Identification of the Haloarchaeal Phasin (PhaP) That Functions in

Polyhydroxyalkanoate Accumulation and Granule Formation in

Haloferax mediterranei
Shuangfeng Cai, Lei Cai, Hailong Liu, Xiaoqing Liu, Jing Han, Jian Zhou, and Hua Xiang
State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing, People’s Republic of China

The polyhydroxyalkanoate (PHA) granule-associated proteins (PGAPs) are important for PHA synthesis and granule formation,
but currently little is known about the haloarchaeal PGAPs. This study focused on the identification and functional analysis of
the PGAPs in the haloarchaeon Haloferax mediterranei. These PGAPs were visualized with two-dimensional gel electrophoresis
(2-DE) and identified by matrix-assisted laser desorption ionization–tandem time of flight mass spectrometry (MALDI-TOF/

Downloaded from http://aem.asm.org/ on April 19, 2018 by guest

TOF MS). The most abundant protein on the granules was identified as a hypothetical protein, designated PhaP. A genome-wide
analysis revealed that the phaP gene is located upstream of the previously identified phaEC genes. Through an integrative ap-
proach of gene knockout/complementation and fermentation analyses, we demonstrated that this PhaP is involved in PHA accu-
mulation. The ⌬phaP mutant was defective in both PHA biosynthesis and cell growth compared to the wild-type strain. Addi-
tionally, transmission electron microscopy results indicated that the number of PHA granules in the ⌬phaP mutant cells was
significantly lower, and in most of the ⌬phaP cells only a single large granule was observed. These results demonstrated that the
H. mediterranei PhaP was the predominant structure protein (phasin) on the PHA granules involved in PHA accumulation and
granule formation. In addition, BLASTp and phylogenetic results indicate that this type of PhaP is exclusively conserved in halo-
archaea, implying that it is a representative of the haloarchaeal type PHA phasin.

P olyhydroxyalkanoates (PHAs) are biodegradable polyesters

present in most genera of bacteria (19, 38) and in Halobacte-
riaceae members of archaea (7, 20). PHAs usually accumulate
when cells are cultivated in an environment with an excess of
carbon sources and limited nitrogen, phosphorus, or oxygen (1).
Serving as carbon and energy storage compounds, PHAs are often
found in the cytoplasm as insoluble inclusions that are also known
as PHA granules (1).
There has been a considerable amount of research carried out
on PHA granules in bacteria. Early investigations indicated that
isolated native PHA granules contain approximately 97.5% PHA,
2% proteins, and small amounts of lipids (9). Many proteins
coated onto PHA granules have been shown to be responsible for
PHA synthesis and granule formation. Previously, these PHA
granule-associated proteins (PGAPs) were placed into four
categories: (i) PHA synthases, (ii) PHA depolymerases and
3-hydroxybutyrate oligomer hydrolases, (iii) the major structure
proteins (phasins), and (iv) the regulatory proteins (29). A recent
review gave a broader overview of PGAPs and listed many new
types of PGAPs, such as the newly found acyl-coenzyme A (CoA)
synthetase (14, 33). In recent years, the major proteins present on
PHA granules, the phasins (PhaPs), which may constitute approx-
imately 5% (wt/wt) of total cellular proteins (41), have attracted
more attention. In addition to their main roles in preventing PHA
granules from aggregating and in preventing the nonspecific at-
tachment of other proteins to PHA granules (37, 41), phasins are
proposed to be involved in the regulation of PHA synthesis, PHA
degradation, PHA granule size control (13, 41–42), the formation
of networks on the PHA granule surface (5), and even the distri-
bution of PHA granules during cell division, a dramatic role dis-
played by phasin PhaF (8) and the phasin-like PhaM (26).
Recently, a few enzymes involved in PHA metabolism have
been characterized in haloarchaea, such as the PHA synthases
(PhaEC) and the PHA-specific acetoacetyl-CoA reductases
(PhaB) (6, 10–12, 22). Among those, Haloferax mediterranei
PhaEC and Haloarcula marismortui PhaC have been revealed by
Western blotting to be PGAPs (12, 22). With the exception of
PhaEC, no PGAP has been investigated in haloarchaea. Sequence
homology searches for other PGAPs in haloarchaea using local
BLAST (Basic Local Alignment Search Tool) searches with bacte-
rial PGAPs have been performed, but no reliable sequences could
be detected, indicating the low homology of haloarchaeal PGAPs
to the bacterial ones.
As most haloarchaeal PGAP gene sequences could not
be found through homology searches, for this study, two-
dimensional gel electrophoresis (2-DE) and matrix-assisted laser
desorption ionization tandem time-of-flight mass spectrometric
(MALDI-TOF/TOF MS) analyses were used to separate and iden-
tify the proteins located on the PHA granule in H. mediterranei. A
major haloarchaeal phasin (PhaP) was successfully identified.
Furthermore, the effects of PhaP on PHA accumulation and PHA
granule morphology also were investigated. This study provides
novel insights for the further exploration of PHA metabolism in
haloarchaea.
MATERIALS AND METHODS
Strains and growth conditions. The strains used in this study are listed in
Table 1. Escherichia coli JM109 was grown in Luria-Bertani medium at
Received 5 October 2011 Accepted 2 January 2012
Published ahead of print 13 January 2012
Address correspondence to Hua Xiang, xiangh@sun.im.ac.cn.
Copyright © 2012, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AEM.07114-11

1946 aem.asm.org 0099-2240/12/$12.00 Applied and Environmental Microbiology p. 1946 –1952

