P. 1
avi1-1

avi1-1

|Views: 2|Likes:
Published by Avinash Bajaj

More info:

Published by: Avinash Bajaj on May 08, 2011
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

05/26/2014

pdf

text

original

Cytokine 48 (2009) 231–238

Contents lists available at ScienceDirect

Cytokine
journal homepage: www.elsevier.com/locate/issn/10434666

In vivo antitumor efficacy of interleukin-21 in combination with chemotherapeutics
Kresten Skak a,*, Henrik Søndergaard a, Klaus Stensgaard Frederiksen b, Eva Ehrnrooth c
a

Immunopharmacology, Building F6.2.30, Novo Nordisk A/S, Novo Nordisk Park, 2760 Måløv, Denmark Molecular Genetics, Novo Nordisk A/S, Novo Nordisk Park, 2760 Måløv, Denmark c Clinical Research Oncology, Novo Alle, Novo Nordisk A/S, 2880 Bagsvrd, Denmark
b

a r t i c l e

i n f o

a b s t r a c t
Interleukin-21 (IL-21) is a class I cytokine with antitumor properties due to enhanced proliferation and effector function of CD8+ T cells and natural killer (NK) cells. Here we have explored the magnitude and time-course of cytostatics-induced lymphopenia in mice and investigated whether treatment with cytostatics influences the antitumor effect of IL-21 in mouse tumor models. We show that pegylated liposomal doxorubicin (PLD), irinotecan and oxaliplatin induced transient lymphopenia, whereas 5-fluorouracil (5-FU) transiently increased lymphocyte counts. B cells were more sensitive than T cells towards irinotecan and oxaliplatin. Additive antitumor effects were observed after combining IL-21 with PLD, oxaliplatin and to less extent 5-FU but not irinotecan, and larger effect was observed when IL-21 administration was postponed relative to chemotherapy, suggesting that these agents may transiently impair immune function. However, the chemotherapies did not significantly alter the levels of circulating regulatory T cells and only marginally affected the ability of CD8+ T cells to respond to IL-21 measured as increased granzyme B mRNA. Our results show that IL-21 therapy can be successfully combined with agents from different chemotherapeutic drug classes, i.e. topoisomerase II inhibitors (PLD), anti-metabolites (5-FU) and platinum analogs (oxaliplatin) provided that IL-21 therapy is delayed relative to chemotherapy. Ó 2009 Elsevier Ltd. All rights reserved.

Article history: Received 16 January 2009 Received in revised form 27 May 2009 Accepted 27 July 2009

Keywords: Immunotherapy Cytokines Chemotherapy In vivo models

1. Introduction Interleukin-21 (IL-21) is a novel four helix bundle class I cytokine produced endogenously by activated CD4+ T cells and natural killer T (NKT) cells [1,2]. IL-21 signals through a heterodimeric receptor complex comprised of the unique IL-21 receptor protein (IL-21R) and the common c chain. IL-21R is predominantly expressed by lymphocytes and dendritic cells, and in common with other common c chain associated receptors, IL-21R signals primarily through the transcriptional JAK/STAT activators pathway [3–5]. IL-21 has profound effects on most lymphocyte subsets, including costimulation of B cell proliferation, differentiation and isotype switching, enhancement of CD8+ T cell proliferation and effector function, activation of NK cells and differentiation of CD4+ T cells into Th17 cells (reviewed in [6]). In vivo studies using recombinant murine IL-21 have demonstrated significant antitumor efficacy in a variety of tumor models including melanoma and renal cell carcinoma (RCC) [7,8], and studies in mice have identified cytotoxic T cell and natural killer (NK) cell functions as likely mediators of IL-21-induced antitumor activity [7,9–11]; a finding that is consis-

* Corresponding author. Tel.: +45 4443 1594; fax: +45 4443 4537. E-mail address: skak@novonordisk.com (K. Skak). 1043-4666/$ - see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.cyto.2009.07.039

tent with the ability of IL-21 to enhance effector functions of these cell types in vitro and augment proliferation of cytotoxic T cells. Clinical studies with recombinant human IL-21 administered as monotherapy have been conducted in patients with stage IV melanoma and renal cell carcinoma. IL-21 demonstrated an acceptable safety profile and was associated with antitumor activity when administered as monotherapy in previously pretreated patients in phase 1 and 2 trials [12–14]. IL-21 is currently being tested in a phase II trial in combination with sorafenib in RCC (clinicaltrials.gov identifier NCT00389285) and in phase I trials in combination with rituximab in non-Hodgkin’s lymphoma (clinicaltrials.gov identifier NCT00347971), with cetuximab in colorectal cancer (Eudract No. 2006-004231-30) and with pegylated liposomal doxorubicin (PLD) in epithelial ovarian cancer (clinicaltrials.gov identifier NCT00523380) are also ongoing. Combining IL-21 with other drugs is the next obvious step in the future development of IL-21, and since the majority of cancer patients are undergoing chemotherapy at some stage during their disease course it is highly relevant to investigate if IL-21 therapy can be successfully combined with chemotherapy. Traditionally combining chemotherapy with immunotherapy has not been considered feasible due to the adverse effect of most cytostatics on the bone marrow and on dividing lymphocytes, which are required for raising an adaptive antitumor immune response. However, more recently several studies have shown that

