052:108 Fall 2013 Exam 1 Name:_Summers / Keg : Midterm Exam il, Closed Book and Notes (50 total points) This portion ofthe exam is closed note, closed book. Any communication devices you may have rust be stowed so they cannot be seen, Additional paper is available from the instuetor. Onee you have finished this portion of the exam, you must tum it in to the instructor before receiving the second part ofthe exam, You beve 2 hours to complete the entre exam (both pats). The possible points for each problem are shown to the lft ofthe problem, (48) 1) List 4 examples of present day biotechnology products Etuanol , eitere acid, chase, gogart, amine acids, Vitauins, antibiotics, geuicdlli Hees, ete 1 Hlavors, Fragrances, baker's 484, Cu rymes, (5 pls) 2). Define facultative anaerobe, halophile, thermophile, acidophile, barophile, Facultative anaerobe- can grow with ov Halophile- weds hiph Solt concen tratisrr fete Lives ad high emperature Aridephile- Lives at low Ce) Barophile- Lives at Aigh pressure Trout oygen G pls) 3) What ate the six major elements comprising cells? Cy ly0, Ay SP052:108 Fall 2013 Exam 1 Name: uMneys / Key : (4 pls) 4) List the 4 major classes of compounds (excluding water) comprising cells; identify the polymer, monomer, and representative intracellular roles. Prokeins— qunine acids steuchure, cabelysrs Muclere actls~ nycleotites- inbnuton storage , prowtsiag Cadoohydrndtes ~ Sogers — eutdy yy Structure Fabs (tipile Fatly kids - membres, energy Shroge (1p) 5) Define the sete point (for amino acids and protins. The pL is the pl at whictr a amine ace Cor prokin) bes no nek Charge Gis) 6) List3 diferences between prokaryotes and cukarytes. Ealaryles ave (atger Mn prolaryles, gently (lo llpem 25: Mote pm? Rokwyoks tse Sisley eivaaee turg im The epee ele Cukergel tate DMA ovpaaistd late clvsmssones i Poe meaclees tu Heryaks have many oigaacllec, prokaryots howt fous te peal. Pekocyoles are untedllule, Lukergtes con be multicellaler, Drolecyoles vile by binary Lrssivn, Cdkoryotes by miPeSiS (1p) 7) Where would you expect to find « protein with a large amount of hydrophobic amino aids on isenenr sue Ty yuebrane” Alt ydrold: Psidues on Pe eilenbr Surface would wat te beim a Mydvophdbit. duuirannia A ithe a mtenbrare) fate Han be expel fo the eyfosel, (1p) 8) Whats tbe unique propery that esse can conti opin? Cysteine Con tim isolate bord Cor diatfide br'dgg) tyrouph fhe S on their R- qr052:108 Fall 2013 Exam 1 Name: Stuns [Key (6 pis) 9) Mlustrate the “Central Dogma” of Biology (show the sequence of processes) List the major enzyme that cartes out each process. Replicction — DAA Clamuense Tianstviption- LWA olymarmse y Traslaton- Libosane! (4pis) 10) Briefly diseuss the fnetion ofthe following organelles: rough endoplasmic reticulum (ER), Golgi apparatus, nucleus, chloroplast Pogln EL - Syuttass of steuhl proteins, protein groussig Glas apparels modi Lication , Sol tin ing oF praktins: as agjarals~ meat hc 4) and packaging oF p fhe sereton trom ea ov draattc J ofhar orgenolls. NUS — Cuehias WA, Sepwates iF from the vest af Tha OU. Chlarplist- Gerserk tnavgy rn igh # (2p 11) Define constitutive and regulated genes. Coustifaioe psd an aaays egpleged ~ abanys frase "00" Resulted