Wuschel

> skill-importer@1.0.
0 start /Users/atulaggarwal/Projects/topcoder/skill-
importer/project
> node start.js
Scheduling Cron
Tue Jun 12 2018 19:16:33 GMT+0530 (IST): Running cron : wuschel
User Info : { about:
'@p42\nmail@p42.ioChemistry, Biotech, IT, Sustainability.',
created: 1381226129,
id: 'wuschel',
karma: 1089,
submitted:
[ 17280803,
17280558,
17269629,
17121997,
17082100,
17081324,
16987537,
16729630,
16430565,
16222057,
16128162,
16128153,
14899760,
14770073,
14717071,
14696478,
14690862,
14688959,
14667249,
14576288,
14575002,
14574976,
14570997,
14567669,
14554462,
14548848,
14543570,
14508227,
14508215,
14504156,
14439249,
14436148,
14408240,
14344170,
14290063,
14168992,
14166537,
14155139,
14132137,
14132042,
14129743,
14126810,
14125034,
14124835,
14049134,
14032958,
14031610,
14019421,
14008236,
13998273,
13975087,
13716998,
13716822,
13716736,
13713116,
13677304,
13675780,
13675658,
13674875,
13674447,
13658384,
13653508,
13651654,
13635336,
13635196,
13559527,
13501369,
13501265,
13498651,
13419328,
13418738,
13410954,
13410770,
13353110,
13343951,
13343223,
13302858,
13302491,
13276935,
13228143,
13051050,
13014901,
13014880,
13002041,
12987956,
12987120,
12954390,
12952639,
12949033,
12948816,
12944878,
12943252,
12930124,
12929686,
12929538,
12919478,
12914097,
12904949,
12904681,
12884642,
... 192 more items ] }
Items size : 292
{ by: 'wuschel',
id: 17280803,
parent: 17280705,
text:
'I share your worries, as I too think that the abstractions used in the trained
models in the talk are inherently leaky, meaning that they do not represent reality
to a suffiently high degree (see corn flakes vs ketchup screen wiping action). As
we do not (yet?) understand the underlying nature of those "2.0-ish"
decision algorithms, we will not be able to make a judgement call when they will
work, and when they will fail.',
time: 1528674962,
type: 'comment' }
{ by: 'wuschel',
descendants: 477,
id: 17280558,
kids:
[ 17282390,
17280877,
17282558,
17281974,
17281150,
17292265,
17283186,
17282265,
17282108,
17281183,
17281050,
17282494,
17281194,
17280985,
17283942,
17280947,
17281082,
17281949,
17283988,
17282561,
17283889,
17285662,
17281055,
17282833,
17283563,
17284107,
17284986,
17292058,
17285008,
17282608,
17282874,
17282182,
17281429,
17282278,
17282751,
17281285,
17289762,
17283032,
17281694,
17285382,
17281425,
17286517,
17282978,
17282584,
17289448,
17285528,
17281236,
17283265,
17282583,
17289443,
17282053,
17282269,
17282358,
17283426,
17280895,
17283802,
17281110,
17284099,
17282342,
17285409,
17281826,
17281799,
17281477,
17280932,
17284023,
17281711,
17281598,
17282803,
17283818,
17282575,
17280909,
17282258,
17283067,
17284512 ],
score: 1081,
time: 1528670227,
title: 'Alternatives to Google Products',
type: 'story',
url: 'https://restoreprivacy.com/google-alternatives/' }
{ by: 'wuschel',
id: 17269629,
kids: [ 17270780, 17270366 ],
parent: 17269348,
text:
'Not sure about the patentibility of those patents (they are still all in the
application phase, and I have not read them), but to my understanding patents a)
have to be tested before court and b) often fall back to less generic claims in
practice (claim no. N, with N > 1), if not being completely invalidated. Now, I
expect Google to have good patent lawyers, but time will show the value of those
patents.',
time: 1528491521,
type: 'comment' }
{ dead: true,
deleted: true,
id: 17121997,
time: 1526938189,
type: 'story' }
{ by: 'wuschel',
descendants: 0,
id: 17082100,
score: 2,
time: 1526476544,
title:
'Audi\'s Level 3 Self Driving System Not Intruded in US but EU',
type: 'story',
url:
'https://www.wired.com/story/audi-self-driving-traffic-jam-pilot-a8-2019-
availablility/' }
{ by: 'wuschel',
id: 17081324,
parent: 17081140,
text:
'Congratulations for the release, and for all the hard work!',
time: 1526467132,
type: 'comment' }
{ by: 'wuschel',
id: 16987537,
parent: 16985292,
text:
'Here is a discussion/summary of the American Cancer Society:<a
href="https://www.cancer.org/cancer/cancer-
causes/radiation-exposure/cellular-phones.html"
rel="nofollow">https://www.cancer.org/cancer/cancer-
causes/radiation-exposu...</a>It is certainly not an easy problem to
measure and collect strong evidence for either side.',
time: 1525365819,
type: 'comment' }
{ by: 'wuschel',
id: 16729630,
parent: 16729318,
text: ':D',
time: 1522606408,
type: 'comment' }
{ by: 'wuschel',
id: 16430565,
parent: 16429216,
text:
'Hello mining guy - would you be perhaps up for a short chat? Our team is
currently looking into innovation in the mining sector. My contact details are in
my description.',
time: 1519230104,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 16222057,
score: 1,
time: 1516795399,
title:
'Personal Healthcare Information Ecosystem, Built on Blockchain',
type: 'story',
url: 'https://medibloc.org' }
{ by: 'wuschel',
id: 16128162,
parent: 16127321,
text:
'Agreed!Great to see YC address the lab space issue and give a larger
cash/equity cut for biotech focused companies.I am wondering how
early/late stage the desired biotech company should be. Right now, many
biotech-y YC applications/interview participants seem to be rejected with the
comment that they should come back later.',
time: 1515706792,
type: 'comment' }
{ deleted: true,
id: 16128153,
parent: 16127549,
time: 1515706735,
type: 'comment' }
{ by: 'wuschel',
id: 14899760,
parent: 14898915,
text:
'I agree that the transition to EV is one of the biggest challenges the German
car industry is facing.Who would have known 15 years ago that a major industry
(~ 800K jobs in Germany, directly or indirect) would have to face such a storm?
Fierce international competition, technologies threatening to erode key value
chains - one could wonder what big strategic consultancies have preaching to the
car industry executives all years long, what the innovation departments have been
doing, and how company culture and the connection of management with state politics
has failed to make change.To be fair, there have been large scale mobility
projects in Germany, both in the EV field, and smart transportation systems e.g.
interconnection the vehicle and road infrastructure with the user. So there has
been very early efforts in experimenting with these concepts.One thing is for
sure: It will be an interesting case study afterwards.',
time: 1501588789,
type: 'comment' }
{ by: 'wuschel',
id: 14770073,
kids: [ 14770197, 14770462 ],
parent: 14769142,
text:
'The article is a PR piece for "Keiyaku Kekkon", a
japanese marriage partner startup.I quickly read through the text - and wondered
what I had learned. It does not present any interesting conclusions, or back its
statements with data.Here is the exec summary of the startup's business
model:"Keiyaku Kekkon is a marriage-focused dating website with a twist.
