leu tyr try leu
Protein Synthesis from the BLAD Mutation CD18 Gene
DNA Strand 5ggc tac ccc atc ggc ctg tac tac ctg 3
Amino Acids gly tyr pro lle gly leu tyr try leu
When the nucleotide adenine (a) is replaced by guanine (g) in the DNA strand, the amino acid glycine (gly) is
produced instead of the correct amino acid aspartic acid (asp). The result is the BLAD condition in cattle.
65
Figure 7
Figure 7 shows the DNA fragments produced by normal cattle, heterozygous BLAD carriers, and
homozygous BLAD affected cattle when their DNA is mixed with the Taq1 enzyme. The enzyme
recognizes the tcga sequence and cuts (t / cga) between the t and c nucleotides. When guanine
(g) replaces adenine (a), the tcga sequence is replaced by tcgg and the enzyme does not cut
the strand.
32 bp 26 bp
DNA Strands Involved in Diagnosis of BLAD
Normal: 32 and 26 bp segments produced
5gtgaccttccggagggccaagggctaccccat / cgacctgtactacctgatggacctct 3
BLAD Carrier: 32, 26, and 58 bp segments produced
5gtgaccttccggagggccaagggctaccccatcggcctgtactacctgatggacctct 3
BLAD Affected: 58 bp segment produced
32 bp 26 bp
nucleotide change
58 bp
nucleotide change
58 bp
nucleotide change
58 bp
66
Credit Notes
Atherly, Alan G.; Girton, Jack R.; and McDonald, John F.
The Science of Genetics. Saunders College Publishing.
1999
Basics of Marker Assisted Selection (BMAS). Julius van
der Werf, Department of Animal Science, and Brian
Kinghorn, Twynam Chair of Animal Breeding Technolo-
gies, University of New England.
Campbell, Neil A. and Reece, Jane B. Biology. Seventh
edition. Pearson-Benjamin Cummings Publications.
San Francisco, California. 2005
Doggy DNA: The Power of PCR. 2000 Summer Biology
Institute: Biodiversity. The Woodrow Wilson Founda-
tion Leadership Program for Teachers.
www.woodrow.org/teachers/bi/2000/Doggy_DNA/
background_for_polymerase_chai.html
Figure 8
Kehrli, Marcus E., Jr. Bovine Leukoctye Adhesion
Deficiency (BLAD) in Holstein Cattle. Virus and Prion
Diseases of Livestock Research Unit, National Animal
Disease Center, USDA-ARS, Ames, Iowa.
Marker-Assisted Selection: Applications to Animal
Production. The Agbiotech Infosource. AG-WEST
BIOTECH INC. Issue 39. October 1998
Olson, Tim. Automated DNA Sequencing and Primer
Design. Department of Animal Sciences, University of
Florida.
Olson, Tim. New Genes: Good and Bad. Department
of Animal Sciences, University of Florida.
Polking, Gary F. The Polymerase Chain Reaction:
Introduction. Introduction to Molecular Biology
Techniques Gen 542A. Iowa State Universitys Office
of Biotechnology. Summer 2003
The BLAD mutation results in the loss of the TaqI restriction site. See Figure 7. A normal cow will
display two fragments, 26 and 32 bp. A carrier will display three fragments, 26, 32, and 58 bp. A BLAD
infected animal has only a single fragment of 58 bp. Based on a gel photo provided by Marcus E. Kehrli, Jr., DVM,
PhD, National Animal Disease Center, USDA-ARS.
Homozygous
Normal
Heterozygous
Carrier
Homozygous
BLAD
Base Pairs (bp)
26 bp
32 bp
26 bp
32 bp
58 bp 58 bp
Agarose Gel of BLAD
PCR Product Digested with Taq1
67
Suszkiw, Jan. Mapping the Way to Bovine Bounty. ARS
National Program Publication.
Terminology based on Campbell, Neil A. and Reece,
Jane B. Biology. Seventh edition. Pearson-Benjamin
Cummings Publications. San Francisco, California.
2005
Van Eenennaam, Alison. Marker-assisted selection
backgrounder. Agriculture and Natural Resources
Research and Extension Centers. University of
California-Davis. 2004
A Holstein dairy cow. Keith Weller, ARS-USDA
68
Marker Assisted
Selection
Part I
TEACHING RESOURCES
Laboratory Lesson Plan:
Student Exercise on Polymerase
Chain Reaction (PCR)
Science Education Standards
Science as Inquiry, Content Standard A
Abilities necessary to do scientific inquiry
(p. 175)
Understanding about scientific inquiry (p. 176)
Life Science, Content Standard C
The cell (p. 184)
Molecular basis of heredity (p. 185)
Matter, energy, and organization in living systems
(p. 186)
Science and Technology, Content Standard E
Understandings about science and technology
(p. 192)
Source: National Science Education Standards,
National Academy of
Sciences, 1996. Used with permission. Page numbers refer to the
seventh printing, November 1999 also available on the Internet at
http://books.nap.edu/html/nses/pdf/index.html.
Science Process Skills
Comparing and measuring
Observing
Ordering
Relating
Inferring
Life Skills
Learning to learn
Science processing
Problem solving
Decision making
Communicating
II
Time
Preparation: Ten minutes to photocopy student
handouts MAS-1 and MAS-2 on p. 73-84.
Activity: One 30-minute block of class time.
Materials
Educators should make enough copies of the student
handouts MAS-1, Learning More About Marker Assisted
Selection, and MAS-2, Student Exercise on Polymerase
Chain Reaction, so that each student has a copy.
Procedure
The background information contained in student
handout MAS-1, Learning More About Marker Assisted
Selection, should be presented before the class period in
which educators want to do the polymerase chain
reaction exercise. Overhead transparencies MAS a-m
on p. 91-115 may be helpful. Give students the student
handout MAS-2, See for Yourself: Student Exercise on
Polymerase Chain Reaction.
The answer key for the exercise appears on the next few
pages. Student answers are in bold print. Educators
also may wish to use the PowerPoint or animated
versions of the exercise that can be viewed or down-
loaded from www.biotech.iastate.edu/publications/
ed_resources/Laboratory_protocols.html. Scroll down
to the Polymerase Chain Reaction section. The Internet
versions have two additional parts that focus on the
mathematical aspects of PCR.
69
Student Exercise on Polymerase Chain Reaction (PCR)
Prepared by the Office of Biotechnology, Iowa State University
Part I
Original-1 3' T C G G C T A C A G C A G C A G A T G G T A C G T A 5'