gees Coa pe tod "on" ee "SEP" fuged bn edule nueds, ewuroamtel conditions , ofc.052:108 Fall 2013 Exam 1 Name: Suimnfers /Key a (pls) 12) Listhe tne types oF RNA and describe their respective oe. mRNA energy aunes br he trenslekd VENA wakes op lage pot ob ibesores, trans MMH ab ® prokin. + DWMA- caries amino acids fo fre Chom A prokin Syttag (Gps) 13) Deseibe the ole of promotes, ribosomal binding sites, and transcription terminators Cromohees~ Site on wh That the OMA polamengg recaqni2ts and binds +9 do stort transcript Cbs - oil of mewA that tae eibusome recnqnizes and binds fo to Stovk translation trenseiption Heainetoy — region of DA That fells the RUA polymerase to shy traascriphin (pO 14) What are the 3 classes of enzymes that ar sed industry? Oxidoveductses bay dralases TSomerases052:108 Fall 2013 Exam 1 Name: Summers / Keg (7 ps)15) You have discovered a novel 10-amino acid therapeutic polypeptide and want to produce @ large amount. The polypeptide is naturally produced at very lor levels in a jellyfish, but there {sa demand for metric tons. You inset the gene forthe polypeptide into a plasmid and expressit in E coll, ‘The DNA sequence below is from the template strand (serves as template for mRNA synthesis), and contains top and start codons for the gene. Assure that all genetic regulatory elements are present and flank the sequence given below. 5" AACAGCTTATTACTTTAATGAACACCTAACACCGTGTGCCATCCTGCAATC:3" 4) Give the DNA sequence ofthe coding stand of DNA (fiom 5! to 3') and identify the start and stop codons. ‘the corresponding mRNA strand (from to 3") that is transcribed from this mRNA. ive the corresponding polypeptide that would be transcribed from this mRNA, » 9 2) StqnrrecncannalycalcactoenfeTractrar|rcaltralnaa|rtnpra aerart-3! Start 8) 5 enact Aue ee | wal car ee [ue a ©) Mok= Ala HS" Gly- Val= Aga 6yS- Ser Lean Lys Chau!052:108 Fall 2013 Exam 1 Name:_ Summers / Key ‘Midterm Exam #1, Onen Book and Notes (60 total points ‘This portion ofthe exam is open note, open book. IF your calculations require more than one ‘page, you may continue them on the reverse side of the page. Additional paper is available rom the insttuctor. Once you have finished this portion of the exam, turn it in to the instrctor. You have 2 hours to complete the entre exam (both pasts). The possible points for each problem are shown tothe left of the problem, credit is available, so SHOW ALL WORK, (Spis) 16) You insert a7 kb plasmid containing a 1.3 kb gene into.an £. col cell for expression of recombinant protein, How long would it take fora single DNA polymerase molecule to make S copies ofthe plasmid (assume that the time it takes to stop copying one plasmid and start copying another is negligible). How long would it tke for RNA polymerase to transeribe a single copy ofthe gene? Fer | plasmid) Tb = ecole J Yee at = 800 b/s For Splacmidg ? BIH, (Splosmals) = [3-75 5 8.15 AUB He gue = (bE a og eo. 4 3 min so tels052:108 Fall 2013 Exam 1 Name: Summers / Ker _ (10 ts) 17) The estiction enayme EcoRI cus the DNA sequence GAATTC with a maximum digestion rate of 6.5 x 10* ug DNAVuL-tun- pg enzyme) a 0° 4) With only the above information, sketch how a graph ofthe reaction rate as a function of | {temperature might