Communication THEJOURNAL OF BIOLOGICAL CHEMISTRY

Vol. 268, No. 28, Issue of October 5,pp. 20687-20690, 1993

0 1993 by The American Society for Biochemistry and Molecular Biology; Inc.
Printed in U.S.A.

A Helix-Loop-Helix Transcription trait may be observed. The most frequently studied mutations
produce either sterility(3-5) or embryonic lethality (6-8). Dra-
Factor-like Gene Is Located at matic structural defects such as limb deformities (9, 10) have
been observed, as well as animals exhibiting short stature (11)
the mi Locus and pigmentation disorders (12, 13) such as the microphthal-
mia phenotype. Successful cloning of genes disruptedby inser-
(Received for publication, July 23, 1993, and in revised form,
August 9, 1993) tional events hasbeen reported for several mutant lines. One of
the genes isolated in such studies had been previously charac-
Michael J. Hughes, Jerry 3 Lingrel, terized, but its full functional activity in the mouse had not
Joan M. Krakowskyt, and Kathleen P. Anderson5
been appreciated until the insertional mutant was discovered
From the Department of Molecular Genetics, and analyzed (14). Other genes from insertion sites havebeen
Biochemistry and Microbiology, University of
Cincinnati, Cincinnati, Ohio 45267-0524
cloned and sequenced and do not correspond to any genes or
proteins currently in the data base; thus, they represent novel
The mouse microphthalmia phenotype is complex and genes (15-18).
consists of one or more of the following phenotypic al- Themousemicrophthalmia ( m i ) locus wasoriginally de-
terations: a lackof pigmentation, smalleyes, a mastcell scribed in 1948 (19);there arenow ll allelic variations (20). We
defect, and bone abnormalities. Thelocus for this allele have recently described another allelic form,termed mi, that
has been assigned to chromosome 6. A single gene defect arose as an insertional mutation (13).Backcrossing and link-
that produces such a pleiotropic effect has suggested age studies have assigned the gene for mi to mouse chromo-
some involvement at a control point in development. some 6 (20) in a region that is syntenic with the human chro-
Recently a mutant line of mice carrying atransgene in- mosome 1Oq (21). The general phenotype of microphthalmic
sertion, which represents a new allelic form of mi, was mice includes defective ocular development, lackof pigment in
described. The integration site of the transgene from the fur, osteopetrosis, and a defect in mast cell function. Al-
these mi*s mice was cloned and analyzed. An exon se-
though the locus is named for the eye defect, this incomplete
quence was discovered adjacent to the insertion. Com-
puter analysis of this nucleotide sequence revealed the ocular development is one of the least understood aspects of
presence of a motif indicative of the helix-loop-helix this mutation. The osteopetrosis in some of these animals re-
class of transcription factors. The gene was expressed in sults from a failure in bone remodeling that involves the re-
a number oftissues from wild type animals but was ab- sorption of calcified cartilage and bone matrix. The basis for
sent in the tissue RNA from m i 9 mice. Southern blot this defect in the m i mice has been traced to the osteoclasts
analysis demonstrated adeletion of some of thegenetic (22). The presence of an intrinsic cellulardefect has also been
material forthis gene in the mi*K mice. Thisis consistent established for the mi mast cells (23). Mast cells exhibit a