Original-2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
1. The purpose of PCR is to make copies of the target DNA, such as the one
above. In our exercise, one strand of the double helix of DNA will be
designated Original-1. Write the nucleotide sequence of the complementary
strand in the blanks designated Original-2 above.
A G C C G A T G T C G T C G T C T A C C A T G C A T
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Target DNA
70
Part II
5' _ _ _ _ _
(Primer-1)
Original-2 5' A G C C G A T G T C G T C G T C T A C C A T G C A T 3'
3' _ _ _ _ _ 5'
(Primer-2)
2. A piece of DNA known as the primer is artificially made that has a
nucleotide sequence complementary to the bases adjacent to the target
DNA on the 3' end of Original-1. Write the nucleotide sequence of the
five bases of Primer-1 in the blanks above.
3. A primer is artificially made that has a nucleotide sequence
complementary to the bases adjacent to the target DNA on the 3' end of
Original-2. Write the nucleotide sequence of the five bases of Primer-2
in the blanks above.
Part III
Copy-1 5' C C G A T _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
(Primer-1)
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ A T G G T 5'
(Primer-2)
4. In cycle 1 and all subsequent cycles of the PCR reaction, a copy of each
of the two original strands will be made beginning at the 3' end of the
primer and continuing to the 5' end of the original strand. Write the
sequence of the copies that are made from the strands of Original-1 and
Original-2 in the blanks above.
C C G A T
A T G G T
G T C G T C G T C T A C C A T G C A T
T C G G C T A C A G C A G C A G
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
71
Part IV
Copy-1 5' C C G A T _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
(Primer-1)
Copy-1 5' C C G A T G T C G T C G T C T A C C A T G C A T 3'
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5'
(Primer)
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ A T G G T 5'
(Primer-2)
Copy-2 3' T C G G C T A C A G C A G C A G A T G G T 5'
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
(Primer)
5. During the second cycle of PCR, a copy is made of each of the strands of
Original-1, Copy-1, Original-2, and Copy-2 obtained in cycle 1. In the
blanks above, write the sequence of Copy-1 formed during the replication
of Original-1 in cycle 2. Does the sequence differ from that of Copy-1
made in the first cycle? No. Write the sequence of Copy-2 formed during
the replication of Original-2 in the second cycle. Does the sequence
differ from that of Copy-2 made in the first cycle? No.
6. To make a copy of the Copy-1 strand, a primer attaches to appropri-
ate sequences on the strand. Note that only one of the two primers will
be appropriate. Write the sequence of the primer and complete the
sequence of Copy-C1 in the blanks above.
7. To make a copy of the Copy-2 strand, a primer attaches to appropriate
sequences on the strand. Write the sequence of the primer and complete
the sequence of Copy-C2 in the blanks above.
8. How many strands of each of the following are present after the second
cycle?
Original-1 ___ Original-2 ___
Copy-1 ___ Copy-2 ___
Copy-C1 ___ Copy-C2 ___
T C G G C T A C A G C A G C A G
G G C T A C A G C A G C A G A T G G T
C C G A T G T C G T C G T C T A C C A
1
2
1
1
2
1
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
72
Part V
Copy-1 5' C C G A T _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'

(Primer-1)
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5'

(Primer)
Copy-1 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

(Primer)
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5'
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'

(Primer)
Original-2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

(Primer-2)
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

(Primer)
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
(Primer)
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5'

