Scribd Logo
Upload

Welcome to Scribd!

  • MEDG421 AparicioSlides

    Uploaded by

    Evelyn Liu
    5 views56 pages
    -slides MEDG421 UBC

    Original Title

    MEDG421_AparicioSlides (1)

    Copyright

    © © All Rights Reserved

    Available Formats

    ODP, PDF or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    Report this Document
    -slides MEDG421 UBC

    Copyright:

    © All Rights Reserved
    Download as ODP, PDF or read online from Scribd
    Flag for inappropriate content
    5 views56 pages

    MEDG421 AparicioSlides

    Uploaded by

    Evelyn Liu
    -slides MEDG421 UBC

    Copyright:

    © All Rights Reserved
    Download as ODP, PDF or read online from Scribd
    Flag for inappropriate content
    of 56
    Clonal dynamics and cancer medicine, ST Ble mol mercial MEDG421 aU} Samuel AJR Aparicio BM BCh PhD FRCPath Canada Research Chair, Molecular Oncology BC Cancer Agency/UBC, Vancouver METHODS CAN BE FOUND AT: http/molone.becre.ca hitp//compbio.booro.ca Structure of the lecture * Pt1 —Intra-tumoural heterogeneity: variation within tumours, evolution, some examples * Pt2—-Inter-tumoural heterogeneity - variation between patients * (if time permits, we can discuss therapeutic targeting of DNA repair deficient breast cancers) Recent results from our work, relevant to clonal analysis of solid cancers Clonal evolution in human cancers + Shah et al, Nature 2009 — deep prevalence estimation of clones over a 9 year interval + Shah et al, Nature 2012 — clonal groups from populations + Eirew et al, Nature 2015- clonal dynamics of PDX Somatic genomic variation between breast cancers * Curtis et al Nature 2012 + Devinge et al Nature 2013 + Perreira et al Nat. Comms. 2016 Computational methods + Roth et al, Nature Methods 2014 (Pyclone) - DP clustering, multiple sample statistics + Ha etal, Genome Res. 2014 (Titan) — Introduces clonal copy number states into Apolloh (HMM) Winning the battle — Imatinib & CML ... The New England Journal of Medicine EFFICACY AND SAFETY OF A SPECIFIC INHIBITOR OF THE BCR-ABL TYROSINE KINASE IN CHRONIC MYELOID LEUKEMIA Stn Sates, 88-0 Gents Sem - But losing the war: ‘A Mutation Conferring Resistance to Imatinib at the Time of Diagnosis of Chronic Myelogenous Leukemia NEJM 2003;348;23 Duration of Treatment with STIS (os) Fr hata ee Why are cancers a moving target - why do they evolve? « Any self replicating system which propagates information with variations, can also evolve. In a population of evolving entities, selection of variation encoding a fitness characteristic leads to directional evolution. This applies to DNA, computer programs, financial systems, languages ... Effects of eliminating competition, weak selection and multiple drug resistance loci (Malaria) ‘Abundant resistant parasites Rare resistant parasites — no competion competition Gametocyte density (log n0./ i!) Reed et al, PNAS 2011 Mackinnon, Proc. R. Soc. Lond. B, 1997 What is happening in tumours? “Hallmarks” of Cancer - acquired by mutation, epigenetic changes <9 cE vie ae ‘Aerobie ahyeaiysis rotor ” Tramune activating inhibitors ‘orang supose anl-CTLAS mAb ES Pesan Entiog Jomerase EE) mimetics = Innbtors PARP. teavong——Acivatng ‘Solocive ant inhitors septs nemend inflammatory drugs Innes of iorsot VEGF signaling Hallmarks of Cancer: The Next Generation Individual cells acquire distinct phenotypes, which may confer non-neutral fitness A,B, C ... = genotype, epigenotype O Selected phenotype Stable phenotype, Transient phenotype, Unstable epigenotype, Transient or stable selection Stable genotype/epigenotype Stable selection A brief history of clonal evolution Tumours as morphological mosaics (19 C morphologists) Bovari & Sutton — chromosomal theories of cancer (1902-14) Hauschka, Makino 1950's “stem lines” in animal tumours Richard Doll — mathematical models of mutational evolution in cancer (1954) 1960's stem cell line theories of cancer, leukemias The Clonal Evolution of Tumor Cell Populations Acquired genetic lability permits stepwise selection Science 1976 of variant sublines and underlies