Professional Documents
Culture Documents
Churchill, Stewart Bohnet, Paul Magrath, Bálint Kacsóh, Lissette Jimenez and
James M. Krueger
Am J Physiol Regulatory Integrative Comp Physiol 293:922-930, 2007. First published May 30, 2007;
doi:10.1152/ajpregu.00237.2007
This article cites 37 articles, 11 of which you can access free at:
http://ajpregu.physiology.org/cgi/content/full/293/2/R922#BIBL
Updated information and services including high-resolution figures, can be found at:
http://ajpregu.physiology.org/cgi/content/full/293/2/R922
Additional material and information about American Journal of Physiology - Regulatory, Integrative
and Comparative Physiology can be found at:
http://www.the-aps.org/publications/ajpregu
The American Journal of Physiology - Regulatory, Integrative and Comparative Physiology publishes original investigations that
illuminate normal or abnormal regulation and integration of physiological mechanisms at all levels of biological organization,
ranging from molecules to humans, including clinical investigations. It is published 12 times a year (monthly) by the American
Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2007 by the American Physiological Society.
ISSN: 0363-6119, ESSN: 1522-1490. Visit our website at http://www.the-aps.org/.
Am J Physiol Regul Integr Comp Physiol 293: R922–R930, 2007.
First published May 30, 2007; doi:10.1152/ajpregu.00237.2007.
Szentirmai É, Yasuda T, Taishi P, Wang M, Churchill L, restores REMS but not NREMS (20). Spontaneous dwarf rats,
Bohnet S, Magrath P, Kacsóh B, Jimenez L, Krueger JM. Growth which have severe GH deficiency and high hypothalamic
hormone-releasing hormone: cerebral cortical sleep-related EEG ac- GHRH mRNA and GHRH release, display excess spontaneous
tions and expression. Am J Physiol Regul Integr Comp Physiol NREMS (26). Hypothalamic GHRH mRNA and GHRH pep-
293: R922–R930, 2007. First published May 30, 2007;
doi:10.1152/ajpregu.00237.2007.—Growth hormone-releasing hor-
tide content correlate with sleep propensity in normal and
mone (GHRH), its receptor (GHRHR), and other members of the sleep-deprived rats (reviewed in Ref. 19). Microinjection of
Address for reprint requests and other correspondence: J. M. Krueger, The costs of publication of this article were defrayed in part by the payment
Washington State Univ., Coll. of Veterinary Medicine, Dept. of VCAPP, PO of page charges. The article must therefore be hereby marked “advertisement”
Box 646520, Pullman, WA 99164-6520 (e-mail: krueger@vetmed.wsu.edu). in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
R922 0363-6119/07 $8.00 Copyright © 2007 the American Physiological Society http://www.ajpregu.org
GHRH ENHANCES LOCALIZED CORTICAL EEG DELTA POWER R923
the bregma in the midline over the cerebellum. Rats were provided the brain was injected. Immediately after injection, the animals were
with guide cannulas for injection with their tips positioned under the returned to their home cages. Sleep-wake activity was recorded for
EEG electrodes between the surface of the somatosensory cortex and 23 h starting from the beginning of light onset (0900).
the dura on each side of the brain. The guide cannulas and the screws Experiment 2. Unilateral cortical administration of GHRH at dark
were fixed to the skull with dental cement. After the surgeries, the onset. Ten rats were used for these experiments; none of these rats
animals were placed in individual sleep-recording cages in sound- were used for light onset injections. The injections were performed 10
attenuated, temperature-regulated environmental chambers at 24 ⫾ to 15 min before dark onset following the same protocol that we
1°C ambient temperature on a 12:12-h light-dark cycle (light on at described above [5 nmol (injection side right: n ⫽ 5; left n ⫽ 4), 0.5
0900) for habituation to the experimental conditions for at least 7 nmol (injection side right: n ⫽ 5; left n ⫽ 4) and 0.05 nmol (injection
days. During this adaptation period, the animals were connected to the side right: n ⫽ 6; left n ⫽ 4)]. All 10 rats were used 2 or 3 times, and
recording cables and handled daily to habituate them to the injection when possible, the opposite side of the brain was used.
procedure. Water and food were available ad libitum during the
experiments. Statistical Analysis
Verification of cannula placement. To verify the location of the
Two-way ANOVA for repeated measures was performed on sleep
microinjection cannulas, 2 l of 20% lidocaine was injected on the
and power spectra data (factors: treatment and time effect or treatment
surface of the cortex under ketamine-xylazine anesthesia. This pro-
and frequency effect, respectively). For SWA analysis, the hours
cedure was carried out at least 1 wk before the animals were used in
during which a rat did not have at least 5 min NREMS were excluded.
