ELSEVIER

Biochimica et Biophysica Acta 1244 (1995) 259-268

Biochi~ic~a et Biophysica A~ta

Synthesis and characterisation of fluorescent oligonucleotides. Effect of internal labelling on protein recognition
Per Hagmar a, Michael Bailey a, Glenn Tong b, Jim Haralambidis b, William H. Sawyer a,*, Barrie E. Davidson a
Russell Grimwade School of Biochemisto', UniversiO, of Melbourne, Parkville, Victoria 3052, Australia b Howard Florey Institute of Experimental Physiology and Medicine, Universi~' of Melbourne, Parkville, Victoria 3052, Australia
Received 22 September 1994; revised 12 December 1994; accepted 10 January 1995

Abstract Fluorescently labelled 42 base pair DNA duplexes were synthesised to examine the interaction between the TyrR repressor protein of
Escherichia coli and its DNA recognition sequence. An Fmoc-protected 5-(3-aminoprop-1-yn-1-yl)-2'-deoxyuridinephosphoramidite was

synthesised and incorporated into oligonucleotides using standard /3-cyanoethyl phosphoramidite chemistry. Oligonucleotides containing the 3-aminopropynyl nucleotide at internal positions were reacted with fluorescein isothiocyanate to generate fluorescent DNA molecules useful for characterising interactions between DNA and proteins. Short DNA duplexes were investigated with respect to their melting temperatures and their ability to bind TyrR. Oligonucleotides containing a TyrR binding site were labelled in the central region of the recognition sequence or near the 5' edge of the recognition sequence. Fluorescein-labelled oligonucleotides could hybridise to form duplex DNA, and gel retardation experiments showed that the presence of the dye did not alter the binding affinity for the TyrR protein significantly. Fluorescence anisotropy measurements were used to examine the binding equilibrium in low and high salt buffers. A dissociation constant of 200-500 nM was obtained for the interaction of the TyrR dimer with a 42 bp duplex containing a centrally located 22 bp TyrR binding site.
Keywords: DNA-protein interaction; Fluorescence oligonucleotide; Repressor

1. Introduction Proteins which recognize and bind to specific base sequences on D N A control the processes of replication, transcription, repair and gene regulation (for reviews, see [1-3]). Studies of the thermodynamics of these interactions contribute to our understanding of the balance of free and bound species that is likely to exist within cells. Of the several methods that have been devised to monitor D N A protein interactions, gel retardation and filtration assays have gained wide acceptance, but there is concern that separation of bound from free species inherent in these procedures may perturb the equilibrium. In this respect, spectroscopic assays offer the advantage that the concentration of free and bound species can be determined in solution. The high sensitivity of fluorescence detection allows assays to be carried out at nanomolar concentra-

* Corresponding author. E-maih edu.au. Fax: +61 3 3477730.

Sawyer@biochemistry.unimelb.

tions and therefore in the vicinity of the dissociation constants of these equilibria. Complex formation may be followed by (i) a change in the intrinsic fluorescence of the protein, (ii) a change in the extrinsic fluorescence of a labelled protein or oligonucleotide, or (iii) a change in fluorescence anisotropy due to a decrease in the rotational diffusion of the complex [4]. A c o m m o n labelling procedure uses standard phosphoramidite chemistry [5,6] to conjugate a primary amine linked via a spacer group to the 5'-phosphate group of an oligonucleotide. A fluorescent dye with an amine-reactive group such as a sulfonyl chloride or an isothiocyanate may then be conjugated to the amine under basic conditions. These aminolinkers are commercially available in lengths of 2 to 12 carbon atoms and labelling at the 3' end is also possible (Applied Biosystems, Foster City, CA; Clontech, Palo Alto, CA). However, if an environment-sensitive fluorophore is to be employed, it must be positioned close to the footprint for the interaction so that the probe environment is affected by protein binding. In these cases, use of 3' or 5' labelling requires truncation of the oligonucleo-

0304-4165/95/$09.50 1995 Elsevier Science B.V. All rights reserved SSD10304-4165(95)00015-1

260

P. Hagmar et al. / Biochimica et Biophysica Acta 1244 (1995) 259 268

tide sequence on at least one side of the recognition sequence to achieve appropriate juxtaposition of the probe and the bound protein. Such truncation may be inappropriate, since footprinting and homology analyses show that the binding of some proteins is sensitive to the length of flanking regions on either side of a specific site. For example, the eukaryotic transcriptional activator GCN4 strongly interacts with at least 18 bp of DNA, a site much larger than the 9 bp consensus sequence identified by homology with naturally occurring binding sites [7]. Similarly, the Escherichia coli CAP protein requires a 28-30 bp DNA molecule to obtain full binding strength [8], as compared to the 16 bp strongly conserved consensus sequence [9]. Insufficient length of the oligonucleotide may indeed explain the low association constants found for some transcription regulators [10]. 5'-Labelling of oligonucleotides also prevents routine 32P-labelling at this end. Labelling within the base sequence avoids this problem and provides opportunities for 'fluorescence footprinting'. A number of labelling strategies are available (for review, see Refs. [4] and [11]). Labelling of the intemucleotide phosphorous by synthesising a deoxynucleoside 3'-phosphorothioamidite has been described by Caruthers et al. [12]. It is also possible to replace a nucleoside with a 3-carbon bridge carrying an aminobutyl side arm to which a fluorescent probe may be conjugated (Clontech, Palo Alto, CA). The 3-carbon bridge is designed to conserve the interphosphate distance but has the disadvantage that a nucleoside is replaced by a foreign bridging group. Of particular interest is labelling at bases within the sequence. Gibson and Benkovic described the synthesis of a phosphoramidite derivative with a phthalimide-protected propylamine on the C5 of deoxyuridine [13]. However, the phthalimide protecting group can be difficult to remove completely under alkaline conditions. Use of the Boc protecting group [14] sometimes results in partial oligonucleotide degradation during trifluoroacetic acid deprotection with consequent low yields of the full length product. Fmoc protection of an alkynylamino deoxyuridine derivative [15] allows easier removal of the group in ammonia solutions at 55 C and will be used in the current study. The length of any spacer on an aminouridine derivative or a terminal linker becomes important when fluorescence anisotropy is used to monitor the DNA-protein association. Local motion of the dye at its point of attachment is promoted by long spacers and can be a major determinant of the steady-state anisotropy. We now report the synthesis of an aminouridine phosphoramidite possessing a short alkynylamino side arm. Incorporation of this nucleoside into an oligonucleotide using standard solid phase phosphoramidite methodology enables efficient synthesis of oligonucleotides which can react with a variety of aminereactive probes. We illustrate the use of the oligonucleotide conjugates as probes for DNA-protein interaction by introducing a fluorescent label at specific residues in the recognition sequence for a DNA binding protein, namely,

