Lareiai7, pets 15.04.2009 PU30637ENGO uiciaeioe IMMUN PUSBSS7ENGO Available online at www.sciencedirect.com scrence @omzers ‘Biochemical and Biopbysical Research Communications 303 2003) 112. BBRC ww eievercomiocatey bore @ ‘ACADEMIC PRESS. Gliclazide protects pancreatic B-cells from damage by hydrogen peroxide Kiyoko Kimoto,* Kenji Suzuki,” Takako Kizaki,* Yoshiaki Hitomi,” Hitoshi Ishida,” Hidenori Katsuta,” Eisuke Itoh,” Tomomi Ookawara,° Keiichiro Suzuki,” Koichi Honke,’ and Hideki Ohno* * Departmen of Melecular Predictive Medicine and Sport Science. Kyori Unversity, School of Mec, Miaka, Tokyo 181-611, Japan * Thnd Deparment of Internal Melee, Kyorin Universi, Schl of Mede, Mlaka, Tokyo 18-8611, Japan Department of Biochemistry, Hyogo College of Medicine, Nishinomiya, Hyogo 663-8501, Japan 4 Department of Biochemistry, Osaka Untersty Graduate School of Medicine, Sata, Osaka 865.0871, Japan Recsved 6 Februaty 2003 Abstract ‘Oxidative stress is induced under diabetic conditions and possibly causes various forms of tissue damage in patients with dia- betes. Recently, it has become aware that susceptibility of pancreatic P-cells to oxidative stress contributes to the progressive de- terioration of fell function in type 2 diabetes. A hypoglycemic sulfonylurea, gliclazie, is known to be a general froe radical Scavenger and its beneficial effects on diabetic complications have been documented. In the present study, we investigated whether sliclazide could protect pancreatic B-cells from oxidative damage. One hundred and fifty uM hydrogen peroxide reduced viability of mouse MING preells to 29,3%, Addition of 24M gliclazide protected MIN6 cells from the cell death induced by H,0; to 55.9%. Giibenclamide, another widely used sulfonylurea, had no significant effets even at 104M. Nuclear chromatin staining analysis revetled that the preserved viability by gliclazide was due to inhibition of apoptosis. Hydrogen peroxide-induced expression of an anti-oxidative gone heme oxygenase-1 and stress genes A20 and p21°""™*"!, whose induction was suppressed by glclazide. These results suggest that glclazide reduces oxidative stress of f-cels by HO probably due to its radical scavenging activity. Gliclazide may be effective in preventing fells from the toxic action of reactive oxygen species in diabetes, (© 2003 Elsevier Science (USA). All rights reserved. ‘Keyword: Glaze; Diabetes; Sulfonslurea; Oxidative srs; f-Cels; Apoptosis Its well known that oxidative stress impairs various cellular functions and plays important roles in the pathophysiology of many diseases. Diabetic patients are exposed to oxidative stress and complications of diabe- tes seem to be mediated by oxidative stress. Hyperely- cemia is one of the main causes of oxidative stress in type 2 diabetes. Under hyperglycemia, the increased blood Jevel of various reducing sugars promotes protein slycation through the Maillard reaction, which consec- utively produces Schiff bases, Amadori products, and advanced glycation end products (AGEs). Reactive ox- rygen species (ROS) are formed in this process and ‘Corresponding author. Fax: +81-422-444427 small ves: suzukik(@syors-uas jp (K. Suzuki). trigger tissue damage. Recently, the progressive deteri- oration of frcell function in type 2 diabetes has been accounted for in the oxidative stress-induced tissue damage. Due to a relatively low expression level of anti- oxidant enzymes, f-cells are implicated to be vulnerable to oxidative stress as compared with other tissues [1]. In addition, oxidative stress is reported to enhance apop- tosis of P-cells and suppress insulin biosynthesis (2.3). It has also been shown that treatment of anti-oxidant chemicals, such as cysteine or N-acetylcysteine (NAC), provides some protection to feels both in vitro and in vivo {4.5} Glclazide, a