experiments. As we previously described, lidocaine decreases the
The exclusions resulted in occasional missing data points. Therefore,
EEG power in all frequency bands on the injected side of the brain
instead of repeated-measures ANOVA, two-way ANOVA was per-
(37). Only animals with correct placement of cannulas (decrease in
formed on SWA. Time spent in sleep and SWA data were analyzed in
EEG power on the injection side after lidocaine) were included in the
3-h time blocks for the 23-h recording period between the baseline
with RNase H. Samples were diluted with sterile DNase-free water, tive PCR SuperMix-UDG (Invitrogen), 0.25 l of 1:1,000 dilutions of
aliquoted, and stored at ⫺20°C. SYBR Green (Invitrogen) and flourescein (Bio-Rad), and 0.5 l of 10
PCR of GHRH and GHRHR in brain samples. cDNA was PCR M primers for GHRH-R, GHRH, and cyclophilin A. PCR amplifi-
amplified with primers to identify the presence of mRNA for GHRH cation conditions were the same as described previously (32). The
and the three isoforms of the GHRHR in the pituitary, hypothalamus, binding of the PCR product with SYBR Green during the extension
and cortex. The PCR reaction used either HotStarTaq Master Mix step of the PCR cycle emitted fluorescence at 495 nm, which was used
(Qiagen, Valencia, CA) or Platinum Taq DNA Polymerase (Invitro- to measure threshold cycles (Ct). Reactions were performed in tripli-
gen). Primer sequences for GHRH were CTACGTGCTCTGGAA- cate, and Ct values were averaged. Gene expression was analyzed by
CATGC (1–20) and TTGCAGATGAGATGGGTCTTT (609 –589), the comparative Ct method using the formula: 2⫺⌬⌬Ct, as described
and primers for GHRHR and cyclophillin were published (32). The earlier (32). The fold-changes between the mRNA expression levels
GHRH PCR reaction used the following conditions: Hot-start: 15 min of the experimental and the control samples were calculated (32). The
at 95°C before the three-step PCR, which consisted of 40 cycles of 1) dissociation curves of used primer pairs showed a single peak, and
template denaturation at 95°C (15 s); 2) primer annealing at 58°C (15 PCR products had a single expected DNA band when run on an
s); and 3) product extension at 72°C (15 s). The final extension cycle agarose gel (data not shown).
was 10 min at 72°C. The GHRHR PCR used the following conditions: Gel purification of GHRHR PCR product. GHRHR PCR products
Initiation was 2 min at 94°C. The three-step PCR consisted of 35 were pooled to 200-l total volume for each part of the brain and
cycles of 1) denaturation at 94°C (30 s); 2) annealing at 57°C (30 s); separated by electrophoresis on 1% agarose/ethidium bromide gels
and 3) extension at 72°C (60 s). The final extension cycle was at 72°C and visualized by UV light. The DNA bands were excised from the
(5 min). PCR products were separated by 1 or 1.5% agarose gel gels and purified by MinElute Gel Extraction Kit (Qiagen) according
electrophoresis and stained with ethidium bromide, and bands were to manufacturer’s instructions. The excised DNA fragments were
visualized by UV transillumination. mixed with 3 volumes of buffer QG (wt/vol) and incubated at 50°C
Table 1. The amounts of wakefulness, non-rapid eye movement sleep, and rapid-eye movement sleep after saline and
GHRH injections
Dark-Onset Injections
Saline, min/23 h Saline, min/12 h Saline, min/11 h 0.5 nmol GHRH, min/23 h
Saline, min/23 h Saline, min/12 h Saline, min/11 h 0.05 nmol GHRH, min/23 h
Light-Onset Injections
Saline, min/23 h Saline, min/12 h Saline, min/11 h 0.5 nmol GHRH, min/23 h
Saline, min/23 h Saline, min/12 h Saline, min/11 h 0.05 nmol GHRH, min/23 h
to identify the band sizes. The normalized values for each of the four (P ⬍ 0.05, Student’s t-test). The average duration of REMS
gels (2 cortical samples/gel; n ⫽ 8) were averaged to yield one value episodes was 96.5 ⫾ 13.4 s after saline vs. 127.5 ⫾ 6.2 s after
for each of the 6 time points (Fig. 7). Data (Fig. 7) were subjected to 0.5 nmol GHRH (P ⬎ 0.05, Student’s t-test). The highest dose
one-way ANOVA. An alpha level of P ⬍ 0.05 was accepted as of GHRH tested (5 nmol) did not affect duration of REMS or
significant. Student’s t-test was used to compare the control and
experimental values (Fig. 8). its distribution across the recording period (data not shown).
After the cortical injections of GHRH, no behavioral abnor-
RESULTS malities were observed; that is, the animals continued to cycle
through bouts of wakefulness and sleep.