The name is Japanese and literally means "Contract Marriage." Users
create their ideal marriage agreement and match up with a suitable
partner.Unlike typical dating sites that match people based on personality,
Keiyaku Kekkon matches people based on their marriage contracts. Users can spell
out exactly what they want out of marriage and exactly what they have to
offer."[1] <a href="http://keiyakukekkon.com"
rel="nofollow">http://keiyakukekkon.com</a>',
time: 1500042863,
type: 'comment' }
{ by: 'wuschel',
id: 14717071,
kids: [ 14717285, 14717440 ],
parent: 14716606,
text:
'What about HN (Reddit and like)? May sound funndy, but there are the also
reward mechanisms at play when we visit these sites, and they can be affecting
work/private life negatively as well.',
time: 1499418370,
type: 'comment' }
{ by: 'wuschel',
id: 14696478,
kids: [ 14697395, 14696666 ],
parent: 14694954,
text:
' import antigravity [1]I in Python, Given the fact Python is a
dynamically typed language, with all the need to write deterministic tests, I am
always amazed to see such packages come up. The eco-system is just incredible in
this regard. Thumbs up![1] <a href="https://xkcd.com/353/"
rel="nofollow">https://xkcd.com/353/</a>',
time: 1499182702,
type: 'comment' }
{ by: 'wuschel',
id: 14690862,
kids: [ 14691065 ],
parent: 14685677,
text:
'I would love to see a small tutorial for package, perhaps even explaining some
concept basics, and differences to Elm when working with it. Just dabbling in
Haskell a bit (for fun, working through Haskell from first principles).
Better a headache from reading a book than a headache installing npm packages on
Linux.',
time: 1499111131,
type: 'comment' }
{ by: 'wuschel',
id: 14688959,
parent: 14682319,
text:
'Same questions - would love to see some numbers here. Perhaps one advantage
would be that you do not need node?',
time: 1499095872,
type: 'comment' }
{ by: 'wuschel',
id: 14667249,
parent: 14649735,
text:
'I was wondering about that, too. Perhaps a solution would be a SSL-esque
certificate for a webassembly blob? Just wondering..',
time: 1498774107,
type: 'comment' }
{ by: 'wuschel',
id: 14576288,
parent: 14576072,
text:
'That - or the results are based on one of those low quality medical research
studies that is performed by medical students in order to get their MD in some
countries.',
time: 1497713453,
type: 'comment' }
{ by: 'wuschel',
id: 14575002,
parent: 14568282,
text:
'Re public domain books, try out Project Gutenberg: <a
href="http://www.gutenberg.org/"
rel="nofollow">http://www.gutenberg.org/</a>',
time: 1497690985,
type: 'comment' }
{ by: 'wuschel',
id: 14574976,
kids: [ 14575184 ],
parent: 14573837,
text:
'SpaceX certainly makes interesting marketing publications regarding the
colonization of other planets. Unfortunately, that does not change that our species
of ape decendents is stripping and destroying its single, most precious planetary
habitat, creates great social divides, and behaves in a most unsustainable way.
That is one of the major problems for me.Edit: Why the downvotes? Colonization
of different planets will not solve some of our systemic problems.',
time: 1497690244,
type: 'comment' }
{ by: 'wuschel',
descendants: 1,
id: 14570997,
kids: [ 14571392 ],
score: 78,
time: 1497634564,
title: 'Calibre 3 released',
type: 'story',
url: 'https://calibre-ebook.com/new-in/twelve' }
{ by: 'wuschel',
id: 14567669,
kids: [ 14567950, 14567909 ],
parent: 14567411,
text:
'I am always wondering if "terrorists" really use means of
communication that are easy to compromise.',
time: 1497606322,
type: 'comment' }
{ by: 'wuschel',
id: 14554462,
kids: [ 14554569 ],
parent: 14554419,
text:
'The question is, under what degradation conditions (time, bacteria, etc), and
what other threat vector does the material bring to animal life.',
time: 1497462209,
type: 'comment' }
{ by: 'wuschel',
id: 14548848,
parent: 14544950,
text:
'Hi,thank you very much for your detailed elaboration on the subject, and the
references. I was not aware of the bigger, geologic perspective:<pre><code> ~
3 mg Uranium in 1 m^3 ocean water. \n</code></pre>\nMakes sense, when one thinks
about the relative ratio of chemical elements on earth. I guess, as always, it is
the demonstration of chemical enrichment procedures that is the key here, and there
is currently no economic incentive to do such a thing. Although, I have not looked
into current fuel production procedures. How expensive is 1g (sufficiently) pure
Uranium fuel?The sentence that our energy requirements could be covered with
breeder reactor systems for 50K years made my smile, though. It will be probably
the lack of higher "level fuels" such as proteins and carbohydrates that
give us headaches, first.Please note that I am not at all hypercritical
regarding nuclear energy. There is a lot of industrial and green propaganda out
there, and it is sad to see that we scientist are loosing the battle in media. Too
often, rigorous scientific explanations in not sexy enough for us apes.',
time: 1497389605,
type: 'comment' }
{ by: 'wuschel',
id: 14543570,
kids: [ 14544950 ],
parent: 14543082,
text:
'Hi, interesting answers.1) Could you tell me more about replenishment of
Uranium in seawater, or point me towards your source?Wouldn't it mean that
we would reach a maximum saturation of Uranium in the ocean after some time (with
precipitation of excess Uranium in the form of salts)?Have you seen /
access to estimates of Uranium electrode deposition cost from water? Are they cost
competitive in any way in comparison to other energy systems that will be employed
in the future?At the end, you would need to use electrical energy converted from
another source to gain Uranium. For me, that scenario is a bit 'fishy'.',
time: 1497343246,
type: 'comment' }
{ by: 'wuschel',
id: 14508227,
parent: 14508215,
text:
'Any thoughts? Found it through an announcement at Sigma-Aldritch [1]. As a side
comment, Merck went on quite a aquisiation rampage recently.<pre><code> [1]
http://www.merckmillipore.com/DE/de/20170512_225124?
ReferrerURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Funited-kingdom.html</code></pre>',
time: 1496856648,
type: 'comment' }
{ by: 'wuschel',
descendants: 1,
id: 14508215,
kids: [ 14508227 ],
score: 3,
time: 1496856571,
title:
'New method to rapidly deploy newly discovered bacterial CRISPR (Merck/May
2017)',
type: 'story',
url: 'https://www.nature.com/articles/ncomms14958' }
{ by: 'wuschel',
id: 14504156,
parent: 14504048,
text:
'At its core, YC is a VC entity, and as such is competing for promising
investment possibilities. IMHO YC's move to "accept 10K new
companies" is a smart attempt in attempting to extend their reach to get the
first pick at the commodity. We will see if it will work out. Either way, it is
great to see YC to lead the way - they have done a lot for the community
already.Disclaimer: Been once in that orange place in Palo Alto, and I am not a
fan-boy. However, I do remember the dark ages around 2005, when there was nothing
in Europe that was even worth to compare to this accelerator program. YC has
greatly helped to change the landscape.',
time: 1496817469,
type: 'comment' }
{ by: 'wuschel',
id: 14439249,
parent: 14439055,
text:
'The article is the usual PR piece on startup sectors in the
EU.Unfortunately, writing hype articles like that do not make things better.