 Haloarchaeal Phasin PhaP

TABLE 1 Strains and plasmids used in this study TABLE 2 Oligonucleotides used in this study
Source or Primer 5=–3= sequencea
Strain or plasmid Relevant characteristic(s) reference phaP-DF1 ATAGGTACCCCTCGTCTCCGTCCAGTC
Strains phaP-DR1 GAGGGATCCTCACTCATTTGAATCACC
H. mediterranei Wild-type strain (ATCC 33500) CGMCC phaP-DF2 TCTGGATCC CTACAGGAGATAGAGGAG
CGMCC 1.2087 phaP-DR2 CGACAAGCTTCTTCGTTTGGGGTTTTGC
H. mediterranei pyrF-deleted mutant of H. mediterranei 21 phaP-testF GAAATCAGAGGTTCCCACA
DF50 phaP-testR CGTAGTGGAGGAGTCTGAGTT
H. mediterranei phaP-deleted mutant of H. mediterranei This study phaP-EF1 GCAGGTACCCTTATGTACTTCGGTATGTG
⌬phaP DF50 phaP-ER1 GCGGAATTCCTCCTAACTCGGTGTTGTAC
E. coli JM109 recA1 supE44 endA1 hsdR7 gyrA96 34 phaP-EF2 GCGGAATTCATGAGTGAACAAGCCAACCC
relA1 thi phaP-ER2 TATGGATCCTCTCGGGCGGGCTAAA
RT-F CACCCAACAACAACTCCG
Plasmids RF-R GCCTTCATACCATCGACCA
pUBP 6.6 kb; derivative of pUBP2 by removing 12 a
Sequences representing restriction sites are underlined.
the pHH9-ori region
pUHFX 7.5 kb; derivative of pUBP by adding This study

Downloaded from http://aem.asm.org/ on April 19, 2018 by guest

pyrF and its native promoter
pDP 8.0 kb; integration vector of pUHFX for This study
knockout of phaP of H. mediterranei
pWL102 10.5-kb shuttle vector; Ampr Mevr 18
pWL502 7.9 kb; derivative of pWL102 by This study
replacing Mevr with pyrF marker
pWLP 8.6 kb; expression vector pWL502 This study
containing phaP and promoter of
gap12
37°C (34). H. mediterranei DF50 and ⌬phaP were cultivated at 37°C in
nutrient-rich AS-168L medium (per liter, 150 g NaCl, 20 g MgSO4 · 7H2O,
2 g KCl, 3 g trisodium citrate, 1 g sodium glutamate, 50 mg FeSO4 · 7H2O,
0.36 mg MnCl2 · 4H2O, 5 g Bacto Casamino Acids, 5 g yeast extract, pH
7.2). H. mediterranei strains harboring expression plasmids were culti-
vated in AS-168SYL (medium with yeast extract omitted from AS-168L).
For the PHA accumulation analysis, H. mediterranei first was grown at
37°C for 2 days in AS-168L or AS-168SYL medium. Seed cultures (2.5 ml)
then were inoculated into 50 ml of nutrient-limited MGL medium [per
liter, 150 g NaCl, 20 g MgSO4 · 7H2O, 2 g KCl, 1 g sodium glutamate, 50
mg FeSO4 · 7H2O, 0.36 mg MnCl2 · 4H2O, 10 g glucose, 5 g NH4Cl, 15 g
piperazine-N,N=-bis(2-ethanesulfonic acid), pH 7.2]. When needed, am-
picillin, uracil, and 5-fluoroorotic acid (5-FOA) were added to the media
at final concentrations of 100, 50, and 250 mg/liter, respectively.
Gene knockout and complementation. The plasmids and oligonucle-
otides used in this study are listed in Tables 1 and 2. For the knockout of
the phaP gene, a 758-bp DNA fragment located immediately upstream of
the phaP open reading frame (ORF) and a 780-bp DNA fragment in the 3=
region of the phaP gene were amplified with the primer pairs phaP-DF1/
phaP-DR1 and phaP-DF2/phaP-DR2, respectively. These two DNA frag-
ments were linked to the suicide plasmid pUHFX to form the integration
plasmid pDP, which was transformed into DF50, and the phaP deletion
mutant was screened as previously described (17, 21). The phaP deletion
mutant was confirmed by sequence analysis using the phaP-testF/phaP-
testR primer pair.
For phaP gene complementation, the promoter sequence of phaP,
which is located immediately upstream of the gap12 ORF (amplified by
phaP-EF1 and phaP-ER1) and the coding sequence of phaP (amplified by
phaP-EF2 and phaP-ER2) were linked and inserted into pWL502, result-
ing in the plasmid pWLP. pWLP was transformed into the ⌬phaP strain to
verify the function of PhaP.
All PCR-amplified sequences were verified by DNA sequencing. The
plasmids were transformed into H. mediterranei with a polyethylene
glycol-mediated transformation method (3).
Isolation of PHA granules. PHA granules were isolated by sucrose
density gradient centrifugation according to Wieczorek et al. (41). Briefly,
after a 2-day cultivation in MGL medium, the cells were collected, washed,
and resuspended in TBSL buffer (per liter, 150 g NaCl, 20 g KCl, 5 g
MgSO4 · 7H2O, 100 mM Tris-HCl, pH 7.1) with 1⫻ protease inhibitor
cocktail (PIC; Sigma). The suspension was subjected to three passages
through a French press (10,000 to 12,000 lb/in2) (Thermo Spectronic
French pressure FA-078 cell), and 4 ml of cell lysate was loaded on a
discontinuous sucrose density gradient prepared from 2 ml each of 2.0,
1.6, 1.3, and 1.0 M sucrose in 100 mM Tris-HCl (pH 7.1). After ultracen-
trifugation (210,000 ⫻ g for 2 h at 4°C), a granule layer was obtained
between the 1.3 and 1.6 M fractions. The granules were isolated for resus-
pension in 100 mM Tris-HCl (pH 7.1) buffer and subsequently were
loaded on the top of a second sucrose density gradient prepared as de-
scribed above. After ultracentrifugation (210,000 ⫻ g for 2 h at 4°C), the
granules were isolated and washed twice with 100 mM Tris-HCl (pH 7.1)
buffer via centrifugation (100,000 ⫻ g for 30 min at 4°C).
Analysis of PGAPs by 2-DE and MALDI-TOF/TOF MS. Proteins
from the native PHA granules were suspended in a solubilization buffer
{7.0 M urea, 2 M thiourea, 4% (wt/vol) 3-[(3-cholamidopropyl)-
dimethylammonio]-1-propanesulfonate (CHAPS)}. After 2 h of stirring
at room temperature, the protein solution was separated by centrifuga-
tion (20,000 ⫻ g at room temperature). For isoelectric focusing (IEF),
25-␮g protein samples were added to rehydration buffer (7.0 M urea, 2 M
thiourea, 4% [wt/vol] CHAPS, 0.28% dithiothreitol [DTT], 0.5% IPG
buffer [pH 3 to 5], 0.001% [wt/vol] bromophenol blue) for a total volume
of 450 ␮l. After centrifugation (20,000 ⫻ g, 10 min), the supernatant was
immediately applied to the first dimension. The IPG strip (24 cm, pH 3.9
to 5.1; Bio-Rad) was rehydrated with the protein samples overnight (0 V,
5 h; 80 V, 7 h) at 20°C. The sample in the IPG strip was focused at 20°C
according to a protocol (200 V, 30 min; 200 to 500 V, 1 min; 500 to 8,000
V, 3 h; 8,000 V for a total of 80,000 volt-hours [Vh]) similar to the proce-
dure described by Cho et al. (2). Following the isoelectric focusing, the
IPG strips were equilibrated in buffers A and B, respectively, for 15 min
with gentle shaking. The equilibration buffers contained 50 mM Tris-
HCl, pH 8.8, 6 M urea, 30% (vol/vol) glycerol, 2% (wt/vol) SDS and
0.002% (wt/vol) bromophenol blue, with a supplement of 1% (wt/vol)
DTT in buffer A and 2.5% (wt/vol) iodacetamide in buffer B. For the
second dimension, the proteins were separated by electrophoresis in a
14% SDS polyacrylamide gel at 1 W/gel for approximately 16 h. The pro-
teins were stained with Coomassie tablets (PhastGel Blue R-350; GE
Healthcare) overnight. The protein spots then were analyzed via MALDI-
TOF/TOF MS using the method of Shevchenko et al. (36).
PHA accumulation assay. The PHA content and PHA composition
were analyzed by gas chromatography as described previously (12, 22).
TEM studies. In addition, 5 to 10 ml of cell cultures in stationary phase
was harvested for transmission electron microscopy (TEM) analysis. After
washing twice with SP buffer (10% NaCl, 0.1 M sodium phosphate buffer,
pH 7.2), the cells were resuspended in SP buffer supplemented with 2.5%
(vol/vol) glutaraldehyde for primary fixation overnight at 4°C. Following

