Animal Feed Science and Technology 166167 (2011) 93100

Contents lists available at ScienceDirect

Animal Feed Science and Technology

journal homepage: www.elsevier.com/locate/anifeedsci

Inhibition of rumen methanogenesis by tea saponins with reference to

fermentation pattern and microbial communities in Hu sheep
Y.Y. Zhou a , H.L. Mao a , F. Jiang a , J.K. Wang a, , J.X. Liu a, , C.S. McSweeney b
a
b

Institute of Dairy Science, College of Animal Sciences, Zhejiang University, 268 Kaixuan Road, Hangzhou 310029, PR China
CSIRO Livestock Industries, 306 Carmody Rd. St Lucia, QLD, 0467, Australia

a r t i c l e

Keywords:
Defaunation
Methane production
Protozoa
Rumen fermentation
Sheep
Tea saponins

i n f o

a b s t r a c t
Twelve rumen stulated Hu sheep were used to assess effects of tea saponins (TS) on
methanogenesis, fermentation pattern and rumen microbial communities. All sheep were
defaunated by administration of sodium lauryl sulfate. After two weeks, half of the defaunated sheep were refaunated by inoculation with faunate rumen uid. Both defaunated
(DfN) and refaunated (RfN) sheep were divided into two groups, and assigned to treatments in a 2 2 factorial arrangement without (RfN, DfN) or with TS (3 g/d) (RfTs, DfTs).
After a feeding period of 3 wk, CH4 production of individual sheep was measured using
open circuit respiratory chambers and rumen uid was sampled for analysis of rumen
fermentation products and extraction of microbial DNA. Numbers of gene copies associated with rumen methanogens (mcrA gene), specic bacteria (16S rDNA gene) and rumen
protozoa and fungi (18S rDNA gene) were measured using real time ploymerase chain
reaction (rt-PCR). The abundance of marker gene-copy number for the methanogens, protozoa, fungi, Ruminococcus albus, R. avefaciens, Fibrobacter succinogenes and Butyrivibrio
brisolvens were expressed relative to the copy number of total rumen bacterial 16S rDNA.
Denaturing gradient gel electrophoresis was completed for protozoa to indicate the change
in their diversity due to TS addition and defaunation. Declines in CH4 production as a result
of addition of TS (2.1 L/d, P<0.01) were similar to defaunation (2.5 L/d, P<0.01). Compared to
RfN, ammonia N concentrations were 12.9, 31.2 and 33.9% lower (P<0.01), whereas microbial protein concentrations were 16.4, 29.2 and 36.0% higher (P<0.01) in RfTs, DfN and
DfTs, respectively. In contrast, the concentration of volatile fatty acids was similar among
treatments although the molar proportion of propionate was higher (P<0.01) in defaunated
sheep. The abundance of fungi and R. avefaciens marker genes relative to total bacterial 16S
rDNA were decreased by defaunation, and abundance of F. succinogenes declined (P<0.01)
with either defaunation or addition of TS. The relative abundance of methanogen marker
gene was reduced by defaunation (P<0.05). Protozoal abundance in RfTs was lower than that
of RfN (P<0.05). The TS reduced (P<0.05) protozoal diversity. Addition of TS reduced CH4
production mainly by inhibiting protozoa, increasing molar proportions of propionate and
decreasing acetate/propionate ratio without adversely altering relative ruminal abundance
of fungi and cellulolytic bacteria.

Abbreviations: DGGE, denaturing gradient gel electrophoresis; DfN, defaunated sheep with no tea saponins; DfTs, defaunated sheep with addition of
tea saponins; MCP, microbial crude protein; rt-PCR, real time ploymerase chain reaction; RfN, refaunated sheep with no tea saponins; RfTs, refaunated
sheep with addition of tea saponins; TS, tea saponins; VFA, volatile fatty acids.
Corresponding author. Tel.: +86 571 86971097; fax: +86 571 86971930.
E-mail addresses: jiakunwang@zju.edu.cn (J.K. Wang), liujx@zju.edu.cn (J.X. Liu).
0377-8401/$ see front matter 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.anifeedsci.2011.04.007

94

Y.Y. Zhou et al. / Animal Feed Science and Technology 166167 (2011) 93100

This article is part of the special issue entitled: Greenhouse Gases in Animal Agriculture Finding
a Balance between Food and Emissions, Guest Edited by T.A. McAllister, Section Guest Editors;
K.A. Beauchemin, X. Hao, S. McGinn and Editor for Animal Feed Science and Technology, P.H.
Robinson.
2011 Elsevier B.V. All rights reserved.