From my personal observation, there is a huge difference in
funding/regulatory/technology adoption and available workforce.',
time: 1496068197,
type: 'comment' }
{ by: 'wuschel',
id: 14436148,
parent: 14435984,
text:
'For context:Please take note that general elections (for the
"Bundestag") will be held in the end of September 2017. Everything that
will be published now and in the next months by the German media may very well be
part of a campaign scheme.',
time: 1496006644,
type: 'comment' }
{ by: 'wuschel',
id: 14408240,
kids: [ 14408603 ],
parent: 14408208,
text:
'This sounds like the reprisals citizens of the totalitarian states in the
Warsaw Pact had to endure. Heads up for pushing against it.Out of curiosity, do
you know if there are any people trying to challenge these rulings/treatment
they receive in court?',
time: 1495612471,
type: 'comment' }
{ by: 'wuschel',
id: 14344170,
kids: [ 14344316, 14346349 ],
parent: 14343396,
text:
'Another approach to attack the holy grail of self cleaning surfaces: Damaged
surface segments on self cleaning materials form a point of 'dirt
crystalization'. From these points, dirt starts to cover the surface.This
problem is addressed by Rühe's* paper [1] with a creative "shedding
concept". Upon damage, water can access the water soluble glue material upon
which the water repelling elements are sitting. The damaged hydrophobic element
rinsed away, exposing a fresh hydrophobic element. Unfortunately, the regenerative
potential is limited to the number of sacrificial hydrophobic
elements.<pre><code> [1] 10.1021/acs.langmuir.7b00814 \n</code></pre>\n*
Disclaimer: I met Jürgen in a joint group meetings during the Macromolecular
Kolloquium in Freiburg. Great to see his name again via HN.. this was such a long
time ago!',
time: 1494874859,
type: 'comment' }
{ by: 'wuschel',
id: 14290063,
kids: [ 14290849 ],
parent: 14287393,
text:
'Breeding ground in mine fields and what not.. [1] penguins are hard-core!
Everytime I see the adaptive capabilities of life forms I have to laugh and cry
at the same time. It is certainly worth an internet meme...<pre><code> [1]
http://time.com/4660247/planet-earth-ii-clip-
penguins/</code></pre>',
time: 1494232338,
type: 'comment' }
{ by: 'wuschel',
id: 14168992,
kids: [ 14170747, 14169738 ],
parent: 14168461,
text:
'> 50 years there won't be that many application developers left
either.I like your comment, but the crystal ball statement in the last sentence
is a bit too much.',
time: 1492805264,
type: 'comment' }
{ by: 'wuschel',
id: 14166537,
parent: 14166506,
text:
'"There such thing as bad publicity" - this is what I learned,
too.Compared to this company, is so sad to see other projects not taking off
because they fail at the funding stage (for one of the many reasons they might not
control).',
time: 1492789310,
type: 'comment' }
{ by: 'wuschel',
id: 14155139,
parent: 14154802,
text:
'I am looking to replace my good old faithful IBM X61.Currently, size wise,
it's only the 2016 Macbook that has made an impression on my eye - and I am
not really happy with putting so much money on the table for a sub-par performance
notebook.I like the hardware specs of the Galago Pro. Unfortunately, I
can't say that for the design. So much wasted real estate (e.g. screen).',
time: 1492679906,
type: 'comment' }
{ by: 'wuschel',
id: 14132137,
parent: 14131210,
text:
'Hey,great to see you here. I left Sothic recently, let's get back in
touch :^)',
time: 1492446297,
type: 'comment' }
{ by: 'wuschel',
id: 14132042,
kids: [ 14136676 ],
parent: 14131603,
text:
'"Democracy is just the train, but not the final destination.", is a
AKP slogan I remember from a documentary on Erdogans long road to power.I would
also support the opinion that Erdogan used the EU integration process to
selectively weaken the kemalist/military grip on Turkey's institutions.
While you could point out that the EU were a 'useful idiot', IMHO there
was never a realistic chance of Turkey joining the EU. The reasons are multifold,
most important ones being the resistance of the EU population in major EU countries
such as Germany, France and Poland. In that regard, I think, EU politics were not
on an honest basis and just a game.',
time: 1492445751,
type: 'comment' }
{ by: 'wuschel',
id: 14129743,
parent: 14128753,
text:
'The Family & Co. is a friendly bunch. Like other actors in Paris, they make
a good contribution to the ecosystem. Nice to see them get this kind of
attention.',
time: 1492415707,
type: 'comment' }
{ by: 'wuschel',
id: 14126810,
parent: 14126317,
text:
'Interesting. Could you perhaps elaborate further, or point towards any sources
re manufacturering difficulties?',
time: 1492367358,
type: 'comment' }
{ by: 'wuschel',
id: 14125034,
kids: [ 14125217 ],
parent: 14124889,
text:
'Very interesting, indeed. I thought that patent issues were a roadblock. Kudos
to Trekstor to stand up for a fight, and thanks for the link.On the other hand,
taken from the article: "overall quality of the screen wasn’t quite as good as
E Ink, but it wasn’t very far off either".',
time: 1492333748,
type: 'comment' }
{ by: 'wuschel',
id: 14124835,
kids: [ 14124889, 14125202, 14125121 ],
parent: 14124086,
text:
'I wonder what the current situation with e-ink is.From my point of
view,current e-ink displays have not really improved significantly in terms of
resolution and refreshing speed. Where are the current difficulties with the
technology?I remember the difficulty of making larger, highly monodisperse
SiO2/polymer particle spheres in the end of the 90s. But I believe this
problem was overcome long ago.So is it the electronic/particle interface
that is problematic e.g. size of "pixels"/sphere clusters?',
time: 1492328454,
type: 'comment' }
{ by: 'wuschel',
id: 14049134,
kids: [ 14049249 ],
parent: 14046404,
text:
'I wonder what the difference is between, say, SWI-Prolog, and a graph
database/query system like Neo4J?',
time: 1491471403,
type: 'comment' }
{ by: 'wuschel',
id: 14032958,
parent: 14031833,
text: 'Thank you!',
time: 1491316145,
type: 'comment' }
{ by: 'wuschel',
id: 14031610,
kids: [ 14031833 ],
parent: 14030444,
text:
'What kind of software/stack was used to make such a kind of visualization?
Any good tutorials, courses or books that can be recommended?',
time: 1491307289,
type: 'comment' }
{ by: 'wuschel',
id: 14019421,
parent: 14019387,
text: 'It's just about vampires.',
time: 1491172120,
type: 'comment' }
{ by: 'wuschel',
id: 14008236,
parent: 14008085,
text:
'Our R&D institute used HORDE [1] back then. However, I was always on the
lookout for something that resembles Google Calendar in functionality and usability
(and possibly even looks). The same can be said for GMail and its Google Task
integration.[1] <a
href="https://www.horde.org/apps/groupware"
rel="nofollow">https://www.horde.org/apps/groupware</a>',
time: 1490994564,
type: 'comment' }
{ by: 'wuschel',
id: 13998273,
parent: 13995711,
text:
'One of our group leaders in our research institute learned physics at the dawn
of quantum mechanics, saw theory translate into practical applications (e.g. laser
technology), and then boost and transform theory again. She is 90+ now.It was
great to hear from her how long it took for the right theories to overcome the
barriers of adoption, how fashion works in science, and how many things we think as
new are actually really old stuff in new clothes.',
time: 1490902691,
type: 'comment' }
{ by: 'wuschel',
id: 13975087,
kids: [ 13975702 ],
parent: 13974929,
text:
'Was is a particular technique or doctor? Just wondering re the quality of
treatment.',
time: 1490691148,
type: 'comment' }
{ by: 'wuschel',
id: 13716998,
kids: [ 13717185 ],
parent: 13716756,
text:
'There are already approaches in this direction e.g. such as providing a
standardized experimental hardware-software interface with Antha [1]. The
complexity of the problems in questions (biological domain, biophysical,
biochemical) is daunting - we do not understand many things, "there is
plenty of room at the bottom".[1] <a href="https://www.antha-
lang.org/" rel="nofollow">https://www.antha-lang.org/</a>',
time: 1487878679,
type: 'comment' }
{ deleted: true,
id: 13716822,
parent: 13713440,
time: 1487877439,
type: 'comment' }
{ by: 'wuschel',
id: 13716736,
parent: 13716489,
text:
'True, biology is a horror show full of surprises. Many experimental
instructions are as reliable as astrologic forecasts. I guess that is the price of
complexity and the human factor.I would love to hear more about your
work, and the strategies you propose to improve the reproducibility of scientific
experiments. My email can be found in my user description.Cheers!',
time: 1487876916,
type: 'comment' }
{ by: 'wuschel',
id: 13713116,
kids: [ 13713440, 13713319 ],
parent: 13712333,
text:
'> Numerical computations and plotting are also my prime use cases for
Python. IMO it's the only real competition to Matlab in this area.What
about Julia and R? I have never worked with them, I am just wondering that they are
not mentioned.',
time: 1487849812,
type: 'comment' }
{ by: 'wuschel',
id: 13677304,
parent: 13677249,
text:
'I would, too, like to see some hard data on your hypothesis, although I believe
that there are too many inseparable human and enviromental variables at play here.