17]. Data acquisition was performed on a LSR II flow cytometer (BD Biosciences) and data were analyzed with BD FACSDiva software (BD Biosciences) for the absolute number of lymphocytes. Data are normalized to a vehicle-treated group in order to compensate for day-to-day variations. USA) were cultured in RPMI 1640 with GlutaMAX supplemented with 10% heat-inactivated FCS. Bergisch Gladbach. Blood samples of up to 100 ll were drawn from the periorbital plexus under isoflurane anaesthesia into heparinized tubes at the following time points: pre-dosing. 7 days and 14 days half of the mice in each cohort were injected s. Denmark). PLD. renal cell carcinoma. the third generation platinum analog oxaliplatin.c. CA. and the samples were incubated for 15 min at RT and transferred to ice. Invitrogen. BD Biosciences). eBioscience) followed by fixation/permeabilization and staining with Foxp3 PE (clone FJP-16.1 FITC (clone PK136. granzyme B. sodium pyruvate (RenCa only). MD. eBioscience). 5-FU (Mayne Pharma) and oxaliplatin (Mayne Pharma) were all purchased through Nomeco (Copenhagen. 7 days. BD Biosciences). All experiments were conducted in accordance with local guidelines on use of experimental animals and approved by the Danish National Ethics Committee on Experimental Animals. To this end we chose four different chemotherapeutics. In vitro results indicate that adjuvant IL-2 based immunotherapy combines effectively with a number of cytostatics e.1. Robert H. cDNA was prepared from total RNA using random hexamer primers and TaqMan Reverse Transcription reagents (Applied Biosystems.1. once on day 0. 5-Fluorouracil (5-FU) was administered intraperitoneally twice on day 0 and 1. Foster City. 2. which may subsequently lead to pro-inflammatory responses at the tumor site. USA) according to the manufacturer instructions.g. For enumeration of Treg cells 80 ll erythrocytes were lyzed in whole blood samples.5 (clone H57–597. CA) and chloroform added. In this study we have investigated how administration of chemotherapy affects the number of circulating lymphocyte subsets in a time-course study and the ability of CD8+ T cells to respond to IL-21 stimulation in vivo measured as increased granzyme B mRNA expression. with 50 lg IL-21. Before injection IL-21 was diluted in PBS. pegylated liposomal doxorubicin.000g at 4 °C. RCC. CD8 APC (clone 56–6. bladder and ovarian cancers. Quantitative PCR was performed in duplicate on each of the cDNA samples (10Â dilutions of cDNA) using TaqMan Universal PCR Master Mix (Applied Biosystems) and the ABI PRISMÒ 7900HT Sequence Detection System (Applied Biosystems). These chemotherapeutics are used either as monotherapy or in different combinations for the treatment of various cancers e. From each blood sample 50 ll blood was transferred to True-count tubes (BD Biosciences) and stained for 15–20 min at RT with the antibodies TCR-b PE-CY5. 14 days. Effect of chemotherapy on IL-21 induced granzyme B Cohorts of 8 mice were injected on day 0 with PLD (200 lg/ mouse). Skak et al. GZMB. At time points 24 h. Samples were vortexed for 15 s and phases separated by centrifugation for 15 min at 10. Denmark). we have addressed whether the antitumor effect of IL-21 can be maintained when chemotherapy is administered prior to or simultaneous with IL-21 therapy. / Cytokine 48 (2009) 231–238 cytostatics can as well augment tumor immunity due to their ability to induce immunogenic cell death. eBioscience) CD4 PE (clone GK1. the topoisomerase I inhibitor irinotecan.1ÀCD4À combined with FSC/SSC gating.1 in true-count tubes as above.3. i.5 mg/ml IL-21 in 0. Four hours after IL-21 or PBS injection the mice were sacrificed and spleens were removed for single cell preparation followed by lysis of erythrocytes in ACK buffer.7. PBS was used as vehicle control for IL-21. Germany). 5-FU permitted efficient CTL-mediated killing of target cells in vitro [16]. For enumeration of granulocyte and monocyte 20 ll whole blood was stained with CD11b APC-Cy7 (clone M1/ 70. irinotecan (Mayne Pharma). Carlsbad. 2. RNA integrity was confirmed on a 2100 Bioanalyzer (Agilent Technologies. breast. or if the MTD was not available the dose was based on published papers using these compounds in mice. Sorted CD8+ T cell samples were lyzed in TRIzol reagent (Invitrogen. uptake of tumor antigen by resident antigen-presenting cells and subsequent augmentation of antitumor T cell responses [15]. 5-fluorouracil (5-FU)1 and doxorubicin [16. 72 h. pH 5. Animals C57BL/6 and Balb/c female mice. and 5% penicillin–streptomycin (all from GIBCO Cell Culture.2. BD Biosciences). All cytostatics were administered using a dose close to MTD for mice as the highest dose. The purity was generally 80–90%. CD19 APC-Cy7 (clone 1D3. 2. CRL-6322) and BALB/c derived RenCa renal cell carcinoma cells (kindly provided by Dr. Similarly. Two alternating cohorts of 4 mice each were used for each group in order to reduce blood sampling from individual mice to maximum two times within one week. 8–10 weeks-old.4G2. The test substance was formulated as 10. the other half were injected with equi-volume PBS. Granulocytes and monocytes were defined as CD11b+CD16/32+NK1. BD Biosciences) and NK1. 5-fluorouracil.66% D-mannitol. 21 days and 28 days post-dosing. oxaliplatin (5 mg/kg). CD4 Pacific Orange (clone RM4–5. Irinotecan and vehicle were administered intraperitoneally once on day 0. were purchased from Taconics. Furthermore.5 (clone H97–597. 2. and the samples were stained with TCR-b PE-Cy5. Materials and methods 2. Total RNA from the aqueous phase was further purified using the RNeasy 96 Qiagen vacuum system following the ‘‘Clean-up” procedure. 72 h. the slow release topoisomerase II inibitor PLD. Chemotherapy-induced lymphocytopenia in mice PLD. Reagents Recombinant murine IL-21 produced by Novo Nordisk A/S was used throughout all experiments. To each tube 1 ml FACS lyzing solution (BD Biosciences) was added.232 K. CD16/32 FITC (clone 2. nonessential amino acids (RenCa only). eBioscience) according to the manufacturer’s recommendations. CD8+ T cells were isolated from 2 Â 107 splenocytes by positive selection using magnetic beads according to the manufacturer instruction (Miltenyi. 24 h. Caltag) and CD25 FITC (clone PC61.5. CA) using the RNA 6000 Pico LabChip kit (Agilent Technologies).16% L-histidine + 4. and the anti-metabolite 5-FU which is used in combination with leucovorin and either oxaliplatin or irinotecan.g. BD Biosciences). In two different mouse tumor models we have addressed whether IL-21 can be successfully combined with any of these chemotherapeutic compounds. 2. Palo Alto. irinotecan (150 mg/kg) or 5-FU (50 mg/kg on two consecutive days) as described above. Cell culture C57BL/6 derived B16 (F0) melanoma cells (American Type Culture Collection (ATCC). PLD (Schering-Plough). An additional cohort of mice (N = 8) was injected only with IL-21 or PBS on day 0 to serve as baseline for the mice injected with chemotherapy.e.5. CD4 PE and NK1. . NCI at Frederick. BD Biosciences). gastrointestinal. Wiltrout. and oxaliplatin were administered to C57BL/6 or Balb/c mice as indicated in the figure legends by intravenous injection 1 Abbreviations used: 5-FU.4.