Effects of GHRH on Cortical EEG Unilateral injection of the 5-nmol dose at dark onset en-
At dark onset, none of the doses of GHRH microinjected hanced EEG slow-wave power compared with values obtained
unilaterally onto the cortex altered the duration of NREMS or on the baseline day from the same side of the cortex during the
REMS, nor were the distributions of these states across the first 3 h postinjection (Fig. 1) [ANOVA, treatment effect
recording period changed (Table 1). Thus, greater duration of F(1,126) ⫽ 9.3, P ⬍ 0.05]. In contrast, the lowest dose tested,
NREMS and REMS was observed during daylight hours than 0.05 nmol, reduced EEG delta wave power ipsilaterally during
during night time hours after all of the doses (data not shown). this period compared with the baseline day values [ANOVA,
Similarly, after light-onset injections of GHRH, none of the treatment effect F(1,140) ⫽ 13.9, P ⬍ 0.05]. Similar results
doses altered the duration or distribution of NREMS. In con- were obtained after daylight-onset injections. Thus, the higher
trast, the two lower doses of GHRH, 0.05 and 0.5 nmol, dose enhanced EEG delta power during the immediate postin-
injected at the onset of daylight, enhanced REMS for about 6 h. jection hours on the side ipsilateral to the injection [ANOVA,
Fig. 3. EEG power density spectra after dark onset injections of GHRH. Differences in the EEG power values during wake, NREMS, and rapid eye movement
sleep (REMS) between the baseline and experimental day on the injected (F) and the noninjected side (E). The EEG power for each rat for each vigilance stage
was determined for on the baseline day and on the GHRH treatment day for both sides of the brain. The values obtained on the baseline day were subtracted
from the values obtained on the GHRH treatment day. Error bars are show means ⫾ SE. *Significant differences between baseline and experimental day (P ⬍
0.05, Student-Neumann-Keuls test).
Fig. 4. EEG power spectra after light onset GHRH injections. See Fig. 3 for details.
in somatostatin regulation by fetal rat brain cells in culture. Neuroendo- 26. Peterfi Z, Obal F Jr, Taishi P, Gardi J, Kacsoh B, Unterman T,
crinology 55: 221–229, 1992. Krueger JM. Sleep in spontaneous dwarf rats. Brain Res 1108: 133–146,
13. Frieboes RM, Murck H, Schier T, Holsboer F, Steiger A. Somatostatin 2006.
impairs sleep in elderly human subjects. Neuropsychopharmacology 16: 27. Rector DM, Topchiy IA, Carter KM, Rojas MJ. Local functional state
339 –345, 1997. differences between rat cortical columns. Brain Res 1047: 45–55, 2005.
14. Kapás L, Obal F Jr, Book AA, Schweitzer JB, Wiley RG, Krueger JM. 28. Rettori V, Milenkovic L, Beutler BA, McCann SM. Hypothalamic
The effects of immunolesions of nerve growth factor-receptive neurons by action of cachectin to alter pituitary hormone release. Brain Res Bull 23:
192 IgG-saporin on sleep. Brain Res 712: 53–59, 1996. 471– 475, 1989.
29. Saper CB, Scammell TE, Lu J. Hypothalamic regulation of sleep and
15. Krueger JM, Obál F. A neuronal group theory of sleep function. J Sleep
circadian rhythms. Nature 437: 1257–1263, 2005.
Res 2: 63– 69, 1993.
30. Shoham S, Blatteis CM, Krueger JM. Effects of preoptic area lesions on
16. Krueger JM, Obál F Jr. Sleep function. Front Biosci 8: d511– d519, muramyl dipeptide-induced sleep and fever. Brain Res 476: 396 –399,
2003. 1989.
17. Liao F, De A, Urza MJ, Krueger JM. GHRH increases cytoplasmic 31. Shoham S, Davenne D, Krueger JM. Muramyl dipeptide, amphetamine,
calcium levels in cultured cortical neurons. Sleep. In press. and physostigmine: effects on sleep of rabbits. Physiol Behav 41: 179 –
18. Obál F Jr, Krueger JM. Biochemical regulation of non-rapid eye 185, 1987.
movement sleep. Front Biosci 8: d520 – d550, 2003. 32. Taishi P, De A, Alt J, Gardi J, Obal F Jr, Krueger JM. Interleukin-
19. Obál F Jr, Krueger JM. GHRH and sleep. Sleep Med Rev 8: 367–377, 1beta stimulates growth hormone-releasing hormone receptor mRNA
2004. expression in the rat hypothalamus in vitro and in vivo. J Neuroendocrinol
20. Obál F Jr, Alt J, Taishi P, Gardi J, Krueger JM. Sleep in mice with 16: 113–118, 2004.
nonfunctional growth hormone-releasing hormone receptors. Am J Physiol 33. Takeuchi T, Suzuki H, Sakurai S, Nogami H, Okuma S, Ishikawa H.
Regul Integr Comp Physiol 284: R131–R139, 2003. Molecular mechanism of growth hormone (GH) deficiency in the sponta-
21. Obál F Jr, Floyd R, Kapás L, Bodosi B, Krueger JM. Effects of neous dwarf rat: detection of abnormal splicing of GH messenger ribonu-