March 2012 Volume 78 Number 6 aem.asm.org 1947

Cai et al.
FIG 1 PHA granule-associated proteins of H. mediterranei. (A) A 2-DE map
of PGAPs of H. mediterranei. The granule samples were collected from cells in
stationary phase in MGL medium. Twenty-five ␮g of PHA granule proteins
was loaded for the first-dimension IEF. (B) Genetic organization of the PGAP
gene cluster. The arrows indicate the directions of gene transcription.
HFX_5217, MaoC (219 aa), enoyl-CoA hydratase; HFX_5218, GAP12 (110
aa), conserved hypothetical protein; HFX_5219, PhaP (154 aa), phasin;
HFX_5220, PhaE (182 aa), PHA synthase subunit PhaE; HFX_5221, PhaC
(492 aa), PHA synthase subunit PhaC.
the primary fixation, the cells were pelleted and washed three times with
SP buffer. The cell pellets then were fixed with 1.0% osmium tetroxide in
SP buffer for 2 h and subsequently washed three times with SP buffer. The
ensuing steps were performed according to the procedure described by
Tian et al. (39). Photomicrographs were taken with a Philips JEOL-1400
electron microscope.
Reverse transcription-PCR. The total RNA was extracted with TRIzol
reagent (Invitrogen) from H. mediterranei grown in MGL medium for
24 h. DNA-free total RNA was obtained after DNase (Promega) treat-
ment. The cDNA was synthesized using Moloney murine leukemia virus
RTase (M-MLV-RT; Promega) with random primers. The products am-
plified through PCR with the primer pair RT-F/RT-R were separated by
agarose gel electrophoresis.
Nucleotide sequence accession numbers. The DNA sequences of
phaP and the adjacent genes of H. mediterranei CGMCC 1.2087 reported
here were deposited in GenBank under the accession numbers EU374220
and JN980969.
RESULTS
Identification of PHA granule-associated proteins in H. medi-
terranei. To isolate the PGAPs in H. mediterranei, the cells were
cultivated in MGL medium, which favors PHA production due to
its excess carbon and limited nitrogen and phosphorous sources.
The PHA granules were collected and purified by sucrose density
gradient centrifugation. The PGAPs then were separated and an-
alyzed by 2-DE. We used 2-DE methods to separate the PGAPs for
several reasons. First, many bacteria possess multiple PhaP ho-
mologs, and their molecular masses are usually similar. For exam-
ple, the molecular masses of PhaP1, PhaP2, PhaP3, and PhaP4 are
nearly identical in Ralstonia eutropha H16 (28). Second, opti-
mized 2-DE methods have recently been established for the sepa-
ration of the haloarchaeal proteins (most are around pI 4 to 5) (2,
15–16). As little is known about the haloarchaeal PGAPs, we used
a broad-pI-range strip (pI 3 to 10) for screening at first and a
1948 aem.asm.org
FIG 2 Transcriptional analysis of the gap12 and phaP genes. (A) The genetic
Downloaded from http://aem.asm.org/ on April 19, 2018 by guest
organization of gap12 and phaP in H. mediterranei. The overlapping region is
shown in detail. The locations of the primers RT-F and RT-R are indicated. (B)
Agarose gel of RT-PCR products (385 bp) amplified with primers RT-F/RT-R
using the following templates: lane 1, total RNA; lane 2, reverse transcripts of
total RNA; lane 3, water; lane 4, H. mediterranei genomic DNA.
narrow-range (pI 3.9 to 5.1) strip for the separation of the H.
mediterranei PGAPs, which all are present at around pI 4 to 4.5
(Fig. 1A). Interestingly, while only a few proteins were observed, a
conspicuous protein spot with an apparent molecular mass of
approximately 25 kDa accounted for more than 90% of the ob-
served PGAPs (Fig. 1A). After trypsin digestion, these potential
PGAPs were analyzed by MALDI-TOF/TOF MS, and five proteins
were determined to locate on the PHA granules (Fig. 1A).
Notably, these five genes were unexpectedly located adjacent to
each other, forming a gene cluster (HFX_5217-HFX_5221) on a
megaplasmid of H. mediterranei (Fig. 1B). As shown in Fig. 1B,
this gene cluster likely contains two two-gene operons and a
monocistronic operon. The operon constituted by HFX_5220 and
HFX_5221 has been characterized to encode the two subunits of
the PHA synthases (PhaE and PhaC) that are the key enzymes in
PHA synthesis (22). HFX_5219 and HFX_5218 may compose an
additional operon exactly upstream of the phaEC operon. Inter-
estingly, HFX_5219 and HFX_5218 encode two conserved hypo-
thetical proteins, the predominant protein (⬎90%) on PHA gran-
ules and a small protein with a SpoVT_AbrB domain (Pfam),
respectively. As HFX_5219 encodes the predominant PGAP, we
designated this PGAP the major phasin (PhaP) of H. mediterranei.
We also temporarily named the HFX_5218-encoded protein
GAP12 based on its small mass (12 kDa). Directly upstream of
HFX_5218 is HFX_5217, which has a reading frame oriented away
from HFX_5218. HFX_5217 is annotated as a putative enoyl-CoA
hydratase (MaoC), an enzyme that also may be involved in PHA
metabolism, as it shows high identities (45 and 36%, respectively)
to PhaJ1 and PhaJ4 of Pseudomonas aeruginosa.
Analysis of phaP transcription in H. mediterranei. The pre-
dicted ORF of phaP overlaps with the gap12 ORF by 8 bp (Fig. 2A).
The genetic organization of gap12 and phaP suggested their
cotranscription. Whether they were transcribed as a unit was in-
vestigated by reverse transcription-PCR (RT-PCR). As PhaP and
GAP12 have been shown to exist on PHA granules, we only
checked the transcription unit spanning both genes with the
primer pair RT-F and RT-R inside the ORFs of gap12 and phaP. A
PCR product with the expected length was detected in the cDNA
Applied and Environmental Microbiology