tumor progression. Peter C, Nowell Clonal dynamics: the changes in cellular sub- populations malignant cells _— stroma (colours indicate different clones) (surrounding non-malignant cells) ; a <—SSs— clonal prevalence neutral clonal dynamics S2=2— clonal prevalence _———- ——— sS= positive (or negative) oo clonal dynamics Clinical problem: Drug resistance, metastatic disease Clonal dynamics: more complex situations Clinical problem: immune evasion, tumour dormancy 3 > 8-H -- co-evolution of stromal components and tumour (eg immunity) ss. See! = SS ae 228 === ee, — clonal co-operation === SS—=_— spatial variation in clonal distribution Clinical problem: diagnostic assessment What could be gained from understanding clonal dynamics? * Mechanistic understanding: epigenotype/ genotype = phenotype relationships from clonal fitness * Define the co-dynamics of tumour and immune system evolution, metastatic niche selection * Prediction of drug combinations that may suppress evolution, based clonal dynamics The nature of the problem + Measurement science * clonal marks in populations of cells « clonal genotypes, epigenotypes in single cells + phenotypic characteristics in single cells and populations + Mathematical models * genotype relationships, single cell analysis * phylogenetic inference, generative process models + clonal fitness landscapes + Relevant time/space interval sampling in patients, model systems ‘Clonal lineage Formalisms for estimating clonal dynamics/1 ay a(@yc vl «@ a ® ale o* ne i ae e A~ 40/40 8 40/40 ‘Clonal-mutation prevalence c= 40/40 = 36/40 E~15/40 F=15/40 G~20/40 H=0/40 Clone - group of cells related by descent from a unitary origin Clonal genotype — the unique set of markers defining membership of a clone Clonal lineage — the hierarchical relationship between clones over time and space Clonal dynamics — the change in prevalence of clones within a population over time, space etc. Clonal evolution — the appearance of new clones in a population (Aparicio & Caldas, NEJM 2013) Inference of clonal relationships requires heritable marks ge DNA nucleotide sequence variation v DNA methylation pattern Histone modifications Gene expression pattern Randomly introduced foreign sequence (eg viral barcode) The relationship between tumour initiating cell concepts and clonality TIC concept: Only rare cells have re-population potential Tumor re-growth assay @ ——x~ @ @ a j Colony forming assay (cell culture) eo OD Xenotransplantation (mouse) oO nmtaton oO @O—x What encodes the re-populating cell phenotype? Unstable cell states Epigenetic characteristics Stable genomic alterations Some methods for non-genetic clonal analysis Random tagging of single cells Limit dilution analysis Measuring the frequency of a cell with a a property , by measuring the number of negative events in a dilution series lt 2D aa RRR Log-linear relationship I 1 1 Prevalence of cells bearing the phenotype Se (linear) luetal NS — Nature Biotech, 2011 = Log(proportion of negative events) Inferring clonal structure from cell populations by next-generation tumour sequencing Non-malignant cells Allele prevalence e ATTCTTGCTGATGTGAAGACAAAAAGAAAAACTTT e ATTCTTGCTGATATGAAGACAAAAAGAAAAACTTTG TATTCTTGCTGATATGAAGACARAAAGARAAACTTT ene oO ToATATTCTIRTGATATGAAGACARAAAGAAAAAC ACTGATATTCTTGCTGATATGAAGACAAAAAGAAAA Population structure CTECTCACTGATATTCTTGCTGATATGAAGACAAAAAGAAAA 4 —— — 3 a 100% co ~~ 4 — 4 Shah et al, Nature 2009 Mutational genotype Roth et al, Nature Methods 2014 Clonal evolution in time, space and as a consequence of therapy is a general property of cancers Terry metastasis Breast cancer © ica i " (= metastasis and ee Seton eee primary, — Capa iia mend Shah et al, Nature name 2009 Pertoncum 1 omentum 1.283 i vee Pertoneum 2: Diaphragm findox 1) Penton ae ‘Gemine Pancreatic cancer — evolution over time and space. Campbell, et al, Nature 2010 loca tine Renal cancer — variation in space within primary tumours AML ~ drug resistance clones evolve during therapy, Ding, Ley Gerlinger et al, NEJM 2012 et al, Nature 2012 How much clonal variation between