(Primer)
9. For the third cycle of PCR, each of the eight strands produced by Cycle
2 are replicated. Write the sequence of the primers and all the new
strands that are formed during copying. You may refer to part IV of the
exercise for assistance.
11. How many strands of each of the following types are present after the
third cycle?
Total number _____ Original-1 ___ Original-2 ___
Copy-1 ___ Copy-2 ___
16 1
3
4
1
3
4
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
C C G A T G T C G T C G T C T A C C A T G C A T 3'
G G C T A C A G C A G C A G A T G G T 5'
T C G G C T A C A G C A G C A G A T G G T 5'
C C G A T G T C G T C G T C T A C C A 3'
C C G A T G T C G T C G T C T A C C A 3'
73
Learning more about . . .
Student Handout
Marker Assisted Selection (MAS)
Lesson Module II Marker Assisted Selection
MAS-1
BACKGROUND INFORMATION
MAS Introduction
Deoxyribonucleic acid (DNA) is a molecule made up of
pairs of building blocks called nucleotides. The four
kinds of nucleotides that make up DNA are adenine
(abbreviated as the single letter A), guanine (G),
cytosine (C), and thymine (T). The DNA molecule has
the shape of two intertwined spirals, referred to as a
double helix.
DNA is packaged into chromosomes that are located
within the nucleus of all cells. These chromosomes are
the same in every cell of an organism and together
make up the organisms genetic information, its
genome. Chromosomes contain stretches of DNA
called genes that code for amino acids that make
proteins. It is the proteins that are the foundation of life
for all organisms. The interaction and structure of
proteins determine the visible characteristics or
phenotype of an organism, while the genetic makeup of
an organism is called its genotype.
The sequence of nucleotides that make up a gene can
differ among individuals. The different forms of a gene
are called alleles. The alleles are the result of nucle-
otide differences in a gene that affect an amino acid
sequence of a protein. This can result in a change,
addition, or deletion of a protein that can affect
the phenotype.
All organisms receive one copy of each gene from their
mother and one from their father. The DNA sequence
of a gene inherited from each parent may be identical,
in which case the individual is said to be homozygous
for that trait. Or the sequence of the gene from one of
the parents may be different, in which case the indi-
vidual is said to be heterozygous. Allele variations may
differ in their DNA sequence by as little as a
single nucleotide.
Differences among alleles caused by a single nucleotide,
called SNPs, can be the basis of genotyping tests.
Genotyping means using laboratory methods to
determine the sequence of nucleotides in the DNA from
an individual, usually a specific gene. Genetic tests
based on SNPs utilize DNA derived from an individual
to determine the nucleotide in the gene of interest.
Marker assisted selection is the process of using the
results of DNA testing in the selection of individuals
to become parents for the next generations. The
information from the DNA testing, combined with the
observed performance records for individuals, is
intended to improve the accuracy of selection and
increase the possibility of identifying organisms
carrying desirable and undesirable traits at an earlier
stage of development.
Complex traits, including many of economic impor-
tance, are controlled by many genes and are influenced
by the environment. When an animal has a favorable
performance record for a certain trait, it means that
based on pedigree and phenotype, the animal has
inherited a greater than average number of good alleles
of each gene affecting that specific trait.
It is important to combine DNA results with perfor-
mance and phenotype information to maximize the
effectiveness of selection for traits of interest. Combin-
ing information from performance records and genetic
tests into the selection process will be better than using
performance, phenotype, and markers separately. The
challenge is to determine what emphasis marker
information should be given in the selection decision.
Molecular Markers
Until recently, researchers relied on information about
how animals, plants, and their relatives perform to
make observations about the genes they possess. Today,
researchers can use molecular markers to find genes of
interest that control how plants and animals perform.
Some molecular markers are pieces of DNA that have
no known function or impact on animal and plant
performance. Other markers may involve the gene of
interest itself.
74
Student Handout
MAS-1
Linked Markers
One type of molecular marker is called a linked marker.
Using well-designed experiments, scientists can find
molecular markers that are located very close to major
genes of interest. The molecular marker is said to be
linked to that gene. Linked markers are only near the
gene of interest on the chromosome and are not part of
the DNA of the gene of interest.
Suppose that scientists are trying to locate a certain
gene in an animal species. Choosing animals randomly
from a population and studying them would give the
scientists no clues about whether a marker is associated
with the gene. However, if scientists studied the
progeny (offspring) of the mating of male and female
animals through many generations, they may determine
the presence of a useful molecular marker.
Direct Markers
A second kind of molecular marker is one that is part of
the gene of interest. Direct markers are easier to work
with after they are found, but they often are more
difficult to find than linked markers.
Marker-Assisted Selection
Three common technologies used as molecular
markers are: restriction fragment length polymor-
phisms, simple sequence repeats, and single
nucleotide polymorphisms.
Restriction Fragment Length Polymorphisms
(RFLPs)
Restriction fragment length polymorphisms (RFLPs)
were the first molecular markers used to diagnose
genetic variability in organisms. RFLP uses restriction
enzymes to digest (cut) the DNA molecule and identify
regions linked to a trait. The number of DNA frag-
ments generated by one restriction enzyme digest can
be in the millions, with many being several thousand
nucleotides long. This makes it difficult to determine
specific DNA fragments that are associated with the
trait of interest on an electrophoresis gel. To help