1. Introduction
Methane production in the rumen represents a loss of energy to the host animal (Holter and Yong, 1992; Johnson and
Johnson, 1995), and contributes to global greenhouse gas emissions (Moss et al., 2000). Thus, reducing CH4 emission in
ruminants is a goal of researchers throughout the world. It is reported that defaunation reduces CH4 production by 2030%
and increases the amount of metabolizable energy available to the host by 12% (Whitelaw et al., 1984; Kreuzer et al., 1986;
Santra et al., 1994). Many attempts have been made to depress rumen methanogenesis by use of feed additives. Plant
secondary metabolites (e.g., saponins, tannins, essential oils) and some organic acids (i.e., fumarate, malate) have shown
potential to inhibit rumen CH4 production (Lila et al., 2003; Yuan et al., 2007; Mao et al., 2010). In the past decade, saponins
extracted from Yucca schidigera (Wang et al., 1998, 2000; Hristov et al., 1999) and tropical fruit (Hess et al., 2003) have been
used to reduce CH4 emissions and numbers of rumen protozoa, resulting in a decrease in rumen ammonia N concentrations
and an improvement in efciency of microbial protein synthesis.
China is one of the biggest tea producers in the world. After extracting the oil, tea seed meal is usually disposed of as
waste. Our in vitro and in vivo studies with sheep have shown that supplementation with tea saponins (TS) improved rumen
fermentation, decreased numbers of rumen protozoa, but had no effect on ruminal methanogens (Hu et al., 2005, 2006; Yuan
et al., 2007; Guo et al., 2008). Although supplementation with 3 g/d of TS increased average daily gain, and gain to feed ratios
in goats, no improvements occurred when the level of TS was increased to 6 g/d (Hu et al., 2006). Protozoa have both an
ecto- and endo-symbiotic relationship with methanogens (Finlay et al., 1994), and methanogens associated with protozoa
are estimated to be responsible for 925% of the total CH4 production in the rumen (Newbold et al., 1995). Therefore, a
reduction in the rumen protozoa population as a result of inclusion of TS in the diet could result in a decrease in enteric
CH4 production. It has been proposed that saponins favor production of propionate in the rumen, a factor that may further
reduce CH4 as propionate formation can also serve as an H2 sink (Lila et al., 2003; Wina et al., 2005; Pen et al., 2006).
Our objective was to assess effects of TS on CH4 production, abundance of rumen microbial populations and ruminal
fermentation of refaunated and defaunated sheep.

2. Materials and methods

2.1. Animals and defaunation procedure
This experiment was conducted in accordance with the Zhejiang University Guidelines for the Care and Use of Experimental Animals. Twelve rumen stulated 7 month old Hu sheep (rams) with an initial weight of 21.5 1.80 kg were used.
All sheep were fasted for 24 h and defaunated by administration of an aqueous solution of sodium lauryl sulfate (200 g/kg)
poured directly into the rumen through the cannula at a dose of 8 g/100 kg body weight on 2 consecutive d (Santra and Karim,
2000). On the rst d of defaunation, the sheep were fed only 200 g of Chinese wild rye (Aneurolepidium Chinese Kitagawa) 8 h
after administration of sodium lauryl sulfate. The remaining protozoa (determined via hemocytometer) after defaunation
was less than 3% of the original population (i.e., 5.5 105 /mL). Two weeks after defaunation, 6 of the sheep were refaunated
by inoculating 100 mL of rumen content from a control sheep on two consecutive days. These sheep were fed a basal diet
at maintenance requirement for digestible energy (MOA, 2004), containing 600 g/kg of Chinese wild rye and 400 g/kg of a
concentrate mixture in which salt and mineral and vitamin mixture were supplemented (Table 1). The remaining 6 sheep
were dosed with sodium lauryl sulfate at 7 d intervals throughout the study.

Table 1
Calculated feed and chemical composition of basal dieta .
Feed composition

g/kg, as fed

Chemical composition

g/kg DM

Chinese wild rye hay

Corn meal
Soybean meal
Wheat bran
Rapeseed meal
NaCl
Mineral/vitamin mixture

600
240
40
44
60
6
10

Crude protein
Neutral detergent ber
Acid detergent ber
Ca
P

121
448
266
3.1
3.3

Digestible energy, MJ/kg DM

Diet was formulated according to the Feeding Standard of Meat-producing Sheep and Goats (MOA, 2004).