second-gencration sulfonylurea, is used in the treatment of type 2 diabetes. It reduces blood slucose level by augmenting insulin release from (006-291,0045 - se font matter © 2003 Elsevier Science (LISA) Al rights reserved, oi10.1026890006-291(03)00310-3K Kimowo eta. Biochemical and Biophysical Research Commanications 303 (2003) 112-119, iy pancreatic islets. Besides its hypoglycemic effect, glcl ide has been shown to possess anti-oxidant properties such as inhibition of LDL oxidation and reduction of platelet reactivity (6,7) It appears that these anti-oxidant effects by gliclazide are independent of any effects of gly- ccemic control [8}. In this study, we investigated the effects of gliclazide on P-cell death induced by H:O2. Gliben- clamide, another hypoglycemic sulfonylurea, was used for comparative purposes. Our results show that glicla- Tide attenuates H;0;-induced oxidative stress on pan- creatic B-cells and maintains a higher cellular viability Materials and methods Materials. Glictzide was obtained from Dainippon Pharmaceuti- ‘al (Osaka, Japan), Glibenclumie was purchased from Sigma B= ‘chemicals (St.Louis, USA), Hochest 33342 end propidium iodide were from Dojn (Tokyo, Japan). MINS cls were provided by Prof, Junichi Miyazaki (Osaka University, Osaka, Japan). ‘Cell eultwe. MIN6 cells were grown in Dulbecco's modified Eagle's medium Q25mM glucose) equilibrated with 8% CO, and 98% air at 31°C as described (9). EDH assay. MING calls wore cultured on 48-vell microplates for two days, Hydrogen peroxide was added to the medium inthe absence for presence of various concentrations of glclzide or glibenclamide LDH activity was measured by using CytoTox 96 Non-Radioactive Cytotoxicity Assay Kit (Promega, Madison, USA), RNA extraction, DNA synthesis, and semiquantitative polymerase chain rection (PCR). Total RNA was extracted from MING calls by ‘sing TRIzol reagent (Invitrogen, Carlsbad, USA) according to the ‘manufacturer’ instruction. After quantification by spectrophotome tty, 2g RNA was revers-transcnbed into cDNA at 42°C for 1h using an RTGRT-PCR Kit (Amersham Biosciences, Piscataway, USA), In 10mM Tris-Cl (pH 8.3), SOmM KCI, 1.5mM MgC, 0.2mM dNTP, 05yM primers, and $Ulml TaKaRa Tag DNA polymerase, PCR was carried out by cyting of 305 at 94°C, 20s at the annealing temperature indicated in Table 1, and I min at 72°C. PCR products wore separated on 2% agarose gel in TAE buf, Intensity of the bands was quantitated with MacWorks Analysis Software (UVP, Upland, USA) [Nuclear clnomatin staining. Mochest 33342 (1. ug) and prop: dium iodide (PE; 3pp/ml) were used to detect diferences between formal and apoptotic nuclei as described previously {10} Calls were Stained with a mixture ofthe wo dyes for 10min and washed with PBS. before examination by fuorescence microscopy with excitation at ‘465mm, HO342 freely passes through cell membranes and stains ou clear DNA blue when visualized under the fluorescent microscope Tet plasma merbeanes are impermeable to Pl, which only enters calls that have lot integrity oftheir ell membrancs, and stains DNA. red. Apoptotic cls were idemied by the presence of condensed oF fragmented nucle stained ether Bue or pink depending on the stage of the proces. Statstcal analyte. All esl ate presented as means SEM. For ‘multiple comparisons, a analysis of variance (ANOVA) was carried ‘out, followed by Fisher's protected last significant difleence test a6 3 post hoc test (StatView, SAS Institute, Cary, USA). A valve of P< 0.05 was considered significant. ‘Table 1 Sequences of primers and PCR conditions Gene Forwardrevene Primer sequence ‘Annealing (6) Produc se p) Calne F ‘TCTGCAGATACCTGTGAACTG o 387 R TAGTCAGGGTGGACGTCAGTG Glutathione peroxidase F CTCGGTTTCCCGTGCAATCAG 6 a1 R (GIGCAGCCAGTAATCACCAAG sop! F TIAACTGAAGGCCAGCATGGG @ 335 R