At the end, the change in role and power is a very human development (see also:
families, partnerships, child-parent relationships).',
time: 1487461185,
type: 'comment' }
{ by: 'wuschel',
id: 13675780,
kids: [ 13693739 ],
parent: 13675710,
text:
'^ This, and the intergration of electronics into the vehicle are the arguments
I heard from test driving customers. Thanks for the answer.I wonder why the
downvote for my question. It was not the tone, I hope.',
time: 1487440572,
type: 'comment' }
{ by: 'wuschel',
id: 13675658,
parent: 13675268,
text:
'Have a look at CoderDojo [1]. I did an IT project with the first class (patient
zero) of kids from this organization. It was a very rewarding experience to see how
great their "hands on" pedagogic approach worked out. The project - a
website with front end and backend, full stack - was a great success. Amazing bunch
of kids.CoderDojo in an NGO that has spread globally. I wholeheartedly recommend
it.Just don't leave your notebook lying around, or some curious kid might take
it apart.. (no joke)[1] <a href="https://coderdojo.com/"
rel="nofollow">https://coderdojo.com/</a>',
time: 1487439333,
type: 'comment' }
{ by: 'wuschel',
id: 13674875,
kids: [ 13675710 ],
parent: 13674005,
text:
'Hi, can you give me the sources/reasoning behind your statement?I have
first hand sales experience with luxury brand vehicles (read:
RR/Bentley price class). Technology oriented US customers love Tesla. Sure,
top notch luxury is nice, shiny and gives a unique experience, but at the end it is
a different kind of experience from that a Tesla customer seeks. At the end, they
buy both.',
time: 1487427807,
type: 'comment' }
{ by: 'wuschel',
id: 13674447,
kids: [ 13675950 ],
parent: 13673620,
text:
'Interesting.How would you minimize these type of errors by design or best
practice?I guess languages with a lack of higher order abstractions and no
strong type system might be more prone to this type of errors.',
time: 1487417030,
type: 'comment' }
{ by: 'wuschel',
id: 13658384,
parent: 13658338,
text:
'I agree that it is old news. Orwell's "1984" with its scary
concepts of mass control and indoctrination is even older.\nWhenever I read about
those TVs I have to think about how dehumanizing the outcome of the dystopian story
was, and how we slowly - but decisively - move into the accepting such privacy and
rights intrusions.',
time: 1487232531,
type: 'comment' }
{ by: 'wuschel',
id: 13653508,
kids: [ 13656035 ],
parent: 13651658,
text:
'I wonder how practical living tissue as actuator for bio-robots. It needs to be
fed, kept healthy and clear of infections, and replaced when beyond certain
age.I remember all those (temperature/pH/electro/magneto-
sensitive) hydrogels actuator publications: Really cool experiments, but not really
useful to engineer a replacement for electric motors.',
time: 1487178674,
type: 'comment' }
{ by: 'wuschel',
id: 13651654,
parent: 13650745,
text:
'I used MiKTeX LaTeX for my thesis, so I had to learn - as many other PhD
candidates - some of the troubles with this typesetting system the hard way.I
had a quick look at ShareLateX in order to help my sister with her latex
experience. While I can not say anything about larger documents, the ease of DVI
previewing in the browser, etc, it for sure gave me the opportunity to debug some
of her code in small pieces, test out LaTeX example code, and share the results
with my sister.Nice project - best of luck and keep up the good work!Edit:
for typos',
time: 1487163459,
type: 'comment' }
{ by: 'wuschel',
id: 13635336,
kids: [ 13636373, 13636296 ],
parent: 13635292,
text:
'> (...) always been at WA with Eurasia.That is an interesting formulation
that reminds me former presidential advisor\nZbigniew Brzeziński's book
"The Grand Chessboard".',
time: 1486995671,
type: 'comment' }
{ by: 'wuschel',
id: 13635196,
parent: 13635115,
text:
'> ROI on our military industrial complex is global stability safe for
commerceI am not sure if this is the case in the long run. However , I have
never seen ROI calculations when it comes to something like the use of military
apparatus. IMHO, the amount of collective hurt that has been generated by military
interventions might backfire in numerous, unpredictable ways. At the end, a small
number of people profit (e.g. those who finance successful military operations),
while soldiers, victims of war pay the price for hegemony status.',
time: 1486994413,
type: 'comment' }
{ by: 'wuschel',
id: 13559527,
parent: 13557663,
text:
'Interesting comments, wahern and nugget. Could you elaborate or
point to some primary/secondary sources?Control of the distribution of
wealth and income is certainly a tricky, multi-faceted challenge that society had
to face since the beginning of civilization, and certainly will have to face many a
day.',
time: 1486127417,
type: 'comment' }
{ by: 'wuschel',
id: 13501369,
parent: 13501003,
text:
'Source?Side comment/question: Depending on your operating system,
perhaps?',
time: 1485540074,
type: 'comment' }
{ by: 'wuschel',
id: 13501265,
kids: [ 13501676, 13502285 ],
parent: 13500918,
text:
'The Irish are a small hyperconnected, global community. Having lived in Ireland
for a while, the statement above does make me smile, but does not surprise me
anymore.',
time: 1485539176,
type: 'comment' }
{ by: 'wuschel',
id: 13498651,
kids: [ 13499112, 13498687, 13498765 ],
parent: 13498413,
text:
'Many of these issues you list can be overcome by good coding practise. Although
I understand that the framework/languages used allowed for these bad
feats.I wonder how Rust with its focus on memory safety could play out in such
scenarios.I need to have a look at Erlang/OTP. It is a bit of a hidden,
alien gem.',
time: 1485508658,
type: 'comment' }
{ by: 'wuschel',
id: 13419328,
parent: 13418453,
text:
'Thank you for the link. The comments of the thought influencer do remind
me the distorted discussions in the Economist's comment section I followed a
couple of years ago. The topics that were heavily spammed were usually revolving
about Chinese politics or economics.',
time: 1484674224,
type: 'comment' }
{ by: 'wuschel',
descendants: 1,
id: 13418738,
kids: [ 13419810 ],
score: 3,
text:
'What is the difference in overhead when using Haskell/Rust on a <insert
project type here e.g. website, ML, driver, data crunching tool etc> project?