visualize specific DNA fragments, a technique called
Southern blotting was developed.
Southern blotting uses a porous membrane containing
specific radioactive DNA probes for one or more DNA
fragments. Probes are very short pieces of DNA used to
find specific sequences of A, C, T, and G in very long
pieces of DNA from a chromosome. The probe
hybridizes (attaches) to the membrane at a unique DNA
band on an electrophoresis gel. The membrane
containing the probe is developed on X-ray film and
analyzed. See Figure 1.
Simple Sequence Repeats or Microsatellites
Simple sequence repeats (SSRs), also called
microsatellites, are repeated units of two to six nucle-
otides that occur throughout an organisms genome.
The sequence ATATATAT is one example of a
microsatellite. The sequence GATGATGAT is another
example. SSRs are useful as molecular markers because
they are highly polymorphic (have many forms). SSRs
have been used successfully as markers in a wide range
of analysis, particularly those involving disease diagno-
sis and forensics.
Single Nucleotide Polymorphisms (SNPs)
On average, SNPs will occur in an organisms DNA
more than 1% of the time. Because only about 3% to
5% of an organisms DNA codes for proteins, most SNPs
are found outside the regions of genes of interest. SNPs
found in a gene of interest are of particular interest to
an agarose gel.
nylon membrane.
DNA band pattern.
DNA FINGERPRINT.
Figure 1
75
Student Handout Lesson Module II Marker Assisted Selection
MAS-1
researchers because they are directly associated with a
desired trait. Because of the recent advances in technol-
ogy, SNPs are playing a greater role in selection and
diagnosis of genetic traits.
Advantage of Molecular Markers
The advantage of molecular markers for researchers
is that they can test for a particular trait as early as the
embryo stage in animals or in the seeds of plants before
they are planted. There is no longer a need for the
organism to develop to a stage at which the trait
can be observed, a wait that in some cases can take
many years.
The Role of PCR in MAS
Once a direct or linked marker has been located,
characterized, and sequenced, a method called poly-
merase chain reaction (PCR) can be used to make
copies of a specific region of DNA to produce enough
DNA to conduct a test. Figure 2 on the next two pages
summarizes the PCR process. Since its conception in
1983 by Kary Mullis, it has become one of the most
widely used techniques in molecular biology. It is a
rapid and simple means of producing a relatively large
amount of DNA from a very small amount of DNA.
DNA replication in natural systems requires:
a source of the nucleotides adenine (A), cytosine (C),
thymine (T), and guanine (G);
the DNA polymerase (DNA synthesis enzyme);
a short RNA molecule (primer);
a DNA strand to be copied;
and proper reaction conditions (pH, temperature).
The DNA is unwound enzymatically, the RNA molecule
is synthesized,the DNA polymerase attaches to the
RNA, and a complementary DNA strand is synthesized.
Use of PCR in the laboratory involves the same compo-
nents and mechanisms of the natural system, but there
are three primary differences:
(1) DNA primers are used instead of the RNA primer
found in the natural system. DNA primers are
usually 18-25 nucleotide bases long and are
designed so that they attach to both sides of the
region of DNA to be copied.
(2) Magnesium ions that play a role in DNA replication
are added to the reaction mixture.
(3) A DNA polymerase enzyme that can withstand
high temperatures, such as Taq, is used.
(4) A reaction buffer is used to establish the correct
conditions for the DNA polymerase to work.
The DNA primers are complementary (match up) to
opposite strands of the DNA to be copied, so that both
strands can be synthesized at the same time. A and
T match, and C and G match. Because the reaction
mixture contains primers complementary to both
strands of DNA, the products of the DNA synthesis can
themselves be copied with the opposite primer.
The length of the DNA to be copied is determined by
the position of the two primers relative to the targeted
DNA region. The DNA copies are a defined length and
at a specific location on the original DNA. Because
DNA replication starts from the primers, the new
strands of DNA include the sequence of the primers.
This provides a sequence on the new strands to which
the primers can attach to make additional DNA copies.
Over the years, the PCR procedure has been simplified
and the results made uniform as a result of two impor-
tant developments. The first was the isolation of a heat-
stable DNA polymerase, Taq polymerase. This enzyme
gets its name from the bacteria from which it was
isolated, Thermus aquaticus. This bacteria was discov-
ered living in the boiling water of hot springs. Until Taq
polymerase was discovered, the DNA polymerases
available to researchers were destroyed at 65C. The
Taq enzyme is not destroyed by the high temperature
required to denature the DNA template (pattern).
Therefore, using this enzyme eliminates the need to add
new enzyme to the tube for each new cycle of copying,
commonly done before Taqs discovery.
The PCR procedure involves three steps that make up a
cycle of copying. Each step allows the temperature of
the mixture to change to optimize the reaction. The
cycles are repeated as many times as necessary to obtain
the desired amount of DNA.
STEP 1 DENATURATION
The double-stranded DNA that is to be copied is heated
to ~95C so that the hydrogen bonds between the
complementary bases are broken. This creates two,
single stranded pieces of DNA.
STEP 2 ANNEALING or HYBRIDIZATION
The temperature is lowered to ~58C so the DNA
primers can bind to the complementary sequence on
the single-stranded DNA by forming hydrogen bonds
between the bases of the template and the primers.
76
Student Handout
Figure 2
The Polymerase Chain Reaction Process
MAS-1
1. Denaturation
95 C.
2. Annealing
DNA.
3. DNA Synthesis
DNA strand.
95 C.
58 C.
72 C.
Cycle One
Primers
(4 bp)
Target DNA
Taq
Taq
(continued on next page)
77
MAS-1
4. Denaturation
the target DNA.
5. Annealing
6. DNA Synthesis
95 C.
58 C.
Cycle Two
72 C.
Target DNA
Taq
Taq
Taq
Taq
Original DNA
Copied DNA
Copied DNA
Original DNA
78
Student Handout
MAS-1
Figure 3
STEP 3 DNA SYNTHESIS or EXTENSION