the TyrR repressor protein of E. coli, and show that steady-state fluorescence anisotropy may be used to follow the formation of the DNA-repressor complex. TyrR regulates the expression of eight transcriptional units essential for aromatic amino acid biosynthesis and transport [16,17]. The activity of TyrR is modulated by the binding of ATP and the aromatic amino acids. At concentrations above 100 nM and in the absence of tyrosine, TyrR exists predominantly as a dimer in solution [18]. The consensus sequence for TyrR binding sites in DNA, so called TyrR boxes, is TGTAAAN6TTTACA. Boxes that have a strong homology with the consensus sequence bind TyrR in the absence of cofactors and are referred to as strong boxes in contrast to weak boxes that have weak homology to the consensus sequence and require the presence of ATP and tyrosine for binding of the protein. We have synthesised 42 bp oligonucleotides containing the strong TyrR box found in the regulatory region of the O'rR gene with the modified deoxyuridine in either of two positions in the N 6 nonspecific spacer region. Reaction of these oligonucleotides with fluorescein isothiocyanate yielded fluorescent oligonucleotides that were able to hybridise to their unmodified complementary oligonucleotide. Analysis indicated that the resulting double-stranded molecules bound TyrR to the same extent as the unmodified TyrR box.

2. Materials and methods

2.1. Materials
3-Aminopropyne, 5-iodo-2'-deoxyuridine, tetra(triphenylphosphine)-palladium(0) and 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite were purchased from Aldrich. 3-tert-Butyloxycarbonylaminopropyne was from Sigma. N-((Fluoren-9-ylmethoxycarbonyl)oxy)succinimo ide and dimethylformamide (distilled and stored over 3 A molecular sieves) were obtained from Auspep, Melbourne. Standard phosphoramidites were from Applied Biosystems. Dichloromethane and methanol were dried over 3 A sieves. Analytical thin-layer chromatography (TLC) was performed on Merck SG-60 pre-coated plastic plates (particle size 5 - 4 0 /zm) and rapid filtration chromatography [19] was performed using thin-layer chromatography grade silica gel (Merck SG-60, particle size 5 - 4 0 /xm). Fluorescein-5-isothiocyanate (FITC) (isomer I) was purchased from Molecular Probes.

2.2. Experimental procedures Spectroscopy Absorbances were measured with a CARY 5 spectrophotometer fitted with thermal accessories and interfaced to a computer for acquisition and analysis of experimental data. Absorbance versus temperature melting curves were

P. Hagmar et al. / Biochimica et Biophysica Acta 1244 (1995) 259-268 measured at 260 nm at a heating rate of l C / m i n . The temperature was measured with a thermistor probe inserted in buffer in a cuvette adjacent to the sample in the thermostated cell block. Fluorescence was measured with a Perkin-Elmer LS-5 luminescence spectrometer. The fluorescence anisotropy was determined in the usual way, allowance being made for the grating correction factor [201. Gel retardation assay Double-stranded 42mers in the experimental buffer were mixed with aliquots of a TyrR stock solution, buffer and glycerol to give the relevant constituent concentrations in 10% glycerol. After 20 min incubation, 10 /zl samples were loaded on a 7.5% polyacrylamide gel and electrophoresed at 15 mA constant current in 90 mM Trisborate, 2 mM EDTA buffer (pH 8.3) (1 x TBE). Gels were stained with ethidium bromide and placed on a UV-transilluminator for photography or scanning with a CCD camera. In the latter case, BIO-PROFIL software (Vilber Lourmat, Marne la Vall~e, France) was used to quantitate the images. For full gel retardation titrations, the integrated intensities for the free oligonucleotides were fitted to a single-site binding model using the non-linear regression option of SigmaPlot 5.0 (Jandel Scientific, San Rafael, CA). NMR Spectra were recorded at 399.9 MHz (~H) and at 99.98 MHz (13C) on a JEOL GX400 instrument. The internal reference was residual solvent in d6-DMSO. ~3C-NMR assignments were confirmed by DEPT experiments with a 135 ~H selection pulse. The 3~p spectrum was obtained on a Varian 300 spectrometer at 121.42 MHz using 85% H 3 P O 4 / H 2 0 as external reference. The numbering system for compounds 3 and 4 is shown in Scheme 1. Mass spectrometry Samples for FAB-MS measurements were suspended in a polyethylene glycol(600)/thioglycerol/glycerol/DMSO matrix. In the case of the nucleoside phosphoramidite, it was necessary to include 3-nitrobenzylalcohol and triethylamine in the matrix to obtain a strong molecular ion. The ionisation gas was Xe. Ion-spray mass spectrometry measurements were performed on a Perkin Elmer PE SCIEX L C / M S , in both the positive and negative ionisation modes. The samples were prepared according to the method of Reddy and Iden [21]. 2.3. Synthesis of 5-propynylamino nucleoside phosphoramidite 5-( 3-( Fluoren-9-ylmethoxycarbonyl)amino )prop- l-yn-1yl)-5'-O-( 9-phenylxanthen- 9- yl)-2'-deoxyuridine 3 The reaction conditions used were identical to those previously described [15] but modifications were made to