IL-21 ‘‘early”. 200 µg/mouse c 140% 120% 100% Irinotecan. The absolute numbers of CD4+.001 vs vehicle on day 3. In the section below the results are presented separately for each drug. B cells and NK cells decreased to 40–50% of controls (p < 0. 21 and 28 by flow cytometry. Unless otherwise indicated chemotherapy was initiated when tumors were small (10–50 mm3) in order obtain maximal effect of IL-21. Injection of 5-FU was repeated on day 1. CD8+. B cells (defined as TCR-bÀCD19+) and NK cells (defined as TCR-bÀNK1. 3. only PLD and irinotecan) mice on day 0. Probe sequences for these assays were: granzyme B (GZMB) (CCAGGACAAAGGCAGGGGAGATCAT (assay Mm00442834_m1)). The data have been normalized to vehicle-treated mice. The absolute number of CD4+ T cells (defined as TCR-b+CD4+). Since mice with tumors exceeding 1000 mm3 had to be terminated according to our guidelines the last observation was carried forward for mice terminated due to tumor size exceeding 1000 mm3 before the analysis of mean tumor size was carried out.e. 3. Mice were allocated according to tumor size to obtain as similar as possible average tumor size in all groups. Mean growth curves were calculated until more than 20% of the mice in each group had exceeded maximum allowed tumor size (1000 mm3). Skak et al. equal variance Student’s t test was used to compare the mean tumor size between groups and to compare cell counts between mice treated with vehicle and test compound. and 18S rRNA (TGGAGGGCAAGTCTGGTGCCAGCAG.1. cytostatic. only a minor. cytostatic + IL-21 ‘‘early” and cytostatic + IL-21 ‘‘late”.064 vs vehicle) with full recovery on day 7. When tumors were visible the mice were allocated to 5 treatment groups: vehicle. 200 lg/mouse PLD (b). 50 mg/kg 5-FU % of vehicle C57Bl/6 100% 80% 60% 40% 20% 0% 180% 160% 80% 60% 40% n=7 0 7 14 Day 20% 21 28 0% 180% 160% 140% 120% 100% 80% 60% 40% n=7 0 7 14 Day 20% 21 28 0% 180% 160% 140% 120% 100% 80% 60% n=7 0 7 14 Day n=4 0 7 14 Day 21 28 21 28 % of vehicle 140% 120% 100% 80% 60% 40% 20% 0% Balb/c Legend: CD19 CD4 CD8 NK1. Pegylated liposomal doxorubicin (PLD) PLD is a pegylated liposomal formulation of doxorubicin used among others for the treatment of ovarian cancer. and expression levels for GZMB were normalized to 18S rRNA levels. 150 mg/kg irinotecan (c) or 50 mg/kg 5-FU (d) was injected intravenously (PLD) or intraperitoneally (irinotecan and 5-FU) in C57Bl/6 mice (upper panel) and Balb/c (lower panel. 2. Vehicle (isotonic NaCl) or 30 lg/mouse PLD (a). This size was chosen as cut-off value as many tumors had a tendency to ulcerate when they became larger. CD8+ T cells (defined as TCR-b+CD8+). Tumor growth was monitored by measuring the longest diameter and the perpendicular diameter with at digital calliper.1+) were measured at defined time points.01 and CD4: p = 0. 1. In C57Bl/6 mice a single dose of 200 lg/mouse (approximately 8 mg/kg) resulted in a decrease to 60–70% of controls in the circulating CD4+ and CD8+ T cells on day 3 (CD8: p < 0. We have therefore administered the chemotherapies only as monotherapy assuming that IL-21 would not substantially change counts when given in combination with chemotherapy.1. 1b). IL-21 administration up to 50 lg/mouse did not have any measurable effect on the above lymphocyte subsets at 24 h up to 7 days after administration (unpublished data). At 30 lg/mouse (approximately 1. NK1.7. Murine IL21 was administered subcutaneously on 5 consecutive days starting on the day of chemotherapy (‘‘early”) or 7 days after chemotherapy (‘‘late”). 3. Transient lymphopenia induced by PLD. Balb/c mice for RenCa cells and C57BL/6 mice for B16 cells. Tumor experiments RenCa renal cell carcinoma cells (2 Â 105 per mouse) or B16 melanoma cells (2 Â 105 per mouse) were injected subcutaneously in the right flank of syngenic mice.1. The exact scheduling of therapy is indicated in the figure legend for each experiment. .2 software (Applied Biosystems). Statistics A two-sided. (assay Hs999 99901_s1)). 7.K.1 n=3 0 7 14 Day 20% 21 28 0% n=3 0 7 14 Day 40% 20% 21 28 0% n=3 0 7 14 Day 21 28 Fig. 2. Chemotherapy-induced lymphocytopenia in mice The effect of cytostatics injection on the number of circulating blood lymphocytes was measured by flow cytometry on blood samples drawn from mice treated with a panel of cytostatics. 150 mg/kg d 250% 200% % of vehicle 150% 100% 50% 0% 5-FU. The tumor size was measured three times weekly. 7 and 14 [B cells] and day 1 and 3 [NK cells]) but returned to baseline after 2–3 weeks (Fig. which has most effect on small tumors [7].2 mg/kg). Tumor volume was calculated according to the following formula: Volume = (longest diameter) Â (perpendicular diameter)2/2.6. / Cytokine 48 (2009) 231–238 233 Primers and FAM-labeled-probes for murine granzyme B mRNA and 18S rRNA were ordered as Assays-on-Demand (Applied Biosystems). unpaired. 30 µg/mouse b 140% 120% 100% 80% 60% 40% PLD. The log-rank test was used to compare Kaplan–Meyer survival curves. Error bars are SEM. i.1+ and CD19+ lymphocytes were measured in the blood samples drawn pre-dose and day 1. 14. Tumor size and Kaplan–Meyer survival analysis of time to reach tumor size = 750 mm3 were used as endpoints. irinotecan and 5-FU. Results 3. Data were analyzed using ABI Prism SDS 2. non-significant decrease in lymphocyte counts was observed a 140% 120% PLD.

