Lecture 11 - Lecture 11 - Genomics and Genetic Engineering

Mutations can be spontaneous or induced

o Mutations can occur spontaneously as result of natural biological processes
o Mutations can be induced by external factors such as chemicals or radiation
o Some types of induced mutations:
DNA replication errors (point mutation)
DNA replication slippage (small insertions or deletions)
Tautomeric shifts (point mutations)
Change in base pairing
Depurination and Deamination
Change in base pairing
o Induced mutations caused by mutagens
Base analogs
Alkylating Agents
Ultraviolet light
Ionizing radiation
Several Different DNA Repair Systems Counteract Mutations
o Proofreading and Mismatch Repair
DNA Polymerase III in bacteria
Error rate of 1 mistake in 100000 bases
However, polymerase proofreads and corrects 99% of these errors
Final error rate of 1 mistake in 10000000 bases
Mismatch Repair: incorrect nucleotide is removed
Polymerase distinguishes old and new strands by methylation
How to Determine whether Compound is Mutagenic?
o Not ethical to test humans
o Can test animals, but questionable ethically and can be inefficient
o So many chemicals to test
Natural and synthetic chemicals
Chemicals used in food, pharmaceuticals, herbicides, pesticides, etc.
Turn to Bacteria: Useful for genetic studies
Ames Test
o Assess mutagenicity of compounds
o Special strains of Salmonella bacteria reveal presence of specific types of
o
o
o
o

mutations
His-auxotroph strain that has mutation can be corrected by substitution
His-auxotroph strain that has mutation that can be corrected by frameshift
Etc
Process:
1) Add mixture to filter paper disk
2) Spread bacteria on agar medium without what its lacking

3) Place disk on surface of medium

4) Incubate at 37oC
If there are more survivors than there should be, the stuff you put on the
filter paper disk is indeed a mutagen for creating what the bacteria was

lacking
What is Genomics?
o Genome: Complete set of DNA sequences in single cell of an organism
o Genomics: Study of genomes, involves the sequencing, analysis, and comparison
of entire genomes
How to Sequence Genome?
o Clone-by-Clone (or map-based) method
Cut DNA into smaller and smaller chunks and analyze them
o Whole-Genome Shotgun method
Cut up DNA into bunch of little pieces, and throw them all into computer
algorithms to try to match stuff
o Sequence Alignment
Look for parts that overlap, and attach them at the overlap
E.g. ATATATATATATATGCCC and GCCCATATATATATA
ATATATATATATATGCCCATATATATATA
Sequence Annotation
o Annotation is the process of identifying
Genes
Their regulatory sequences
Their functions
o BLAST is a program that compares a segment of genomic DNA to sequences
throughout major databases to identify portions that align with or are same as

existing sequences
o Bioinformatic annotation of genomes can reveal new genes
Major Features of the Human Genome
o The human genome contains 3.1 billion nucleotides, but protein-coding sequences
make up only about 2% of genome
o Genome sequence is ~99.9% similar in individuals of all nationalities
Single Nucleotide Polymorphisms (SNPs) and Copy Number Variations
(CNVs) account for genome diversity from person to person
o The genome is dynamic

At least 50% of genome is derived from transposable elements, such as

LINE and Alu sequences, and other repetitive DNA sequences

o The human genome contains ~20,000 protein-coding genes, far fewer than
predicted number of 80,000-100,000 genes
o Average size of human gene is ~25 kb including gene regulatory regions, introns,
and exons
On average, mRNAs produced by human genes are ~3000 nt long
o Many human genes produce more than 1 protein through alternative splicing, thus
enabling human cells to produce much larger # of proteins (perhaps ~200,000)
from only ~20,000 genes
o More than 50% of human genes show high degree of sequence similarity to genes
in other organisms
However, more than 40% of genes identified have no known molecular
function
o Genes are not uniformly distributed on the 24 human chromosomes
Gene-rich clusters are separated by gene-poor deserts that account for
20% of genome
Deserts correlate with G bands seen in stained chromosomes
o Human genes are larger and contain more and larger introns than genes in
genomes of invertebrates
Numbed of introns in human genes ranges from 0 (in histone genes) to