261

the work-up procedure. The reaction, performed on a 7.9 mmol scale, was complete after 2 h as judged by TLC using ethyl acetate as the solvent. AGIX8 (HCO 3) ion exchange resin (3-fold excess) was added with 50% MeOH/dichloromethane (10 m l / m m o l of nucleoside). After 0.5 h the resin was removed by filtration and the solvent removed in vacuo. Purification was by rapid filtration chromatography. The column was pre-washed with 90% dichloromethane/triethylamine (1 column volume) followed by dichloromethane (2 column volumes) before application of the sample. The crude residue was then applied to a silica gel column (10 g of TLC silica gel per m m o l of nucleoside); the initial eluant was dichloromethane, followed by 50% ethyl acetate/dichloromethane, and then finally ethyl acetate. The desired nucleoside 3 was obtained as a fawn solid with typical yields between 35-60%. 1H-NMR (DMSO-d6): ~ 2.25 (m, 2H, 2 H2'), 2.96 (dd, 1H, H5', J = 10.3, 4.4 Hz), 3.08 (dd, 1H, H5", J = 10.4, 2.7 Hz); 3.29 (s, 2H, H9), 3.73 (t, 1H, N9H, J = 5.3 Hz), 3.90 (m, IH, H4'), 4.14 (m, 1H, H3'), 4.20 (t, IH, Fmoc H9 J = 6.8 Hz), 4.28 (d, 2H, Fmoc CH2, J = 7.0 Hz), 5.29 (d, 1H, 3'OH, J = 4 . 4 Hz), 7.10-7.50 (m, 17H, Fmoc + Px H), 7.69 (d, 2H, Fmoc HI and H8, J = 7.3 Hz), 7.89 (d, 2H, Fmoc H4 + H5, J = 7.3 Hz), 7.98 (s, IH, H6). 13C-NMR (DMSO-d6): 6 30.4 (C9), 40.3 (C2'), 46.6 (Fmoc C9), 63.7 (C5'), 65.7 (Fmoc CHz), 70.8 (C3'), 74.2 (C8), 75.5 (Px C9), 85.3 (CI'), 85.9 (C4'), 89.7 (C7), 98.2 (C5), 116.3 (Px CH), 120.1 (Fmoc C3 and C6), 122.3, 123.9, 124.0 (Px CH), 125.2 (Fmoc C2 and C7), 125.8, 126.7 (Px CH), 127.1, 127.6 (Fmoc C1 and C8), 128.0, 129.0, 129.1, 129.7 (Px CH), 140.7 (Fmoc C4a and C4b), 143.1 (C6), 143.7 (Fmoc C8a and C9a), 148.3 (C2), 149.3 (Px CI'), 150.53, 150.67 (Px C4a and Cl0a), 155.8 (Fmoc CO), 161.6 (HR-FABMS: exact mass found 760.2659 (M + H), calculated for ( C 4 6 H 3 7 N 3 0 8) qH 760.2659. R F 0.21 (ethyl acetate). Synthesis of nucleoside phosphoramidite 4 The nucleoside phosphoramidite 4 was synthesised on a 2.2 mmol scale by the method of Sinha [6] except that a 3-fold excess of phosphitylation reagent and dry dichloromethane were used. The reaction was monitored by TLC (99% ethyl acetate/triethylamine) and was complete after 80 min. The crude residue was purified by rapid filtration chromatography (20 g silica gel for 2.2 mmol scale reaction). The column was pre-washed with ethyl acetate/dichloromethane/triethylamine (45:45:10, 1 X column volume) followed by ethyl acetate/dichloromethane (50:50, 2 X column volume). The sample was loaded on the column in ethyl acetate/dichloromethane/triethylamine (50:49:1). The column was then eluted with ethyl acetate/dichloromethane/triethylamine of the following compositions: 50:49:1, 75:24:1, and 98:1:1. The fractions containing the desired product were pooled, the solvent was removed in vacuo, and the result-

262

P. Hagmar et al. / Biochimica et Biophysica Acta 1244 (1995) 259 268

ing thick syrup was redissolved in toluene (4 ml) and precipitated from rapidly stirring hexane (30 ml) at room temperature. The fine colourless precipitate was collected by gravity filtration, air-dried and dried in vacuo - (16 h) (1.14 g, 55%). TLC (99% ethyl acetate/triethylamine) showed two close spots (R F 0.37 and 0.44) corresponding to the two diastereoisomers of the product. Partial ~H-NMR (CD2C12) mixture of diastereoisomers: 6 3.05, 3.07 (dd, 1H, H5', J = 7.6, 2.9 Hz), 4.55 (m, 1H, H3'), 6.26, 6.28 (dd, IH, HI', J = 6.0, 1.4 Hz), 7.00-7.80 (m, 21H, Fmoc and Px aromatic (H), 8.31, 8.34 (s, 1H, H6). 31P-NMR (CD2C12): 6 148.8 and 149.1. FABMS: m / z 959.4. HR-FABMS: exact mass found 960.3729 (M + H), calculated form (C55H54N,509P) + H 960.3737.

Synthesis of oligonucleotides
Two 42 bp DNA fragments (42A/42B and N S I / N S 2 , see Fig. 1) with sequences taken from the 5' regulatory region of the ~rR gene were synthesised. The sequences correspond to the following regions of ~,rR: 42A/42B, bp 218-259; NS1/NS2, bp 282-323 [22]. One of the oligonucleotides, 42A, was also synthesised with the modified deoxyuridine replacing the thymidine at position 7, 19 or 22 from the 5'-end ((7)42A, (19)42A and (22)42A). The 42 bp oligonucleotides were chosen because 10 bp flanking regions on either side of the 22 bp consensus sequence were found to increase the binding affinity for TyrR. Oligonucleotides were synthesised on an Applied Biosysterns Model 381A synthesizer, using standard /3-cyanoethyl phosphoramidite chemistry. The modified phosphoramidite was used in place of the normal thymidine phosphoramidite at the specified positions in the 42A sequence. For this coupling step, the modified phosphoramidite solution was prepared at twice the concentration (0.2 M in anhydrous argon-degassed acetonitrile) of the normal phosphoramidite solutions, and the coupling time was extended to 15 rain (normally 30 s). The oligonucleotides were cleaved off the support with 25% ammonium hydroxide as trityl-on derivatives, and subsequently deprotected in concentrated ammonium hydroxide (35%) at 55C for 18 h. The oligonucleotides were then dried in a vacuum centrifuge. A drop of triethylamine was added every 30 rain during drying to keep the solution basic in order to prevent detritylation. The yields for 1 /xmol syntheses of oligoTyrR BOX
5'3'TTTCCGTCTT AAAGGCAGAA 5'-