TABLE 3 PHA accumulation in H. mediterranei strainsa
Day Strain PHBVb content (% [wt/wt])
3 DF50 38.37 ⫾ 0.23
3 ⌬phaP 22.39 ⫾ 0.32
3 ⌬phaP(pWLP) 38.73 ⫾ 0.57
5 DF50 37.20 ⫾ 0.48
5 ⌬phaP 26.95 ⫾ 1.55
5 ⌬phaP(pWLP) 47.30 ⫾ 1.76
a
Cells were cultured at 37°C for 3 and 5 days. Data are shown as means ⫾ standard deviations (n ⫽ 3).
b
PHBV, poly(3-hydroxybutyrate-co-3-hydroxyvalerate).
sample as well as the genomic DNA sample but was absent from
the mRNA sample (Fig. 2B). These results indicated that gap12
and phaP could be cotranscribed during PHA accumulation.
In Pseudomonas oleovorans, two independent promoters for
the major phasin gene phaF have been identified (30, 35). As the
protein level of PhaP is much higher than that of GAP12, as de-
tected by 2-DE (Fig. 1A), we examined whether an additional
phaP promoter was present in H. mediterranei. We constructed
expression plasmids with a modified gfp gene (32) fused to the
upstream region of the gap12 and phaP genes, named putative
promoters Pgap12 and Pp, respectively. After plasmid transforma-
tion, the expression of the gfp gene in H. mediterranei was moni-
tored during different growth phases. A remarkable fluorescence
signal of green fluorescent protein was detected under the control
of the promoter Pgap12, whereas no fluorescent signal was detected
from that controlled by the putative promoter Pp. These results
suggest that the upstream region of the phaP gene did not have
promoter activity. Therefore, there is likely only one promoter
(Pgap12) for the phaP gene, and the higher abundance of PhaP
proteins compared to that of GAP12 proteins may be due to the
higher translation efficiency or stability of PhaP.
Effect of PhaP on cell growth and PHA accumulation in H.
mediterranei. As part of the functional analysis of the putative
PhaP, the phaP gene was deleted using a double-crossover homol-
ogous recombination method in the uracil auxotrophic strain
(⌬pyrF) named H. mediterranei DF50 (21). The DF50 strain ex-
hibits a wild-type phenotype with respect to growth behavior and
PHA accumulation (data not shown). The knockout of phaP
(⌬phaP mutant) was confirmed by DNA sequence analysis.
To determine the growth behavior and the PHA accumulation
capability of the ⌬phaP mutant, the ⌬phaP and DF50 strains were
cultivated in MGL medium. The growth of the ⌬phaP mutant was
defective, as measured by optical density. The growth rate and the
final cell concentration at the stationary phase for the ⌬phaP mu-
FIG 3 Transmission electron microphotographs of PHA granules in H. mediterranei strains. (A) H. mediterranei DF50. (B) H. mediterranei DF50/⌬phaP mutant.
(C) H. mediterranei DF50/⌬phaP::pWLP. The cells were cultivated in MGL medium.
March 2012 Volume 78 Number 6
Haloarchaeal Phasin PhaP
Cell dry wt PHBV concn
3HV fraction (mol%) (g/liter) (g/liter)
10.28 ⫾ 0.12 5.09 ⫾ 0.10 1.95 ⫾ 0.03
9.02 ⫾ 0.25 5.42 ⫾ 0.07 1.21 ⫾ 0.02
11.60 ⫾ 0.59 4.20 ⫾ 0.04 1.63 ⫾ 0,02
10.08 ⫾ 0.19 4.49 ⫾ 0.17 1.67 ⫾ 0.05
8.80 ⫾ 0.20 4.89 ⫾ 0.11 1.32 ⫾ 0.10
9.54 ⫾ 0.07 4.26 ⫾ 0.07 2.01 ⫾ 0.09
tant both were lower than that of DF50. After cultivation for 3 and
5 days, the cells were collected for the gas chromatographic anal-
ysis of PHA production. A significant decrease in PHA production
Downloaded from http://aem.asm.org/ on April 19, 2018 by guest
in the ⌬phaP mutant strain was observed compared to that of the
DF50 strain (Table 3). The DF50 strain, at early stationary phase (3
days), produced 1.95 g/liter of PHA, while the ⌬phaP mutant
strain only produced 1.32 g/liter PHA even after 5 days of fermen-
tation. When phaP was deleted, the 3-hydroxyvalerate (3HV) con-
tent was slightly decreased. When the ⌬phaP mutant strain har-
bored a plasmid that expressed the phaP gene, high PHA
accumulation was restored (Table 3). These results revealed that
PhaP was important for cell growth and PHA production but was
not essential.
Effect of PhaP on PHA granule morphology in H. mediterra-
nei. The PHA granule morphology of cells in the stationary phase
was investigated by transmission electron microscopy (Fig. 3). In
DF50 and wild-type strains, most cells harbored multiple granules
that were generally 100 to 500 nm in diameter. However, in the
⌬phaP mutant strain, usually only one large round granule, ap-
proximately 1 ␮m in diameter, existed in most cells, while in a
significant proportion of the other cells no granule was observed.
The complementary expression of the phaP gene in the ⌬phaP
mutant resulted in a return to multiple moderately sized granules
being produced in the cell (Fig. 3). These phenotypes were consis-