11.8

Y.Y. Zhou et al. / Animal Feed Science and Technology 166167 (2011) 93100

95

2.2. Feeding and experimental design

All sheep were fed with the same basal diet (Table 1). Feed intake was restricted to ensure all feed was eaten, and daily
amount of diet was fed in equal portions twice daily at 08:30 and 16:30 h. The experiment was a 2 2 factorial arrangement
with addition of TS and defaunation as main effects. After 5 d of refaunation, as described above, the refaunated (RfN) and
defaunated (DfN) sheep were randomly divided into two groups of 3 with one group from each of the RfN and DfN sheep
supplemented with 3 g/d of TS (RfTs, DfTs). The saponins (600 g triterpenoid saponins/kg DM) as extracts from tea (Camellia
sinensis) seeds were purchased from Zhejiang Orient Tea Development Co. Ltd. (Hangzhou, Zhejiang, China) The dose of TS
was based on results of previous studies with rumen uid in vitro (Hu et al., 2005) and in vivo (Hu et al., 2006; Mao et al.,
2010). The TS powder was premixed with small amount of corn meal and then mixed with other ingredients of the diets at
feeding.
Each sheep was fed in an indoor individual pen for 3 wk with free access to water. Rumen liquid was collected from
each sheep via the rumen cannula before feeding (0 h) and at 3, 6 and 12 h after feeding on the 22nd and 23rd d. Collected
rumen uid was immediately strained through four layers of muslin cloth. After measuring pH (PB-20; Sartorius, Gettingen,
Germany), samples were stored at 20 C for later determination of ammonia N, volatile fatty acids (VFA) and microbial
crude protein (MCP) and for DNA extraction.
2.3. Methane measurements
After 3 wk on each of the respective diets, each sheep in each group was individually transported to the open circuit
respiratory chambers to measure CH4 production using the procedure of Yuan et al. (2007). Briey, after sheep had adapted
to the chamber for 24 h, an hourly air sample was taken from the outlet of each chamber with an airtight syringe, and CH4
concentration was analyzed by gas chromatograph (GC-2100, Shimadzu, Kyoto, Japan) equipped with a Flame Ionization
detector (Hu et al., 2005). Inlet CH4 concentration was determined by the methods as described above. The outside air was
supplied to the chamber from one side and the chamber air was removed from another side through a pump (2XZ-2, Kangjia,
Shanghai, China) with an outlet ow of 2 L/s. The volume of the air through the chamber was recorded by the ow meter
(2XZ-2, Kangjia, Shanghai, China) at the outlet. Measurement was for two consecutive d. The feeding schedule was the same
as that of pen feeding via a window in the front of the chamber which was opened at each feeding.
2.4. Sample analysis
2.4.1. Chemical analysis of diet and rumen uid
Chemical composition of the diet was estimated using table values (MOA, 2004). Concentrations of ammonia N, VFA and
MCP in the rumen uid were determined using the procedure described by Hu et al. (2005) with MCP estimated using a
purine method (Makkar and Becker, 1999).
2.4.2. Real-time PCR and denaturing gradient gel electrophoresis (DGGE)
Rumen samples from 8 times (4 times daily for two consecutive d) for each sheep were pooled to extract genomic DNA
by bead-beating (Zoetendal et al., 1998). Real time PCR assays for microorganisms reported in Table 2 were completed as:
one cycle at 95 C for a 10 s for initial denaturation, followed by 40 cycles of denaturation at 95 C for 5 s and annealing at
60 C for 34 s. The variable regions of 18S rDNA of protozoa were amplied by primers with a GC clamp. The amplication
for protozoa was: 35 cycles consisting of 94 C for 30 s, 62 C for 30 s and 72 C for 30 s. All primers are in Table 2.
The DGGE assay was according to Guo et al. (2008). Denaturing gradient gels ranged from 20 to 35% for PCR products
of protozoa. Bands were visualized using silver staining (Kocherginskaya et al., 2001) after electrophoresis. DGGE images
were captured using Quantity One (Bio-Rad Laboratories, Hercules, CA, USA). The protozoal fragments were recovered and
amplied with the primers without GC clamp. The resultant product was puried, ligated with pMD18-T and transformed
into Escherichia coli JM109 for sequencing. Ten clones for each band were examined.
2.5. Data calculation and statistical analysis
Methane production as VCH4 ; L/h was calculated as:
VCH4 =

(P P0 ) V
R

where P and P0 was the CH4 concentration (ppm) of air samples taken from outlet and inlet, respectively, V was the volume
(L/h) of air owing through the chamber and R was recovery of CH4 in the chamber. The copy number of marker genes for
methanogens, protozoa, fungi, Ruminococcus albus, R. avefaciens, Fibrobacter succinogenes and Butyrivibrio brisolvens were
each expressed relative to the copy number of total rumen bacterial 16S rDNA as a reference gene in the rumen. Thus the
relative abundance of each marker gene was estimated as a proportion of total rumen bacterial 16S rDNA as:
relative quantication of target = 2Ct = 2(Ct targetCt total bacteria)

96

Y.Y. Zhou et al. / Animal Feed Science and Technology 166167 (2011) 93100

Table 2
Primer sets used to amplify 16S rDNA sequences from rumen bacteria, 18S rDNA sequences from protozoa and fungi, and methyl coenzyme A reductase
gene (mcrA) from methanogens.
Target Species