How much more work is jumping through recursive library hoops with Haskell to solve
a real work problem, how much work is it to manage memory manually on a larger
project? How good are these languages as a general tool?From my limited
knowledge, in Rust I have to wade through low level, strict type, and borrow
checker concepts while working with a procedural language. Haskell, on the other
hand, forces me to go much deeper into functional territory than ever and learn its
crazy sophisticated type system.I do stuff in Python (fun, amazing library
support, but hacky/quirky) or Scheme (define SICP "mindblowing")
these days, but I keep wondering whether it is worth to make a jump into Rust or
Haskell, as these languages offer strong advantages when it comes to program speed
and compile time error correction.Would love to hear some thought from people
that realized small projects in both languages and lived to tell a tale..',
time: 1484669923,
title:
'Ask HN: Haskell/Rust – what work overhead when used as general language?',
type: 'story' }
{ by: 'wuschel',
id: 13410954,
parent: 13410329,
text:
'I agree.Scheme/lisp based languages and Haskell are a great choice for
this kind of project.',
time: 1484584543,
type: 'comment' }
{ by: 'wuschel',
id: 13410770,
kids: [ 13411258, 13411905 ],
parent: 13410492,
text:
'Having had a bit of startup mileage, I second this. I don't know why the
above post downvoted.',
time: 1484583199,
type: 'comment' }
{ by: 'wuschel',
id: 13353110,
parent: 13350428,
text:
'42See also: <a
href="https://en.wikipedia.org/wiki/The_Hitchhiker's_Guide
_to_the_Galaxy"
rel="nofollow">https://en.wikipedia.org/wiki/The_Hitchhiker&#x2
7;s_Guide_to_the_...</a>',
time: 1483922192,
type: 'comment' }
{ deleted: true,
id: 13343951,
parent: 13340246,
time: 1483794519,
type: 'comment' }
{ by: 'wuschel',
id: 13343223,
parent: 13342803,
text:
'Good points.Check out as a possible alternative:1) riot.im\n2)
matrix.org',
time: 1483782271,
type: 'comment' }
{ by: 'wuschel',
id: 13302858,
parent: 13301558,
text:
'How do you know that cats, flies, and other lifeforms run their brains at the
same "frequency" as humans?When it comes to comparing the
sophistication, adaptivity and functions of life to the in-silico mashines
we produce and use very, very primitive.',
time: 1483379600,
type: 'comment' }
{ by: 'wuschel',
id: 13302491,
parent: 13302300,
text:
'Spot on. Once the food chain collapses, primates and many other higher life
forms will be in peril.',
time: 1483377205,
type: 'comment' }
{ deleted: true,
id: 13276935,
parent: 13276364,
time: 1483014590,
type: 'comment' }
{ by: 'wuschel',
id: 13228143,
kids: [ 13229896 ],
parent: 13227350,
text:
'Hi,I am afraid I won't dig into this now due to time reasons (I have to
go back and read up stuff), but I just would like to give a remark regarding the
concept you have sketched out:The different states you describe do not have to
be on different energy levels. A catalyst provides an alternative reaction
mechanism that might have a different activation energy. It can result in a
molecule of similar energy state, and, yes, you can have a reaction towards an
energetically higher state.I am sure there is many a publication that models
the electronic transitions that occurs when gas molecules react with metals. Funky
stuff, which involves number crunching with models of atomic/molecular
orbitals or bands, and even more funky spectroscopic real time measurements of
reactions.Chemistry has gone a long way since alchemy, and there are many
abstraction layers to get through if you want to have an explanation that would
satisfy a physicists. At the end, you will move from empirical knowledge towards a
world of quantum chemistry/physics. That is the beauty (or curse) of the
discipline that is chemistry.Now, if you are curious how such a thing works, I
suggest look up the "Wilkenson catalyst" (a Rhodium based catalytic
hydrogenation agent) as an example. It gives you an idea how organometallic
compounds work at various levels of depth.',
time: 1482316793,
type: 'comment' }
{ by: 'wuschel',
id: 13051050,
parent: 13029038,
text:
'Your welcome. I just thought I give a comment - does not hurt, after all. As
you mentioned, if you accomplish your life goals as planned there should not be
reason to worry.',
time: 1480276315,
type: 'comment' }
{ by: 'wuschel',
id: 13014901,
kids: [ 13029038 ],
parent: 13002041,
text:
'Not sure why the downvotes. It was an opinion, and actually not a disinformed
one due to experience in my circle of friends. I did not want to sounds
paternalistic in any way.',
time: 1479830263,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 13014880,
score: 1,
text:
'Hi,we are currently in seed 2 fundraising these days. It might be a minor
point, but I am wondering if services that allow you to keep and track access to
your investor decks are a potential turn-off with potential angel
investors.Plus:- reduces size of email- metrics if and how deck gets
accessed by prospect- control of access, information on who gets
deckMinus:-- People might be hesitant to enter their credentials if deck--
Workflow different (e.g. sharing of deck is done via PDF, searching etc).Any
experiences/feedback on this?Cheers!',
time: 1479830072,
title:
'Ask HN: Attach a deck to a investor email or Link/track access to Deck?',
type: 'story' }
{ by: 'wuschel',
id: 13002041,
kids: [ 13014901 ],
parent: 13000739,
text:
'To me, this loss of control looks like a very classic addiction pattern.
As a suggestion, try to get in touch with a Internet/computer addiction
specialist.',
time: 1479686429,
type: 'comment' }
{ by: 'wuschel',
id: 12987956,
parent: 12987471,
text:
'> Leaving your home country has a lot of drawbacks, no matter where you are
from or where you are going to.So true. I emigrated three times. I learned a
lot. But there was so much sacrifice that I ask myself now and then if it was worth
it.',
time: 1479486956,
type: 'comment' }
{ by: 'wuschel',
id: 12987120,
parent: 12986641,
text:
'I owned both X61 and T61. Great design, possibilities of modification, strong
CPU, and good build quality that lasted for ages (I am still using the X61, now in
its 8 year).The model policies for the current models seems to have changed,
though.',
time: 1479480952,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 12954390,
score: 5,
time: 1479167272,
title: 'Mercury Programming Language',
type: 'story',
url: 'https://mercurylang.org/' }
{ by: 'wuschel',
id: 12952639,
kids: [ 12952911 ],
parent: 12949069,
text: 'Sorry, that was want I meant to imply.',
time: 1479152935,
type: 'comment' }
{ by: 'wuschel',
id: 12949033,
kids: [ 12949069 ],
parent: 12948852,
text:
'Don't forget the monarchists who held many an important position in the
state. Indeed, the first german fledgling democractic state, the
Weimarer Republic, still called the "Reich" bei many of its
inhabitants, had a horrible economic start in a time of great social change.',
time: 1479122487,
type: 'comment' }
{ by: 'wuschel',
id: 12948816,
parent: 12945886,
text:
'Thanks for sharing this. I would be interested to read more about it. People
like who have not been counting their years migh have some imagination, but
imagination does not replace experience. Perhaps you should make a write up of your
time and observations.',
time: 1479119725,
type: 'comment' }
{ by: 'wuschel',
id: 12944878,
parent: 12944474,
text:
'Let's not forget that Obama got the Nobel Peace Prize for ...well,
for not being Bush?A prize from a war profiteur in explosives and
munitions to a war monger of drones.So many things are failing, sometimes I
think we are a hopeless race.But fortunately, there are decent people around -
and that gives me hope.',
time: 1479062955,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 12943252,
score: 2,
time: 1479044448,
title: 'Technology and Inequality (MIT Tech Review)',
type: 'story',
url:
'https://www.technologyreview.com/s/531726/technology-and-inequality/' }
{ by: 'wuschel',
id: 12930124,
parent: 12930057,
text:
'I see. Sad to see this development, and thanks for bringing this up. The
ability to run linux flavours is now definitely a purchase criterium for me when it
comes to new hardware.',
time: 1478868739,
type: 'comment' }
{ by: 'wuschel',
id: 12929686,
kids: [ 12930034 ],
parent: 12929594,
text:
'After years of thinking and consideration, I switched recently. And behold...