During the replication step, the reaction solution is
heated to ~72C so the DNA polymerase incorporates
the nucleotide bases A, C, T, and G into the new copy
of DNA. The new DNA strand is formed by connecting
bases that are complementary to the template until it
comes to the end of the region to be copied.
To view simulations of the PCR process, go to
www.biotech.iastate.edu/publications/ed_resources/
Laboratory_protocols.html and find the PCR activity
and simulation links. To view an animation of the PCR
process, visit www.dnalc.org/resources/Biology
AnimationLibrary.htm and view or download the
polymerase chain reaction.
DNA Sequencing
A technology used to detect molecular markers of DNA
is called DNA sequencing. DNA sequencing is the
process of determining the exact order of the bases A, T,
C, and G in a piece of DNA. The DNA to be sequenced
is used to generate a set of fragments that differ in
length from each other by one base pair. The fragments
are separated by size using electrophoresis. By reading
the gel from the bottom up, the sequence of DNA can
be determined.
The most commonly used method of sequencing DNA
was developed by Frederick Sanger in 1977. He
modified the chemical structure of the normal nucle-
otides used in PCR by replacing a hydroxyl group (OH)
with a hydrogen (H) on the 3 carbon. The modified
molecule is referred to as a dideoxynucleotide (ddNTP).
This chemical change in the nucleotide causes the
replication of the DNA strand to terminate during the
PCR process. Four PCR reactions, each containing a
different ddNTP along with the normal dNTPs, are
conducted. This generates many different sizes of
fragments in the reaction solution, each ending with a
specific nucleotide.
The four reaction solutions are loaded into side-by-side
wells and electrophoresed in one of several gel matrixes.
The distance the fragment migrates is inversely propor-
tional to its size. The smallest fragment travels farther
and faster through the gel matrix than the larger
fragments, thus creating a ladder or pattern of bands
that can be read from the bottom to the top of the gel.
In the gel pictured in Figure 3, the size of the fragment
increases by one base pair relative to its position on the
gel. The DNA sequence for the gel is read as
CATTCGAATGCA.
To view a sequencing simulation, go to www.dnalc.org/
shockwave/cycseq.html or www.pbs.org/wgbh/nova/
genome/sequencer.html.
Credit Notes
1999.
Basics of Marker Assisted Selection
(BMAS). Julius van der Werf,
Department of Animal Science, and
Brian Kinghorn, Twynam Chair of
Animal Breeding Technologies,
University of New England.
Campbell, Neil A. and Reece, Jane B.
Biology. Seventh edition. Pearson-
Benjamin Cummings Publications.
Doggy DNA: The Power of PCR.
2000 Summer Biology Institute:
Biodiversity. The Woodrow Wilson
Foundation Leadership Program for
Teachers. www.woodrow.org/
teachers/bi/2000/Doggy_DNA/
background_for_ polymerase_
chai.html
ddC ddT ddA ddG
CATTCGAATGCA
CATTCGAATGC
CATTCGAATG
CATTCGAAT
CATTCGAA
CATTCGA
CATTCG
CATTC
CATT
CAT
CA
C
79
MAS-1
Learn the Language
Alleles
Different forms of the same gene
Deoxyribonucleic acid (DNA)
A molecule made up of four bases; adenine (A),
cytosine (C), thymine (T), and guanine (G); that
carries the genetic information in the nucleus of
all cells
Direct marker
A sequence of DNA located within a gene
of interest
DNA sequencing
The process of determining the exact order of the
bases adenine (A), cytosine (C), thymine (T), and
guanine (G) in a piece of DNA
Design. Department of Animal Sciences, University
of Florida.
2005
Genome
The complete genetic code of an organism
Genotype
The genetic makeup of an individual, typically
expressed in alphabetical letters
Heterozygous
Having two different alleles of a gene (Rr)
Homozygous
Having two identical alleles of a gene (RR or rr)
Linked marker
A sequence of DNA located near, but outside of, a
gene of interest
Marker assisted selection
Use of molecular markers to select
desirable individuals
Molecular marker
A piece of DNA linked to or part of a gene
of interest
Phenotype
Description of an observable trait
Polymerase chain reaction (PCR)
A method used to make enough copies of a specific
region of DNA
Polymorphism
Having many forms
Restriction enzyme
A class of enzyme that was originally discovered in
bacteria and is extensively used in genetic engineer-
ing to recognize a specific target nucleotide
sequence in DNA and break the DNA chain at
the target
and justice for all
The U.S. Department of Agriculture (USDA) prohibits discrimination in all its
programs and activities on the basis of race, color, national origin, gender, religion,
age, disability, political beliefs, sexual orientation, and marital or family status. (Not
all prohibited bases apply to all programs.) Many materials can be made available
in alternative formats for ADA clients. To file a complaint of discrimination, write
USDA, Office of Civil Rights, Room 326-W, Whitten Building, 14th and Independence
Avenue, SW, Washington, DC 20250-9410 or call 202-720-5964.
Issued in furtherance of Cooperative Extension work, Acts of May 8 and June 30,
1914 in cooperation with the U.S. Department of Agriculture. Stanley R. Johnson,
director, Cooperative Extension Service, Iowa State University of Science and
Technology, Ames, Iowa.
81
See for yourself . . .
Student Handout
Polymerase Chain Reaction (PCR)
MAS-2
and justice for all
The U.S. Department of Agriculture (USDA) prohibits discrimination in all its programs and activities on the basis of race, color, national origin, gender, religion, age, disability,
political beliefs, sexual orientation, and marital or family status. (Not all prohibited bases apply to all programs.) Many materials can be made available in alternative formats for
ADA clients. To file a complaint of discrimination, write USDA, Office of Civil Rights, Room 326-W, Whitten Building, 14th and Independence Avenue, SW, Washington, DC 20250-
9410 or call 202-720-5964.
Issued in furtherance of Cooperative Extension work, Acts of May 8 and June 30, 1914 in cooperation with the U.S. Department of Agriculture. Stanley R. Johnson, director,
Cooperative Extension Service, Iowa State University of Science and Technology, Ames, Iowa.
Student Exercise on Polymerase Chain Reaction (PCR)
Prepared by the Office of Biotechnology, Iowa State University
Part I