tent with reduced PHA accumulation, implying that PhaP is im-
portant for PHA granule formation and separation. It played im-
portant roles in preventing PHA granules from aggregating. A
similar phenomenon was reported for several bacteria strains with
phasin proteins absent or truncated (27, 41). Therefore, this pre-
dominant PhaP identified in the PHA granules would be a sub-
stantial PHA granule structural protein in H. mediterranei.
Sequence and phylogenetic analysis of PhaP homologs in
Haloarchaea. A search of the homologous proteins of this H.
mediterranei PhaP with NCBI BLAST indicated that 16 conserved
aem.asm.org 1949
Cai et al.
FIG 4 Bootstrap neighbor-joining phylogenetic tree of the conserved phasin sequences from haloarchaea and bacteria. The tree was constructed based on the
deduced amino acid sequence of each protein using MEGA version 5.0. The GenBank accession numbers or locus tags are given. The numbers on the branches
indicate the bootstrap values (percentages) based on 1,000 replications. Scale bar, 0.2 substitution per site.
hypothetical proteins from 11 haloarchaeal species (Halorhabdus
utahensis, Haloarcula hispanica, Halomicrobium mukohataei,
H. marismortui, Halorhabdus tiamatea, Halogeometricum
borinquense, Haloterrigena turkmenica, Halalkalicoccus jeotgali,
Halopiger xanaduensis, Haloquadratum walsbyi, and Natronomo-
nas pharaonis) were significantly similar, with identity of approx-
imately 30% and similarity greater than 50%. The putative halo-
archaeal phasins were clustered together on a phylogenetic tree
generated using the phasins from representative bacteria and the
haloarchaeal PhaP homologs (Fig. 4). A multiple-alignment anal-
ysis of the amino acid sequences from the putative haloarchaeal
PhaPs revealed several conserved amino acid residues (Fig. 5). The
C-terminal regions of these proteins were rich in the acidic resi-
dues Glu (E) and Asp (D). These conserved residues and D/E-rich
regions may play an important role in their function in haloar-
chaea.
We have also analyzed the genes adjacent to the phaP ho-
mologs in the 11 haloarchaea species using available genomic data.
With the exception of N. pharaonis, all of the species carried the
phaE and phaC genes, which all were located adjacent to the phaP-
homologous genes. Interestingly, a similar gene cluster composed
of maoC-gap12-phaP-phaE-phaC was present in 7 of the 10 spe-
cies, with the exception of H. utahensis, H. borinquense, and H.
jeotgali, which harbored a PGAP gene cluster lacking the maoC
gene. Based on the phylogenetic analysis, alignment data, and
genomic arrangement, we propose that the homologs of H. medi-
terranei PhaP represent unique haloarchaeal phasins and perform
an important function in haloarchaeal PHA biosynthesis.
1950 aem.asm.org
Downloaded from http://aem.asm.org/ on April 19, 2018 by guest
DISCUSSION
While an increasing number of studies have addressed the metab-
olism of PHA in haloarchaea, there are few studies that focused on
haloarchaeal PHA granule proteins. In this study, with the explo-
ration of the PHA granule proteome of H. mediterranei, five
granule-associated proteins were identified, and they were found,
unexpectedly, to be encoded by genes in a cluster. The two PHA
synthase subunits (PhaE and PhaC) were determined to be PHA
granule associated, which is consistent with previous observations
(22). The other PGAPs detected were a putative enoyl-CoA hydra-
tase (MaoC) and the small conserved hypothetical proteins
GAP12 and PhaP, the most abundant PGAPs. The inconsistency
between the apparent molecular mass (25 kDa) of PhaP in the
2-DE gel and the deduced value (18 kDa) from amino acid se-
quence analysis could be due to the strong acidic character of
halophilic proteins, which usually significantly affects their appar-
ent molecular mass as measured by SDS-PAGE. Notably, al-
though many proteins are characterized as phasins in bacteria,
including PhaP/PhaP1, PhaP2, PhaP3, PhaP4, PhaF, PhaI, the
newly identified PhaP5 (25), and phasin-like PhaM (26), the ho-
mologous PhaP proteins of H. mediterranei (PhaPhme) only exist
in haloarchaea. Thus, the PhaPhme protein identified in this study
represents a novel (haloarchaeal type) phasin family.
After a genome-wide investigation into the 12 haloarchaea that
harbored the phaP gene, most of these archaea were found to possess
a similar pha cluster, with the five genes (maoC-gap12-phaP-phaE-
phaC) having the same organization as that in H. mediterranei. The
Applied and Environmental Microbiology
 Haloarchaeal Phasin PhaP

