Diego Azuga

Title: Determining the presence of three endosymbiotic bacteria in aphids

Abstract: B. aphidicola is a primary endosymbiont of aphids, while H. defensa and R.
insecticola are secondary endosymbionts. These bacteria have been found to suppress growth
and reproduction in the host aphid, as a result of eating certain plants. Wild aphid samples were
first collected and tested for the presence of three endosymbiotic bacteria using st-pcr and gel
electrophoresis. The data was inconclusive, and it may be assumed that these endosymbionts
have not been acquired by the aphid samples collected. Finding the bacteria within the aphid
DNA would allow more research to be done on the plants that aphids are feeding on, and to
establish a growth/reproductive decline once the endosymbiont is acquired.
Background: There are symbiotic bacteria in multiple aphid species that absorb plant
nutrients and provide amino acids for the host aphid, such as: Buchnera aphidcola, Hamiltonella
defensa, and Regiella insecticola (Chandler, Wilkinson, & Douglas, 2007). B. aphidcola is
required for the insect to survive by synthesizing essential amino acids and vitamins from its
plant diet, and this bacteria is a primary symbiont (Brownlie & Johnson, 2009). H. defensa and
R. insecticola are secondary symbionts which some species of aphid have acquired (Brownlie &
Johnson, 2009). H. defensa bacteria targets parasitoid wasp larva that try to kill the aphid
(Brownlie & Johnson, 2009). R. insecticola also protects aphids that have it acquired by
providing fungal protection from a natural fungal enemy, Pandora neoaphidis (Brownlie &
Johnson, 2009). This fungus contaminates the insect with spores, and the fungi grow on the
aphid body until it dies. Aphids with R. insecticola have shown resistance to this infection, but
most aphids contaminated with neoaphidis have less spores growing on them, with the R.
insecticola present (Brownlie & Johnson, 2009). It is also known that secondary endosymbionts

can completely replace a primary symbiont if the primary symbiont degenerates too much. B.
aphidicola sometimes goes through genome decay, and loses the ability to provide essential
amino acid synthesis to the aphid (Feldhaar & Gross, 2008). When feeding on certain plants, it is
noted that the impact of the relationship between the secondary symbionts and the aphid can
sometimes cause the aphid to reproduce and grow slower (Chandler, Wilkinson, & Douglas,
2007). When this happens, the symbiotic bacterium responsible for the decline in growth
reproduces itself rapidly and at high densities (Chandler, Wilkinson, & Douglas, 2007). What
remains unknown about these endosymbiotic bacteria is whether or not the same strains of
bacteria can be found in aphid populations in the U.S. as they were found in England and
Switzerland. This is necessary to then answer the next question, which is whether or not the
aphids have the same symptoms of population decline, and knowing what exact nutrients from
plants cause this to happen. PCR, or polymerase chain reaction, is a technique used to amplify
strands of DNA so multiple copies can be available to examine. PCR, used in this research, was
used to detect the bacterias presence in the aphid gut. The primers necessary for the DNA
sequencing of the three endosymbiotic bacteria are already known (Chandler, Wilkinson, &
Douglas, 2007). When working with aphids, it should be noted that they hatch from eggs in the
spring and sometimes disappear during hot weather or when the plant of choice for the
population of aphids is no longer in season (Aphids, n.d.). This is relevant when collecting
samples of wild aphids. Most work with aphids and their secondary symbiotic bacterium is fairly

recent.
In a paper written by Jousselin, Desdevises, and Dacier (2008) a genus of aphids was
experimented on. In the same research, DNA results showed that the B. aphidcola had mutated

and cospeciated with the aphids, creating a different species of B. aphidcola in the process. It
was concluded that the bacterium are diverse with each individual species of aphid, with all
aphids being in the same genus.
Also published in the Royal Society, in a paper by Chandler, Wilkinson, and Douglas
(2007) it was concluded that the two symbionts, R. insecticola and H. defensa, caused a decrease
in aphid growth and reproduction, with higher densities of the bacterium themselves. This
research utilized polymerase chain reaction, which was used to detect the symbiotic bacteria in
the aphids.
Vorburger, Gehrer, and Rodriguez (2009) demonstrated that symbionts found in aphids
are capable of resisting the effects of parasitoids, such as Aphidius colemani, which was tested on
a species of aphids. The research supported the idea that many endosymbiotic bacteria in aphids
evolve to provide their host with protection from parasitoids.
In a paper by McLean, van Asch, Ferrari, and Godfray (2010) it is suggested that the presence of
secondary symbiotic bacteria such as H. defensa in aphids may lead the pea aphids to prefer one
plant over another. This was disproven, as aphids without the secondary symbiont were tested on
the plant, and the preference to one plant still existed, only with a slight reduction in aphid
reproduction on both plants. Therefore, the hypothesis wasnt supported by the research.
The problem this research addresses is whether or not the same symbionts B. aphidcola,
H. defensa, and R. insecticola are present in a variety of aphid species found in the U.S. Northern
Virginia region as the ones found in previous research have been from across the Atlantic. Also,
the ability of these symbiotic bacteria to inhibit growth and reproduction of the aphid host would
be favored for further research. It could be beneficial to know which amino acid is prevalent in
the plants that do affect the symbiotic bacteria, causing a higher population.