appear 1) What will be the digestion rate at 37°C (the recommended incubation temperature Foran EcoRI digestion reaction) if you add 30 ug FeoRI to a $0 pL. tube containing 50 yg DNA? ‘Assume thatthe activation enerey and Arrhenius constant (A) fort reaction are 42.4 Kif(mol) and 4680.4 yg DNAM(min-yg enzyme), respectively, and tha the DNA contains atleast one EcoRI site b) Pe BTC HIB SOK ex O3* Fe 74 ae 4, = 4L, 400 Y/nely rs Uso 18 DAM, Ve CEI athe aa py ent Blar <> Vs (Re y 42,440 “Vcr Ve oes (ust ae Zpea) *P FW Gon) |v nowt sm mine052:108 Fall 2013 Exam 1 ‘Name: : Summers / Keg (20pts) 18) A pesticide inhibits the activity ofa particular enzyme, A, which can therefore be used (0 assay forthe presence ofthe pesticide in an unknown sample. 8) Inthe laboratory, the intial rate data shown inthe Table given below were obtained. The pesticide concentration in te inhibited reactions was 10 jtmol/.. Is the pesticide a competitive, uncompetitive, or noncompetitive inhibitor? Calculate Yas, Ky, and Ki 1) You mix $0 mL enzyme solution with $0 ml. solution containing 8 x 10" moVL substrate ‘and 25 mL sample with unknown pesticide concentration. ‘The initia reaction rate observed ia 44 ymolanin-L), What i the pesticide conccntation in the aample assuming to other inhibitors or substrates in the sample? os “a a | Gal TaD 3 u Ve | Sycaonty | ora wan ar F ea tater yopoh——«08L 9014) SOx 10° | 144 80. 2.0000 0. 0064 © otS 67x10" [158 a8 v4025 9.0063 got tote p76 (0000.00: olen aoxto" [io [08 Sooo cee Ott | soto" [a0 [07 ee | 00048 — 'y, 0086 4) See odttached Linwenser- Guile plo which clearly Shows that his 16 pon-coapetitiog Dhibitir~ (pay Aaa 9 She, #5hyec) | aes Nao .- ne MN Gadeveagh ~ vas is > [ME Coe Kun * Sle Cane) 4 Sipe’ * (wae (%) = oldt min oe - 1800oa Hook 0-015 — 15% Fok Feomem (8 S00 (4 Seo no wbibitor60 m! Bb) Céd> [eA Cadc) = o4 [A], ot Me 2 04 (a Bn) = 888 aa * pecause une? Fl) © Ky? 2 co kp 2 105 A (y+ bo pl ( 4): 30 ey = 44 aoelfion L Nae > [A kp Sate Vinee ' ay oo) Bs “et B86 Ae ype ue Ne sal poi Le hing Tur engined somplt, [PJ =052:108 Fall 2013 Exam 1 Name:_Sumamas_/ Key (05 p's) 19) An enzyme is immabilzed onthe sutice of non-porous beads of -mm diameter. The Substrate concentration inthe bale (8) 8 100 mM, = 0: | ML/ad) Additonal da: Kx 10cm Vg I mol(en?}; Ks = 20m, > 0.08 mag 8) What is the Damkholer number? 'b) Which is limiting the reaetion- diffusion or reation rate? ©). Determine the substrate concentration at the bead surface (S). 4d) Determine the reaction rate in mmol(cm). ©) What isthe effectiveness factor? ! a) he Viney ties vmey | whe | E H led woes (domi) = [Leo — a 6) Because D>, Bert aiLasion aud reachon ek axne. [twiting ©) v= u(G- (53) » vine Ck : a [S5)_ Ve joe (a ae! -[5)) = es ote + Ls. ‘ (l 465))( ar &ss) = i) > oat tsg)-orts) “else [1 ge oa AF soa Hos) ~ [sho 88 = | 2¢{0) i. re 3) yer ¥ (- -(5)) = : tool \ es - - 9.856 2) a “ — ye doemived “es Foufae qrphical lotion H pats 6 and d, fu siflion Ve (Gi3-C53). Whim Gj) ~ £5], Veo at Cee oles Wen C5J*0) VE KALI) = Mo cos (ol 4.2) ¥| whos Daw a stint fine Thigh botr. points. Bor reaction y= Ni £553 Ku + CS) gl v coach) _—fiee tug phy : 0.05 as Gale 6.63 og) |om toed oh oS ¢ ot os) oo CGY (mig) ob ot y GA=C50)