with the lack of expression in the mifB mice. Interest- proliferative response either to interleukins secreted by T cells
ingly, when DNA from other mi allelic variants was sub- (e.g. IL-3l and IL-4) or to cell contact with mouse embryo fi-
jected to a similar analysis, a deletion was also observed broblasts (MEF). In mi mice, the growth response to condi-
in this gene in two other mi lines. Taken together,these tioned medium from T cell lines is intact, but mi mast cells fail
data suggest that the gene encoding this new helix-loop- to grow when co-cultured with normalMEF. The evidence that
helix DNA-binding protein, and residing in the mi locus, this is a function of the mi mast cells is derived from experi-
is a strong candidate for the mi gene. ments in which mi skin fibroblasts were used as the feeder
layer for normal mast cells (23). These mi cells were able to
support the growthof the wild type mast cells. Thus, the mast
A number of recognizable phenotypes have been discovered cell deficiency in themi mutations isbelieved to be the resultof
over the past 10 years as a result of the generation of inser- a defect in the mastcell response.
tional mutants(1,2). The majorityof these studies have arisen Over the last 2 years a very intriguing association has been
from the breedingof transgenic mice. Although the insertionof made between the mi locus and three other mouse mutants:
the transgene usually occurs in a region of DNA that has no Dominant spotting (W), Steel (SZ), and osteopetrosis ( o p ) .The
apparent biological activity, occasionally the DNA integrates phenotypic traits of these mutantsoverlap withmi and suggest
into or near a gene that plays an important functional role. an importantrole for the mi gene in the transduction of extra-
Most of these mutations arerecessive and are not observed in cellular signals for the developmental fate of various cell lin-
a hemizygous mouse that carries one copy of the normal gene eages (24). This model has evolved since the recent identifica-
and one copyof the disrupted gene. When these transgenic tion and cloning of the genesfor the W, SI, and op defects. The
animals are mated to give homozygous mice a novel genetic gene residingat the W locus is c-kit, a transmembrane tyrosine
kinase receptor (25), and theSI locus encodes the ligandfor this
* This work was supported by National Institutes of Health Grant receptor, mast cell growth factor (26-28). This receptor-ligand
39585 and by the American Cancer Society (Ohio chapter). The costs of association confirmed the biological data, which had indicated
publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked aduertisement that while the W and S1 mice exhibited identical phenotypes
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. consisting of pigmentation defects, mast cell deficiencies, ane-
The nucleotide sequence(s) reported in this paper has been submitted mia, and often sterility, the mutation in theW mice was dem-
to the GenBankTMIEMBL Data Bank with accession number(s1 L22958. onstrated to cause an intrinsic cellular defect, while cells of the
t Present address: Marion Merrell Dow Inc., 2110 E. Galbraith Rd.,
Cincinnati, OH 45215-6300.
5 To whom correspondence should be addressed. Tel.: 513-558-5458; The abbreviations used are: IL, interleukin; MEF, mouse embryo
Fax: 513-558-8474. fibroblasts; HLH, helix-loop-helix; kb, kilobase(s).