it is great. Just do it - there is so much choice that I am sure you will find your
sweet spot.My suggestions: Xubuntu or Ubuntu w/o all the nasties,
Elementary OS, Debian, Arch Linux or a BSD flavour.',
time: 1478863009,
type: 'comment' }
{ by: 'wuschel',
id: 12929538,
kids: [ 12929722, 12930583 ],
parent: 12929399,
text:
'I completely agree.This and the introduction of hostile upgrades on Windows
7 was the reason I actually switched to a Linux based operating system (Xubuntu),
with my old Windows 7 as occasional virtualized guest operating system for old
applications.I was never happy with Microsofts product policies and aggressive
strategies, but I accepted them since they did not cross the lines too much. Also,
I thought the barrier to switch was much higher.It is not. There is no reason
not to switch away from proprietary, closed OS such as Windows or Mac OS these
days. Unless you are really a fan, of course. But then you are willing to pay the
price.',
time: 1478861112,
type: 'comment' }
{ by: 'wuschel',
id: 12919478,
parent: 12919242,
text:
'Suggestion: Have a look at Lisp Flavoured Erlang [1], a Lisp-2 on top of
Erlang/OTP that might be 90% of what you want to achieve. :^) I am sure they
are happy for new members of the community![1] <a
href="http://lfe.io/"
rel="nofollow">http://lfe.io/</a>',
time: 1478776857,
type: 'comment' }
{ by: 'wuschel',
id: 12914097,
kids: [ 12914881 ],
parent: 12910158,
text:
'Very interesting, great concept! The paper is on \nmy to-read list!I am
only afraid that the datasets you have used might not be of sufficiently quality
for a neural network application. There are old recipes when the state of art in
chemistry was at an earlier stage e.g. before the discovery of specific mechanisms,
molecule classes, analytics and general concepts. Also, as mentioned in this
thread, there are aspects of the synthetic chemists work and experience that might
not be taken into consideration in this approach.',
time: 1478721930,
type: 'comment' }
{ by: 'wuschel',
id: 12904949,
kids: [ 12904987 ],
parent: 12901712,
text:
'The nice thing about Excel is that it does resemble a functional programming
tool.Would love to work with a replacement, even if it is some sort of
Pandas/Python/Matplotlibb derivative - but it takes too long to set up
things with these tools, and it seems not all operations are as trivial as I want
them to be.',
time: 1478647991,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 12904681,
score: 2,
time: 1478645684,
title:
'Don’t Go Chasing Unicorns, Mr Moedas – Thoughts Re European Innovation
Council',
type: 'story',
url:
'http://sciencebusiness.net/news/79808/Dont-go-chasing-unicorns-Mr-Moedas' }
{ by: 'wuschel',
id: 12884642,
kids: [ 12884796 ],
parent: 12884383,
text:
'I drove them in 2002 Tunis to Sidi Bou Said. This link [1] has a picture of
them, although I remember them being red. But human memory is flawed, for the bulky
shape looks right ;)I witnessed a mass burglary/theft in the train, my
friend to barely hold on to his rucksack.[1] <a
href="https://www.visiting-
africa.com/africa/tunisia/2010/03/trains-from-tunis-to-
sidi-bou-said.html" rel="nofollow">https://www.visiting-
africa.com/africa/tunisia/2010/03/train...</a>',
time: 1478432174,
type: 'comment' }
{ by: 'wuschel',
id: 12884370,
kids:
[ 12884724,
12884415,
12885035,
12884609,
12884411,
12884573,
12884836,
12884479,
12884631,
12885536,
12884650,
12885463,
12901148,
12884383,
12885331 ],
parent: 12884144,
text:
'Berlin's trains in North Korea..On a side Note:The Stuttgart S-
Bahn's can be found it Tunis.Has anyone encountered other trains in
exile?',
time: 1478426610,
type: 'comment' }
{ by: 'wuschel',
id: 12882631,
parent: 12882349,
text: 'Finishing a seed 2 fundraising campaign.',
time: 1478390830,
type: 'comment' }
{ by: 'wuschel',
id: 12871868,
parent: 12870387,
text:
'Making it to an IPO and owning n% is the platinum medal already. Anything else
is just bonus.Would love to see more in depth comparison between the cases.',
time: 1478260633,
type: 'comment' }
{ by: 'wuschel',
id: 12844460,
kids: [ 12846091 ],
parent: 12844369,
text:
'I second this. I have switched from Windows 7 to Xubuntu and have never looked
back. It runs smoothly on a X61 IBM Notebook with 4 GB RAM. If I have to use an
expensive software suite that is only available on Windows/MacOS, I Switch to
virtualized Windows 7 mashine.',
time: 1477994556,
type: 'comment' }
{ by: 'wuschel',
id: 12841513,
parent: 12838703,
text:
'VLC is one of the best open source programs ever written. I use it on
mobile+notebook for video and music (320-encoded files on a 128 GB SD card).
Youtube/many other apps are just not OK in quality.',
time: 1477952630,
type: 'comment' }
{ by: 'wuschel',
id: 12829292,
parent: 12828966,
text:
'And shocking! I have never been in Detroit before, and followed the crisis
through the distorted lens of media. this kind of imagery is a source for visual
understanding of the impact of the crisis.',
time: 1477828391,
type: 'comment' }
{ by: 'wuschel',
id: 12814312,
kids: [ 12814364 ],
parent: 12814265,
text:
'Could you elaborate on the data they are collecting?The human body with
it's organs and molecular pathways is quite a tough black box to crack, and
there is not a spark of a doubt that Soylent - and no one else - will not
understand it for quite a while.And then there is human human variations.The
concept was flawed from the very beginning. It's sad to see them fail, and I
feel bad for the people that suffer because they believed what was marketing and
not hard science.',
time: 1477647138,
type: 'comment' }
{ by: 'wuschel',
id: 12806858,
parent: 12806644,
text:
'And you are not alone. It has been too much. If not for certain high value
programs that run best on a native system, I would not start the old VMWare-
virtualized Windows 7 up again.There are sufficiently good (and cheap) solutions
in the Linux community. First Microsoft has to fix what they have been doing wrong
for years. And then then have to answer the question what additional value they are
providing for the money a company has to pay for their "services".Hype
articles can not undo evil.',
time: 1477587548,
type: 'comment' }
{ by: 'wuschel',
id: 12794942,
parent: 12794932,
text:
'Yes, down. Google cache version here [1]. Starting from $297 for 30 seconds,
$447 for 60 seconds.Having done a video on our own [2] I know how much work in
involves. It is amazing what you can do nowadays with tools like
Videoscribe/Illustrator etc.Another option is to seek people of Fiver to do
it. But that only works if you have standardized image/doodle
requirements.[1] <a
href="http://webcache.googleusercontent.com/search?q=cache:SyWfaIOJ-
P4J:explainwithvideo.com/+&cd=1&hl=en&ct=clnk&gl=ie"
rel="nofollow">http://webcache.googleusercontent.com/search?