Downloaded from http://aem.asm.org/ on April 19, 2018 by guest

FIG 5 Multiple alignments of amino acid sequences of PhaP homologous proteins from 11 haloarchaea species: H. mediterranei, H. utahensis, H. hispanica, H.
mukohataei, H. marismortui, H. tiamatea, H. borinquense, H. turkmenica, H. jeotgali, H. xanaduensis, and H. walsbyi. The corresponding locus tags are given as
shown in Fig. 4. Amino acids are given using standard one-letter abbreviations, and the numbers indicate the positions of the amino acids within the respective
proteins. The black shading indicates identical residues, and the gray shading indicates similar residues.

extensive existence of this pha gene cluster indicates an evolutionarily
conserved pha gene cluster unique to haloarchaea. Therefore, this
confirms that the five genes are functionally related. During the in-
vestigation of the organization of the phaP genes and their neighbor
genes in bacteria, most of the phaP genes were found to be carried in
monocistronic operons (23, 40). In the Pseudomonas genus, although
the two phasin genes phaI and phaF are in an operon, the gene phaF
still possesses its own promoter nearby (30, 35). In the known regu-
lation models for phasins, all phasin genes harbor their own pro-
moter, which is regulated by PhaR. However, RT-PCR analysis and
promoter activity analysis in this study revealed that gap12 (likely a
regulator) and phaPhme were cotranscribed under a single promoter,
implying that there is a novel mechanism for phaPhme expression
regulation in haloarchaea. The further exploration of the roles of the
pha cluster genes could help elucidate the regulation of PHA synthesis
and granule assembly.
Phasins in bacteria, which function as PHA granule structure
proteins, have been characterized as small amphiphilic proteins
(mostly 11 to 25 kDa) that consist of hydrophobic domains for
PHA binding and hydrophilic domains exposed to the cytoplasm
(29). A hydrophobicity profile of PhaPhme also displays amphiphi-
lic characteristics. Although PhaPhme shares no sequence homol-
ogy with bacterial phasins, secondary-structure prediction analy-
sis of PhaPhme indicates high alpha helix (83.23%) content,
resembling that of phasins in bacteria (24). Studies of bacteria
indicate that the absence of the granule structure protein phasin
led to a decrease in PHA synthase activity (31). When the phasin
genes are knocked out or disrupted, the bacterial strains suffer a
PHA accumulation defect. PHA fermentation experiments indi-
cate that the knockout of phaPhme also significantly reduces PHA
production in H. mediterranei. In addition, in transmission elec-
tron microscopy studies, only one large granule was produced by
most of the cells lacking the PhaP protein. These results suggest
that PhaPhme acted as the major structural protein on the PHA
granules, and that the protein facilitates PHA accumulation and
granule segregation.
It is worth mentioning that three putative phaP genes are found in
N. pharaonis, but the species lacks detected phaEC genes in the ge-
nome. As several new functions of PhaP have been proposed recently,
including a stress-reducing effect (4) and a role in granule distribu-
tion during cell division (8), the autonomous existence of phaP sug-
gests that phaP has other functions independent of PHA synthesis in
N. pharaonis and in other haloarchaea, and comprehensive future
investigations are needed to resolve these issues.
ACKNOWLEDGMENTS
This work was supported by grants from the National 863 Program
of China (2009AA09Z401), the National Natural Science Foundation of