nucleotides containing the modified uridine base were about 50% as judged from the DNA base absorption at 260 nm. This is comparable to the yields obtained using standard phosphoramidites. The oligonucleotides were characterised by PAGE, reverse-phase HPLC and UV spectrophotometry. For the PAGE analysis, 5 - 1 0 /zg of each oligonucleotide was loaded on a 1 mm thick 20% acrylamide gel and electrophoresed at 1.70 W / g e l constant power in 1 TBE for 17 h. Gels were stained with 0.02% methylene blue solution for 30 min, destained for a few hours and photographed. Reverse-phase HPLC was carried out on a C-18 column (flow rate 1 m l / m i n ) with a gradient from 10% acetonitrile in 100 mM aqueous triethylammonium acetate (pH 7.0) (solvent A) to 100% acetonitrile (solvent B) at 1% increase in acetonitrile/min following a 4 min isocratic step of solvent A (Gradient 1). Molar absorptivities for the oligonucleotide 42mers calculated from the sequences [23] were as follows: 42A, E260 = 4.41 105 M l cm -1", 42B, ~260=5.01 " 105 M I cm 1; NS1, e260 = 4.44. 105 M i cm 1;NS2, e260=4.44 .105 M i cm-1. No correction due to the presence of the modified deoxyuridine instead of thymidine was made due to the small change in overall absorptivity this substitution causes.

FITC-labelling
The 42mer containing the modified uridine base (40 nmol) was dried in a vacuum centrifuge. The sample was then dissolved in 50% acetic acid in water (200 /~1) and incubated at room temperature for 20 min to remove the dimethoxytrityl group. The sample was dried again and residual dimethoxytrityl alcohol was removed by ethanol precipitation. The dried oligonucleotide was redissolved in 200 mM sodium carbonate buffer (40 /~1) (pH 10) to give a concentration of about 1 mM. A 250 mM solution of FITC in dimethylformamide (8 /xl) was added to give a 50-fold molar excess of dye to oligonucleotide. After 4 h incubation at room temperature in the dark, additional FITC (250 mM, 8 /.d) was added and the reaction allowed to proceed for a further 18 h. Unreacted FITC was removed by gel filtration through Sephadex G-25 in 100 mM triethylammonium acetate. The eluate was collected and characterised by absorption at 260 nm and 495 nm. The fluorescein-labelled 42mer was purified by reverse-phase

TGTGTCAATG I A T T* GT *T G A C A G A ACACAGTTACTAACAACTGTCT NNTGTAAANNNNNNTTTACANN

AACCTTCCTG TTGGAAGGAC ,- 3'

- 3' - 5'

42A 42B

Consensus

5'3 '-

TCATATTAATTGTTCTTTTTTCAGGTGAAGGTTCCCATGCGT
AGTATAATTAACAAGAAAAAAGTCCACTTCCAAGGGTACGCA

-3'
- 5 '

NSI
NS2

Fig. 1. Sequences of synthesised oligonucleotides. The asterisks indicate thymidine nucleotides that were replaced by the modified deoxyuridine (one replacement in each oligonucleotide) to provide the fluorescently labelled oligonucleotides.

P. Hagmar et al, / Biochimica et Biophysica Acta 1244 (1995) 259-268

263

C l8 HPLC using the following elution sequence (Gradient 2): (1) 4 rain isocratic elution with solvent A, (2) solvent B increased by l % / m i n for 8 min, (3) solvent B increased by 0.5%/rain for 24 min (the region where the 42mer elutes), (4) solvent B increased to 100% in 4 rain followed by (5) a 10 min isocratic step at 100% solvent B. The flow rate was 1 m l / m i n . The fluorescein-labelled 42mer was then dried in a vacuum centrifuge. The labelling ratio determined spectrophotometrically was in the range 0.91.1.

[24]. Equimolar amounts of the two strands were mixed and incubated at 90C for 5 min and then cooled at a rate of 0.5% C / m i n . The purity of the double stranded oligonucleotide was monitored by native PAGE and by DNA melting analysis.

TyrR preparation
TyrR was prepared as previously described [25] and transferred to the experimental buffer by Centricon centrifugation. To determine the molar absorptivity of TyrR [26], a sample was denatured in 6 M guanidine hydrochloride for 2 h at 0 C, and absorbances measured for three native and denatured protein dilutions. The molar absorptivity of TyrR m o n o m e r s (EZS0) was found to be 34470 M t c m - ~.

Annealing of DNA
Complementary 42mers were dissolved in distilled water and precipitated with ethanol to remove possible fluorescent contaminants from the HPLC solvents and any remaining triethylammonium acetate salt. The dry pellets were dissolved in the experimental buffer (100 mM KC1, 25 mM KH 2POa-K 2HPO4, 1 mM EDTA, 0.1 mM DTT, 0.02% ( w / v ) NaN 3 (pH 7.5)) and their concentrations determined by absorption spectroscopy. No correction was made for the absorption of fluorescein at 260 nm since the correction would be less than 3% of the DNA absorption
0 HN I

3. Results

3.1. Synthesis of the modified phosphoramidite

We have previously reported the preparation of the Y-protected C5-alkynyl nucleoside 3 (Scheme. 1) [15]. In

I
2 N H 4

.,~

~-~

a ,. ~

~-._

"rF " ~ . ? ~
, o

o. 92',, J ~

o.
6 7

(b)

N_______f
Scheme 1. (a) ( P h 3 P ) 4 P d / C u I / E t 3 N / D M F . (b) 2-Cyanethy-NN-diisprpychrphsphramidite/diisprpyethyamine/dichlrmethane.