20687
20688 Helix-Loop-Helix Gene Resides at the mi Locus
SI mice appeared to lack an appropriate environmentfor nor- Transgene (6X)
mal functioning. The third mouse mutation related to mi is 1.1 -36 kb 0.8 2.5

referred to as op for osteopetrosis. The gene cloned from this

locus encodes the macrophage colony-stimulating factor 1(29,
30). Interestingly, this growth factor is a ligand for c-fms, an- FIG.1. Schematic d i a g r a m of the transgene insertion. Six copies
of the 6-kb human A y transgene aredenoted by the light stippled area.
other transmembrane tyrosine kinase receptor. The 1.1-kb nonrepetitive fragment was isolatedfrom clones represent-
In this reportwe have analyzed the mi@insertional mutant ing the 5 end of the insertion. The0.8- and 2.5-kb junction fragments
and discovered a transcription factor-like gene with a helix- are diagrammed 3 of the transgene. The exon identified by the GRAIL
program is marked by a black box.
loop-helix motif that is interrupted by the transgene insertion.
The helix-loop-helix (HLH) structure hasbeen used todefine a
family of DNA-binding proteins which include MyoD (31),myo- mouse genomic library in the h DASH vector with DNAisolated
genin (321, the proteins encoded by the protooncogenes c-myc, from mice carrying the insertion in the microphthalmia locus.
N-myc, and L-myc (311, and several proteins thatbind immu- This library was screened with the globin gene to isolate DNA
noglobulin enhancer sequences (E47, E12, TFE3, and TFEB) in the region of the transgene. Six positive clones were ob-
(33-35). The DNA consensus sequence for this family of tran- tained. Mapping of the insertsfrom these positive recombinant
scription factors is termed the E-box and was actually derived phage was performed in order to identify junction fragments
from these immunoglobulin enhancer sequences. The HLH pro- carrying sequences from both the globin transgene and mouse
teins function as dimers, with apparent differential activities genomic DNA. Such sequences define the border of the trans-
gene insertion and should therefore reside in or close to the
depending on whether the formation is a homodimer or a het-
microphthalmia gene. Nonrepetitive fragments from these
erodimer with another HLH protein (36).We describe here the
junction regions were isolated. The map of the insertion site,
identification of a new gene encoding a HLH motif that is
including these junction fragments, isshown in Fig. 1.
located at the mi locus.
The 0.8- and 2.5-kb EcoRI fragments on the 3border of the
MATERIALS AND METHODS insertion havebeen mapped to themi locus on mouse chromo-
Library Screenings-DNA from mice hemizygous for mifginsertional
some 6 using recombinant inbred strain analysis as well as
mutation was used to generate a genomic library using the A Dash backcross analysk2 The 1.1-kb fragment from the 5junction
vector (Stratagene, La Jolla, CAI. The library was screened according to of the transgene insertion was similarly analyzed; however,
themanufacturers protocol withthehumantransgene.Junction this locus was found to map t o mouse chromosome 1. We have
fragments free of repetitive elements 5 and3 to the transgene insert not yet determined whether thereis a n additional insertion of
were isolated from thepositive phage clones. a small amount of chromosome 1 material at the site of the
An oligo(dT)-primed mouse heart cDNA library in hgtll (Clontech, transgeneinsertion. Alternatively, a translocation between
Palo Alto, CA) was plated to a densityof 10,000 plaque-forming units/
chromosomes 1 and 6 could have occurred at the time of the
plate. An 858-base pair BanI fragment containing a putativeexon se-
quence was isolated from the 2.5-kb genomic junction fragment for use transgene insertion, although no gross chromosomal abnor-
a s a probe. malities were observed with Giemsa banding.3 Examples of
Nucleotide Sequencing and Computer Analysis-The genomic junc- each of these events hasbeen observed in the pastwith inser-
tion fragments were isolated and subcloned into pBS (Stratagene), and tional mutations (6, 7, 39). Regardless of which event has oc-