we conclude that IL-21 and PLD has an additive antitumor effect in both B16 and RenCa models. The effect of PLD was compared between C57Bl/6 and Balb/c mice.01 vs vehicle for all subsets) with full recovery around day 3–7. Due to the lack of the NK1. A small. Based on this study 5 mg/kg oxaliplatin was established as MTD in mice and chosen for combination studies with IL-21. a dose-titration was initially performed to establish a dose where PLD would lead to partial inhibition of tumor growth. 3. 3. 1d). NK1. 3. the possible additive effect of IL-21 and chemotherapy was tested in two different schedules.234 K. In this experiment both combination regimens reduced tumor growth com- a 200% 180% 160% 140% 120% 100% 80% 60% 40% 20% 0% 180% 160% 140% % of vehicle % of vehicle Oxaliplatin 120% 100% 80% % of vehicle 60% 40% 20% 0% 10 mg/kg 1 mg/kg 0 7 14 21 n=4 28 n =4 0 7 14 Day 21 28 120% 100% 80% 60% 40% 20% 0% Legend: CD19 CD4 CD8 NK1. Since these tumors are much more resistant to PLD therapy than RenCa tumors (data not shown) the mice were treated with 200 lg/mouse PLD.2. 3. The combination of oxaliplatin and IL-21 was performed in the RenCa tumor model.05 vs vehicle on day 3 for all subsets and day 1 for B cells only) and slower recovery.2. Antitumor effect of IL-21 in mice treated with chemotherapy Chemotherapy may interfere with immunotherapy due to the adverse effect of many chemotherapies on the hematopoietic system and immune function. The highest dose (200 lg/mouse) led to partial regression and slow recovery. 14. No difference between the strains was found at 200 lg/mouse. T cell numbers were decreased to 25–35% of controls on day 1 (day 1: p < 0. Error bars are SEM. a significant additive antitumor effect was obtained when IL-21 therapy was initiated one week after PLD injection (Fig. 3. We wanted to test whether IL-21 treatment would preserve its antitumor effect in mice treated with chemotherapy. 1a). Thus. non-significant reduction in tumor growth was observed when IL-21 therapy was initiated on the same day as PLD injection. Whereas IL-21 alone reduced the growth of both RenCa and B16 tumors. 3. The absolute numbers of CD4+. 2. 3. 4).05 vs vehicle for all subsets). Below the results are presented separately for each compound.3.3.05 vs vehicle) and 150% of controls for NK cells (non-significant) (Fig. This dose was selected for the combination studies. there was no additive antitumor effect of irinotecan and IL-21 in the B16 and RenCa models. No significant effect was observed at 1 mg/kg except an increase in NK cells day 7 (p < 0. Vehicle (isotonic NaCl) or oxaliplatin was injected intravenously in C57Bl/6 mice on day 0.2. irinotecan given in combination with IL-21 did not inhibit tumor growth compared to either compound alone. Our results above show that for all chemotherapies except oxaliplatin circulating T lymphocyte numbers were normalized 7 days after chemotherapy treatment.2.1 5 mg/kg 0 7 14 Day n=4 21 28 Fig. PLD Since this compound has a potent antitumor effect against RenCa tumors. non-significant effect on tumor growth (Fig.1 molecule in Balb/c mice NK cells were not measured in this mouse strain. 3c). 7. / Cytokine 48 (2009) 231–238 (Fig. Since timing of immunotherapy relative to the chemotherapy may be crucial for success. dose-dependent lymphopenia.2.1. at which time point the mice had to be terminated due to weight loss and toxicity induced by oxaliplatin. only irinotecan + IL-21 ‘late’ had a small. and treatment at small tumor size was more efficient than treatment at larger tumor size (Fig. as previous studies have shown that IL-21 has antitumor effect in both these syngeneic mouse tumor models [7]. We tested the effect of IL-21 therapy in combination with PLD and irinotecan in both RenCa and B16 models. 3b).1. A single injection of PLD reduced growth of RenCa tumors dosedependently. 5-FU At 50 mg/kg given on two consecutive days a small (27–46%) drop in all lymphocyte subsets was observed on day 3 (day 1 and 3: p < 0.4.01 and day 3: p < 0. full recovery (B cells and NK cells) or partial recovery (T cells) was observed on day 21 (Fig. p < 0.1+ and CD19+ lymphocytes were measured in the blood samples drawn pre-dose and day 1. Two combination studies were performed in the RenCa model and one study in the B16 model.1. 2a).001 vs vehicle). 21 and 28 by flow cytometry. 1a). In all experiments the mice received a single injection of 150 mg/kg irinotecan. CD8+.05 vs vehicle for all subsets). Oxaliplatin induces transient.1. Based on these results 30 lg/mouse of PLD was chosen in the following study to give partial tumor inhibition. Irinotecan After a single injection of 150 mg/kg irinotecan into C57Bl/6 mice.05 vs vehicle for B and NK cells). whereas the lower doses tested (20 and 50 lg/mouse) led to partial reduction in growth rate without any tumor regression. with rebound effect reaching 200% of controls on day 14 for B and T cells (p < 0. and additionally in combination with oxaliplatin and 5-FU in the RenCa model. The effect of irinotecan was more profound in Balb/c mice (Fig. 3. At 10 mg/kg a much more profound lymphopenia was observed. Irinotecan A pilot study showed that only administration of irinotecan at the MTD (150 mg/kg) resulted in a minor reduction in tumor growth (Supplementary Fig. The data have been normalized to vehicle-treated mice. lymphocyte counts decreased to 60% of controls on day 1 after dosing (p < 0. B cells and NK cells decreased to 6% of controls at day 7. where treatment with IL-21 and chemotherapy were initiated either on the same day (‘early’) or IL-21 therapy was initiated 7 days after chemotherapy (‘late’). Skak et al. Oxaliplatin At a dose of 5 mg/kg a decrease to 50–70% of controls was observed for all subsets on day 7 (day 3 and 7: p < 0. .2. Oxaliplatin A titration study was performed to establish the optimal dose of oxaliplatin in Balb/c mice (data not shown). 3a). This study showed a similar additive effect of IL-21 in the B16 model as in the RenCa model. To this end we used the subcutaneous RenCa renal cell carcinoma and B16 melanoma tumor models. 1c) leading to lower counts (28–48% of controls.001 vs vehicle for all subsets) with partial recovery on day 7 (p < 0. Compared to PLD as single therapy. A similar study was subsequently performed in the B16 model. The combination of IL-21 and PLD (30 lg/mouse) was tested in the RenCa tumor model. Thus. with the ‘late’ IL-21 treatment being superior to ‘early’ IL-21 treatment (Fig.