264

P. Hagmar et al. / Biochimica et Biophysica Acta 1244 (I995) 259-268

that study, coelution of the starting material PxldU 1 with the product 3 under a variety of TLC conditions made monitoring of the coupling reaction and the subsequent purification difficult. We have now found that 100% ethyl acetate is an excellent TLC solvent that resolves the starting material from the product. Its use allows the reaction to be monitored and the product to be effectively purified. Palladium(0)-catalysed coupling of the Fmoc-alkyne 2 with 5'-pixyl-IdU 1 gave the desired alkynyl nucleoside 3 in yields ranging between 35 and 60%. Unlike the analogous reactions between 5'-pixyl-IdU 1 and propargylamines protected with acid-labile Boc and Pixyl groups, a major fluorescent side-product with a significantly lower R F was formed during the work-up. Initial analysis of this side-product by FAB mass spectrometry was inconclusive, with only low molecular fragment ions detected. Subsequent analysis by ion-spray mass spectrometry gave pseudomolecular ions of 538 (M + H) and 536 (M-H), using positive and negative ion sources, respectively. By analogy with the work of Robins and Barr [27], the fluorescent side-product was assigned the structure of 5. However, efficient purification procedures allow the desired nucleoside 3 to be isolated in high purity. Phosphitylation at the 3'-hydroxyl of 3 gave the desired modified phosphoramidite 4. The ~H- and ~3C-NMR spectra of nucleoside Y-phosphoramidites are complex due to the existence of the Rp and S p diastereoisomers and IH-31p and 13C-31p coupling. We therefore characterised the target amidite 4 by a combination of 3~p_ and I H-NMR spectroscopy, and high-resolution FAB mass spectrometry. The 3~p-NMR spectrum showed two resonances at 8 148.8 and 149.1, indicative of two phosphoramidite diastereomers. In contrast to an earlier report [28], we find FAB mass spectrometry in the positive ionisation mode to be an excellent method for characterising nucleoside phosphoramidites. By employing a matrix which consists of a 'cocktail' of polyethylene glycol (M r 600), thioglycerol, glycerol, DMSO, triethylamine, and 3-nitrobenzyl alcohol, it is possible to obtain strong molecular ions for the modified phosphoramidite 4 and also a series of 5' nucleoside phosphoramidites (data to be published elsewhere). The ability to obtain a high resolution pseudomolecular ion (M + H) of nucleoside phosphoramidites provides an additional way of characterising these complex and labile molecules. The pseudo-molecular ion of 960.3729 is consistent with the molecular formula of 4.

<:
C~

.<
Or?

O,2 C',2

<~ 0,2

U'~ ~_~

......

.....

..........

........

f g

Fig. 2. Electrophoresis (7 M urea, 20% polyacrylamide gel) of the 42 bp oligonucleotide with the modified deoxyuridine at position 22 from the Y-end ((22)42A): (a) crude trityl-ON reaction mixture, (b) HPLC-purified trityl-OFF sample, (c) crude reaction mixture after FITC conjugation, (d) HPLC-purified fluorescein-labelled 42mer, (e) unmodified trityl-OFF 42A. Oligonucleotide modified at position 19 from the 5'~end ((19)42A): (f) crude trityl-ON reaction mixture, (g) crude reaction mixture after FITC conjugation, (h) HPLC-purified fluorescein-labelled 42mer.

3.2. Synthesis and labelling of oligonucleosides

The modified and normal oligonucleotides used in this study were synthesised using standard solid-phase /3cyanoethylphosphoramidite methodology [5,6]. It was thought desirable to lengthen the standard coupling time of 30 s to 15 min and also to increase the concentration of the solution from the usual 0.1 M to 0.2 M to ensure maximum coupling efficiency of the modified phosphoramidite.

The coupling efficiency of the modified phosphoramidite, as assessed by trityl assays before and after its addition, was comparable to that of normal phosphoramidites (between 98 to 100%). Analysis of the crude 5'-trityl-ON oligonucleotides by 20% denaturing PAGE (Fig. 2, lanes a and f) indicated a high degree of purity with no detectable amounts of failure sequences. Reverse-phase HPLC analysis of one of these crude modified oligonucleotides (oligonucleotide 42A with the modified uridine in position 22 from the Y-end) showed two major peaks with retention times of 17.3 min and 24.8 min (Fig. 3A). The peak at 24.8 min was collected, detritylated in the usual manner and then re-analysed by HPLC (Fig. 3B) and PAGE (Fig. 2, lane b). Both analyses indicated the presence of only one species. It is noteworthy that not only is there the expected significant difference in retention times between trityl-ON and trityl-OFF oligonucleotides on reverse-phase HPLC, but there is also a noticeable reduction in the electrophoretic mobility of trityl-ON oligonucleotides relative to trityl-OFF samples in PAGE analysis. Consequently, purification by either method is straightforward. In our case, the purity of the crude oligonucleotides was sufficient for use in labelling studies without prior purification. Yields of the DNA-fluorescein conjugates always exceeded 60%. Fig. 2 (lanes c and g) shows the electrophoretic patterns of the crude reaction mixtures. The dye-labelled oligonucleotide has reduced electrophoretic mobility compared with the unlabelled species and could be purified easily from a gel. Purification by reverse-phase

P. Hagmar et al. / Biochimica et Biophysica Acta 1244 (1995) 259-268

265

O2 ~ 02

O2 .,~ 0,2
o2 02 09

O2

o2 U]

o~
B
0 r.D O,2
o

-~

I>~ o2

o2

--+ --+

-+

-+

r~ ,.Q o 5o ,.o

ab
I I

c d e fg

hij

10 Elution time

20

30

{minutes)

Fig. 4. The effect of TyrR on DNA 42mers in PAGE. Labelled and unlabelled oligonucleotides (2.5 pmol) in the absence ( - ) and presence (+) of 5-fold molar excess TyrR: unmodified 42A/42B (a,b); fluorescein-labelled in position 19 (c,d) and position 22 (e,f); unlabelled nonspecific control sequence NSI/NS2 (g,h). 25 pmol TyrR dimer (i), 14 pmol single-stranded 42A (j), and 42B (k).

Fig. 3. HPLC chromatograms of (22)42A. (A) Crude trityl-On reaction

mixture (Gradient 1). (B) Re-chromatographed detritylated 42mer (Gradient 1). (C) Crude reaction mixture after FITC conjugation (Gradient 2). (D) HPLC-purified fluorescein-labelled 42mer (Gradient 1). See text for details of gradients.