ATCACTCCACAGGCCAAGCGG sopz F TGCACCACAGCAAGCACCATG 55 a3 R CTCCCACACGTCAATCOCCAG. Ho FE ATaccccacTeracrreccra @ 309 R TIGOTGGGGCTGTCOATGTTCG Bela F ceteacarerrcrecrre ss 169 R AGAAGTCATECCCAGCCe Bax F CAGGATCGAGCAGGGAGGATGG 8s an R GATQGTCACTGTCTGCCATGTG ra F TIGIGTTTCAGCCACAGGCACCATG = 263 R ACCCAGGGCTCAGGTAGACCITG An F ‘TITGAGCAATATGCGGAAAGC © a R AGTTGTCCCATICGTCATTCC Heat shock protein 70, ACGCAGACCTTCACCACCE © a ® cacteaaTerectccrta Cyst F AGCACTGGAGAGAAAGGATT @ 290 R CACAATGTICATGCCTTCTT forward: R, reverse14 Kioto etal. 1 Biochemical and Biophysical Rescarch Communications 303 (203) 112-119 Results In order to assess the protective effect of gliclazide on pancreatic p-cells against the oxidative stress, LDH as- say of MING cells was conducted (Fig. 1). Exposure to 150M H,O; for 6h reduced the viability of MIN6 cells to 29.3%, Addition of 24M gliclazide protected MING cells from the cell death induced by H:0- to 55.9% (A).. Protective effect of gliclazide was significant at 0.5- 104M. Glibenclamide had no significant effect even at 10uM. Enhanced viability by gliclazide was significant from 6 to I8h after H3O2 addition (B). One to five uM liclazide showed a protective effect against damage ‘caused by higher concentrations (150 and 200uM) of 1,0; (©). DNA binding dyes, PI and HO342, were used for nuclear double staining (Fig. 2). In control MING cells, no chromatin condensation or nuclear fragmentation was evident (A). In contrast, the nucleus of MIN6 cells, exposed to 150M H,O; exhibited condensed chroma- tin (B), which is characteristic of apoptosis [11]. In the presence of 2uM gliclazide, the number of apoptotic cells showing condensed, bright chromatin was de- creased (C), suggesting that gliclazide confers resistance to B-cells by inhibiting apoptosis. Again, there was no significant effect observed with glibenclamide (D).. To evaluate the molecular mechanism involved in the freell protection by gliclazide against oxidative stress, MRNA levels of anti-oxidative enzymes were compared at oN cote 05) > (Fig. 3). At 3h after H,0; addition, the expression levels of glutathione peroxidase, not catalase, were markedly reduced. Neither gliclazide nor glibenclamide showed any effect on the reduction of glutathione peroxidase expression. On the other hand, both gliclazide and gli- benclamide induced the expression of catalase in the presence of H;0; as compared with the basal levels. No significant change of expression levels of SODI or SOD2 was evident by H;0:. Only in the presence of gliclazide, SODI mRNA was upregulated by the addi- tion of H:0;. Meanwhile, glibenclamide alone induced the expression of SOD? in the presence of H:0:. Hy- drogen peroxide markedly induced the expression of hheme oxygenase (HO)-I. This remarkable induction of HO-1 expression was also observed in the presence of glibenclamide; however, it was nearly suppressed by eliclazide. Next, the possible effects of gliclazide on the expres- sion of apoptosis-related genes were examined (Fig. 4). No significant effect by the sulfonylureas on the ex- pression of Bcl-2 and Bax was observed. The expression levels of the anti-apoptotic gene A20 and the cell eycle- related protein p21Ct/*4"! were significantly increased by adding H,0,, while the induetion was suppressed by gliclazide. No such suppression in p2I@P!