For technical reasons the group treated with IL-21 alone was not included in this experiment. (c) B16 cells were injected s. It should be noted that in this experiment variation was high and the group size was small (N = 7–10 mice).c. 50 mg/kg per injection (Supplementary Fig. 5-FU In the clinic 5-FU is normally administered as a bolus followed by 48 h infusion. whereas the difference in tumor volume was non-significant. IL-21 did not affect the number of circulating Treg cells (Fig.c.c. with the largest effect observed when IL-21 therapy was initiated one week after oxaliplatin injection (Fig. 3.c. Both oxaliplatin and 5-FU led to an initial reduction in monocytes which subsequently recovered beyond baseline. 7a) nor did it affect the numbers of CD4+ and CD8+ T cells in the blood (data not shown). A comparison between spleen and blood on day 7 showed that the relative effect of the drugs compared to vehicle was similar in spleen and blood (data not shown). (Fig. oxaliplatin treatment resulted in 3-fold increase in neutrophils on day 7 whereas 5-FU led to profound neutropenia on day 7 leading to subsequent recovery day 14 slightly above baseline. A minor. 7a). .4. Murine IL-21 (50 lg/injection) or PBS was administered s. In order to mimic this regimen we administered 5-FU as a once daily injection on two consecutive days. 6). daily for 5 days on the days shown. N = 5.4. (b) RenCa cells were injected s. Here. PLD was injected intravenously at the indicated doses on day 9 or 16.c.K. Skak et al. Tumors were measured thrice weekly and the volume was calculated.05 vs PLD only by Student’s t test. To investi- gate whether treatment with chemotherapeutics or IL-21 affect Treg numbers we injected these drugs in mice and subsequently monitored the circulating numbers of Treg cells over a 4 week period. 1b).3. on day 0. PLD led to 70–90% increase in granulocyte numbers from day 7 (non-significant) whereas IL-21 did not affect granulocyte numbers (Fig. IL-21 mediated upregulation of granzyme B mRNA in CD8+ T-cells To examine whether the chemotherapeutic compounds suppressed IL-21 mediated effects in a relevant immune-cell subset. / Cytokine 48 (2009) 231–238 1000 235 Tumor volume (mm3) a PLD 750 500 250 0 PLD Control 20 µg PLD d9 50 µg PLD d9 100 µg PLD d9 100 µg PLD d16 200 µg PLD d16 0 5 10 15 20 25 30 35 40 45 Days after tumor inoculation % mice with tumors < 750 mm3 1000 Tumor volume (mm3) b 100 80 60 40 20 0 0 20 40 60 80 750 500 PLD 250 0 Vehicle PLD + PBS Vehicle + mIL-21 d10-14 PLD + mIL-21 d10-14 PLD + mIL-21 d17-21 ** 0 10 20 30 40 50 Days after tumor inoculation Days after tumor inoculation Tumor volume (mm3) 1250 1000 750 500 250 0 0 c % mice with tumors < 750 mm3 1500 100 75 50 25 Vehicle PLD + PBS Vehicle + mIL-21 d4-8 PLD + mIL-21 d4-8 PLD + mIL-21 d11-15 PLD * 5 10 * * * 20 25 # 0 0 10 20 30 40 50 15 Days after tumor inoculation Days after tumor inoculation Fig. on day 0. 5FU + IL-21 ‘late’ therapy significantly increased ‘survival’ time compared to 5-FU alone. PLD and 5-FU combined with IL21 could be due to a decrease in regulatory T cells (Tregs). Murine IL-21 (50 lg/injection) or PBS was administered s. 7c). N = 11. This dose was used in the following combination study in the RenCa model. A dosetitration of 5-FU in the RenCa model showed a small antitumor effect at the highest dose tested. (a) RenCa cells were injected s. #p < 0. whereas the charts to the right show Kaplan–Meyer survival analysis of mice with tumors <750 mm3. non-significant decrease in CD4+CD25+Foxp3+ Treg cells was observed around day 7 after injection of the chemotherapies. 7b). The charts to the left show mean tumor size. In the 5FU + IL-21 ‘late’ group a reduction in tumor size up to 75% compared to 5-FU alone was observed (Fig. 3. 3. consistent with a general decrease in CD4+ T cells. on day 0. PLD (200 lg/mouse) or vehicle was injected intravenously on day 4. In the Kaplan–Meyer survival analysis of time to reach tumor volume = 750 mm3.2. PLD led to an approximately 3-fold increase in monocyte numbers from day 7 whereas IL-21 did not affect monocyte numbers (Fig. Error bars are SEM. Thus. Effect of chemotherapeutics and IL-21 on regulatory T cells The additive effect of oxaliplatin.05 vs PLD by Log-rank test. 3. Additive antitumor effect of PLD and IL-21 in the RenCa model. *p < 0. pared to oxaliplatin alone. N = 10. daily for 5 days on the days shown. In the same experiment we also monitored circulating granulocytes and monocytes. PLD (30 lg/mouse) or vehicle was injected intravenously on day 10. we conclude that oxaliplatin and IL-21 has additive antitumor effect in the RenCa model. 5).