HPLC was preferred since larger amounts of material could be processed at any one time. A chromatogram of a purification of crude labelled 42mer is shown in Fig. 3C. Fluorescein-labelled 42mer eluted at 22 min (the last major peak) and was shown to be pure by P A G E (Fig. 2, lanes d and h) and HPLC (Fig. 3D).

4 2 A / 4 2 B and two fluorescein-labelled duplex samples in the experimental buffer are shown in Fig. 5. As analysed by the two-state midpoint method of Breslauer et al. [29], unmodified 4 2 A / 4 2 B has a melting point of 65.9 C. For the fluorescent oligonucleotides labelled in the 19 and 22 position ( F ( 1 9 ) 4 2 A / 4 2 B and F ( 2 2 ) 4 2 A / 4 2 B ) , the melting temperatures are 63.2C and 63.8 C, respectively. The slight destabilisation of the complex may result from the introduction of the negatively charged dye into a negatively charged polyelectrolyte. For comparison, the reI I I I I [

3.3. Annealing and thermal analysis

Annealed oligonucleotides, whether containing the modified deoxyuridine or not, migrate as single bands of the same mobility on native polyacrylamide gels (Fig. 4). The small amounts of single-stranded material (Fig. 4, lanes a,d) are due to a slight excess of the unlabelled strand added during sample preparation. This excess ensures that no single-strand labelled material is present which would otherwise interfere with fluorescence anisotropy measurements. The steady-state fluorescence anisotropy of fluorescein-labelled single-stranded 42mer (excitation at 495 rim, slit width 2.5 rim, and emission at 520 nm, slit width 20 nm) is 0.09. In the double-stranded complex, the anisotropy increases slightly to 0.10. D N A melting curves for the unmodified 42mer

1.o
~0.9o 0.8
-

J'
I I I I I I

1
70 8 0 (C)

80

4 0 50 60 Temperature

Fig. 5. Melting curves of 42mers. Normalised absorbance (260 nm) as a function of temperature for the unlabelled 4 2 A / 4 2 B (broken line) and fluorescein-labelled F(19)42A/42B and F(22)42A/42B (solid lines).

266

P. Hagmar et al. / Biochimica et Biophysica Acta 1244 (1995) 259-268

placement of one G-C base pair for an A-T base pair (and thus the removal of one hydrogen bond) in a 42met is expected to give a lC reduction in melting temperature [30,31]. The increase in absorbance at 260 nm of the unmodified 4 2 A / 4 2 B from room temperature to the completion of chain melting is 30%. The corresponding value for F(19)42A/42B and F(22)42A/42N is 29% indicating that the dye label does not cause any significant decrease in the base pairing.

A
0 0

42A/42B

F(19)42A/42B

----~ ','--~ t"g. O0 <O 0

C~ ",,'--~ -,"~ ['X2 CO LO

3.4. Gel retardation assay

The fragments 4 2 A / 4 2 B and N S l / N S 2 have identical sequences to segments of the 5' regulatory region of the E. coli gene tyrR (Fig. 1). 4 2 A / 4 2 B contains a strong TyrR box, whereas N S I / N S 2 does not. We have performed DNase I footprinting experiments with large DNA fragments containing the entire 5' tyrR regulatory region, including the segments in 4 2 A / 4 2 B and N S I / N S 2 (P. Maroudas and B.E. Davidson, unpublished data). These experiments showed that the TyrR box equivalent to that in 4 2 A / 4 2 B bound TyrR in the presence or absence of tyrosine, whereas N S I / N S 2 DNA did not bind TyrR under any conditions. We therefore carried out gel retardation assays to determine if the TyrR box was still able to bind TyrR when present in the smaller fragment (42A/42B) and the effect, if any, of the fluorescein moiety on the TyrR-binding properties. The electrophoretic mobility of 4 2 A / 4 2 B is markedly decreased by the presence of TyrR (Fig. 4, lanes a and b), indicating binding of the protein to the fragment. The presence of TyrR does not affect the mobility of NS 1/NS2 (Fig. 4, lanes g and h). We conclude that non-specific binding of TyrR to DNA does not occur under the conditions of the experiment and that retardation of 42A/42B is due to sequence-specific binding of TyrR to the TyrR box. The mobilities of derivatives labelled with fluorescein at positions 19 and 22 also decreased in the presence of TyrR (Fig. 4, lanes c-f). The extent of the decrease is the same as that seen with unlabelled 42A/42B. This result shows that the fluorescein group at positions 19 and 22 does not prevent the binding of TyrR to the TyrR box in these fragments. The assays shown in Fig. 4 were carried out with a 5-fold molar excess of TyrR dimer over DNA fragment. Since this excess could have obscured small differences in the protein binding properties of the fragments, we carried out gel retardation assays at a series of increasing concentrations of TyrR and a fixed concentration of either unlabelled or fluorescein-labelled 4 2 A / 4 2 B (Fig. 6A, results for F(22)42A/42B not shown). Densitometric analysis revealed no significant differences between the resulting gel patterns, indicating identical affinities of the duplexes for TyrR within the error limits of the experiment (Fig. 6B). Assuming a stoichiometry of one protein dimer bound per molecule of DNA fragment, curve fitting procedures

20

15

10

~
V ........ V
I I

2 [TyrR]t

3 (ffM)

Fig. 6. The effect of increasing TyrR concentration on the mobility of DNA 42reefs in PAGE. A, lanes contained 1 /,tM of unlabelled (42A/42B) and fluorescein-labelled (F(I9)42A/42B) duplexes. The numbers above the lanes indicate the TyrR dimer/42mer ratio. B, scanned intensities of the free DNA band for 42A/42B (circles) and F(19)42A/42B (triangles). The solid and broken lines are the fitted curves representing dissociation constants of 200 nM and 500 riM, respectively. gave a dissociation constant of 200-500 nM for the interaction of TyrR with the three DNA fragments under the conditions used.