/¥*"" or A20 mRNA was observed by the addition of glibenclamide. ‘The expression of heat shock protein (Hsp) 70 was in- creased by HzO:. This induction was significantly en- hanced by the addition of glibenclamide. Although the ig. 1. MING cell viability quantitated by LDH assay. (A) MING cells wore treated with 1S0uM HiO2 for 6h inthe presence of ether ecazide (aquare) or glibenclamide (crcl). Results are presented as means = SEM (n = 5) **P < 0.01 vs. vehicle treatment, *P < 005, ‘ibenclamide treatment. (B) MING cells were treated with 150M Hs i the bsence or presence of gliclazie qu SEM (1 lueated with HO; for 6h in the absense or presence of licazide or glibenclamide, Results are means 4 SEM (n= 3). *P-< 0.05, [solid line] oF 5 [dota line] uM). Results are presented as mean vohile treatment MP con va ) or glibenclamide (rele (0.5 '). *P-<005, **P < 00 vs. vehicle treatment, (C) MINS cols were P< 001M,K, Kimo eal | Biochemical and Biophysical Research Communications 303 (2003) 112-119 us Fig, 2. Ect of glitzigeon apoptotic ol death of MING cls induced by H,0. Ces were treated with 150M HO; fo 1h inthe presence (C) or absence (B) of 2uM gllasde. Cells were stained with HO342 and propidium iodide and visualized using a uoreseent microscope. Untreated ells (A) and H,O,-teated cells in the presence of 24M glibenclamide (D) are shown as a compatison. 120 Catala lation peronkase ‘01 160 wo | se 120 : { ~ = 0 Sie 4] 100 L relative expresso lve! () gag relive expression lve (4) relative expression bevel (4) 8 eli eae . a | » ° © ¢ ° we 6 ® omer woe vo ee c = * 120 * Peli le b I r 0 L 150 |: ic i. be rr re ove ee a RR Fig. 3. Changes in antioxidative enzyme gene expression levels in MINS cells reated with H:Os, Cells were treated with 150M 1303 for 3h in the presence or absence of 24M sulfonylurea before isolation of total RNA. mRNA levels were compared by semiquantitative RT-PCR, mRNA levels after normalization of the specific gene to cyclophilin are expressed af a percent of that of untreated calls. Values are means = SEM ( *P-<005, **P < 001. C, untreated; G, gliclazde;R, glibenclamide116 K. Kimoto etal. Biochemical and Biophysical Research Commmaications 303 (2003) 112-119 oa = a te : v0 ex z Pe i Ts } iy i: i is el it io i ° 5 we SSE EE mmo ee eet esi os . [i relive expression evel (36) BB relative expresion evel (16) “le eel T TP | so citcumcuebuninca| ec @ mol S ff tt Woe 5 $f Fig, 4, Changesin ses gene mRNA levels in MINS cells treated with HsO,, Cells were treated with 150)1M 10; for hin the presence o absence of uM sulfonylureas before isolation of total RNA. mRNA levls were compared by semiquantitative RT-PCR, mRNA level after normalization of the specie gene to eyclophil tmtreatedG, gcluzide,R, glibenclamide difference was not significant between “untreated” and “gliclazide-treated,” the induced expression level of Hsp70 in the presence of gliclazide was the lowest Discussion ‘There is increasing evidence to suggest that apoptosis is the main mode of B-cell death leading to type | dia- betes and that the destruction of fells is caused by the infiltration of lymphocytes into the pancreatic islets (12. On the other hand, itis also well documented that B- cells undergo apoptosis in type 2 diabetes [13,14]. In general, the apoptosis cascade is triggered by various kinds of stimuli such as DNA damage, cell cycle per- turbation, metabolic imbalance, withdrawal of growth factors, cytokines as well as oxidative stress. Possible sources of oxidative stress in diabetes include an in- creased production of ROS, especially from enhanced elycation, and decreased enzymatic or non-enzymatic, anti-oxidant defense systems. ROS participate in the toxic actions that lead to necrosis or apoptosis of the insulin-producing cells. Chronic hyperglycemia induces protein glycation and oxidative siress is increased in type 2 diabetes. The level of 8-hydroxy-2'-deoxyguano- are expresed asa percent ofthat of untreated ells. Values ae means + SEM (x 3). P< 008""P <001.C, sine was increased in mononuclear cells from the whole blood and urine of diabetic patients, suggesting that oxidative stress is induced in diabetic patients (11,15). It has also been reported that pancreatic Becells are oxi- datively stressed in diabetic GK rats [16]. Progressive impairment of