individuals with the same primary cancer subtype + Triple Negative Breast Cancer (TNBC) ~15% of breast cancers + All EARLY TNBC - ie early in clinical course, all treated with curative intent. Same clinical stage/grade at presentation * 104 patients, whole genome sequenced/RNA-seq, multiplatform, re-validation + 2164 validated SNVs re-measured at median of >20,000 fold coverage Shah et al, Nature 2012 Wide variation in clonal complexity among TNBC with same stage/grade patient 1 patient 2 patient 3 ss —S—— i simple atte atte tee complex SARIB n= 96 Go Mame cote Fite or&val subtype difference umber of mutations so 100 150 200 Shah et al, Nature 2012 Patient-derived models of cancer - what do the models represent? Originating tumour::Xenograft — can recapitulate tumour metabolism and growth characteristics CT (non contrast) 18F — deoxyglucose PET/CT ER+/HER2+ breast cancer, xenoengrafted Micro-calcifications (red arrow) at hypoxic penumbra Hypoxic centre (yellow arrow) Benard, Aparicio, 2013 Questions What proportion of the original clones engraft? Is clonal diversity maintained? What happens over long term serial passaging? Are the clonal dynamics deterministic with respect to the genome? Do the clonal dynamics in PDX reflect that of the patients? Eirew et al, Nature 2015 saeco sacoe sats sAsco sAsor Asst sass Asse Patient derived breast tumour xeno-engraftment into immunocompromised mice Originating tumour Met ep (ey wet (eren Sub-ransplants Ma = 9 a (em Pom gece (wee Prem. an ar ween Prom. — (Erpaned am (ez (do sequence) owas time in vo (years) isro1es) % Source: Locally advanced breast cancers, primary cancers from surgical resection, metastatic cancers (biopsy and pleural sao ~ effusion) sass rez sas prenea® Host: Nod/SCID/IL2gammakO — 2 fully immunodeficient (lacks NK); — {alternative NRG) < Su posonsfucts teow Sites Of transplant: mammary «ote! fat pad; sub-renal capsule; SAS 2 ‘subcutaneous cr "2 sasu 9S = Method of disaggregation: paddle blender (Stomacher) sAs35 wt Support matrix: matrigel aien Poste Booey time in vivo (years) Primary engraftment site selection SAd29 Met. ERS = Subcutaneous = Subrenal = Mammary fat pad SAd96 Met. ERs The same tumour cell sample engrafted multiply into mammary fat pad, renal capsule and skin only grew in one of the sites Clonal selection on initial engraftment: What proportion of the original clones engraft? Engraftment from a rare clone (~5%) of originating sample (metastatic ER+/PR+, pleural effusion) SA494 ‘Common founder mutations Rare clone(s) in 90 originating tumour (5%), selectively engrafted M075: Mutation groups 2 ° ; | Cuero © 2 Custer 2 (nett) oS 5 | cuder3 net) mo BP oso . cower gai 2 | tesa Oo xs 2 | Boos | | 0.09. e) Dominant clone in 00 originating tumour, not engrafted 0.25 0.50 075 Tumour cellular prevalence Initial clonal selection but retained polyclonality Low abundance clones), selectively engrafted sa500__ Common founder mutations Mutation group ‘Cluster 1 (n=51) Clucter 2 (n=81) Cluster 3 n=8) ‘Cluster 4 (n=) (Cluster 5 (rt) (Cluster 6 (n=t7) ‘Cluster 7 ras) Xenograft Clonal prevalence Abundant clone(s) i originating tumour, a engrafted {F } @ 0.00) 025 0:50 075 +00 umour Clonal prevalence Summary: 3 patterns of initial clonal selection on engraftment selection on initial xenogratting minor clone engraftment polyclonal engraftment with selection independent clonal engraftment temporal evolution in patient temporal evolution in xenograft How stable are PDX clones over time/ serial propagation? PDX clonal dynamics over multiple passages ‘SA490 (Prim. TN) SA500 (Prim. Her2+) PN | eae Da To @ 1 MS r °. i 8 ° Bs Strong early selection, Moderate early selection, Relative stability Significant ongoing evolution Eirew, Steif, Khattra, et al: Nature 2015 Are clonal dynamics deterministic with respect to genotype? Reproducible dynamics of PDX genomic clones indicates deterministic dynamics ASO re-transplant into disaggregate _separate hosts tumour @e@ we eS oe —¢ —_ > oe eee ™ g20 Eirew, Steif, Khattra, et al: Nature 2015 Resolving clonal genotypes — single