3.5. Steady-state fluorescence anisotropy titrations

The binding of TyrR to the labelled 42mers reported here was not accompanied by any change in the intrinsic fluorescence of the TyrR or in the fluorescein fluorescence of the conjugates. Consequently, fluorescence anisotropy becomes the most appropriate fluorescence method for following complex formation. Fig. 7 shows the fluorescence anisotropy titration of a 42met labelled at position 7 (F(7)42A/42B) with TyrR under low salt (buffer plus 18 mM KCI) and high salt (buffer plus I00 mM KCI) conditions; values of K d were 335 nM and 380 nM, respectively. The specificity of TyrR binding is demonstrated by the fact that no anisotropy increase is observed when N S I / N S 2 is used in the titration (Fig. 7). Although the binding energy is only marginally greater under the low

P. Hagmar et al. / Biochimica et Biophysica Acta 1244 (1995) 259-268

267

~>~ 0.14 03

0"12 ~

0 0

u) Q)
L.

0.10
la..

0 0 0
I

O
I

0 0
I

0.0

0.5

1.0

1.5

[TyrR] #M
Fig. 7. Fluorescence anisotropy titrations of fluorescein-labelled duplexes (F(7)42A/42B) (510 nM) with TyrR in a buffer containing 4.5 mM K H 2 P O a / K 2 H P Q , 0.1 mM ATP, 5 mM MgC12, pH 7.5, under low salt (buffer+ 18 mM KCI) ( ~ ) or high salt (buffer+ 100 mM KCI) ( n ) conditions. The abscissa represents the total TyrR added. Excitation and emission wavelengths were 495 nm and 520 nm, respectively. Anisotropies were measured 5 rain after the addition of each aliquot of TyrR and are the average of 3 readings. Solid lines are the nonlinear leas! squares fit for the low salt (K d = 335 nM) and high salt (K d = 380 nM) titrations. Hollow circles are for the titration of NS 1/NS2.

salt condition, anisotropies in the presence and absence of TyrR were consistently higher in the low salt buffer.

4. Discussion

The experiments described in this paper show that oligonucleotides can be internally labelled by fluorescent probes at the position of a thymine base in the sequence. The primary amino group used for the conjugation is attached to C5 of the deoxyuridine via a very short and rigid alkyne linkage. Modelling studies show that the alkyne linker will project out of the major groove of double-stranded DNA. In contrast to the phthalimide protection group which can be difficult to remove [13], the Fmoc group is readily cleaved under normal oligonucleotide deprotection conditions. Being based on a standard /3-cyanoethyl phosphoramidite, this derivative can be incorporated easily into an oligonucleotide using established automated techniques. Several hundred micrograms to a few milligrams of the modified oligonucleotide can be synthesised as required. The palladium(0)-catalysed coupling of the Fmoc-protected propynylamine 2 and the 5'-pixyl-5-iododeoxyuridine 1 was hampered by the formation of significant amounts of a furanopyrimidinone sideproduct as a result of cyclisation with concomitant loss of the Fmoc group. This side reaction is not observed in the coupling of box- or pixyl-protected propargylamines to 5'-pixyl-5-iododeoxyuridine under similar conditions and

is hence most probably due to the removal of the base-labile amino protecting group. However, moderate to good yields of the desired alkynyl nucleoside are still obtainable due to efficient chromatographic work-up. Oligonucleotides with specific deoxythymidines replaced by the modified deoxyuridine were synthesised in high yields and were found to label with high efficiency. These oligonucleotides can be purified by polyacrylamide electrophoresis or by trityl-ON reverse-phase HPLC. Alternatively, purification may be initiated after conjugation of a probe, resulting in total purified yields of about 20%. The 5'-end of the oligonucleotide is still available for subsequent 32p_labelling if required. The labelled oligonucleotides hybridise with complementary strands to form double-stranded DNA with melting characteristics similar to those of unlabelled DNA. Gel retardation assays indicated that the binding affinity of 42A/42B for TyrR was not affected by the presence of the fluorescein label ( K d = 200-500 nM). Given the uncertainty in determining the amount of oligonucleotides by the gel scanning procedure and the possible distortion of the equilibrium by separation of the free and complexed duplexes on the gel, we chose not to pursue the determination of the binding constant to greater accuracy by gel retardation analyses. Several three-dimensional structures of DNA-protein complexes show two recognition half-sites in the DNA separated by one turn of the DNA helix [32-36]. D N A protein interactions occur predominantly on one side of the helical barrel, with the major groove of the spacer DNA between the half-sites being turned away from the protein. A probe pointing out from the major groove of the spacer region should thus interfere minimally with protein binding. The fluorescein conjugates of 42A were labelled at positions 19 and 22 in the N 6 region of the TyrR box. The absence of any effect of this bulky group on the TyrR binding affinity indicates that TyrR does not interact with the major groove in this region of the TyrR box. The analysis of the binding properties of other derivatives of 42A in which the label is attached to different positions will help to delineate these interactions more precisely. The fluorescein-DNA conjugates reported here have steady-state anisotropies (0,10-0.13) considerably lower than the limiting anisotropy for fluorescein (0.39) [37]. A 42 bp duplex acting as a rigid rod would have diffusion coefficients for rotation about its long and short axis of DII = 1.3. 106 s ~ and D , = 1.6. 107 S - ] , and therefore correlation times of about 770 ns and 62 ns, respectively. Considering the short life-time of fluorescein ( 2 - 4 ns), the low anisotropies suggest that even with a relatively short linker such as the aminopropynyl group the probe undergoes substantial local motion. Indeed, time-resolved fluorescence studies to be reported elsewhere show that 4 7 52% of the anisotropy decay is due to fast motion of the probe with a correlation time of 16-340 ps (Bailey et al., unpublished data). It is possible that the higher anisotropies observed at low ionic strength are due to a more restricted

268

P. Hagmar et al. /Biochimica et Biophysica Acta 1244 (1995) 259-268

motion o f the probe at its point o f attachment to the D N A brought about by electrostatic repulsion b e t w e e n the anionic fluorescein moiety and the charged phosphate backbone o f the D N A . For the F ( 7 ) 4 2 A / 4 2 B conjugate, binding of T y r R caused little change in the fast correlation time indicating that the fast m o t i o n of the probe at its point of attachment was p r e s e r v e d in the D N A - T y r R c o m p l e x . Internally f l u o r o p h o r e - l a b e l l e d oligonucleotides should prove particularly useful for studying the binding of repressor proteins to multiple operators on D N A . For e x a m ple, four of the eight transcriptional units regulated by T y r R contain a strong and a w e a k T y r R box in close p r o x i m i t y in the s e q u e n c e [18]. By conjugating the dye to the different sites, the binding affinities may be studied independently. An investigation o f the D N A binding properties of T y r R along these lines is currently under way in our laboratory.