Forward/Reverse

Primer sequences

Reference

Total bacteria

F
R
F
R
F
R
F
R
F
R
F
R
F
R
F
R
F
R

CGGCAACGAGCGCAACCC
CCATTGTAGCACGTGTGTAGCC
TTCGGTGGATCDCARAGRGC
GBARGTCGWAWCCGTAGAATCC
GAGGAAGTAAAAGTCGTAACAAGGTTTC
CAAATTCACAAAGGGTAGGATGATT
GCTTTCGWTGGTAGTGTATT
CTTGCCCTCYAATCGTWCT
GTTCGGAATTACTGGGCGTAAA
CGCCTGCCCCTGAACTATC
GAGGAAGTAAAAGTCGTAACAAGGTTTC
CAAATTCACAAAGGGTAGGATGATT
CGGCAACGAGCGCAACCC
CCATTGTAGCACGTGTGTAGCC
GAGGAAGTAAAAGTCGTAACAAGGTTTC
CAAATTCACAAAGGGTAGGATGATT
GGTGGTGCATGGCCG
CGCCCGCCGCGCCCCGCGCCCGGCCCGCCC
CCGCCCGGGGCCAATTGCAAAGATCTATCCC

Denman and McSweeney

(2006)
Denman et al. (2007)

Methanogens
Total fungi
Protozoa
Fibrobacter. succinogenes
Ruminococcus avefaciens
Ruminococcus albus
Butyrivibrio brisolvens
For DGGEa (protozoa)

Denman and
McSweeney (2006)
Denman et al. (2007)
Denman and McSweeney
(2006)
Denman and McSweeney
(2006)
Koike and Kobayashi
(2001)
Koike and Kobayashi
(2001)
Regensbogenova et al.
(2004)

DGGE, denaturing gradient gel electrophoresis. The underlined fragments indicate the GC clamp.

where Ct is Ct target bacteria minus Ct total 16S rDNA, and Ct is the difference in threshold cycles for target and
reference (Ct represented threshold cycle). The Shannon index, H (Shannon and Weaver, 1963) was used as the parameter
for the structural diversity of the protozoa community (Konstantinov et al., 2003).
Data were statistically analyzed by analysis of variance using the GLM procedure of SAS (1999) with individual sheep
as the experimental unit and TS and defaunation as main effects. When the TS defaunation interaction was signicant,
a secondary test was conducted to separate the efcacy of TS within defaunation (and vice versa; Robinson et al., 2006).
Multiple comparisons of means among treatments were completed by Duncans multiple range test. Signicance and trends
were declared if P<0.05 and 0.1 respectively.
3. Results
3.1. Methane production
All sheep consumed the diet fed, with sheep from the 4 groups having a similar diurnal pattern of CH4 production over 24 h
(Fig. 1). Ruminal CH4 production increased rapidly after feeding, reached a peak 23 h later, and then declining until the next
feeding. Compared to RfN, CH4 production in RfTs and DfN decreased by (2.1 L/d, P<0.01) and (2.5 L/d, P<0.01), respectively
(Table 3). The effect of TS on inhibiting methanogenesis was comparable to that of defaunation. An interactive effect of TS
and defaunation on reducing rumen methanogenesis occurred, which resulted in further reduction of CH4 production in
DfTs (3.5 L/d, P<0.01).

Fig. 1. Diurnal pattern of CH4 emission in RfN (--), RfTs(--), DfN (--) and DfTs (--). All values were average of CH4 production during the two
consecutive days (n = 3). The bar is the standard error of the mean.

Y.Y. Zhou et al. / Animal Feed Science and Technology 166167 (2011) 93100

97

Table 3
Effects of tea saponins on rumen fermentation products in defaunated and refaunated sheep (n = 3)a .

Ruminal pH
Methane production (L/d)
Total volatile fatty acids (mmol/L)
Acetate (A)
Propionate (P)
Butyrate
A:Pb
Ammonia-N (mg/dl)
Microbial protein (mg/dl)

RfN

RfTs

DfN

DfTs

6.61
19.8
63.5
70.9
20.5
8.7
3.49
12.1
69.6

6.48
17.7
61.5
68.4
22.7
8.9
3.02
10.5
81.0

6.41
17.3
59.5
67.1
26.5
6.5
2.56
8.3
89.9

6.36
16.3
60.9
66.3
27.5
6.2
2.43
8.0
94.7

SEM

0.032
0.24
1.04
0.74
0.73
0.17
0.112
0.28
4.13

Pc
Df

TS

Df TS

**
**
NS
**
**
**
**
**
**

*
**
NS
NS
NS
NS
*
**
**

NS
*
NS
NS
NS
NS
NS
**
NS

All values were determined as pooled rumen uid samples (before feeding and at 3, 6 and 12 h after feeding over two days).
Acetate to propionate ratio.
c
*, P<0.05; **, P<0.01; NS, P>0.05; Df, defaunation effect; TS, tea saponins effect; Df TS, interactive effect.
b