the clones were sequenced on a n Applied Biosystems model 373 DNA curred, themi@insertional mutationwe have identified exhib-
sequenator (Applied Biosystems, Inc., Foster City, CAI using the Taq its themi phenotype and complementation studies haveshown
DyeDeoxy sequencing protocol with dye-labeled terminators. GRAIL
that it is allelic with known mi mutations (13). The 0.8- and
computer algorithms (Oak Ridge National Laboratory) were used t o
determine the presenceof possible exons. Clones fromthe mouse heart 2.5-kb flanking markers that map to themi locus were there-
cDNA library wereexcised from the h g t l l vector and subcloned prior to fore subjected to further analysis.
a similar sequence analysis. Sequence comparisons were carried out Nucleotide sequence analysis was performed on these junc-
against the EMBL data base. Sequence alignments were carried out tion fragments, and computer analysis of the data indicated
using DNAnalyze (37) nucleotide analysis software. there were several open reading frames in the 2.5-kb sequence.
RNA Preparation a n d Northern Blot Analysis-Total RNA was iso- This sequence was submitted to the OakRidge National Labo-
lated using the method described by Chomczynski and Sacchi (38).
Poly(A) RNA was isolated on oligo(dT) columns from total RNA. Probes
ratory for analysis with the GRAIL computer program (40).
generated from the mis genomic BanI fragment or from the partial This software not only searches for exons within a sequence
cDNA clone were used t o screen the blots. based on open readingframes,but alsoconsiders certain
Genomic Southern Blot Analysis-DNA was isolated from segments nucleotide patterns that are more common in exons. All the
of the tails from mi,Miwk,mi*, mi@ andC57B16 mice and used for information is fed through neural networks and possible exons
Southern blot analysis as previously described (13). The cDNA isolated are identified and scored as marginal, Ugood,or excellent.
from the mouse heart cDNA library was used as a probe. Three potential exons were reported for the 2.5-kb fragment.
Mice-Animals were housed under standard conditions, and all ani-
mals were given rodent lab chow ad libitum. Those lacking incisors One was categorized as marginal, one was good, and one was
were provided withpowdered rodent chow. listed as excellent. Analysis of this nucleotide sequence data
was continued by comparing the sequences against the EMBL
RESULTS AND DISCUSSION data base and resulted ina very interesting match.An align-
We have previously described a new allele at the mi locus ment wasobserved at the nucleotide and amino acid level with
that was produced as an insertional mutant from the breeding a transcription factor, TFE3 (34). Moreover, the region of align-
of transgenic mice. When hemizygous transgenic animalsfrom ment spans a conserved HLH motif. This alignment between
a particular line were bred, the resulting homozygous pups the sequence derived from the fragment flanking the insertion
exhibited microphthalmia and alterations in thepigmentation at the mi locus and the HLH transcription factor TFE3 is
of their fur and eyes. This insertional mutant wasdesignated shown in Fig. 2 A . While the degree of similarity is significant,
mi@ (13).The great advantage of such an insertional mutant is76.7% identity at the nucleotide level and 72.7% at the amino
that the line arose from the integration of known exogenous acid level, a n exact match was not observed. Alignments with
DNA, in thiscase, a human globin transgene. Thisglobin gene
thus serves as a tag for the direct cloning of genomic sequences R. W. Elliot and J. M. Krakowsky, unpublished observations.
flanking the insertion site. We therefore prepareda transgenic J. J. Lee and J.M. Krakowsky, unpublished observations.
 Helix-Loop-Helix Gene Resides at the mi Locus 20689
A
miHLH n.t. GACATGCGGTGGAACAAGGGAACCATTCTCAAGGCCTCTGTGGACTACATCCGGAAGTTGCAACGGGAACAGCAACGA
...............................................................
...............................................................
HUMTFE3 n . t . GAGATGCGCTGGACATCCTGAAGGCCTCTGTGGATTATATCCGCAAGCTGCAGAAGGAGCAGCAGCGC