01 vs oxaliplatin alone by Student’s t test. When comparing the GZMB mRNA levels in the IL-21 dosed groups. Mice were dosed with 5-FU. Generally. but so far it is only in a few indications that these agents can cure cancer. / Cytokine 48 (2009) 231–238 Tumor volume (mm3) 600 500 400 300 200 100 0 0 RenCa tumors Irinotecan Vehicle Irinotecan + PBS Vehicle + mIL-21 d11-15 Irinotecan + mIL-21 d11-15 Irinotecan + mIL-21 d15-21 5 10 15 20 25 Days after tumor inoculation 30 and clearly upregulated after 4 h in all of the IL-21 dosed groups (on average $8-fold upregulation). oxaliplatin. 800 Tumor volume (mm3) % of mice withtumors < 750 mm3 100 80 60 40 20 0 600 400 200 0 Vehicle 5-FU + PBS 5-FU+ mIL-21 d 11-15 5-FU+ mIL-21 d 18-22 5-FU # 0 10 20 30 40 0 10 20 30 40 50 60 70 80 Days after tumor inoculation Days after tumor inoculation Fig. Error bars are SEM. daily for 5 days as indicated. irinotecan. 8). . we analyzed the mRNA expression of the cytotoxic effector molecule granzyme B (GZMB) in MACS-sorted CD8+ T cells from spleens. The antitumor activity of IL-21 has generally been asVehicle Oxaliplatin + PBS Vehicle + mIL-21 d8-12 Oxaliplatin + mIL-21 d8-12 Oxaliplatin + mIL-21 d15-19 1400 Tumor volume (mm3) 1200 1000 800 600 400 200 0 0 B16 tumors Irinotecan Vehicle Irinotecan + PBS Vehicle + mIL-21 d3-6 Irinotecan + mIL-21 d3-6+11-14 Irinotecan + mIL-21 d13-17 5 10 15 20 Fig. The charts show the mean tumor size.c. daily for 5 days as indicated. N = 9.236 700 K. 5. No additive antitumor effect of irinotecan and IL-21. #p < 0. Murine IL-21 (50 lg/injection) or PBS was administered s. daily as indicated. RenCa cells were injected s. The left chart shows mean tumor size. 3. Irinotecan (150 mg/kg) or vehicle was injected intravenously on day 3. Oxaliplatin (5 mg/kg) or vehicle was injected intravenously on day 8. or PLD on day 0.05 and **p < 0.c. RenCa cells were injected s. and the chemotherapeutics dosed groups. on day 0.c. 4.c. Discussion Chemotherapy has a long history in the treatment of cancer. Immunotherapy is another approach that has proven successful in some clinical trials.05 vs 5-FU alone by Log-rank test. on day 0. Skak et al. The right chart shows Kaplan–Meyer survival analysis of mice with tumors <750 mm3. Error bars are SEM.18].c. N = 7–10. 6. on day 0. i. In this study we demonstrate an additive antitumor effect in vivo of IL-21 in combination with chemotherapeutic agents with different mechanisms of action. Combining immunotherapy with chemotherapy has usually been considered unfeasible due to the known suppressive effects of many chemotherapies on the bone marrow. although. These cell lines were chosen since they have both proven to be responsive to IL-21 therapy in vivo [7].c. a growing body of evidence is emerging that these modalities may complement rather than antagonize each other [15. (a) RenCa cells were injected s. In the PLD dosed group a trend towards increasing responses to IL-21 was observed at day 7 and 14 after compound injection. anti-metabolites (5-FU) and platinum analogs (oxaliplatin) provided that IL-21 therapy is delayed relative to chemotherapy. N = 12. 5-FU (50 mg/kg) or vehicle was injected intraperitoneally on day 11 and day 12. (b) B16 cells were injected s.e. Additive antitumor effect of oxaliplatin and IL-21.c. there were generally no significant differences between the control group (receiving no chemotherapy). Error bars are SEM. IL-21 dosing initiated 7 days after chemotherapy showed improved antitumor efficacy compared to IL-21 therapy initiated simultaneously with chemotherapy. The only two groups which were found to be marginally suppressed was the irinotecan dosed group at day 3 and the 5-FU dosed group at day 1 (p < 0. *p < 0.05 with no correction for multiple testing). 4. Murine IL-21 (50 lg/injection) or PBS was administered s. Murine IL-21 (50 lg/injection) or PBS was administered s. topoisomerase II inhibiting drugs (PLD). N = 10–12. and IL-21 or vehicle was injected at day 1. Irinotecan (150 mg/kg) or vehicle was injected intraperitoneally on day 11. 800 % mice with tumors < 750 mm 3 100 75 50 25 0 Tumor volume (mm 3) 600 400 Oxaliplatin 200 0 * * 0 10 ** * ** ** 20 30 40 0 10 20 30 40 50 60 70 Days after tumor inoculation Days after tumor inoculation Fig. The GZMB mRNA levels were very low in the PBS injected groups. The effect of IL-21 dosing was analyzed 4 h after injection of IL-21 (Fig. The right chart shows Kaplan–Meyer survival analysis of mice with tumors <750 mm3. The left chart shows mean tumor size. The data shown are representative of two independent experiments. on day 0. 7 or 14. Additive antitumor effect of 5-FU and IL-21. Murine IL-21 (50 lg/ injection) or PBS was administered s. but is still only used in certain narrow indications. To investigate the possible antitumor effect of combining IL-21 therapy with chemotherapy we used the subcutaneous RenCa renal cell carcinoma and B16 melanoma tumor models. daily for 5 days on the days shown.c.