3.2. Rumen fermentation parameters

Both defaunation (P<0.01) and TS addition (P<0.05) decreased ruminal pH, but all pH values were between 6.15 and 6.90
(Table 3). Concentrations of total VFA were 63.5, 61.5, 59.5 and 60.9 mmol/L for RfN, RfTs, DfN and DfTs, respectively, with no
differences among treatments. However, the molar proportion of acetate was lower (P<0.05) and proportion of propionate
was higher (P<0.05), resulting in a reduced ratio of acetate to propionate (P<0.05) for RfTs, DfN and DfTs sheep than for RfN
sheep. Compared to that of RfN (12.1 mg N/dl), ammonia N concentrations were reduced by 12.9, 31.2 and 33.9% (P<0.05),
whereas MCP concentrations were increased by 16.4, 29.2 and 36.0% (P<0.05) in RfTs, DfN and DfTs as compared to MCP
(69.6 mg/dl) in RfN sheep.

3.3. Quantitation of ruminal microorganisms

The abundance of methanogen mcrA genes relative to total bacterial 16S rDNA was reduced by defaunation (P<0.05),
whereas additional TS had no effect on methanogen abundance in either refaunated or defaunated sheep (Table 4). The
protozoal 18S rRNA copy number in defaunated groups was extremely low, and was lower for RfTs compared to RfN (P<0.05).
Furthermore, TS addition had positive interactive effect on reducing protozoa by defaunation. Defaunation decreased relative
abundance of fungi (P<0.01), R. avefaciens (P<0.05) and F. succinogenes (P<0.01), increased it for B. brisolvens (P<0.01), and
had no effect on R. albus. There was a negative TS x defaunation interaction (P<0.01) on the abundance of F. succinogenes.

3.4. Diversity analysis of protozoa community

The DGGE proles of protozoa community as affected by treatments are in Fig. 2A. The number of DGGE bands (Fig. 2B)
and Shannon diversity index (Fig. 2C) of rumen protozoal DGGE prole were lower (P<0.05) in RfTs than those in RfN,
respectively. The eleven bands were sequenced and submitted to GenBank (from FJ907164 to FJ907174). No band afliated
with protozoa occurred in defaunated sheep.

Table 4
Effects of tea saponins on relative abundance of marker genes for specic microbial populations (% of total bacterial 16S rDNA) in sheep under defaunated
and refaunated status (n = 3)a .
Microorganism

RfN

RfTs

Methanogens
Protozoa
Fungi (103 )
R. albus (102 )
R. avefaciens (102 )
F. succinogenes
B. brisolvens

0.61
4.68
15.19
4.85
14.74
1.28
1.03

0.57
2.66
14.70
5.49
9.61
0.27
0.88

a
b

DfN

0.34
6.75E04
0.34
3.42
7.04
3.78E04
2.27

DfTs

0.35
1.84E04
0.63
3.07
4.60
4.23E04
2.05

SEM

0.064
0.364
0.004
0.022
0.024
0.047
0.295

Pb
Df

TS

Df TS

**
**
**
NS
*
**
**

NS
*
NS
NS
NS
**
NS

NS
*
NS
NS
NS
**
NS

All values were determined as pooled rumen uid samples (before feeding and at 3, 6 and 12 h after feeding over two days);
*, P<0.05; **, P<0.01; NS, P>0.05; Df, defaunation effect; TS, tea saponins effect; Df TS, interactive effect.

98

Y.Y. Zhou et al. / Animal Feed Science and Technology 166167 (2011) 93100

Fig. 2. DGGE prole (A), number of bands (B) and Shannon diversity index, H (C) of rumen protozoal community in RfN and RfTs. All values were listed as
mean SEM of sheep in the same group (n = 3). The bar is the standard error of mean. a, b: bars without a common letter differ (P<0.05).

4. Discussion
4.1. Role of TS in rumen CH4 production
The TS and defaunation reduced ruminal CH4 production by 10.6 and 12.7% respectively, which was comparable to
disodium fumarate (Yuan et al., 2007) or soybean oil (Mao et al., 2010), but inferior to that of the same dose of TS in vitro (Hu
et al., 2005). The lower effect of TS in vivo may in part be due to adaptation of the rumen protozoa to saponins, or through
degradation of these compounds by rumen bacteria, which adapt to become capable of degrading antiprotozoal component
such as saponins (Newbold et al., 1997).
The observations that there was an interaction between defaunation and tea saponin in decreasing CH4 production, and
that tea saponin decreased CH4 in both refaunated and defaunated sheep, indicates that reduced methanogenesis by tea
saponin addition was not only due to the inhibition of protozoa, but that another mechanism of inhibition existed (Van
Nevel and Demeyer, 1996). The TS may have a minor affect on other microbiota which results in a lower amount of H2 being
produced, and thus less CH4 in the DfTs as compared to that of RfTs and DfN.
4.2. Effects of TS and defaunation on fermentation characteristics in rumen
Concentrations of VFA were not affected by either TS addition or defaunation, but the molar proportion of acetate was
decreased and the propionate proportion increased. Together with the decreased CH4 production by TS and defaunation,
we suggest that efciency of ruminal fermentation was improved by channeling H2 used for methanogenesis to synthesis
of propionate (Lila et al., 2003; Wina et al., 2005; McAllister and Newbold, 2008). Addition of TS decreased ammonia N
concentrations, but increased MCP yield, which is consistent with previous studies (Lila et al., 2003; Hu et al., 2005; Pen
et al., 2006). The reduction of ruminal ammonia N concentration by TS is likely due to its ammonia binding ability and
toxicity to rumen ciliate protozoa (Wallace et al., 1994).
4.3. Effects of TS on rumen microbes
Rumen protozoa play an important role in CH4 formation in the rumen due to ecto- and endo-symbiotic relationships with
methanogens (Finlay et al., 1994). Therefore, defaunated and refaunated sheep were used in this study to distinguish effects