Original-2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Target DNA
82
MAS-2
Part II
5' _ _ _ _ _
(Primer-1)
3' _ _ _ _ _ 5'
(Primer-2)
Part III
Copy-1 5' C C G A T _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
(Primer-1)
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ A T G G T 5'
(Primer-2)
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
83
MAS-2
Part IV
Copy-1 5' C C G A T _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
(Primer-1)
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5'
(Primer)
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ A T G G T 5'
(Primer-2)
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
(Primer)
made in the first cycle?_____ Write the sequence of Copy-2 formed during
differ from that of Copy-2 made in the first cycle?_____
cycle?
Copy-1 ___ Copy-2 ___
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
84
MAS-2
Part V
Copy-1 5' C C G A T _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'

(Primer-1)
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5'

(Primer)
Copy-1 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

(Primer)
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5'
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'

(Primer)
Original-2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

(Primer-2)
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

(Primer)
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
(Primer)
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5'

(Primer)
third cycle?
Copy-1 ___ Copy-2 ___
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
A T G G T
85
Learning more about . . .
MAS-3
Sire Osborndale Ivanhoe:
The Story of Bovine Leukocyte Adhesion
Deficiency (BLAD)
By the year 1988, a genetic disease specific to Holstein
cattle was claiming an ever-increasing number of
animals. Because Holsteins are a major breed in milk
production throughout the world, the disease was
causing serious economic loss to the milk industry. The
disease, called bovine leukocyte adhesion deficiency or
BLAD, is characterized in young calves by their inability
to fight off common bacterial infections like pneumo-
nia. Death usually occurs at an early age.
BLAD is caused by a hereditary genetic mutation that
disrupts the function of a protein on white blood cells
called leukocytes. Leukocytes are part of the immune
system and help cattle fight disease. When a cow is
exposed to an infectious agent called an antigen, leuko-
cytes are attracted to the site of the infection by mole-
cules that appear on the walls of blood vessels closest to
the infected area. When the leukocytes reach the
infected area, they attach to the vessel walls, go through
the walls into the infected tissue, and destroy the
antigen. The mutation associated with BLAD changes
the leukocyte so it cannot attach to the vessel wall and
reach infected tissue.
BLAD is an autosomal (non-sex chromosome) recessive
disease. To suffer from the disease, calves must have
two defective alleles for the trait, one donated by
each parent.
Through an investigation of pedigrees of affected calves,
a common sire was determined. Osborndale Ivanhoe, a
Holstein bull, is now known to have had the largest
impact of any bull on the Holstein breed. It is estimated
that he sired over 79,000 daughters and over 1,200 sons
that produced additional female cows. By the time
BLAD was understood and a molecular test developed
in 1991, some estimates are that 28% of the Holstein
population tested positive as BLAD carriers, and an
estimated 16,000-20,000 calves were born with BLAD
each year in the United States.
BLAD and Sire Osborndale Ivanhoe
How could one bull be responsible for a genetic disease
that spread through a large segment of the Holstein
breed? The answer lies in the way the dairy industry
breeds its cows for milk production. Bulls are selected
for breeding by evaluating the milk production of their
female offspring. When a bull has female offspring with
superior milk production, its sperm are collected for
use in artificial insemination (AI). The benefit of AI is
that one bull of superior genetics can improve the
performance of herds on many farms. One of the risks
of AI is that if a sire is a heterozygous carrier of an
undesirable recessive allele, that allele can be spread
undetected to many progeny.
Because bulls and cows with heterozygous alleles for
the trait are healthy, a recessive allele can spread
undetected for many generations. BLAD can only
manifest itself when heterozygous male and female
descendants of Ivanhoe are bred and two recessive
alleles, one from each parent, combine to produce
calves with a homozygous recessive condition. See the
BLAD pedigree, Figure 1, on the next page.
When a heterozygous bull is crossed with a heterozy-
gous cow, there is a 25% chance the calf will be inflicted
with BLAD, and a 50% chance the calves will be
carriers. See Figure 2. Breeders needed a reliable test to
identify cattle that were heterozygous carriers. The test
that was developed was marker assisted selection.
A Holstein dairy cow. Keith Weller, ARS-USDA