P-cell function in type 2 diabetes has been demonstrated to be attributed to chronic hyperglycemia 117-19, For the purpose of glycemic contro! of patients with type 2 diabetes, hypoglycemic sulfonylureas have been widely used. Besides its metabolic effects, glclazide shows some non-metabolic effects that are specifically related to vascular diseases in diabetes. More specifi- cally, it is reported that pliclazide decreases the oxida- tion of LDL cholesterol and the adhesion of monocytes to endothelial cells induced by oxidatively modified LDL [7]. In addition, a clinical study documented a decline in the vasoconstrictor prostanoid TXA2 together with a decline in lipid peroxidation [20]. Since gliclazide has been shown to possess free radical scavenging ace tivity both in vitro and in vivo, these beneficial effects have been claimed to be due to its anti-oxidant prop- erties rather than to its hypoglycemic activity [21,22] However, litle is known about whether gliclazide has a protective effect on f-cells against oxidative stress.K Kimoto eal! Biochemical and Biophysical Research Communications 303 (2003) 112-119 uT In the present study, we have demonstrated that B- cell death induced by H202 is partially suppressed by the addition of gliclazide using MIN6 cells. Instead of B-cell-specifc toxins such as alloxan or streptozotocin, hhydrogen peroxide was used as a trigger of oxidative stress since it is known to act physiologically during most oxidative processes. Moreover, the destruction of B-cells in the present study occurred in a relatively short time period. Fluorescent microscopic analysis suggested that the induced viability of MING cells in the presence of gliclazide is due, in part, to inhibition of apoptosis Cellular anti-oxidant defense systems are composed of several different levels. Among them, the primary enzymatic defenses are conducted by SOD, which cat- alyzes the conversion of superoxide radicals into H:03, and by catalase and glutathione peroxidase, both of which eliminate HO: [I]. In pancreatic p-cells, these protective genes are expressed at low levels. The im- portance of the anti-oxidant enzymes in protection against the toxicity of ROS was confirmed by overex- pressing these genes in insulin-producing cells [23]. HO- 1, the inducible form of HO, is also suggested to play pivotal role in anti-oxidant defense in pancreatic fecells [24]. When oxidative stress was added to the cell, these anti-oxidative enzymes were induced as an adaptive re- sponse (23]. On the other hand, Tiedge et al. [25] re- ported that the induction of cellular stress by high glucose treatment did not affect anti-oxidant enzyme expression at 48h in rat pancreatic islets and RINmSF cells, In the present study, expression of HO-1 was markedly induced at 3h afier H2O2 addition, whereas slutathione peroxidase was reduced. There was no change induced by oxidative stress in expression of catalase, SODI, or SOD2, Such variations in response of anti-oxidant enzymes to oxidative stress may be due to the differences in the time-course and the applied stimuli, Gliclazide suppressed the changes in the ex- pression of both glutathione peroxidase and HO-1, suggesting that the compound decreased the oxidative stress toward MING cells. A protective effect was ob- served at the 4M level. Scott et al. (26] reported that Bliclazide shows a free radical scavenging activity in vitro at a comparative concentration. In addition to anti-oxidant genes, induction of stress gene expression is part of the adaptation of Becells to ‘oxidative stress, and the destruction of B-cells is medi- ated by an altered expression level of anti-apoptotic or pro-apoptotic genes. In many cell types. including, pancreatic cells, the onset of the apoptosis process is regulated by the relative abundance of Bcl2 