Y.Y. Zhou et al. / Animal Feed Science and Technology 166167 (2011) 93100

99

of TS on protozoa and methanogens, and to elucidate the mechanism by which addition of TS decreased CH4 production.
Although protozoal abundance was reduced by both TS and defaunation, methanogens were only slightly reduced by TS
when protozoa were present, and not in defaunated sheep (Table 4). A similar conclusion regarding effects of saponins on
rumen microbiota was reported in other studies (Soliva et al., 2003; Goel et al., 2008; Guo et al., 2008). In contrast, Hess
et al. (2004) observed that saponins from S. saponaria increased the number of methanogens in the rumen. Among rumen
microbes, protozoa are the most sensitive to saponin induced changes in cell membrane permeability (Klita et al., 1996; Moss
et al., 2000). However, the variation of major protozoa species among the refaunated sheep in our study (Fig. 2) suggests
that inhibition of TS on protozoa is likely selective and sustained.
Rumen fungi and cellulolytic bacteria play important roles in maintaining a stable intra-ruminal environment for ber
digestion. A decrease in feed intake and/or digestibility is commonly observed when their activities are inhibited (Patra and
Saxena, 2009). Using uorescence microscopy, Imai and Ogimoto (1978) observed that only 110% of rumen bacterium was
attached to the surface of protozoa, most of which were carbohydrate fermenters. In our study, abundance of fungi and the
cellulolytic bacteria R. albus, R. avefaciens, F. succinogenes and B. brisolvens, were generally unaltered by supplementation
of 3 g/d of TS in defaunated sheep. Wina et al. (2005), by using a nucleic acid hybridization technique, also reported that
populations of R. albus and R. avefaciens were not affected by Sapindus rarak methanol extract at a concentration of less than
1 mg/mL, but dramatically reduced at concentrations of 24 mg/mL. Further, it was shown that S. rarak saponins inhibited
R. albus, R. avefaciens and Chytridiomycetes in the short term, while neither R. albus nor R. avefaciens was affected by the
saponins after 105 d of administration (Wina et al., 2006). Therefore, the CH4 inhibition by TS and other saponins seems to be
dose and time dependent. Further research is needed to assess long term effects of TS on rumen microbes and on decreasing
ruminal CH4 production.
5. Conclusions
Saponins from tea seeds decreased CH4 production in the rumen of Hu sheep, and the inhibition on methanogenesis
was higher in defaunated than refaunated sheep due to differences in protozoal abundance. Decreased CH4 production was
due mainly to effects of TS on reducing numbers of protozoa, and thus lowering methanogenic activity of the associated
methanogens which resulted in a channeling of H2 towards propionate production. Tea saponins could be a potential feed
additive for mitigating CH4 emission from ruminants.
Conicts of interest
None.
Acknowledgements
This work was supported partly by grants from the National Natural Science Foundation of China (No. 30972105) and
International Atomic Energy Agency (No. 12665/R3).
References
Denman, S.E., McSweeney, C.S., 2006. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within
the rumen. FEMS Microbiol. Ecol. 58, 572582.
Denman, S.E., Tomkins, N.W., McSweeney, C.S., 2007. Quantitation and diversity analysis of ruminal methanogenic populations in response to the
antimethanogenic compound bromochloromethane. FEMS Microbiol. Ecol. 62, 313322.
Finlay, B.J., Esteban, G., Clarke, K.J., Williams, A.G., Embley, T.M., Hirt, R.P., 1994. Some rumen ciliates have endosymbiotic methanogens. FEMS Microbiol.
Lett. 117, 157161.
Goel, G., Makkar, H.P.S., Becker, K., 2008. Changes in microbial community structure, methanogenesis and rumen fermentation in response to saponin-rich
fractions from different plant materials. J. Appl. Microbiol. 105, 770777.
Guo, Y.Q., Liu, J.X., Lu, Y., Zhu, W.Y., Denman, S.E., McSweeney, C.S., 2008. Effect of tea saponin on methanogenesis, microbial community structure and
expression of mcrA gene, in cultures of rumen micro-organisms. Lett. Appl. Microbiol. 47, 421426.
Hess, H.D., Beuret, R.A., Lotscher, M., Hindrichsen, I.K., Machmller, A., Carulla, J.E., Lascano, C.E., Kreuzer, M., 2004. Ruminal fermentation, methanogenesis
and nitrogen utilization of sheep receiving tropical grass hay-concentrate diets offered with Sapindus saponaria fruits and Cratylia argentea foliage.
Anim. Sci. 79, 177189.
Hess, H.D., Kreuzer, M., Daz, T.E., Lascano, C.E., Carulla, J.E., Soliva, C.R., Machmller, A., 2003. Saponin rich tropical fruits affect fermentation and
methanogenesis in faunated and defaunated rumen uids. Anim. Feed Sci. Technol. 109, 7994.
Holter, J.B., Yong, A.J., 1992. Methane prediction in dry and lactating Holstein cows. J. Dairy Sci. 75, 21652175.
Hristov, A.N., McAllister, T.A., Van Herk, F.H., Cheng, K.J., Newbold, C.J., Cheeke, P.R., 1999. Effect of Yucca schidigera on ruminal fermentation and nutrient
digestion in heifers. J. Anim. Sci. 77, 25542563.
Hu, W.L., Liu, J.X., Wu, Y.M., Guo, Y.Q., Ye, J.A., 2006. Effects of tea saponins on in vitro ruminal fermentation and growth performance in growing Boer goat.
Arch. Anim. Nutr. 60, 8997.
Hu, W.L., Liu, J.X., Ye, J.A., Wu, Y.M., Guo, Y.Q., 2005. Effect of tea saponin on rumen fermentation in vitro. Anim. Feed Sci. Technol. 120, 333339.
Imai, S., Ogimoto, K., 1978. Scanning electron and uorescent microscopic studies on the attachment of spherical bacteria to ciliate protozoa in the ovine
rumen. Jpn. J. Vet. Sci. 40, 919.
Johnson, K.A., Johnson, D.E., 1995. Methane emissions from cattle. J. Anim. Sci. 73, 24832492.
Klita, P.T., Mathison, G.W., Fenton, T.W., Hardin, R.T., 1996. Effects of alfalfa root saponins on digestive function in sheep. J. Anim. Sci. 74, 11441156.
Kocherginskaya, S.A., Aminov, R., White, B.A., 2001. Analysis of the rumen bacterial diversity under two different diet conditions using denaturing gradient
gel electrophoresis, random sequencing, and statistical ecology approaches. Anaerobe 7, 119134.