FIG. 2. Nucleotide and amino acid HUMTFE3 a.a. GluMetArgTrpAsnLySGlyThrIleLeuLysAlaSerValAspTyrIleArgLysLeuGlnLysGluGlnGlnArg

sequence comparisons of mi HLH.
Panel A illustrates thenucleotide and de-
duced amino acid sequence of a HLH re-
gion of the gene interrupted in the mi" miHLH n.t. GCTAAGGACCTTGARAACCGACAGAAGAAGCTGGAGCATGCGAACCGGCACCTGCTGCTCAGAGTACAG
mice. The sequence was obtained from the
................. ..............................
HUMTFE3 n.t. TCCAARGACCTGGAGAGCCGGCAGCGATCCCTGGAGCAGGCCAACCGCAGCCTGCAGCTCCGAATTCAG
2.5-kb junction fragment. This sequence
is aligned with TFE3, a gene encoding a HUMTFE3 a.a. SerLysAspLeuGlUSerAr~lnArgSerLeuGluGlnAlaAsnArgSerGluGlnGl~rgIleGln
HLH motif that binds the immunoglobu-
lin E box (35).This amino acid alignment
m i HLH a.a. Ala - - - - Asn - - LysLys - - His - - - HisLeuLeuLeu - Val -
is expanded in panel B to include three
B **********..*.**
additional HLH proteins. E2A (34) and
E47 (33) are proteins that also bind the mi "_"_"" DRWNKGTILKASVDYIRKLQRQQPAKDP
immunoglobulin enhancer sequence, and
......................................
hTFE3 -NLIERRRRFNIM)RIKELTLIPKSSDPEMRWNKGTIL~SVDYI~LQKE~RS~LESRQRSLEQ~SLQLRIQ
c-myc is a cellular protooncogene (41).The
E2A
. . .. . . . . . .. . . . . .. .. .. .. .. .. .. .. .. .. .. . .
NNARERLRVRDINEAFKEU;RMCPLHLNSEKPQTKLLILHQAVSVI--LNLEQQ------~~~-CL-E
one-letter amino acid code is used in the ..........................................
.......................................... .....
alignment. The amino acids highlighted E47 -NARERVRVRDINEAFRULKSDKAPTKLLILQQAV~VI--LLEQQ------~~-------------
by stars compose the second helix of the .. .. .. .. .. .. . . . . . . .
HLH motif. The boldface lettered amino c-uyc -NvLERQRRNELKRsFFALRQIPELE~~-~ILK~TAYI--------------------------------
acids correspond to a portion of the puta-
tive leucine zipper domain. Panel C shows C
the match between the same mi HLH ge- m i HLH genomic ATTGTCTTGTTTTATCACAGAGACATGCGGTGGAACAAGGGAACCATTCTCAAGGCCTCTGTGGACTA~TCCGGAAG
..........................................................
..........................................................
nomic sequence from panel A and thecor- mi HLH =DNA __------------_-____
AGACATGCGGTGGAACAAGGGAACCATTCTCAAGGCCTCTGTGGACTACATCCGGAAG
responding cDNA isolated from a mouse
heart library. m i HLH genomic TTGCAACGGWULCAGCAACGAGCTAAGGACCTTGARAACCGACAGAAGAAGCTGGAGCATGCGAACCGGCACCTGCTG
..............................................................................
..............................................................................
m i HLH CDNA T T G C M C G G G A A ~ G C A A C G A G C T A A G G A C C T T G A R A A C C T G

m i HLH genomic CTCAGAGTACAGGTATCCACCCTCTGCCATGTGAACTGATTTCAGGACAATA

...........
...........
mi HLH cDNA CTCAGAGTACA-----------------------------------------

other HLH proteins showed much less similarity, although sev- Li SI LI St Ki Ov Ut Lu He SM Sk Di Sp Br h

eral conserved amino acids were maintained, particularly in mi HLH 3
the helix region as shown in Fig. 2 B . This sequence from the mi
locus therefore most probably represents an uncharacterized
member of this HLH class of transcription factors. Importantly,
mTFE3 - &@@eaab .ma@
Fro. 3. Northern blotanalysis demonstratingexpression of the
Y x