and Bax. (27.28). Cycline-dependent kinase inhibitor p2icrWAF" "which is responsive to oxidative stress in B-cells, is shown to act as an inhibitor of apoptosis [5,29,30). The zine finger protein A20 is also reported to it apoptosis of islets, probably by blocking the nuclear factor-KB activation (31,32). At 3h after HO; stimulation, expression of neither Bel-2 nor Bax was ‘modified in MING cells, Both p21 and A20, however, ‘were significantly induced by oxidative stress. Again, this induction was completely suppressed by adding sliclazide, thereby suggesting that gliclazide attenuates oxidative stress to fells and thus protects them from apoptotic cell death. Since the involvement of oxidative stress in froell dysfunction and also complications in type 2 diabetes have been well recognized, the effect of supplementation with anti-oxidants on pancreatic f-cells has been inves- tigated in vitro and in vivo. Rasilainen et al. [33] re- ported the protective effect of extracellular cysteine on H,Or-induced oxidative stress in insulinoma RINmSF cells. In their system, the damage at higher concentra~ tions of HO; was not completely abolished by cysteine, which is consistent with our results. NAC and amino- guanidine prevented defective insulin gene expression induced by glucose toxicity in HIT-T15 cells. In Zucker diabetic fatty rats, these anti-oxidants ameliorate the progression of diabetes mellitus [4]. In combination with Vitamin C plus E, NAC exerts beneficial effects in dia- betic CSTBL/KsJ-db/db mice [5]. Increased P-cell mass im anti-oxidant-treated diabetic mice may prove the va- lidity of the hypothesis that apoptosis induced by oxi- dative stress in chronic hyperglycemia causes reduction of B-cell mass in type 2 diabetes. Since improved gly- cemic control also seems to be a beneficial factor to decrease oxidative stress in diabetic patients, a hypo- slycemic sulfonylurea gliclazide with possible anti-oxi- dant activities may have an enhanced therapeutic role. It is possible that suppression of apoptotic cell death induced by H,Or is mediated through some other effects of gliclazide that are not correlated with its rad- ical scavenging activity. Hypoglycemic sulfonylureas elicit insulin secretion by binding to the high affinity sulfonylurea receptor (SUR-1) that is part of the ATP- sensitive K* channel, with a resultant cell depolar- ization. Recently, there have been several reports which indicate that the agents augment Ca**-dependent insulin secretion via other mechanisms (34-36). In addition, Efanova et al, (37] reported that another sulfonylurea, tolbutamide, induces apoptosis in pancreatic cells at high glucose concentrations, indicating that sulfonyl- urea may have additional effects directly or indirectly connected to the programmed cell death pathways. Further studies will be needed to elucidate the molecular mechanisms involved in the freell protection by sliclazide. ‘The present study provides the first evidence for a protective effect of gliclazide on pancreatic Proells damaged by oxidative stress, but the underlying mech- anism remains to be clarified. Our data favor the view that the protective effects of gliclazide are derived from its anti-oxidative activity.ne K. Kimote etal | Biochemical und Biophysical Research Communications 303 (2003) 112-119 Acknowledgments ‘We thank Pro, Junichi Miyazaki (Osaka University) for providing MIN6 cell and Dr. Nobuko Miyazawa for excelent technical assis- lance. This study was supported by grant rom the Japanese Ministry ‘of Education, Culture, Sports, Science and Technology, and the Pro- motion and Mutual Aid Corporation for Private Schools of Japan, References (1). Lenzen, J. Drnkgern, M. Tiedge, Low antixidunt enzyme gene expression in pancreatic isles compared with various other mouse tissue, Poe Radic