86
Student Handout
B b
B B B b B
b b B b b
Figure 2
Figure 1
BLAD Pedigree
II
I
III
IV
V
inbreeding
Osborndale Ivanhoe
Scientists found that the deleterious recessive allele for
BLAD had two mutations in the CD18 gene. One of the
mutations did not affect the amino acid sequence, but
the second mutation caused an incorrect amino acid
to be produced. In that second mutation, the
nucleotide guanine (G) replaced adenine (A) so the
amino acid glycine is produced instead of aspartic
acid. See Figure 3. Figure 4 on p. 88 illustrates the
DNA strands from each allele containing the site of
the BLAD mutation during the PCR process. When
these PCR products are treated with the restriction
(cutting) enzyme TaqI, the enzyme recognizes the
TCGA sequence and cuts between the T and C nucle-
otides. Each strand will generate DNA fragments
consistent with the presence or absence of the restric-
tion site TCGA on the strand. A normal DNA sequence
will contain a TaqI restriction site and generate two
fragments, one of 26 base pairs (bp) and the other 32
bp. In the case of the BLAD mutation, the restriction
site for TaqI is lost. Since there is no restriction site for
TaqI on the mutation, a single fragment of 58 bp (the
size of the PCR product) remains. The presence of the
26, 32 and 58 bp fragments indicate the carrier. See
Figure 5 on p. 89.
The protein with the amino acid change prevents
leukocytes from reaching and destroying the invading
antigen by interfering with their ability to adhere to the
blood vessel walls at the area of infection. This is why
calves with BLAD cannot fight infections and die early
in life.
Using molecular marker technology, it has been
possible to identify the heterozygous carriers of BLAD
and remove those individuals from the breeding stock.
As a result, the disease has been virtually eliminated
from the Holstein cattle breed.
The defective allele causing BLAD has not been found
in breeds other than Holsteins. However, a similar form
of the genetic disorder has been described in humans.
MAS-3
Cattle that have the Bb alleles are carriers of BLAD.
Affected cattle have two copies of the b allele.
87
MAS-3
Figure 3
When the nucleotide adenine (a) is replaced by guanine (g) in the DNA strand, the amino acid glycine (gly) is
produced instead of the correct amino acid aspartic acid (asp). The result is the BLAD condition in cattle.
88
Student Handout
MAS-3
Figure 4
Figure 4 shows the DNA fragments produced by normal cattle, heterozygous BLAD carriers, and
the strand.
32 bp 26 bp
32 bp 26 bp
nucleotide change
58 bp
nucleotide change
58 bp
nucleotide change
58 bp
89
MAS-3
Figure 5
The BLAD mutation results in the loss of the TaqI restriction site. See Figure 4. A normal cow will
display two fragments, 26 and 32 bp. A carrier will display three fragments, 26, 32, and 58 bp. A BLAD
infected animal has only a single fragment of 58 bp. Based on a gel photo provided by Marcus E. Kehrli, Jr., DVM,
PhD, National Animal Disease Center, USDA-ARS.
Homozygous
Normal
Heterozygous
Carrier
Homozygous
BLAD
Base Pairs (bp)
26 bp
32 bp
26 bp
32 bp
58 bp 58 bp
Agarose Gel of BLAD
90
Student Handout
MAS-3
Credit Notes
1999
Basics of Marker Assisted Selection (BMAS). Julius van
der Werf, Department of Animal Science, and Brian
Kinghorn, Twynam Chair of Animal Breeding Technolo-
gies, University of New England.
Campbell, Neil A. and Reece, Jane B. Biology. Seventh
edition. Pearson-Benjamin Cummings Publications.
Doggy DNA: The Power of PCR. 2000 Summer Biology
Institute: Biodiversity. The Woodrow Wilson Founda-
tion Leadership Program for Teachers.
www.woodrow.org/teachers/bi/2000/Doggy_DNA/
background_for_polymerase_chai.html
Design. Department of Animal Sciences, University
of Florida.
2005
Learn the Language
Antigen
An infectious agent, such as a virus
Autosomal chromosome
All chromosomes, except the sex chromosomes. A
diploid cell has two copies of each chromosome.
Leukocytes
White blood cells
Recessive
An allele (r) that expresses itself in a phenotype
only in homozygous individuals (rr)
and justice for all
The U.S. Department of Agriculture (USDA) prohibits discrimination in all its
programs and activities on the basis of race, color, national origin, gender, religion,
age, disability, political beliefs, sexual orientation, and marital or family status. (Not
all prohibited bases apply to all programs.) Many materials can be made available
in alternative formats for ADA clients. To file a complaint of discrimination, write
USDA, Office of Civil Rights, Room 326-W, Whitten Building, 14th and Independence
Avenue, SW, Washington, DC 20250-9410 or call 202-720-5964.
Issued in furtherance of Cooperative Extension work, Acts of May 8 and June 30,
1914 in cooperation with the U.S. Department of Agriculture. Stanley R. Johnson,
director, Cooperative Extension Service, Iowa State University of Science and
Technology, Ames, Iowa.
91
DNA Fingerprinting
an agarose gel.
nylon membrane.
DNA band pattern.
DNA FINGERPRINT.
Overhead Master: MAS-a
93
Lesson Module II Marker Assisted Selection Overhead Master: MAS-b