Acknowledgements
W e w o u l d like to thank Mr. Peter M a r o u d a s (Russell G r i m w a d e School o f B i o c h e m i s t r y ) for p r o v i d i n g the T y r R protein, Dr. A l u n Jones (3D Centre, U n i v e r s i t y o f Q u e e n s land) for p e r f o r m i n g the ion-spray mass spectrometry measurements and Mr. Stewart T h o m p s o n (Victorian C o l l e g e o f Pharmacy, M o n a s h University) w h o kindly p r o v i d e d the F A B mass spectra. This research was supported by Australian Research Council grants to W . H . S . and B.E.D. and by the C o m m o n w e a l t h A I D S Research Grants C o m m i t t e e of Australia by a project grant and a postgraduate scholarship to G.T. The H o w a r d F l o r e y Institute is supported by a b l o c k grant f r o m the National Health and Medical Research Council o f Australia. P.H. is the recipient of a S w e d i s h Natural S c i e n c e R e s e a r c h Fellowship. M.B. is the recipient of an Australian Postgraduate Research scholarship.

References
[l] Steitz, T.A. (1990) Q. Rev. Biophys. 23, 205-280. [2] Harrison, S.C. and Aggarwal, A.K. (1990) Annu. Rev. Biochem. 59, 933-969. [3] Pabo, C.O. and Sauer, R.S. (1992) Annu. Rev. Biochem. 61, 10531095. [4] Jameson, D.J. and Sawyer, W.H. (1994) Methods Enzymol., in press. [5] Beaucage, S.L. and Caruthers, M.H. (1981) Tetrahedron Letl. 22, 1859-1862.

[6] Sinha, N.D., Biernat, J. and Koster, H. (1983) Tetrahedron Lett. 24, 5843-5846. [7] Gartenberg, M.R., Ampe, C., Steitz, T.A. and Crothers, D.M. (1990) Proc. Natl. Acad. Sci. USA 87, 6034-6038. [8] Liu-Johnson, H.-N., Gartenberg, M.R. and Crothers, D.M. (1986) Cell 47, 995-1005. [9] Berg, O.G. and Von Hippel, P.H. (1988) J. Mol. Biol. 200, 709-723. [10] H~ird, T., Dahhnan, K., Carlstedt-Duke, J. Gustafsson, J.-A. and Rigler, R. (1990) Biochemistry 29, 5358 5364. [11] Ruth, J.L. (1991) in Oligonucleotides and Analogues. A Practical Approach (Eckstein, F., ed.), pp. 255-282, IRL Press, Oxford. [12] Caruthers, M.H., Beaton, G., Wu, J.V. and Wiesler, W. (1992) Methods Enzymol. 211, 3-20. [13] Gibson, K.J. and Benkovic, S.J. (1987) Nucleic Acids Res. 15, 6455-6467. [14] Haralambidis, J., Chai, M. and Tregear, G.W. (1987) Nucleic Acids Res. 15, 4857-4876. [15] Tong, G., Lawlor, J.M., Tregear, G.W. and Haralambidis, J. (1993) J. Org. Chem. 58, 2223-2231. [16] Pittard, A.J, and Davidson, B.E. (1991) Mol. Microbiol. 5, 15851592. [17] Yang, J., Ganesan, S., Sarsero, J. and Pittard, A.J. (1993) J. Bacteviol. 175. 1767-1776. [I 8] Wilson, T.J., Maroudas, P., Howlett, G.J. and Davidson, B.E. (1994) J. Mol. Biol. 238, 309-318. [19] Morin, C. (1988) J. Chem. Educ. 65, 903. [20] Lakowicz, J.R. (1983) Principles of Fluorescence Spectroscopy, Plenum Press, New York. [21] Reddy, D.M. and Iden, C.R. (1993) Nucleos. Nucleot. 12, 815-826. [22] Cornish, E.D., Argyropoulos, V.P., Pittard, J. and Davidson, B.D. (1986) J. Biol. Chem. 261,403-410. [23] Applied Biosystems Inc. (I989) User Bulletin No. 1, Foster City, CA. [24] Kubista, M.. SjiSback, R. and Albinsson, B. (1993) Anal. Chem. 65, 994-998. [25] Argaet, V.. Wilson, T.J. and Davidson, B.E. (1994) J. Biol. Chem. 269, 5171 5178. [26] Gill, S.C. and Von Hippel, P.H. (1989) Anal. Biochem. 182, 319326. [27] Robins, M.J. and Barr, P.J. (1983) J. Org. Chem. 48, 1854-1862. [28] Toren, P.C., Betsch, D.F., Weith, H.L. and Coull, J.M. (1986) Anal. Biochem. 152, 291-294. [29] Breslauer, K.J.. Sturtevant, J.M. and Tinocco, I., Jr., (1975) J. Mol. Biol. 99, 549-565. [30] Marmur, J. and Doty, P. (1962) J. Mol. Biol. 5, 109 118. [31] Schildkraut, C. and Lifson, S. (1965) Biopolymers 3, 195-208. [32] Jordan, S.R. and Pabo, C.O. (1988) Science 242, 893-899. [33] Aggarwal, A.K., Rodgers, D.W., Drottar, M., Ptashne, M. and Harrison, S.C. (1988) Science 242, 899-907. [34] Schultz, S.C., Shields. G.C. and Steitz, T.A. (1991) Science 253, 1001-1007. [35] Otwinowski, Z.. Schevitz, R.W., Zhang, R.-G., Lawson, C.L., Joachimiak, A., Marmorstein, R.Q., Luisi, B.F. and Sigler, P.B. (1988) Nature 335, 321-329. [36] Luisi, B.F., Xu, W.X., Otwinowski, Z., Freedman, L.P.. Yamamoto, K.R. and Sigler, P.B. (1991) Nature 352, 497-505. [37] Abbott, A.J.. Amler, E. and Ball, W.J., Jr. (1991) Biochemistry 30, 1692-1701.