Professional Documents
Culture Documents
27 Safrina-2012
27 Safrina-2012
E-mail: safrina_bioui@yahoo.com
Abstract
Carbamazepine (CBZ) has been known as the commonest antiepileptic drug (AED) causes of cutaneous adverse
drugs reactions (cADR) with manifestation ranges from a mild maculopapular exanthema (MPE) and increase
severity such as Steven-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) in patients with HLAB*1502 polymorphism. We have genotyped the HLA-B*1502 polymorphism using SSP-PCR on three epileptic
patients from PPUKM (Pusat Perubatan UKM) who got cADR during CBZ administration. The adverse drug
reaction has range from mild like non-bullous MPE/HSS to SJS/TEN with bullous. The genotyping for HLAB*1502 polymorphism showed that non-bullous patient did not carry HLA-B*1502 allele while patients with
bullous had this allele. The non-bullous patient got HSS after increasing the dose of CBZ and the rash stopped
after decreasing the dose as previous. The bullous patients who have characteristic of HLA-B*1502 indicated
have different onset of cADR related to the characteristic of the amplicon of HLA-B*1502 genotyping. In this
limited study, this finding confirmed that drug hypersensitivity is typically dose-independent and genotypephenotype specific.
Keyword: cADR; carbamazepine; epilepsy; HLA-B*1502 genotyping
Introduction/background
Epilepsy is the most common neurological problem which is treated by antiepileptic drug (AED) and
usually taken for long period especially for idiopathic epilepsy.[1,2] Several studies reported that AED
are one of the commonest causes of cutaneous adverse drugs reactions (cADR) with manifestation
ranges from a mild maculopapular exanthema (MPE) and increase severity to life-threatening severe
cutaneous reaction such as Steven-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN)
with mortality rate can reach up to 30%.[3] For investigating the origin of this adverse reactions, some
research has been found that these reactions are significantly more common in patients with particular
human leukocyte antigen (HLA) allele, HLA-B*1502. Interestingly, this allele association is ethnicity
specific and is seen in south-east Asians but not common in Caucasian except for patients with Asian
ancestry.[4] Furthermore, a genetic association can also be phenotype specific, as HLA-B*1502 is
associated only with carbamazepine-SJS/TEN.[5] Identification of genetic polymorphisms affecting to
development of AED-induced cADR offers the possibility of avoiding these high-risk drugs in
susceptible patients.[6] In brief, application of HLA-B*1502 genotyping as a screening tool before
prescribing carbamazepine could be a valuable tool in preventing CBZ-induced SJS/TEN in southeast Asian countries.
Objectives
The purpose is to observe the genotype-phenotype correlation between the HLA-B*1502 genotyping
and physical feature of cADR among epileptic patients treated with CBZ.
cutaneous adverse drug reaction during CBZ administration. The adverse drug reaction has range
from mild like non-bullous MPE/HSS (Patient III) to SJS/TEN with bullous (Patient I and II) (Table
2). Clinical examination of patients refered to OMS medical record PPUKM.
Blood collection
Ten ml of peripheral blood was drawn from the subjects into EDTA blood container
(vacutainer) for DNA analysis and underwent to DNA extraction.
DNA extraction
The step to extract DNA from whole blood was followed procedure in UMBI. DNA was
extracted from the peripheral blood using the salting out method.
Optical Density (OD) of DNA was measured to determine the quantity and quality of DNA
sample. The results were performed as spectrum length measurement at 260nm and 280nm, purity,
and concentration was performed in ng/ul. The purity range must be at 1.8 until 2.0 for a good result.
DNA 100 ng/ l for routine working was made from the stock by diluting with TE buffer refer to the
DNA quantity result.
Table 1. Table show the fragment size of each PCR products along the internal control
(IC) indicates positive for HLA-B*1502
Set
Primer
Sequence
Fragment
size (bp)
I
1
IC
II
2
3
4
IC
Forward: ACTTACCGAGAGAGCCTGCGGAA
Reverse: GCCCACTTCTGGAAGGTTCT
Forward: GAGTCAAGGCTGAGAGATGCAGGA
Reverse: CAATGTATCATGCCTCTTTGCACC
1.340
Forward: CGCGAGTCCGAGGATGGC
Reverse: GCCCAACTTCTGGAAGGTTCT
Forward: ACCGGAACACACAGATCTC
Reverse: GAGCCACTCCACGCACAG
Forward: GGAGTATTGGGACCGGAAC
Reverse: GCCATACATCCTCTGGATGA
Forward:GAGTCAAGGCTGAGAGATGCAGGA
Reverse: CAATGTATCATGCCTCTTTGCACC
124
850
562
369
850
Gel documentation
The 1.2% agarose gel was prepared for both sets by dilutes and boiled agarose analytical
grade in 1x TBE electrophoresis buffer. Gel was placed in electrophoresis tank and filled up with 1x
TBE electrophoresis buffer. Mix of 5 l samples with 5x gel loading dye blue was loaded in separate
wells of the gel using micropipette. The 6 l 100 bp DNA ladder in TBE buffer was included in the
gel to identify the size of the products of set I. While set II used 1 l 100 bp DNA ladder as a marker.
The PCR products were separated by electrophoresis for 1 hour at 90 volts or until the loading dye is
2/3 to of the distance to the end of the gel.