suggesting that 5-FU could have a beneficial effect on lymphocytes. GZMB mRNA was quantified by qRT-PCR in CD8+ cells from mice (N = 4) 4 h after s. 7. Considering the modest decrease in lymphocyte numbers observed after chemotherapy it is not likely that the lymphopenia per se will confound the effect of IL-21 therapy. granulocytes (b) and monocytes (c) were measured in the blood samples drawn pre-dose and on day 1. which can be enhanced by IL-21 therapy.05. *p < 0. **p < 0. we have demonstrated that GZMB mRNA was upregulated in CD8+ T cells and CD56+ NK cells from metastatic melanoma patients administered with recombinant human IL-21 [12. Vehicle (isotonic NaCl). homeostatic proliferation may produce memory-like T cells.19]. 50 µg/mouse n=4 0 7 14 21 28 100% 80% 60% 40% 20% 0% b % of vehicle 350% 300% 250% 200% 150% 100% 50% 0% Granulocytes *** 450% 400% 350% 300% 250% 200% 150% 100% 50% c Monocytes * ** * * *** *** 0 7 14 Day 21 28 0% ** 0 7 * 14 Day 21 28 Fig. This explanation is supported by our differential lymphocyte counts.K. irinotecan. nevertheless irinotecan inhibited the antitumor effect of IL-21 therapy initiated 7 days after irinotecan injection. whereas at a later stage the immune system may recover. we did not observe a significant change in the number of circulating Tregs following chemotherapy or IL-21 injection. All GZMB levels were normalized to 18S. 5-FU or IL-21 was injected in C57Bl/6 on day 0. 21 and 28 by flow cytometry. GZMB mRNA (18S normalized) 5 4 3 2 1 0 Granzyme B mRNA in CD8+ cells PBS IL21 Days after injection of chemo (compound) Fig. Thus. but the fact that the antitumor effect of IL-21 was lost in mice treated with irinotecan suggests that not only the number of circulating lymphocytes is important for the antitumor effect of IL-21. administration with either PBS or murine IL-21 (50 lg/injection). Previously. Skak et al. doxorubicin. 7 days post injection. 50 mg/kg x 2 Oxaliplatin. as demonstrated in a study where IL-21 was shown to enhance homeostatic proliferation leading to rapid T cell turnover and autoimmunity [20]. the ability of IL-21 to promote homeostatic proliferation may contribute to the antitumor activity of IL-21. The effect of IL-21 dosing on GZMB mRNA levels was analyzed at day 1. 30 µg/mouse 5-FU. and dying tumor cells may facilitate presentation of tumor antigens and activation of phagocytes and DCs leading to augmented antitumor T cell responses. The strong IL-21 mediated upregulations of GZMB mRNA in CD8+ T cells observed in all treatment groups suggests that the ability of the CD8+ T-lymphocytes to respond to IL-21 was intact after administration of chemotherapy. which may be important considering that the primary antitumor effect of IL-21 is through activation of CD8+ T cells. As with the other chemotherapies. Differences in the immunogenicity of dying tumor cells induced by the various chemotherapeutics could be another important factor [22]. T cells generally appeared to recover faster from the treatment than B and NK cells. with the exception of oxaliplatin given at 10 mg/kg. so the antitumor effect of the compounds is not likely to be caused by a contraction of Tregs. The data have been normalized to vehicletreated mice. 5-FU had opposite effect on monocytes and granulocytes numbers compared to PLD and oxaliplatin. suggesting a negative impact of irinotecan on the target cells. tumor cell death induced by doxorubicin as well as oxaliplatin has also been shown to boost tumor immune responses via stimulation of TLR-4 [24]. Error bars are SEM. The absolute numbers of CD4+CD25+Foxp3+ Tregs (a). In combination with IL-2. 7. especially if IL-21 is given after the nadir.11. which showed varying degrees of lymphopenia after injection of the chemotherapeutics but generally returned to normal or slightly above normal levels approx. In contrast to these results. leading to enhanced T cell activity. T cell numbers were almost back to normal 7 days after irinotecan injection. Here. Establishing similar kinetics of chemotherapy-induced lymphopenia in humans may be important to clinically translate our results. and hence used this biologically relevant marker in the present study to examine whether the chemotherapeutic compounds suppressed IL-21-induced activation of CD8+ T cells. the active component of PLD. our observed differences in antitumor activity of the various combinations of IL-21 and chemotherapy must be due to other parameters. and IL-21 did not have any effect at all. 1 (Oxaliplatin) 3 (Oxaliplatin) 7 (Oxaliplatin) 14 (Oxaliplatin) 1 (Irinotecan) 3 (Irinotecan) 7 (Irinotecan) 14 (Irinotecan) 1 (5-FU) 3 (5-FU) 7 (5-FU) 14 (5-FU) No Compound 1 (PLD) 3 (PLD) 7 (PLD) 14 (PLD) . has been thoroughly studied and showed superior induction of immunogenic cell death when compared to a panel of distinct chemotherapies [23]. oxaliplatin. Effect of chemotherapy on granulocytes and monocytes but not Tregs. Thus.001 vs vehicle by Student’s t test. 3. 5 mg/kg IL-21. the optimal time point for combination therapy.01 and ***p < 0. which was discontinued due to associated toxicity. Therefore. oxaliplatin. 3. there might still be differences in the specific immunomodulatory effects of the chemotherapeutics used here. it is possible that in the recovery phase following the modest lymphopenia. No chemotherapeutic impairment of IL-21 mediated granzyme B (GZMB) mRNA upregulation in CD8+ cells. combining IL-21 with the topoisomerase I inhibitor irinotecan produced no additive effect or even an antagonizing effect of IL-21 even with postponed initiation of IL-21. / Cytokine 48 (2009) 231–238 237 a 160% 140% 120% % of vehicle Treg Legend: PLD. 14. 8. A possible explanation for our findings is the fact that chemotherapy induces short term immune suppression which may be harmful to the effect of IL-21. PLD. leading to a longer lasting unresponsiveness to IL-21 stimulation. Treatment with 5-FU even caused B and T cell numbers to increase following an initial drop. A group receiving no chemotherapeutic compounds was included as a reference.c. we also addressed whether the immune cells may be functionally impaired after exposure to certain chemotherapeutics.21]. Obviously. which have to be determined. This process may be reinforced by IL-21 therapy. Rather. It is possible that the initial decline in lymphocytes is reducing the responsiveness to IL-21. Our results suggest that the antitumor effect of chemotherapy and IL-21 is not related to their effect on monocytes and granulocytes. cribed to costimulation and expansion of antigen-specific T cells as well as costimulation of NK cell activity [8. 7. Thus on day 7. Also. and mean values with SEM error bars are shown. and 14 after injection of either 5-FU. or PLD. Furthermore.