Biol. Med, 20 (196) 463-466, P]H. Kaseto, J. Fuji, T. Myint, N. Migazaws, K.N. Islam, ¥. Kawasaki, K. Suzuki, M. Nakamura, H, Teteumi, Y, Yama- sai, N. Taniguchi, Reducing sugars trigger oxidative modifca- tion'and apoptosis in pancreatic B-cells by provoking oxidative stress through the glycation reaction, Biochem. J. 320 (1996) 855-863, 1B) T. Matsuoka, ¥. Kalmoto, H. Watada, H. Kaneto, M. Kishim- oto, ¥. Unayahara, ¥. Fujten, T. Kamada, R. Kawamori, Y. ‘Yamasaki, Giycation-dependent, reactive oxygen speces-redi- ated suppression of the nsulin gene promoter activity sn HIT exis, J, Gin Invest. 99 (1997) 144-150, (1. Taka, CE Gleason, PO. Tran, JS. Harmon, RP. Roberson, Prevention of glucose toxicity in HIT-TIS celle and Zucker diabetic aty rats by aniondants, Proc. Nall Acad. Se USA 96 (199) 10857-10862 [5] H.Kaneto, Y. Kajimoto, J Miyagawa, T, Matsuo, Y. Fujtan, Y. Umayahara, T. Hanafusa, Y- Matsuzawe, Y. Yamasaki, M Hori, Benefeil efets of antioxidants in diabetes: possible protection of pancreatic fels against glucose toxicity, Diabetes 48 (999) 2398-2406 (6) PE, Jennings, NA. Scott, AR. Sanlabadi, JJ, Boch, Efects of alilazide on platelet reactivity and fre radicals in type Hl diabetic Palins: clinieal assessment, Metabolism 41 (1992) $36-S39, IMAC. Desfais, 0, Serr, G. Reniet, Glclazide decreases cll ‘mediated low-density lipoprotein (LDL) oxidation and reduces monocyte adhesion to endothsial cells induced by oxidatively ‘modifed LDL, Metabolism 46 (1997) 1150-1156, [8] PE. Jenninogs, LF. Belch, Free radical scavenging activity of sulfonylaress: « clinical asesment of the eet of glclaride, Metabolism 4 (S1) (2000) 23-26, [P]4. Miyazaki, K. Araki, E. Yamato, H. Ikegami, T. Asano, ¥. ‘Shibasaki, Y. Oka, K. Yamamura, Establishment of a pancreatic Bell ine that retains glucose inducible insulin seeetion: special reference to expression of glucose transporter isoforms, Endocri- ‘ology 127 (1980) 126-132, [10] A. Hooress, M. Van de Caste, G. Kloppel, D. Pipers, Giucose promotes survival of rat pancreatic Beals by activating synthesis of proteins which suppress 2 constitave apoptotic program, J. Clin Invest. 98 (1996) 1568-1574, [01] J. Leinonen, . Lehtimaki, 8. Toyokuni, K. Okada, T, Tanaka, H. Wii, H. Ochi, P. Laippala, V. Rantalaiho, 0. Wir, A, Pasternack, H.” Alho, New biomarker evidence of oxidative DNA damage in patients with nondasulin-dependent diubetes rls, FEBS Let, 417 (1997) 150-152, [02] TW, Kay, HLE. Thomas, LC. Harrison, J. Alison, The Bella autoimmune diabetes: many mechanisms and pathways of loss, Trends Endocrinol, Metab. 11 (2000) 11-15. (03) D, Porte J, Banting lecture 1950. f-Cel in type II diabetes ‘melts, Diabetes 40 (1991) 165-180, U4 RA. DeFronzo, RC. Bonadonns, E, Ferranini, Pathogenesis of NIDDM. A balanced overview, Diabetes Care 15 (1992) 318-368, (05) P, Dandona, K. Thusu, 8. Cook, B. Snyéer, J. Makowski, D. Amutrong, T. Nicotera, Oxidative damage to DNA in diabetes melts, Lancet 347 (1996) 444-495, (06) ¥. Thar, S. Toyokuni, K. Ushida, H. Okada, T. Tanah, H, Toda, H. Hisi, ¥. Seino, Y. Yamada, Hyperglycemia causes oxidative sues in pancreatic Bee of GK ras, a model of type 2 diabetes, Disbetes $8 (1999) 927-932 (07) RP. Robertson, HJ. Zhang, KL. Pyzdrowski, TF. Wale, reservation of insulin mRNA levels and insli secretion in HIT call by avoidance of chronic exposure to high glucose concen- ‘uations, J. Cli, Invest. 90 (1992) 320-325, [18] LiK, Olion, 1.8. Redmon, H.C, Towle, RP. Robertson, Chronic exposure of HIT calls to high glucose concentrations paradox cally decreases insulin gene traneription and ales binding of insulin gee regulatory protein, J. Clin. Invest 92 (1983) 514-519. U9] V. Poitou, LC Olson, RP. Robertson, Chronic exposure of FITC:6 cells to supraphysiologie concentrations of glucose de creases binding of the RIPE3b1 insulin gene transeription activator, J Clin, Invest. 