q=cache:SyWfaIO...</a>[2] <a href="https://www.youtube.com/watch?
v=lcrSJ5Osyjc" rel="nofollow">https://www.youtube.com/watch?
v=lcrSJ5Osyjc</a>[3] <a href="http://www.videoscribe.co/"
rel="nofollow">http://www.videoscribe.co/</a>',
time: 1477472257,
type: 'comment' }
{ by: 'wuschel',
id: 12794892,
parent: 12794292,
text:
'As simple as possible, no "dashboards" needed :)-- Calendar for
events e.g. Google Calendar-- GoogleMail with its task function for emails--
one file for yearly, quartely and weekly goals-- a normal file structure, with a
README in each respective project folder, all literature, documents contacts, work,
etc-- one hard copy lab book for conceptual work.',
time: 1477471531,
type: 'comment' }
{ by: 'wuschel',
id: 12783298,
kids:
[ 12784402,
12783587,
12783689,
12783453,
12783933,
12784319,
12786070 ],
parent: 12783279,
text:
'I second this question and would like to add another one:Where is it that
Haskell shines?',
time: 1477346546,
type: 'comment' }
{ by: 'wuschel',
id: 12774562,
kids: [ 12774662, 12774647 ],
parent: 12773314,
text:
'Chicken Scheme is a great Scheme implementation. For a beginner, however, there
is a lack of IDE e.g. a good guide how to get EMACS running for Chicken Scheme. I
used Sublime Text at the beginning, but I showed performance problems when using
the REPL.',
time: 1477245275,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 12740150,
score: 1,
time: 1476839324,
title:
'Asia\'s Ascent – Global Trends in Biomedical R&D Expenditures (2014)',
type: 'story',
url: 'http://www.nejm.org/doi/full/10.1056/NEJMp1311068' }
{ by: 'wuschel',
id: 12694971,
parent: 12693047,
text:
'Addendum: official statement from Beyond Meat at \n<a
href="http://beyondmeat.com/whats-new/view/why-i-am-
welcoming-tyson-foods-as-an-investor-to-beyond-meat"
rel="nofollow">http://beyondmeat.com/whats-new/view/why-i-
am-welcoming-tyso...</a>',
time: 1476294093,
type: 'comment' }
{ by: 'wuschel',
id: 12693780,
kids: [ 12694237 ],
parent: 12693538,
text:
'Well, good point, I typed my comment up fairly quickly.It is a lot of land
occupied by a very recource hungry industry and less efficient industry\ne.g. you
need 100x more water to make animal protein when compared to plant protein. We use
25% of our freshwater consumption for animal protein production - not even
mentioning other recourses. With a growing number of people on the planet,
efficiency is key.',
time: 1476286457,
type: 'comment' }
{ by: 'wuschel',
id: 12693133,
parent: 12691186,
text:
'Spot on - see my post above. They are very much interested in portfolio and
tech integration.',
time: 1476282480,
type: 'comment' }
{ by: 'wuschel',
id: 12693047,
kids: [ 12693538, 12694971 ],
parent: 12690432,
text:
'That is great news! Beyond Meat is not the only player on the block,
though.The challenges in the alt.ag. sector lie in the development of mass
production technology. From the side of the market, consumers need an extra benefit
(animal cruelty free products are not enough) in order to be converting. Outside of
the startups, the time to maturity is hypothesized to be 5-15 years.Tyson is a
very forward looking company, very much worried about the future of protein food
supply. I had the pleasure of meeting some of their folks, and at least the top
level very well outlined the problems we are going to face.Current business
model in the sector is focused on high volume production with strong attrition,
little regard to animal ethics (low regulations) and consolidation among
manufacturers.Just the numbers make me shudder:* Livestock produces 18% of
greenhouse emissions* Feed animals occupy 70% of arable land on our
planet.With the classic animal protein supply chain being almost max'ed out
in terms of capacity (and energy+matter conversion effiency), we have some grim
perspectives here.Disclaimer: I work in the alt tag tech startup sector.',
time: 1476282056,
type: 'comment' }
{ by: 'wuschel',
id: 12684604,
parent: 12684266,
text:
'The analogy is horribly flawed, especially the bio compiler metaphor. In
silico automatons are primitive in complexity when compared to processes in simple
organisms.Disclaimer: Have seen both the IT/CS and biotech side of
things.',
time: 1476195864,
type: 'comment' }
{ by: 'wuschel',
id: 12667697,
parent: 12665949,
text:
'Don't forget other ventures e.g.* <a
href="http://www.spiber.se/"
rel="nofollow">http://www.spiber.se/</a>',
time: 1475946792,
type: 'comment' }
{ by: 'wuschel',
id: 12660119,
parent: 12660084,
text:
'Seconded. More and more noise, less signal. Unfortunately, this trend does not
seem to stop at the IT sector.',
time: 1475843623,
type: 'comment' }
{ by: 'wuschel',
id: 12660097,
parent: 12659876,
text:
'Just curious - I have been around in pretty much every place* in Europe but
London, and I am flying over the Atlantic now and then:What are your reference
points here? Would love to hear other recommendations of yours.* With a of
noteworthy/critical tech sector',
time: 1475843410,
type: 'comment' }
{ by: 'wuschel',
id: 12626789,
kids: [ 12627278 ],
parent: 12625852,
text:
'I agree. HN and pg's old essays were a gem in the times were little other
startup resources were out there.',
time: 1475496799,
type: 'comment' }
{ by: 'wuschel',
id: 12618793,
parent: 12617443,
text:
'What finally scared me off MS Windows were the forced updates and the blatant
spyware.I still run a MS OS from time to time: Windows 7, for some legacy
software, well confined in a virtual box.Linux is an alternative the days, both
for individuals and companies.',
time: 1475341927,
type: 'comment' }
{ by: 'wuschel',
id: 12612655,
kids: [ 12612867 ],
parent: 12612032,
text:
'Thank you for the link. Lisp-y things have a soft place in my heart, although I
must say I never did any productive with them (Python happened to be our software
stack back then). Neithertheless, they gave me interesting insights into CS. I
dabbled with Chicken Scheme, but the difficulty to run an IDE (there is
Emacs, but is not so trivial to get it running) gave me lots of
headaches.DrRacket seems to be a refreshing alternative.',
time: 1475245925,
type: 'comment' }
{ by: 'wuschel',
id: 12580529,
parent: 12580360,
text:
'I faintly remember the Klammeraffe. Fun times.In Poland it is still
called Małpa, which means monkey.',
time: 1474883623,
type: 'comment' }
{ by: 'wuschel',
id: 12538717,
kids: [ 12539048, 12539630 ],
parent: 12538299,
text:
'Well, I hope for the head of the NK chief propaganda minister that the grand
divine dictator's internet does not break down with all the traffic from
Hacker News.."Kim Jong Un, Chairman of the Workers' Party of Korea,
Chairman of the State Affairs Commission of the DPRK and Supreme Commander of the
Korean People's Army, visited the Sohae Space Centre to inspect the ground jet
test of a new type high-power engine of a carrier rocket for the geo-stationary
satellite."It sounds really hilarious, but it reminds me of the soviet
era in the Warsaw Pact member states. Poor citizens. We are so lucky to have a
degree of control over our supreme leadership..',
time: 1474371859,
type: 'comment' }
{ by: 'wuschel',
id: 12530677,
parent: 12530212,
text:
'Very lengthy, well written article about the history, political implications
and principles of public key encryption.I am a big fan of this technology [1],
and still hope that it will be more wide spread among citizens in a secure form.