Massobrio M. these results suggest that other indications may also be amenable to IL21-mediated immunotherapy and/or chemo-immunotherapy. Hjorth-Hansen H. Smyth MJ. Lundsgaard D. Roden RBS. Appendix A. IL-15. Eppolito C. Ozaki K.2009. Li Q.117:265–77.66:5419–26. Skrumsager BK. Cutting edge: the common gamma-chain is an indispensable subunit of the IL-21 receptor complex. Berleth E. Our data also highlight the importance of selecting the proper time point for commencing IL-21 therapy after chemotherapy. Smyth MJ. Tesniere A. and IL-21.313:1960–4. [5] Brenne A. IL-21 limits NK cell responses and promotes antigen-specific T cell activation: a mediator of the transition from innate to adaptive immunity. Redman BG. et al. Ruijter R. N Engl J Med 2006. Ghiringhelli F. Feng C. Spolski R. Clin Cancer Res 2002. A better way for a cancer cell to die. Dillon SR. Hayakawa Y. IL-21 induces in vivo immune activation of NK cells and CD8(+) T cells in patients with metastatic melanoma and renal cell carcinoma. [7] Søndergaard H. Apetoh L. J Exp Med 2005. J Clin Oncol 2008. Phase I study of recombinant interleukin-21 in patients with metastatic melanoma and renal cell carcinoma. A phase I study of the natural killer T-cell ligand alpha-galactosylceramide (KRN7000) in patients with solid tumors. Conejo-Garcia JR. Sareneva T. [18] Zitvogel L. supporting clinical trials of this concept. Ghiringhelli F. Millward M. Criollo A. Ohuchi A. Cebon J.07. Cancer Immunol Immunother 2008. [25] Ewens A.13:1050–9.408:57–63. Sundan A. [13] Thompson JA. and furthermore this ability to induce immunogenic cell death may to some extent counteract the adverse effect of chemotherapy on immune cells and bone marrow. [26] Coukos G. Koelsch K.173: 900–9. [20] King C. Thus. Conflict of interest K. [22] Lake RA.63:9016–22. [19] Kasaian MT. J Immunol 2007. Nutt SL. Shiiba K. Matikainen S. Agarwala SS. J Immunol 2004. et al.172:2048–58. doxorubicin also resulted in immune mediated cures of metastatic murine breast cancer [25]. Tao J. Wollman R. Nagura H. Hughes SD. Bonifaz L. N Engl J Med 2003.198:267–79. et al. Cancer Res 2001. Cancer Immunol Immunother 2007.5:1193–210. Acknowledgements We thank Ann-Christin Løff. et al. H. Robinson BW.S.26:57–79. Bhatia S. Julkunen I. Nat Med 2007. Ortiz C. Synergy of IL-21 and IL-15 in regulating CD8+ T cell expansion and function. at doi:10. [29] Galon J. and location of immune cells within human colorectal tumors predict clinical outcome. Annu Rev Immunol 2008.13:3630–6. Thus. J Immunol 2004. Spolski R.99:3756–62. Barlow JW.56:1417–28. Pellicci DG. IL-21 induces the functional maturation of murine NK cells. Nat Rev Immunol 2008. whereas IL-21 primarily is expected to be used in indications with known immunotherapeutic success. two-arm. Mlecnik B. Nishi N. Curti BD. Cancer Res 2006. Sprecher C. Apetoh L.8:3702–9. we show that IL-21 can be successfully combined with certain chemotherapeutic agents without loosing its immune stimulating and antitumor activity. Clin Cancer Res 2007. Interleukin-21: basic biology and implications for cancer and autoimmunity. Saito K. Shimizu K. Skak K. Ken Heding. Lowe LD. Kovanen PE. Immunity 2002. Interleukin21 is a growth and survival factor for human myeloma cells. [10] Wang G. et al. Supplementary data Supplementary data associated with this article can be found. Semra Esiyok. In vivo antitumor activity of interleukin 21 mediated by natural killer cells. Leonard WJ. Katsaros D. Deng BJ. Science 2006. Saigenji K. Doxorubicin plus interleukin-2 chemoimmunotherapy against breast cancer in mice. Berzins SP. Nat Med 2007.5:397–405.201:139–48. Nicholaou T. Sarvetnick N. Perfettini JL. [30] Schumacher K. et al. [27] Zhang L. and profoundly affected the natural course and clinical outcome of these diseases [26–30]. Waage A. Clin Cancer Res 2009.cyto. Type. et al. Borset M. Brady B. Immunotherapy for gynaecological malignancies. Kirilovsky A. [16] Fujii S. Kumaki S. Cancer Res 1998. Skrumsager BK. Tschoi M. Immunological aspects of cancer chemotherapy.16:559–69.1016/j. IL-21 enhances and sustains CD8+ T cell responses to achieve durable tumor immunity: comparative evaluation of IL-2.58:3491–4. IL-21 up-regulates the expression of genes associated with innate immunity and Th1 response. Kyparissoudis K. [2] Coquet JM. IL21 is produced by NKT cells and modulates NKT cell activation and cytokine production. et al. Prognostic significance of activated CD8+ T cell infiltrations within esophageal carcinomas. Weber JS. Ishii N. Cebon J. Kristjansen PE. Regnani G. CD8+ T cells infiltrated within cancer cell nests as a prognostic factor in human colorectal cancer. Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Kroemer G. Shrikant PA. Moller NPH. Costes A. Oh S. Lagorce-Pages C. phase I trial of recombinant human interleukin-21 in patients with metastatic melanoma.238 K. et al. In summary. Whitters MJ. a notion which should be considered in future clinical trials. and K. Clegg CH.57:1439–49. Hinrichs CS. Roefzaad C. A phase 1 trial combining recombinant human IL-21 with liposomal doxorubicin in ovarian cancer patients is currently ongoing (clinicaltrials. Clinical and biological efficacy of recombinant human interleukin-21 in patients with stage IV malignant melanoma without prior treatment: a phase IIa trial. [8] Zeng R. are employees of Novo Nordisk A/S who sponsored this study and who has been involved in the development of IL-21 as oncology drug. Skrumsager BK. [28] Naito Y. Conejo-Garcia JR.039. Gross JA. [14] Davis ID. Finkelstein SE. [4] Strengell M.F. Toll-like receptor 4-dependent contribution of the immune system to anticancer chemotherapy and radiotherapy.. [15] Lake RA. et al. Obeid M. in the online version. Lene Normann Nielsen. Luo L. Tsuchiya S. / Cytokine 48 (2009) 231–238 [6] Spolski R. the dissimilar effect of different chemotherapies on the immunogenicity of dying tumor cells may provide an explanation to the different ability to provide additive antitumor effects with IL-21. Okuyama C. [24] Apetoh L. Gimotty PA. Nat Rev Cancer 2005. et al. The chemotherapeutics combined with IL-21 in this study are used as monotherapy or in different combinations in the treatment of various human solid tumors such as ovarian cancer and gastrointestinal malignancies. Smith C. [21] Frederiksen KS. Foster D. J Exp Med 2003. melanoma and RCC.348:203–13.gov identifier NCT00523380). Freeman JA. Nature 2000. et al. Haensch W. [12] Davis ID. Homeostatic expansion of T cells during immune insufficiency generates autoimmunity.S. Immunotherapy and chemotherapy – a practical partnership. Steinman RM. Schlag PM. Galsgaard ED. Blood 2002. et al. Calreticulin exposure dictates the immunogenicity of cancer cell death. Frederiksen KS. . An open-label.26:2034–9. Skak et al. Holm TL. Cancer Res 2003. [3] Asao H. Nelson A. Intratumoral T cells. Fimia GM.178:2827–34. Immune surveillance mechanisms have also been shown to be active in selective patients with ovarian.61:3932–6. Jussif JM.167:1–5. Ro TB.354:2503–4. Activation of natural killer T cells by alpha-galactosylceramide rapidly induces the full maturation of dendritic cells in vivo and thereby acts as an adjuvant for combined CD4 and CD8 T cell immunity to a coadministered protein. Hafeez BB.S. Expert Opin Biol Ther 2005. Interleukin 21 therapy increases the density of tumor infiltrating CD8+ T cells and inhibits the growth of syngeneic tumors. Ghiringhelli F. Alderfer J. Hammond A. et al. et al.169:3600–5. J Immunol 2001. Cell 2004. et al.15:2123–9. Carter LL. Wu TC. Punt CJ. and Heidi Winther for technical assistance with the experiments. [11] Moroz A. Kefford RF. Foster D. van der Most RG. Tesniere A. i. Besra G. et al. Ando Y. Lou Y. density. Peters M. [17] Giaccone G. Ilic A. References [1] Parrish-Novak J. et al. J Immunol 2002.8:59–73. and survival in epithelial ovarian cancer. colorectal and esophageal cancer. recurrence. [23] Obeid M.e. Thygesen P.13:54–61. Sanchez-Cabo F. [9] Brady J.

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->