Polymerase Chain Reaction Process
1. Denaturation
95 C.
2. Annealing
DNA.
3. DNA Synthesis
DNA strand.
95 C.
58 C.
72 C.
Cycle One
Primers
(4 bp)
Target DNA
Taq
Taq
95
Polymerase Chain Reaction Process
4. Denaturation
the target DNA.
5. Annealing
6. DNA Synthesis
95 C.
58 C.
Cycle Two
72 C.
Target DNA
Taq
Taq
Taq
Taq
Original DNA
Copied DNA
Copied DNA
Original DNA
Overhead Master: MAS-c
97
Lesson Module II Marker Assisted Selection Overhead Master: MAS-d
In the gel pictured, the size of the
fragment increases by one base pair
relative to its position on the gel. The
DNA sequence for the gel is read as
CATTCGAATGCA.
DNA Sequencing
ddC ddT ddA ddG
CATTCGAATGCA
CATTCGAATGC
CATTCGAATG
CATTCGAAT
CATTCGAA
CATTCGA
CATTCG
CATTC
CATT
CAT
CA
C
99
Lesson Module II Marker Assisted Selection Overhead Master: MAS-e
BLAD Pedigree
II
I
III
IV
V
inbreeding
Osborndale Ivanhoe
Bovine leukocyte adhesion deficiency
(BLAD) can only manifest itself when
heterozygous male and female
descendants of Ivanhoe are bred and
two recessive alleles, one from each
parent, combine to produce calves
with a homozygous recessive
condition.
BLAD Pedigree
101
Lesson Module II Marker Assisted Selection Overhead Master: MAS-f
BLAD Punnett Square
B b
B B B b B
b b B b b
Cattle that have the Bb alleles are
carriers of BLAD. Affected cattle have
two copies of the b allele.
103
Lesson Module II Marker Assisted Selection Overhead Master: MAS-g
Protein Synthesis and BLAD
When the nucleotide adenine (a) is replaced
by guanine (g) in the DNA strand, the amino
acid glycine (gly) is produced instead of the
correct amino acid aspartic acid (asp).
The result is the BLAD condition in cattle.
105
Lesson Module II Marker Assisted Selection Overhead Master: MAS-h
This figure shows the DNA fragments produced by normal cattle, heterozygous BLAD carriers, and
the strand.
32 bp 26 bp
32 bp 26 bp
nucleotide change
58 bp
nucleotide change
58 bp
nucleotide change
58 bp
107
Lesson Module II Marker Assisted Selection Overhead Master: MAS-i
Diagnosing BLAD Using PCR
The BLAD mutation results in the loss of
the TaqI restriction site. A normal cow
will display two fragments, 26 and 32
bp. A carrier will display three frag-
ments, 26, 32, and 58 bp. A BLAD in-
fected animal has only a single fragment
of 58 bp. Based on a gel photo provided by Marcus E. Kehrli, Jr., DVM, PhD,
National Animal Disease Center, USDA-ARS.
Homozygous
Normal
Heterozygous
Carrier
Homozygous
BLAD
Base Pairs (bp)
26 bp
32 bp
26 bp
32 bp
58 bp 58 bp
Agarose Gel of BLAD
109
Lesson Module II Marker Assisted Selection Overhead Master: MAS-j
Student Exercise on
Polymerase Chain Reaction
(PCR)
Part I
Original-2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Target DNA
Prepared by the Office of Biotechnology
Iowa State University
111
Lesson Module II Marker Assisted Selection Overhead Master: MAS-k
PCR Student Exercise Continued
Part II
5' _ _ _ _ _
(Primer-1)
3' _ _ _ _ _ 5'
(Primer-2)
Part III
Copy-1 5' C C G A T _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
(Primer-1)
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ A T G G T 5'
(Primer-2)
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
113
Lesson Module II Marker Assisted Selection Overhead Master: MAS-l
Copy-1 5' C C G A T _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
(Primer-1)
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5'
(Primer)
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ A T G G T 5'
(Primer-2)
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
(Primer)
made in the first cycle?_____ Write the sequence of Copy-2 formed during
differ from that of Copy-2 made in the first cycle?_____
cycle?
Copy-1 ___ Copy-2 ___
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Part IV - PCR Student Exercise Continued
115
Lesson Module II Marker Assisted Selection Overhead Master: MAS-m
Part V PCR Student Exercise Continued
Copy-1 5' C C G A T _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'

(Primer-1)
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5'

(Primer)
Copy-1 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

(Primer)
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5'
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'

(Primer)
Original-2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

(Primer-2)
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

(Primer)
Copy-2 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
(Primer)
Copy-C2 5' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3'
Copy-C1 3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5'

(Primer)
third cycle?
Copy-1 ___ Copy-2 ___
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
A T G G T

Bio Chapter # Marker Assisted Selection (MAS) PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Bio Chapter # Marker Assisted Selection (MAS) PDF

Uploaded by

Copyright:

Available Formats

57

Iowa State University Extension and ISU Office of Biotechnology

Original-1 3' T C G G C T A C A G C A G C A G A T G G T A C G T A 5'

Original-1 3' T C G G C T A C A G C A G C A G A T G G T A C G T A 5'

You might also like