97 (1996) 1081-1046, (20) D. Tessier, P. Maheus, A. Khalil, T. Fulop, Efects of glade versus metformin on the eiical profile and lipkd peroxidation markers in type 2 diabetes, Metabolism 48 (1999) 897-503. [21] ¥. Noda, A" Mori, L. Packer, Gkiclazide scavenges hydroxyl superonie and nitric oxide radials: an ESR study, Res. Com ‘mun. Mol. Pathol. Pharmacol. 96 (1997) 115-128. (22) R.C. Oren, M. Lao, N. Balas, J. Mercuri, Invitro and in vivo antioxidant properties of glad, J. Diabetes Complications 14 (2000) 201-206 [23] DAK. Laybutt, H. Kaneto, W. Hasenkamp, S. Grey... Jonas, D.C. Sproi,A. Grol, C. Ferran, 8. Bonner-Wei, A. Sharma, GC. ‘Weir, Increased expression of antioxidant and antiapoptotic genes in islets thet may contribute 10 fel survival during chronic Iyperalycemia, Diabetes $1 (2002) 13-423, [24] E. Tobiasch, L. Gunther, FH. Bach, Heme oxygenase! protects pancreatic B cells from apoptosis caused by various stimuli, J Trvest Med, 49 (2001) 566-571 [25] M. Tiedge, S Lortz, J. Drinkger, S. Lenzen, Relation between antioxidant enzyme gene expresion and antioxidative defense status ofinsuln-producing cls, Diabetes 46 (1997) 1733-1742. (26) NA. Scott, PLE. Jennings J. Brown, JJ. Belch, Glicaxde: « tener fee radical scavenger, Eur J. Pharmacol 208 (1991) 175 im. [271 IM. Adams, 8. Cory, The Bek? protein family: arbiters of cll survival, Science 241 (1988) 1922-1326 [28] N. Mizino, H. Yoshitoms, H. Ishida, H. Kucomi, J. Kawa, Seino, 5. Seino, Altered Bel. and Bax expression and intracellular (Ca signaling in apoptosis of pancreatic cel and the impairment of glucose-induced insulin secretion, Endocrinology 139 (1998) 128-1439. [25] M. Asada, T. Yamada, H. Ichi, D. Dela, K. Miyazono, K. Fukumuro, $. Mizutani, Apoptosis inhibitory activity of eyto- plasmic p21" in monocytic diferentiation, EMBO J. 18 (0999) 1223-1234 (80) K. Tomita, G, Caramor, SLi, K. Mo, T, Hanazama, T, tes, 1, Chiselita,E, azrawi, KP. Chung, P.. Barnes, IM. Adcock, Hnereased p21" gad B cll Iymphoma lakemia-x(L) expression end reduced apoptosis in alveolar macrophages from smokers, Am. J. Respir. Crit. Care Med, 165 (2002) 724-73) (BI) C. Peran, DM. Sttoka, AZ. Badrchani, 17. Cooper, C2. Wirighton, M. Soares, ST. Grey, F-H. Bach, A20 inhibits NF- XB activation in endothelial cells without sensitiing to tumor necrosis factormedised apoptosis, Blood 91 (1998) 2249- 2258, [02] ST. Grey, MR, Arvelo, W. Hasenkamp, FH. Bach, C. Ferran, ‘A20 inhibits eytokineinduced apoptosis and nuceatfacior xl ependent gone activation i sll, J. Exp. Med, 190 (1999) 1135- 146Kimowo eta. Biochemical and Biophysical Research Commanication 303 (20038) 112-119 19 (33) 5, Rasiainen, IM, Nieminen, A.L. Levonen, T. Otonkoski, R Lapatt, Dose dependent eyssine- mediated protection of iasulin~ producing cells from damage by hydrogen peroxide, Biochem, Pharmacol. 63 (2002) 1297-1304 [B4] L. Bliasson, E. Renstzom, C. Ammala, P.O. Bergeren, A.M Bertorello, K. Bokvis. A’ Chibalin, JT. Deeney, PR. Flat, J. Gabel, J. Gromade, 0. Larson, P. Lindstrom, Cl Rhodes, P. Rorsman, PKC-ependent stinlation of exoxyto sis by sulfonyureas in pancreatic B cells, Science 271 (1996) 813-815, (85) P-A. Smith, P.Proks, A. Moorhouse, Direct eects of tolbutamide on mitochondrial function, inteacelulae Ca™ and exocytosis in pancreatic feels, Pagers Arch, 437 (1999) 577-588 (36) E. Rensirom, S. Barg. F. Thevenod, P. Rorsman, Sulfonylucea- mediated stimulation of intl exocytosis via an ATP-sensitive K" channebindependent action, Diabetes $1 2002) 33-836, [I LB. Efanova, SV. Zaitsev, B. Zhivotovsky, M. Kohler, S. Orrenius, P-O. Berggren, Glucose and tolbutamide induce spoptotis in pancreatic feels. A process dependent on intrace!- Iular Ca concentration, J. Biol Chem. 273 (1998) 33801-33807,