100

Y.Y. Zhou et al. / Animal Feed Science and Technology 166167 (2011) 93100

Koike, S., Kobayashi, Y., 2001. Development and use of competitive PCR assays for the rumen cellulolytic bacteria: Fibrobacter succinogenes, Ruminococcus
albus and Ruminococcus avefacies. FEMS Microbiol. Lett. 204, 361366.
Konstantinov, S.R., Zhu, W.Y., Williams, B.A., Tamminga, S., de Vos, W.M., Akkermans, A.D.L., 2003. Effect of fermentable carbohydrates on piglet faecal
bacterial communities as revealed by denaturing gradient gel electrophoresis analysis of 16S ribosomal DNA. FEMS Microbiol. Ecol. 43, 225235.
Kreuzer, M., Kirchgessner, M., Muller, H.L., 1986. Effect of defaunation on the loss of energy in wethers fed different quantities of cellulose and normal or
steam aked maize starch. Anim. Feed Sci. Technol. 16, 233241.
Lila, Z.A., Mohammed, N., Kanda, S., Kamada, T., Itabashi, H., 2003. Effect of sarsaponin on ruminal fermentation with particular reference to methane
production in vitro. J. Dairy Sci. 86, 33303336.
Makkar, H.P.S., Becker, K., 1999. Purine quantication in digesta from ruminants by spectrophotometric and HPLC methods. Br. J. Nutr. 81, 107113.
Mao, H.L., Wang, J.K., Zhou, Y.Y., Liu, J.X., 2010. Effects of addition of tea saponins and soybean oil on methane production, fermentation and microbial
population in the rumen of growing lambs. Livest. Sci. 129, 5662.
McAllister, T.A., Newbold, C.J., 2008. Redirecting rumen fermentation to reduce methanogenesis. Aust. J. Exp. Agric. 48, 713.
Ministry of Agriculture (MOA), P.R.C., 2004. Feeding Standard of Meat-producing Sheep and Goats (NY/T 816-2004). China Agricultural Press, Beijing, China.
Moss, A.R., Jouany, J., Newbold, J., 2000. Methane production by ruminants: its contribution to global warming. Ann. Zootech. 49, 231253.
Newbold, C.J., Lassalas, B., Jouany, J.P., 1995. The importance of methanogenesis associated with ciliate protozoa in ruminal methane production in vitro.
Lett. Appl. Microbiol. 21, 230234.
Newbold, C.J., El Hassan, S.M., Wang, J., Ortega, M.E., Wallace, R.J., 1997. Inuence of foliage from African multipurpose trees on activity of rumen protozoa
and bacteria. Br. J. Nutr. 78, 237249.
Patra, A.K., Saxena, J., 2009. Dietary phytochemicals as rumen modiers: a review of the effects on microbial populations. Antonie Van Leeuwenhoek 96,
363375.
Pen, B., Sar, C., Mwenya, B., Kuwaku, K., Morikawa, R., Takahashi, J., 2006. Effects of Yucca schidigera and Quillaja saponaria extracts on in vitro ruminal
fermentation and methane emission. Anim. Feed Sci. Technol. 129, 175186.
Regensbogenova, M., Pristas, P., Javorsky, P., Moon-van der Staay, S.Y., van der Staay, G.W., Hackstein, J.H., Newbold, C.J., McEwan, N.R., 2004. Assessment
of ciliates in the sheep rumen by DGGE. Lett. Appl. Microbiol. 39, 144147.