cell whole genome sequencing ‘Clonal lineage Formalisms for evaluating clonal dynamics/1 ay a(@yc vl «@ a ® ale o* ne i ae e A~ 40/40 8 40/40 ‘Clonal-mutation prevalence c= 40/40 = 36/40 E~15/40 F=15/40 G~20/40 H=0/40 Clone - group of cells related by descent from a unitary origin Clonal genotype — the unique set of markers defining membership of a clone Clonal lineage — the hierarchical relationship between clones over time and space Clonal dynamics — the change in prevalence of clones within a population over time, space etc. Clonal evolution — the appearance of new clones in a population (Aparicio & Caldas, NEJM 2013) Clonal dynamics of serial PDX passages at single cell resolution Eirew, Steif, Khattra, etal: Nature 2015 Single cell whole genome sequencing — resolving clonal genotypes with microfluidic cell processors Carl Hansen Physics, microfluidics Summary conclusions * Clonal dynamics of solid human cancers can be now be measured in populations of cells and single cells « We know very little about the epigenetic and genomic variations that MODIFY the behaviour of cancer over time - most of what we have learned has come from static “snapshots” of cancer. Pt2. Inter-patient heterogeneity: biological subtypes of primary breast cancers ‘This presentation 1s the intellectual property of he authorpresenter, Contact hen at saparloo@sces.a for permission to reprint andi tut. What constitutes a molecular disease subtype? Molecular marker of therapeutic efficacy with level 1 prospective trial based evidence — Eg. ER+/- Distinct biologies associated with important disease phenotypes (eg outcome, recurrence rate, disease site sterotyped) — Eg. Chr11 q amplicons, ETV6-Ntrk fusion in secretory breast carcinomas Non-random grouping of molecular features without prognostic significance — Large number of patients needed to establish non-randomness Model systems functional groupings (cell lines, genetic models) — Often very limited or indirect linkages to human disease ‘This presentation 1s the intellectual property of he authorpresenter, Contact hen at saparloo@sces.a for permission to reprint andi tut. Primary breast cancer — how many diseases? CLINICAL SUBTYPES _Non basal Heterogenous group HER2- ER- ” Younger patients Express Basal markers HER2+ trastuzumab ‘Special types High mitotic rate ER+ Endocrine therapy H-/ Low mitotic cytotoxicchemo = HER2- ER rate ER+ z = MOLECULAR SUBTYPES Eg: PAMS0, Oncotype, mammaprint, ete: gene transcript expression based centroids for classification HER2=HER2 (ER+ or ER-) LUMA=ER+, low mitotic rate LUMB=ER+, mitotic active BASAL=subtype of “triple negative” Normalike="similar to normal breast epithelium” No adjuvant systemic therapy Time (years) (Parker et al, JCO 2008) ‘This presentation 1s the intellectual property of he authorpresenter, Contact hen at saparloo@sces.a for permission to reprint andi tut. Primary breast cancer genomes with clinical outcomes in 2,000 patients - METABRIC (Molecular Taxonomy of Breast Cancer International Consortium) * Consortium between Canada and UK, 6 centres: Vancouver, Winnipeg, Cambridge, Nottingham, Guys. Started in 2007. * Gene copy number and expression from 2167 primary breast cancers where > median 12 years clinical outcome data was available. (Curtis et al, Nature 2012) * microRNA landscape (Devinge et al, Nature 2013) * Mutation landscape + 400 additional cases (NeoTango, Nottingham series) (Pereira et al, 2015 - in review) ‘This presentation 1s the intellectual property of he authorpresenter, Contact hen at saparloo@sces.a for permission to reprint andi tut. 10 20] 20] Cis-linked CNA-expression hotspots in 1000 tumours identifies new drivers 0 ir 8 2vrz00 Vo) PAKURSFUINTSA| 2: al 1 1 a po T 2 sa 39 1121S 14 1S 18 TTB 18 BE \romesome % Curtis otal Nature 2012 ‘This presentation 1s the intellectual property of he authorpresenter, Contact hen at saparloo@sces.a for permission to reprint andi tut. Joint CNA-expression (IntClust) groups revalidate in 1000 patients, with long term outcomes Discovery set Logank P=1.2x10""* Intclust2 Disease-specitic