March 2012 Volume 78 Number 6 aem.asm.org 1951

Cai et al.
China (30621005, 30830004, 30925001), and the Chinese Academy of
Sciences (KSCX2-EW-G-2-4).
REFERENCES
1. Anderson AJ, Dawes EA. 1990. Occurrence, metabolism, metabolic role,
and industrial uses of bacterial polyhydroxyalkanoates. Microbiol. Rev.
54:450 – 472.
2. Cho CW, et al. 2003. Improvement of the two-dimensional gel electro-
phoresis analysis for the proteome study of Halobacterium salinarum. Pro-
teomics 3:2325–2329.
3. Cline SW, Lam WL, Charlebois RL, Schalkwyk LC, Doolittle WF. 1989.
Transformation methods for halophilic archaebacteria. Can. J. Microbiol.
35:148 –152.
4. de Almeida A, Catone MV, Rhodius VA, Gross CA, Pettinari MJ. 2011.
Unexpected stress-reducing effect of PhaP, a poly(3-hydroxybutyrate)
granule-associated protein, in Escherichia coli. Appl. Environ. Microbiol.
77:6622– 6629.
5. Dennis D, Sein V, Martinez E, Augustine B. 2008. PhaP is involved in the
formation of a network on the surface of polyhydroxyalkanoate inclusions
in Cupriavidus necator H16. J. Bacteriol. 190:555–563.
6. Feng B, et al. 2010. Identification of the phaB genes and analysis of the
PHBV precursor supplying pathway in Haloferax mediterranei. Wei Sheng
Wu Xue Bao 50:1305–1312.
7. Fernandez-Castillo R, Rodriguez-Valera F, Gonzalez-Ramos J, Ruiz-
Berraquero F. 1986. Accumulation of poly(beta-hydroxybutyrate) by
halobacteria. Appl. Environ. Microbiol. 51:214 –216.
8. Galán B, et al. 2011. Nucleoid-associated PhaF phasin drives intracellular
location and segregation of polyhydroxyalkanoate granules in Pseudomo-
nas putida KT2442. Mol. Microbiol. 79:402– 418.
9. Griebel R, Smith Z, Merrick JM. 1968. Metabolism of poly-beta-
hydroxybutyrate. I. Purification, composition, and properties of native
poly-beta-hydroxybutyrate granules from Bacillus megaterium. Biochem-
istry 7:3676 –3681.
10. Han J, et al. 2010. Wide distribution among halophilic archaea of a novel
polyhydroxyalkanoate synthase subtype with homology to bacterial type
III synthases. Appl. Environ. Microbiol. 76:7811–7819.
11. Han J, Lu Q, Zhou L, Liu H, Xiang H. 2009. Identification of the
polyhydroxyalkanoate (PHA)-specific acetoacetyl coenzyme A reductase
among multiple FabG paralogs in Haloarcula hispanica and reconstruc-
tion of the PHA biosynthetic pathway in Haloferax volcanii. Appl. Envi-
ron. Microbiol. 75:6168 – 6175.
12. Han J, Lu Q, Zhou L, Zhou J, Xiang H. 2007. Molecular characterization
of the phaEC H m genes, required for biosynthesis of poly(3-
hydroxybutyrate) in the extremely halophilic archaeon Haloarcula maris-
mortui. Appl. Environ. Microbiol. 73:6058 – 6065.
13. Handrick R, et al. 2004. Unraveling the function of the Rhodospirillum
rubrum activator of polyhydroxybutyrate (PHB) degradation: the activa-
tor is a PHB-granule-bound protein (phasin). J. Bacteriol. 186:2466 –
2475.
14. Jendrossek D. 2009. Polyhydroxyalkanoate granules are complex subcel-
lular organelles (carbonosomes). J. Bacteriol. 191:3195–3202.
15. Karadzic IM, Maupin-Furlow JA. 2005. Improvement of two-
dimensional gel electrophoresis proteome maps of the haloarchaeon Ha-
loferax volcanii. Proteomics 5:354 –359.
16. Kirkland PA, Busby J, Stevens S, Jr, Maupin-Furlow JA. 2006. Trizol-
based method for sample preparation and isoelectric focusing of halo-
philic proteins. Anal. Biochem. 351:254 –259.
17. Krebs MP, Mollaaghababa R, Khorana HG. 1993. Gene replacement in
Halobacterium halobium and expression of bacteriorhodopsin mutants.
Proc. Natl. Acad. Sci. U. S. A. 90:1987–1991.
18. Lam WL, Doolittle WF. 1989. Shuttle vectors for the archaebacterium
Halobacterium volcanii. Proc. Natl. Acad. Sci. U. S. A. 86:5478 –5482.
19. Lee SY. 1996. Bacterial polyhydroxyalkanoates. Biotechnol. Bioeng.
49:1–14.
20. Legat A, Gruber C, Zangger K, Wanner G, Stan-Lotter H. 2010. Iden-
tification of polyhydroxyalkanoates in Halococcus and other haloarchaeal
species. Appl. Microbiol. Biotechnol. 87:1119 –1127.
21. Liu H, Han J, Liu X, Zhou J, Xiang H. 2011. Development of pyrF-based
gene knockout systems for genome-wide manipulation of the archaea Ha-
1952 aem.asm.org
loferax mediterranei and Haloarcula hispanica. J. Genet. Genomics 38:261–
269.