Robinson, P.H., Wiseman, J., Udn, P., Mateos, G., 2006. Some experimental design and statistical criteria for analysis of studies in manuscripts submitted
for consideration for publication. Anim. Feed Sci. Technol. 129, 111.
Santra, A., Kamra, D.N., Pathak, N.N., Khan, M.Y., 1994. Effect of protozoa on the loss of energy in Murrah buffalo (Bubalua bubalis) calves. Buff. J. 3, 249253.
Santra, A., Karim, S.A., 2000. Growth performance of faunated and defaunated Malpura weaner lambs. Anim. Feed Sci. Technol. 86, 251260.
SAS, Version8.0. 1999. SAS Inst. Inc., Cary, NC, USA.
Shannon, C.E., Weaver, W., 1963. The Mathematical Theory of Communication. University of Illinois Press, Urbana, IL, USA.
Soliva, C.R., Hess, H.D., Meile, L., 2003. Suppression of ruminal methanogenesis by dietary means: apparent inconsistency between methane release and
counts of microbes involved in methanogenesis. Trop. Subtrop. Agro-Ecosyst. 3, 209213.
Van Nevel, C.J., Demeyer, D.I., 1996. Control of rumen methanogenesis. Environ. Monit. Assess. 42, 7397.
Wallace, R.J., Arthaud, L., Newbold, C.J., 1994. Inuence of Yucca shcidigera extract on ruminal mmonia concentrations and ruminal microorganisms. Appl.
Environ. Microbiol. 60, 17621767.
Wang, Y., McAllister, T.A., Newbold, C.J., Rode, L.M., Cheeke, P.R., Cheng, K.J., 1998. Effect of Yucca Schidigera extract on fermentation and degradation of
steroida1 saponins in the rumen simulation technique (RUSITEC). Anim. Feed Sci. Technol. 74, 143153.
Wang, Y., McAllister, T.A., Yanke, L.J., Xu, Z.J., Cheeke, P.R., Cheng, K.J., 2000. In vitro effects of steroidal saponins from Yucca Schidigera extract on rumen
microbial protein synthesis and ruminal fermentation. J. Sci. Food Agric. 80, 21142122.
Whitelaw, F.G., Eadie, J.M., Bruce, L.A., Shand, W.J., 1984. Methane production in faunated and ciliate free cattle and its relationship with rumen volatile
fatty acid production. Br. J. Nutr. 52, 261275.
Wina, E., Muetze, S., Becker, K., 2006. The dynamics of major brolytic microbes and enzyme activity in the rumen in response to short- and long-term
feeding of Sapindus rarak saponins. J. Appl. Microbiol. 100, 114122.
Wina, E., Muetzel, S., Hoffmann, E., Makkar, H.P.S., Becker, K., 2005. Saponins containing methanol extract of Sapindus rarak affect microbial fermentation,
microbial activity and microbial community structure in vitro. Anim. Feed Sci. Technol. 121, 159174.
Yuan, Z.P., Zhang, C.M., Zhou, L., Zou, C.X., Guo, Y.Q., Li, W.T., Liu, J.X., Wu, Y.M., 2007. Inhibition of methanogenesis by tea saponin and tea saponin plus
disodium fumarate in sheep. J. Anim. Feed Sci. 7 (Suppl. 2), 560565.
Zoetendal, E.G., Akkermans, A.D.L., De Vos, W.M., 1998. Temperature gradient gel electrophoresis analysis of 16S rRNA from human fecal samples reveals
stable and host-specic communities of active bacteria. Appl. Environ. Microbiol. 64, 38543859.