234 (in gene for titin, which encodes a muscle protein)

Comparative Genomics
o Differences between species
o Complete sequences of various organisms show # of genes humans share w/ other
species very high, ranging from ~30% of genes in yeast to ~80% in mice and

~98% in chimps
o Many mutated genes involved in human diseases also present in model organisms
o Major difference between us and chimps
Additional -omics
o Transcriptions: Analysis of all expressed genes in a cell/tissue
o Proteomics: Analysis of all proteins in cell/tissue
o Glycomics: Analysis of all carbohydrates in cell/tissue

What can we do with the human genome?

o Use linkage analysis to determine which mutant alleles cause which diseases
o Increased knowledge about causes of disease facilitates genetic screening
o Increased knowledge about causes of disease may permit gene therapy
How can we see DNA?
o Separate out differently sized DNA fragments with agarose gels
Smaller pieces go through gel faster
o Can stain w/ dyes that fluoresce when bound to any DNA
o Can stain w/ fluorescent/radioactive pieces of DNA that will bind specifically to
particular sequence of DNA
Longer pieces of DNA are closer to where you put in DNA
Shorter pieces of DNA are further from where you put in DNA
Remember: Bigger things cant travel as far, thats why
Restriction Enzymes
o Molecular scissors for cutting DNA
o Enzymes cut DNA at specific sites
o Cutting DNA into pieces that can be analyzed on a gel
o These DNA analysis techniques create molecular markers
- becomes =
Practical Uses for DNA Markers
o Mapping: Use genetic variation in DNA markers to map traits to defined locations
in genome
o Genetic Testing: Use genetic variation in DNA markers to determine whether
individual carries particular trait
o Forensics: Use genetic variation in DNA markers to link individuals to tissue
samples
o Microsatellite Markers: Genetic variation in repeat length
Many regions of genome have repeats of nucleotides
# of repeats can vary between individuals
Amplify this region (with PCR) and look at size on gel
Use these markers for mapping, forensics, etc.
o Restriction Fragment Length Polymorphisms (RFLPs): Genetic variation in
restriction enzyme sites
If homozygous with bigger version of allele, _
If homozygous with smaller version of allele, _
If heterozygous (both, =
So: - - =

o Single Nucleotide Polymorphisms (SNPs): Genetic variation at single nucleotide

level

Change in a single nucleotide

E.g. AAGGTTA to ATGGTTA
Change can be detected in several ways
If it changes a restriction site can detect by digesting DNA and
running on a gel
o SNP/snip
Sequencing: becoming more common
SNPs in Humans: useful landmarks
~3 million spread throughout genome
On average, found in >1% of population
o Part of definition of a SNP (vs. a mutation)
Usually in non-coding DNA (only 3-5% of DNA codes for proteins

in humans)
Evolution of Gene Mapping Methods
o Classical Mapping using visible phenotypes
E.g. fruit flies (white/red eyes)
Limited by genes, obvious phenotypes
o DNA Markers
Landmarks along chromosome
Look at DNA within genes or between genes
o Allows much finer resolution mapping
o Dont need obvious visible phenotype
As always, need to be heterozygous at both loci to be analyzed
How most modern genetic mapping is done
Using DNA Markers for Forensic Analysis
o Compare DNA marker profile in individual and in tissue sample
o Use microsatellites (also called short tandem repeats of STRs)
o The FBI has selected a core set of 13 STRs for CODIS
Comparisons of Individual Human Genomes can Reveal Genetic Basis for Traits
o Genome-wide Association Studies (GWAS) have resulted in >700 publications
linking >3000 genetic variations to >150 traits
o GWAS compares the genomes of thousands of unrelated individuals with a
particular disease to genomes of those without the disease to identify variation
that may confer risk

o Genome Scanning allows analysis of DNA for dozens or hundreds of disease

alleles, including those predisposing a person to heart attacks, asthma, diabetes,

Alzheimer disease, and other genetically defined disease subtypes

Pharmacogenomics can facilitate personalized medicine