22. Lu Q, Han J, Zhou L, Zhou J, Xiang H. 2008. Genetic and biochemical
characterization of the poly(3-hydroxybutyrate-co-3-hydroxyvalerate)
synthase in Haloferax mediterranei. J. Bacteriol. 190:4173– 4180.
23. McCool GJ, Cannon MC. 1999. Polyhydroxyalkanoate inclusion body-
associated proteins and coding region in Bacillus megaterium. J. Bacteriol.
181:585–592.
24. Neumann L, et al. 2008. Binding of the major phasin, PhaP1, from
Ralstonia eutropha H16 to poly(3-hydroxybutyrate) granules. J. Bacteriol.
190:2911–2919.
25. Pfeiffer D, Jendrossek D. 2011. Interaction between poly(3-hydroxybutyrate)
granule-associated proteins as revealed by two-hybrid analysis and iden-
tification of a new phasin in Ralstonia eutropha H16. Microbiology 157:
2795–2807.
26. Pfeiffer D, Wahl A, Jendrossek D. 2011. Identification of a multifunc-
tional protein, PhaM, that determines number, surface to volume ratio,
subcellular localization and distribution to daughter cells of poly(3-
hydroxybutyrate), PHB, granules in Ralstonia eutropha H16. Mol. Micro-
Downloaded from http://aem.asm.org/ on April 19, 2018 by guest
biol. 82:936 –951.
27. Pieper-Fürst U, Madkour MH, Mayer F, Steinbüchel A. 1995. Identifi-
cation of the region of a 14-kilodalton protein of Rhodococcus ruber that is
responsible for the binding of this phasin to polyhydroxyalkanoic acid
granules. J. Bacteriol. 177:2513–2523.
28. Pötter M, et al. 2004. The complex structure of polyhydroxybutyrate
(PHB) granules: four orthologous and paralogous phasins occur in Ral-
stonia eutropha. Microbiology 150:2301–2311.
29. Pötter M, Steinbüchel A. 2005. Poly(3-hydroxybutyrate) granule-
associated proteins: impacts on poly(3-hydroxybutyrate) synthesis and
degradation. Biomacromolecules 6:552–560.
30. Prieto MA, Bühler B, Jung K, Witholt B, Kessler B. 1999. PhaF, a
polyhydroxyalkanoate-granule-associated protein of Pseudomonas oleo-
vorans GPo1 involved in the regulatory expression system for pha genes. J.
Bacteriol. 181:858 – 868.
31. Ren Q, de Roo G, Witholt B, Zinn M, Thöny-Meyer L. 2010. Influence
of growth stage on activities of polyhydroxyalkanoate (PHA) polymerase
and PHA depolymerase in Pseudomonas putida U. BMC Microbiol. 10:
254.
32. Reuter CJ, Maupin-Furlow JA. 2004. Analysis of proteasome-dependent
proteolysis in Haloferax volcanii cells, using short-lived green fluorescent
proteins. Appl. Environ. Microbiol. 70:7530 –7538.
33. Ruth K, de Roo G, Egli T, Ren Q. 2008. Identification of two acyl-CoA
synthetases from Pseudomonas putida GPo1: one is located at the surface
of polyhydroxyalkanoates granules. Biomacromolecules 9:1652–1659.
34. Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual,
3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
35. Sandoval Á., et al. 2007. Genetic and ultrastructural analysis of different
mutants of Pseudomonas putida affected in the poly-3-hydroxy-n-
alkanoate gene cluster. Environ. Microbiol. 9:737–751.
36. Shevchenko A, Wilm M, Vorm O, Mann M. 1996. Mass spectrometric
sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem.
68:850 – 858.
37. Steinbüchel A, et al. 1995. Considerations on the structure and biochem-
istry of bacterial polyhydroxyalkanoic acid inclusions. Can. J. Microbiol.
41(Suppl. 1):94 –105.
38. Steinbüchel A, Füchtenbusch B. 1998. Bacterial and other biological
systems for polyester production. Trends Biotechnol. 16:419 – 427.
39. Tian J, Sinskey AJ, Stubbe J. 2005. Kinetic studies of polyhydroxybu-
tyrate granule formation in Wautersia eutropha H16 by transmission elec-
tron microscopy. J. Bacteriol. 187:3814 –3824.
40. Wang C, et al. 2007. Influence of the poly-3-hydroxybutyrate (PHB)
granule-associated proteins (PhaP1 and PhaP2) on PHB accumulation
and symbiotic nitrogen fixation in Sinorhizobium meliloti Rm1021. J. Bac-
teriol. 189:9050 –9056.
41. Wieczorek R, Pries A, Steinbüchel A, Mayer F. 1995. Analysis of a
24-kilodalton protein associated with the polyhydroxyalkanoic acid gran-
ules in Alcaligenes eutrophus. J. Bacteriol. 177:2425–2435.
42. York GM, Stubbe J, Sinskey AJ. 2001. New insight into the role of the
PhaP phasin of Ralstonia eutropha in promoting synthesis of polyhydroxy-
butyrate. J. Bacteriol. 183:2394 –2397.
Applied and Environmental Microbiology