A paper by Brinza, Cilia, et al. (2009) talks about the primary symbiont B. aphidicola,
and supports the fact that it helps the aphid synthesize essential amino acids. This bacteria cant
be cultured outside of the aphid, and is found in specialized eukaryotic cells called bacteriocytes,
located in the aphid body cavity. Several different Buchnera aphidicola genomes have been
found and sequenced, which has helped to determine the exact function of these endosymbionts.
In this research, wild aphids will be captured and preserved in 95% ethanol along with
their plant of choice and run through PCR to detect the aforementioned symbionts using known
primers necessary for PCR. The hypothesis stated was Endosymbiotic bacteria will be found in
the wild aphids with the use of known primers and gel electrophoresis for these bacteria. The
independent variable is the wild aphid samples collected. The dependent variable is the presence
of B. aphidicola, R. insecticola, or H. defensa. The control during PCR was CO1 gene primers
used on positive wolbachia DNA (Positive control) as well as on aphid DNA (Negative control).
Constants include aphids from the order hemiptera, 95% ethanol used for preservation, primers
used for bacteria detection, and thermalcycler settings. This is important to previous research,
because a new strain of secondary symbionts could be found, or a certain amino acid in plants
may account for the inhibition of aphid growth and reproduction. It could also rule out the
production of amino acids as a factor in controlling the population of aphids. Overall, working
with the secondary symbionts H. defensa and R. insecticola is important because possible results
could help with the development of non-chemical pest controlling techniques. A further step in
research would not only include establishing the slowed growth/reproduction effect and
examining the plants of choice for these herbivorous insects, but also could include looking into
the possibility of having the symbiotic bacteria re-inserted into a different genus or species of
herbivorous insect to see if it will produce the same effects.

Methods: Wild aphid samples were collected from different locations and grouped
according to these locations. Samples were stored in jars with 95% ethanol, in a -80oC. DNA was
extracted from the aphids collected and kept in a -20oC or 4oC. PCR was used on the DNA to
detect B. aphidicola, R. insecticola, or H. defensa. Known primers for the bacteria were used as
follows: B. aphidicola forward TGCGGCACTTGCATATGGT, reverse
CGAAAGTCCCCCCACCTAAG, H. defensa forward CAAGCGGATTATTAATGAACCCA,
reverse TGGTGCTATTCCCTTTTCCCT, and R. insecticola forward
CCGTAAAGACGTCAATCCCG, reverse GCACCCCTCCTTGAATAGCA. Polymerase chain
reaction controls included positive Wolbachia DNA tested for the CO-1 gene, as well as another
control of experimental aphid DNA tested for the CO-1 gene. Gel electrophoresis in a 1% gel
was used as post-PCR analysis of the products. Safety precautions include handling 95% ethanol
properly, keeping it away from flames, as it is highly flammable, and disposing of it and washing
hands properly after use. The gel transilluminator uses UV light, and it is safer not to look
directly at this light because it can have damaging effects.
Data/Results:
Well 1: Positive Wolbachia DNA with CO-1 primers (Control)
Well 2: Aphid DNA with CO-1 primers (Control)
Well 3: Aphid DNA with B. aphidicola primers
Well 4: Aphid DNA with H. defensa primers
Well 5: Aphid DNA with R. insecticola primers
Well 6: DNA ladder (50 1000bp)

Gel #1 (12-14-11)

Gel #2 (12-20-11)

Gel #3 (2-9-12)

Gel #4 (2-28-12)