survival probablity 109 a Months Curtis otal Nature 2012 Monte Discovery set Validation sot 220 209 soot 400000 90020 2096098001000 “gs owes “ga tact e Ye sens01r Nop u-20 tesa ue -20 pewcvoarne ha cronrsies : —— — —— he — pia ot oe oo co — a = :a = =< —- = = ‘This presentation 1s the intellectual property of he authorpresenter, Contact hen at saparloo@sces.a for permission to reprint andi tut. 10 Primary breast cancer subtypes in TCGA cNAiecaot Relative mutation prevalence CNA-expression P AP od 02 04 c@ 08 19 00 02 0s 08 08 10 Group (Patient %) gecaraeegt) ams * = “ar%) ER+ 88% ;PR+ 43%; HER2+ 14% beng High grade el of CNA i aici hun e\ fF CN. Intermediate prognosis. = ifs: ERs BNP RY 45%; HERDS 1 Be ead prgonie tees Esso 2 (4%) 5 (10%) iq 13/14 amp ERY 96% ;PR+ 71%; HERZ+ 4% sisson EREB2 amplified ee eet ER 42%;PR+21%; HER2#95% Poor prognosis i cisonncesto PRD: Younger age, high grade, high LN+ Poor prognosis - 6 (4%) ec apis GATAS. ER+ 85% ;PR+36%; HER2+4% No distinct features Intermediate prognosis 3 (15%) Low prevalence of CNA Ene 90% PRe 72%, HERQS <1% Cowgrado, Low UN Good prognosis crocet i roe ieee. . Dawson et al, EMBO J., 2013 TCGA, Nature 2012 ‘This presentation 1s the intellectual property of he authorpresenter, Contact hem at saparioo@bees.ca for permission to reprint ander tute, 10 Primary breast cancer subtypes in TCGA ‘CNA-expression Relative mutation prevalence CNA-expression Group (patient) Group (patent %) 0 ee yee ee case 7 (10%) Pc oa 9 (7%) 18p+;16q-;8p+ rks + (EEE Prkzcn ERs Seve 70%; HER2+ 1% EEN ones Sqr; 204;PPP2RZA Sgr SS To rs) Enotes tr HeRa+ 74 Ses easgnans 5 3 Sora ood prognos mcr + i Intnsoute prognosis 3 Bm wove © i ensco0000047772 BB rvrs 7 oe co os ot os on ap 00 one ant) 8 (15% EEE Pac + a dqesié ( ) EEMMans + basal TNBC: Pe ‘ Squ0qes0qe:t2a¢ ER Sbi:pRe 70m; Hees <1 SEO SRE oe on Henze ax Gtesegeowaraio gs : ounger age, High grade; Largo Good prognosis 3 tumours; BASAL TNBC 7H ge Feta ‘csMo1 Ml osscn as cca ‘EE irs Mi cacnaia * Dawson et al, EMBO J., 2013 TCGA, Nature 2012 ‘This presentation 1s the intellectual property of the authorpresenter, Contact hem at saparioo@bees.ca for permission to reprint ander tut, Identification of 40 tumour suppressor-oncogene drivers (Mut-drivers) from sequencing of 2,433 breast cancers 2,433 cases | Clinical outcomes Median 12 years IntClust subtypes ———, Pereira ot al, 2016 Nat.Comms, in press ‘Ths presentation eth intelectual property of te authoxpresenter, Contact then at saparisiog@bcceoa for permission to repent anor atu, Pereira et al, 2016 Nat.Comms, in press. 40 Mut-Drivers in 2,433 breast cancers sf E . é a 21 ER+ only 3 ER- only 16 shared 6/40 oncogenes ER-(n=632) TOGA BREA TCGA PAN : : cosmic : : te we CDOS ‘This presentation isthe intellectual property ofthe authodpresenter. Contact them at saparisog@bcere.ca fr permission to repent andiersstibut, METABRIC Mut-drivers identified as impacting gene expression across 12 cancer types incis Idontitiod in METABRIC > => = ° S $10. = Ding et 3 5 = => cHex2ucec ‘ Nature communications 5 => BaPi king in trans 2015 2 6 > wsserce = 2 => cama Bra 8 inna 2 0 2 40 60 80 100 120 genes ‘This presentation 1s the intellectual property ofthe authorpresenter, Ceftacthemn at saparioo@beee.ca for permission to reprint ander but, Mutation co-occurence and anti-correlation in 2,433 eRo2 461 -3.89 3.17 -2.46 4.74 -1.02 Pereira ot al, 2016 Nat.Comms, in press cancers ag. ff -ve association “3 I +ve association RE U g. im e2 a fe ag mim] ies ay a fs i. 5 L_) 310.41 1.13 1.84 2.66 Log (odds ratio) ‘This presentation 1s the intellectual property of he authorpresenter, Contact hen at saparloo@sces.a for permission to reprint andi tut. Segregation of Mut-drivers by histological subtypes in 2433 cancers Other (21) g Mucinous (24) oe °. oa 02 ° oe 6 boaines a | ere g s0aN g jauov Ea 2 wows 9 Boon ik e fey toe s 2 ow 3 rave Exar 3 ive 3 Ser »B ince 2 a 8 i = rar O uve etn SeLNy yoo woe » TN voce . yoy “ fade segs ge sgqge pea ban ean Pave nes ea e i ‘on e keg Boy 5 ese vig s eo SS 8 vice & exer 3 3

    You might also like