the open reading frame involved in this data base alignment
corresponds to the putative exonic sequence scored as excellent
by the GRAIL algorithms.
Although the identification of the exon sequence by computer
comparison is highly suggestive of the interruption of a tran-
scribed gene at the site of the transgene insertion, more com-
pelling evidence was obtained from a Northern blot analysis.
Since the mi phenotype affects several different organ systems,
poly(A) RNAwas isolated from a variety of tissues for analysis.
A n 858-base pair BanI fragment containing the HLH exonic
sequence was isolated from the 2.5-kb EcoRIjunction fragment
used previously. This smaller fragment was used to probe the
poly(A) Northern blot. The results are shown in Fig. 3. An
approximately 5-kb transcript signal is apparent in RNA from
several tissues including heart, lung, and uterus. A cDNA clone
for mouse TFE3 wasused both as a control for the presence of
RNA in the samples where the mi signal is weak and to dem-
onstrate thatTFE3 and mi encode nonidentical transcripts.
Based on the resultsof this Northern analysis, a mouse heart
cDNA library was screened with the BanI exonic probe. T w o
positive clones were isolated. Nucleotide sequence analysis
from a partial clone is an identical match to the genomic se-
quence of the 2.5-kb junction fragment. This alignment is
shown in Fig. 2C.We have therefore isolated a partial cDNA
encoded by a gene at themi locus and apparently interrupted
by a transgene insertion. As confirmation of this, poly(A) RNA
was prepared from the heartsof normal mice and from the mi@
mice. A Northern analysis was performed using the partial
cDNA as a probe. Fig. 4 shows the resultsof this analysis. As
expected, a strong signal is observed with the normal mouse
heart, while a very faint, truncated transcript isvisible in the
mi@heart RNA. This cDNA therefore recognized a transcript
that isaltered in the mi@microphthalmic animals.
mi HLH gene in several adult mouse tissues. One pg of poly(A)
RNA was used in each lane. A cDNA for mouse TFE3 was used as a
control probe. The tissue survey included: liver (Li), small intestine
(SI), large intestine (LZ), stomach (St),kidney (Ki),ovary (Ou),uterus
( U t ) ,lung (Lu), heart (He),skeletal muscle (SM), skin (Sk),diaphragm
(Di), spleen ( S p ) ,and brain (Br).
One problem that hasbeen encountered during the analysis
of insertional mutationsis the finding of deletions that accom-
pany the integration of the transgene (6, 7). It was possible,
therefore, that thegene we had identified as being interrupted
by the transgene insertion was fortuitously present at thebor-
der of the integration while the actual mi gene had been deleted
in theprocess. An approach to eliminating this as a possibility
is thedemonstration of defects in thissame gene in other allelic
variants of mi. A Southern blot analysis was therefore per-
formed using DNA isolated from four different mi allelic lines.
These included mi", Miwh, miws, and our insertional line, mi@.
The rw,wh, and ws lines all arose spontaneously. The back-
ground for the mi- mice is the CBA strain, while Miwharose in
a DBA x C57BV6 hybrid and miws appeared in a mating of
C57BV6mice. Miwh and miws have been described as semi-
dominant mutations,though mi" is recessive (20). W o differ-
ent restriction enzymes were used in theSouthern blot analysis
of DNA from these mice and from a C57BV6 mouse included as
a control. The Southern blot was probed with the partialcDNA
isolated from the heart library, and the results are shown in
Fig. 5. Several of the genomic bands hybridizing to the cDNA
are absent from the mi'g DNA, indicating that a deletion of
some material has occurred uponintegration of the transgene.
More importantly, however, is the deletion of material in the
allelic variants miws and mi". A different pattern with the
DNA from these linesis observed with both restriction enzyme
20690 Helix-Loop-Helix Gene Resides at the mi Locus
Acknowledgments-We thank Stephanie Shaw for assistance with
the Northern blot analysis.We thank Dr. Ray Boissy for supplying mi
allelic variant animals for the Southern blot analysis.
We are grateful to
Drs. Rosemary Elliotand JamesJ. Lee for sharing unpublished results.
We thank Dr. Muther Periasamy for the generous giff of the mouse
mi-HLH heart cDNA library. We thank Jon Neuman forhelpful discussions and
for assistance in caring for the transgenic animals.