Discussion: The hypothesis was not supported by the data in this research. Gel
electrophoresis did not reveal the presence of any bands that could be identified as B. aphidicola,
H. defensa, or R. insecticola. Lanes 1 and 2 in the gels often turned up positive for the CO1 gene
as a control. Experimental lanes showed no bands most of the time. Gels #1 and #2 showed a
faint band under lane three over 1000 bp in length. This could not be B. aphidicola, which is
only about 600 bp in length. H. defensa is approximately 500 base pairs in length, while R.
insecticola is about 400 base pairs. DNA samples tested on a nanophotometer showed
exceptional purity nearing 1.8, showing that extractions had been performed successfully.
Furthermore, bands 700 bp long in lane 2 of any gel also showed that the aphid DNA was
extracted successfully, because the CO1 gene was present in the DNA (and this is close to 700
base pairs). To ensure that these results of large base pair lengths in the experimental lanes are
not caused by the inability of primers to attach to their selected sequence, the method could
include DNA of an aphid infected with the three endosymbionts as a control (to assure that the
primers worked, but the endosymbionts arent present in the aphids).
Sources of error can include gels not forming correctly. When liquid agarose is poured
into a gel tray, it should not be moved in order to make sure no waves form inside of the gel
(because the gel is supposed to consist of multiple channels through which the PCR product
travels through).
Solutions to finding the bacterial endosymbionts include collecting even more aphids, or
ordering aphids of a certain species and using modified primers. Once aphids infected with these
special bacteria can be acquired, further research can be done to determine if the aphids are
experiencing symptoms of declined growth and reproduction, as well as what causes these
abnormalities. Plants could be analyzed for their vitamins, nutrients, and amino acid

concentrations, to determine if any one of these is responsible for the decline in

growth/reproduction of aphids. This is important because it would provide an alternate method of
pest control that doesnt involve pesticide use, or the use of a barrier plant that could alter the
environment in a greater way.

References:
Aphids. (2010). Unpublished manuscript, Colorado State University, Denver, Colorado.
Retrieved from http://www.colostate.edu/Dept/CoopExt/4dmg/Pests/aphids.htm

Aphids. Unpublished manuscript, University of Rhode Island, Kingston, Rhode Island. Retrieved
from http://www.uri.edu/ce/factsheets/sheets/aphids.html

Brinza, Cilia et al. (2009) Systematic analysis of the symbiotic function of Buchnera aphidicola,
the primary endosymbiont of the pea aphid Acyrthosiphon pisum. Vol. 332 1034-1049

Brownlie, J. & Johnson, K. (2009). Symbiont-mediated protection in insect hosts. Trends in

Microbiology, 17, 8.

Chandler, S.M., Wilkinson, T.L., & Douglas, A.E. (2007). Impact of plant nutrients on the
relationship between a herbivorious insect and its symbiotic bacteria. Proceedings of the
Royal Society B, 275, 565-570.

Drees, B.M. (n.d.). Appendix a collecting and preserving insects. Retrieved from
http://bughunter.tamu.edu/appendixa.htm

Feldhaar, H. & Gross, R. (2009). Insects as hosts for mutualistic bacteria. International Journal
of Medical Microbiology, 299, 1-8.

Gosalbes, M., Latorre, A., Lamelas, A., & Moya, A. (2010). Genomics of intracelular symbionts
in insects. International Journal of Medical Microbiology, 300, 271-278.

Graf, J. (2003). Aphid symbiosis. Retrieved from

http://web.uconn.edu/mcbstaff/graf/BuAp/Baphidright.htm

Hansen, A.K., & Moran, N.A. (2011). Aphid genome expression reveals hostsymbiont
cooperation in the production of amino acids. Proceedings of the National Academy of
Sciences of the United States of America, 108, 7 2849-2854.

Jousselin, E., Desdevises, Y., & d'acier, A.C. (2008). Fine-scale cospeciation between
brachycaudus and buchnera aphidicola: bacterial genome helps define species and
evolutionary relationships in aphids. The Royal Society, 276, 1654.

Keenlyside, J. (n.d.). Aphid culture. Retrieved from

http://www.thebdg.org/library/feeding/aphid_culture.htm

McLean, A.H.C., van Asch, M., Ferrari, J., & Godfray, H.C.J. (2010). Effects of bacterial
secondary symbionts on host plant use in pea aphids. Proceedings of the Royal Society B,
278, 760-766.

Vorbuger, C., Gehrer, L., & Rodriguez, P. (2009). A strain of the bacterial symbiont regiella
insecticola protects aphids against parasitoids. The Royal Society, 6, 109-111.