After electrophoresis the gel was incubated in 0.2% ethidium bromide solution for 20 minutes
then rinsed twice in TBE buffer. The gel was visualized and photographed at 8 second using UV
transilluminator. The presence of all four bands with the fragment size as a follows: 124 bp, 369 bp,
562 bp, and 1.340 bp indicated positive for HLA-B*1502, while the incomplete band show negative
for these allele.
Result
Amplification of fragment 1 (1340 bp) and fragment 2 (124 bp) of HLA-B*1502 polymorphism was
presence on all samples. Although fragment 2 (569 bp) and fragment 3 (376 bp) only presence on
sample I and II. Internal control (IC) in size 850 bp using -globin primer shows this PCR work is
valid (Figure 1).
I
II
III
1340 bp
850 bp (IC)
562 bp
376 bp
124 bp
Figure 1. Gel documentation. PCR amplification of HLA-B*1502 fragment 1,2,3, and 4 were shown
in size 124 bp, 369 bp, 562 bp. Internal control (IC) using -globin gene was shown in size 850 bp.
The number on lane indicates the number of sample
The genotyping for HLA-B*1502 polymorphism showed that non-bullous patient did not carry HLAB*1502 allele while patients with bullous had this allele.
No.
1
2
3
Discussion
The result of PCR for HLA-B*1502 polymorphism shows that non-bullous patient (Patient III)
does not carry HLA-B*1502 allele while patients with bullous (Patient I and II) have this allele (Table
2). The adverse reactions in patient I and II then stopped after CBZ discontinued. Then both patients
were consuming phenytoin (PHT) to replace CBZ. This study confirms that HLA-B*1502 allele is
associated with bullous reaction during CBZ administration. [5] Patient III has been taking CBZ twice
a day for approximately 1 year until clinician added the dose three times a day which caused rash at
abdomen area. Rash stopped after the dose was decreased as earlier. This finding confirms that drug
hypersensitivity is typically dose-independent and unpredictable.[7] Since this allele was not found in
the non-bullous patient (Patient III), it supports the previous study that genetic association with CBZinduced cADR is phenotype specific. Based on physical examination patient III was more likely to
have hypersensitivity syndrome (HSS).[5,8]
Interestingly, two patients with bullous reaction (patient I and II) illustrated the difference of
clinical feature spectrum. Both patients had taken CBZ in order to prevent seizure. Patient I got fever
with petechiae after 10 days CBZ administration, while patient II got rash after 3 days. This red spot
was spread on the whole body of patient II continuing with inflammation on the mucous area like eye
and lips which eye swab culture test infection did not show the presence of infection. These features
were absent on patient I who had petechiae only at the extremities. Since genotyping result shows the
difference width of the band on set 1 between patient I and II, this finding could demontrate the
spectrum of adverse reaction. It can be assumed that the severity of ADR could be associated with
band thickness due to the allele homozygosity. The possible explanation for this might be that patient
II who got more severe features of ADRs is homozygous for this allele. Otherwise, this finding must
be verified by further research.
Conclusion
This finding confirmed that HLA-B*1502 has association with CBZ induced SJS/TEN and was not
observed in HSS. Thus, there was genotype-phenotype correlation between HLA-B*1502 allele and
CBZ administration. Although we found some genotype-phenotype associations, the relationship
between clinical manifestation of cADR and genotyping of HLA-B*1502 should be proved by larger
study and further work to investigate the homozygosity.
References
1. Chung WH, Hung SI, Hong HS, Hsih MS, Yang LC, Ho HC, Wu JY, Chen YT. Medical genetics:
a marker for Stevens-Johnson syndrome. Nature 428:486, 2004.
2. Leeder JS. Mechanisms of idiosyncratic hypersensitivity reaction to antiepileptic drugs. Epilepsia,
39(suppl. 7):S8-S16, 1998.
3. Nayak S & Acharjya B. Adverse cutaneous drug reaction. Indian J Dermatol, 58(1):2-8, 2008.
4. Lonjou C, Thomas L, Borot N, Ledger N, de Toma C, LeLouet H. A marker for Stevens-Johnson
syndrome: ethnicity matters. Pharmacogenomics J, 6:265-268, 2006.
5. Man CBL, Kwan P, Baum L, Yu E, Lau KM, Cheng ASH, Ng MHL. Association between HLAB*1502 allele and antiepileptic drug-induced cutaneous reactions in Han Chinese. Epilepsia, 48(5):
1015-1018, 2007.
6. Then SM, Rani ZZ, Raymond AA, Ratnaningrum SD, Jamal R. Frequency of the HLA-B*1502
allele contributing to carbamazepine-induced hypersensitivity reactions in a cohort of Malaysian
epilepsy patients. APJAI 29(3):290-3, 2011.
7. Chung WH, Hung SI, Chen YT. Human leukocyte antigens and drug hypersensitivity. Curr Opin
Allergy Clin Immunol, 7:317-323, 2007.
8. Hung SI, Chung WH, Jee SH, Chen WC, Chang YT, Lee WR, Hu SL, Wu MT, Chen GS, Wong
TW, Hsiao PF, Chen WH, Shih HY, Fang WH, Wei CY, Lou YH, Huang YL, Lin JJ, Chen YT.
Genetic susceptibility to carbamazepine-induced cutaneous drug reactions. Pharmacogenetics &
genomics, 16(4):297-306, 2006.