al-NKA ug REFERENCES
1. Meisler, M. H. (1992) ?"ends Genet. 8,341-344
2. Reith, A. D., and Bernstein, A. (1991) Genes & Deu. 5, 1115-1123
3. Magram, J., andBishop, J. M. (1991)Proc. Natl. Acad.Sci. U.S. A . 88,10327-
FIG.4. The mi HLH gene is not expressed in the hearts of adult 10331
mi'# mice. Northern blot analysis of 1 pg of poly(A) RNA from the 4. Merlino, G. T., Stahle, C. J., Happan, C., Linton, R., Mahon, K. A,, and Will-
hearts of a normal C57BV6 mouse and ami'"/rni'E mouse. Themi HLH ingham, M. C. (1991) Genes & Deu. 5,1395-1406
cDNA was used as a probe. A fragment from the mouse a1 Na,K-ATPase 5. Pellas, T.C., Ramachandran, B., Duncan, M., Pan, S. S.,Marone, M., and
cDNA was used asa control. Chada, K.(1991) Proc. Natl. Acad. Sci. U.S. A. 88,87874791
6. Radice, G., Lee, J. J., and Costantini, F. (1991) Development 111,801-811
7. Costantini, F., Radice, G., Lee, J. J., Chada, K. K., Perry, W., and Son, H. J.
(1989) Proc. Nucleic Acids Res. Mol, Biol. 36, 159-169
8. Mark, W. H., Signorelli, K., and Lacy, E. (1985) Cold Spring Harbor Symp.
Quant. B i d . 40, 453-463
9. Woychik,R. P., Stewart, T. A,, Lewis, L.G., DEustachio, P., and Leder, P.
(1985) Nature 318, 36-40
10. McNeish, J. D., Scott, W. J., and Potter, S. S.(1988) Science 241,837-839
11. Xiang, X.,Benson, K. F., and Chada, K. (1990) Science 248,967-969
12. Tachibana. M., Hara, T., Vyas, D., Hodgkinson, C., Fex, J., Grundfast,K., and
Amheiter, H. (1992) Mol. Cell. Neuiosci. 3, 433-445
13. Krakowsky, J. M.,Boissy, R. E., Neumann, J. C., and Lingrel, J. B (1993)
Pansgenic Res. 2, 14-20
14. Schneike, A,, Harbers, K., and Jaenisch, R. (1983) Nature 304, 315-320
15. Woychik, R. P., Maas, R. L., Zeller, R., Vogt, T. F., and Leder, P. (1990)Nature
346,850453
16. Gridley, T., Gray, D. A,, Orr-Weaver, T., Soriano, P., Barton, D. E., Francke. U.,
FIG.5. Southern blot analysis showing a deletion in the mi and Jaenisch, R. (1990) Development 109,235-242
HLH gene in threemi allelic variants.DNA was isolated from four 17. Weiher. H., Noda, T., Gray, D. A,, Sharpe,A. H., and Jaenisch,R. (1990)Cell 62,
mi allelic strains and thecontrol C57B116 strain (20). Ten pg of the DNA 187-192
was digested with either PstI or EcoRI. The blot was probed with the mi 18. Lee, J. J.. Radice, G., Perkins, C.P., and Costantini,F. (1992)Deuelopment 115,
HLH cDNA. 227-238
19. Gruneberg. H. (1948) J. Genet. 49, 1-13
20. Lyon, M. F., and Searle, A. G. (eds.) (1989) in Genetic Variants and Strains of
theLaboratoryMouse,, 2nd Ed., pp. 236-238, Oxford University Press,
digestions. The Southern analysis thus demonstrates a dele- Oxford
Hillyard, A.L., Doolittle, D.P., Davisson, M.T., and Boderick, T. H. (1992)
tion of material hybridizing to the putativemi cDNA in these 21. Locus Map ofMouse with Comparative Map Points ofHuman on Mouse, The
alleles. The Miwh line is indistinguishable from the C57BV6 Jackson Laboratory, Bar Harbor, ME
wild type in thisassay. This mutantmay therefore result from 22. Thesingh, C. W., and ScherR, J. P. (1985) Bone (Elmsford)6,43-52
23. Ebi, Y., Kasugai, T., Seino, Y., Onoue, H., Kanemoto, T., and Kitamura, Y.
a point mutation rather than a deletion at the mi locus. Thus, (1990) Blood 75,1247-1251
in addition to a deletion of the gene in the mitR mice, this 24. Dubreuil, P.. Forrester, L., Rottapel, R., Reedijk, M., Fujita, J., and Bernstein,
A. (1991) P m . Natl. Acad. Sci. U.S. A. 88,2341-2345
analysis also reveals a deletion in this HLH gene in other mi 25. Geissler, E. N., Ryan, M. E., and Housman, D.E. (1988) Cell 55,185-192
allelic variants. 26. Copeland, N. G., Gilbert, D. J., Cho, B. C., Donovan, P. J.. Jenkins, N.A.,
These results demonstrate that a gene encoding a helix-loop- Cosman, D.,Anderson,D., Lyman, S. D., and Williams, D. E. (1990)Cell 63,
175-183
helix motif resides at the mi locus. This gene is transcription- 27. Flanagan, J. G., and Leder, P. (1990) Cell 63.185-194
ally competent and isexpressed in several tissues. The gene is 28. Williams, D. E., Eisenman, J., Baird,A.. Rauch, C., VanNess. K., March, C. J.,
Park, L. S.,Martin, U., Mochizuki, D. Y., Boswell, H. S., Burgess, G . S.,
disrupted in the mi's allelic variant of mi as illustrated by Cosman, D., and Lyman, S. D. (1990) Cell 63,167-174
deletions in the Southern analysis and the alteredonsignal the 29. Yoshida, H., Hayashi, S. I., Kunisada, T., Ogawa, M.. Nishikawa, S.,Okamura,
H., Sudo,T., Shultz, L. D., and Nishikawa,S. I. (1990)Nature 345,442-444
Northern blot analysis of mouse heart RNA. Moreover, a dele- 30. Wiktor-Jedrzejczak. W., Bartocci, A,, Ferrante, A. W., Ahmed-Ansari, A., Sell,
tion was alsoobserved in this transcriptionfactor-like gene in K. W., Pollard, J. W., and Stanley,E.R. (199O)Proc. Natl. Acad.Sci. U.S. A.
mice carrying the miWRand mi" forms of the microphthalmia 87,4828-4832
S. J., Davis, R. L., Thayer, M. J., Cheng, P. F., Weintraub, H., and
mutation. This strongly supports the proposal that themi phe- 31. Tapscott,Lassar (1988) Science 242,405-411
notype, is caused by a mutation in this new member of the 32. Wright, W. E., Sasson, D. A., and Lin, V. K.(1989) Cell 56,607-617
helix-loop-helix family of DNA-binding proteins. Because the 33. Murre, C., McCaw, P. S.,and Baltimore, D. (1989) Cell 56, 777-783
34. Beckmann, H., Su, I. K., and Kadesh, T. (1990) Genes & Deu. 4, 167-179
phenotype involves several tissues resulting in pigmentation 35. Carr, C. S., and Sharp. P.A. (1990) Mol. Cell. Biol. 10,4384-4388
defects, mast cell defects, and osteopetrosis, i t is perhaps not 36. Murre, C., McCaw,P. S., Vaessin, H., Caudy, M.. Jan, L.Y., Jan, Y.N., Cabrera,
C. V., Buskin, J. N., Hauschka, S. D., Lassar, A.B., Weintraub, H., and
unusual to find the gene expressed in a number of tissues. In Baltimore, D. (1989) Cell 58,537-544
addition, i t is known that membersof this classof transcription 37. Wernke, G. R., and Thompson, R. L. (1989) Biophys. J. 55,390a
factors function as dimers, either with like subunits or with 38. Chomczynski, P., and Sacchi, N. (1987)Anal.Biochem. 162, 156-159
39. Francke, U., Hsieh, C.L., Kelly D., Lai, E., and Popko, B. (1992) Mamm.
other helix-loop-helix proteins.Afull understanding of the Genome 3,209-216
mechanism of action of the protein encoded by this gene from 40. Uberbacher, E. C., and Mural, R. J. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,
11261-11265
~~~.~
the mi locus may therefore also require theelucidation of the 41. Battey, J., Moulding, C., Taub, R., Murphy, W., Stewart, T., Potter, H., Lenoir,
~~~~~

partners with which i t interacts. G., and Leder, P. (1983) Cell 34,779-787