Like freedom of speech, information security is definitely an important pillar of
the modern state and empowers citizens. Unfortunately, all attempts to introduce it
to the masses and get it right from the security point of view have failed so
far.It is a tough balancing act to get right [2]: freedom, convenience, safety -
you seemingly can only have two of them.[1] e.g. in the form of <a
href="https://www.gnupg.org/"
rel="nofollow">https://www.gnupg.org/</a>[2] <a
href="https://www.schneier.com/blog/archives/2010/11&
#x2F;dan_geer_on_cyb.html"
rel="nofollow">https://www.schneier.com/blog/archives/2010
/11/dan_geer_on_c...</a>',
time: 1474286803,
type: 'comment' }
{ by: 'wuschel',
id: 12517780,
kids: [ 12517795 ],
parent: 12517700,
text:
'I take that as bleeding edge sarcasm :^)There are many startup endeavours
that aim to use tech for the better of our ecosystem e.g. all the startups
affiliated with the New Harvest Community (<a href="http://new-
harvest.org" rel="nofollow">http://new-harvest.org</a>).',
time: 1474064189,
type: 'comment' }
{ by: 'wuschel',
id: 12517611,
kids: [ 12517700, 12518222 ],
parent: 12517536,
text:
'"Are we doing enough?"This question is spot on. We have this
planet, our habitat, in our hands. Overexploition of natural recources can bring
our ecosystem in dire straits, and us with it. We can loose so much. About time to
use technology to change this. And about time to change out behaviour en masse.',
time: 1474062530,
type: 'comment' }
{ by: 'wuschel',
descendants: 26,
id: 12517379,
kids: [ 12518073, 12517581, 12517530, 12517536, 12519539 ],
score: 40,
time: 1474060192,
title: '500 dead horseshoe crabs have washed up in Japan',
type: 'story',
url:
'http://www.sciencealert.com/500-horseshoe-crabs-have-mysteriously-washed-up-
dead-in-japan' }
{ by: 'wuschel',
id: 12500038,
parent: 12499871,
text:
'Seconded.1) A PhD is a very personal experience, but hard work is the
common denominator.2) The article is off - very much because there is a
multitude of outcomes when it comes to personal development during a PhD.',
time: 1473878722,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 12499031,
score: 1,
text:
'I am currently looking for practical solution for the storage of sensitive
data. It seems to me that the solution is not trivial taking the following
requirements into account:* the usage of a cloud provider (e.g. Google Drive or
Dropbox) as a data storage platform.* cryptographic protection (e.g. veracrypt)
with decryption on the side of the client* possibility of backupsDoes anyone
have some good practises or designs on how to build such a company internal system?
We have access to servers, cloud providers, etc, but we do not want to spend much
time in coding this ourselves.Thanks!',
time: 1473872770,
title:
'Ask HN: What is a good multi-user solution for encrypted cloud data',
type: 'story' }
{ by: 'wuschel',
id: 12496544,
parent: 12496078,
text:
'Thank you for your reply, and making your position understandable. In my humble
opinion science has already a problem with communicating to the general
public.We are still far away from the comprehension of state, or even
computuation in living tissue. The technology underlying silicium based computers
is quite primitive compared to biologics. Certainly - these are interesting
thoughts in theory - but for the sake of science communications with the general
public I am very careful in what context and what way I would articulate these
concepts.Animal welfare, and the health of ecosystems, is definitely another
minefield of a discussion.',
time: 1473859156,
type: 'comment' }
{ by: 'wuschel',
id: 12495702,
kids: [ 12496078 ],
parent: 12494711,
text:
'sarcasm onDon't forget, human brains are squishy, too, and there
are many more of them!Sarcasm offNot sure if your comment meant to be
provocative, or if you just did not think through the ethical considerations of
your statement. In fact, I am not sure how well protected octupus as a species are,
since they lack a spine.',
time: 1473851571,
type: 'comment' }
{ by: 'wuschel',
id: 12472929,
parent: 12471440,
text:
'I am astonished how geo-political squabbles over resources such as oil and
fishing may destroy the great reef ecosystems of this region. Ecosystems, that are
far more valuable than the things these nations squabble about.The cold war was
messed up in so many ways. It reminds me these developments.The type of people
that advocate such nationalistic projects in favour of international, peaceful and
reasonable exploitation should be removed from power.',
time: 1473593870,
type: 'comment' }
{ by: 'wuschel',
id: 12451959,
parent: 12447495,
text: '1. Never give up. \n2. Get to work.',
time: 1473333632,
type: 'comment' }
{ by: 'wuschel',
id: 12432053,
parent: 12431949,
text:
'This is true - wildlife conservation is an incredibly difficult endeavor.
Classical strategies such as those employed by WildAid [1] are not the only
approaches on how to help poor creatures to survive poaching. Unfortunately,
governments are slow to adopt technologic approaches that might help, and there is
fierce resistence in NGOs to do so. The Rhino is a classical example of that case
[2].[1] <a href="http://goo.gl/c8iQZs"
rel="nofollow">http://goo.gl/c8iQZs</a> \nPanel on Conservation
through Technology, New Harvest Conference.[2] www.pembient.com, <a
href="http://twitter.com/pembient;"
rel="nofollow">http://twitter.com/pembient;</a> Biotech Startup.',
time: 1473107093,
type: 'comment' }
{ by: 'wuschel',
id: 12426567,
parent: 12426120,
text:
'That means that we should take it as a lesson to improve our way to handle
decisions like that.',
time: 1473021259,
type: 'comment' }
{ by: 'wuschel',
id: 12426021,
kids: [ 12426120 ],
parent: 12425892,
text:
'Generally, I do agree with you. Voting power, even if it is just one vote,
comes with responsibility. And one should respect a vote, and also demand from a
voter to behave in a mature, educated and responsible way.> So all the rest
(economic devastation, EU disintegration, counterproductive attitudes) might be
exactly [...]I doubt that one can draw a straight line from the outcome of the
referendum to a fatalistic, self destructive attitude of the population of the UK.
There are many factors at play here - protest votes against the political
establishment, general abstinence, phobia against EU bureaucracy, nationalistic
tendencies et cetera. I am not in the picture here, since I have never lived long
enough in the UK to understand the tendencies at hand.> perhaps democracy
isn't really your preferred form of government.I will not comment on that
apart from the remark that every form of human government has its suboptimal
characteristics. Democracy is not such a bad solution - apart from the fact when it
fails.All in all, again, the EU will survive the BREXIT, albeit it will take
damage. The UK might not.',
time: 1473014876,
type: 'comment' }
{ by: 'wuschel',
id: 12425796,
kids: [ 12425892 ],
parent: 12424995,
text:
'As mentioned above, the vote has been made - but is not legally binding.
I completely agree that one should respect the vote of the voters - after all,
isn't that one of the basis of our western political systems?On the other
hand, what if the electorate did not vote out of protest, was misinformed by the
politicians or media, or simply not educated enough to make the proper choice?
Apart from the shocking failure of an established western democracy to make a good
economical and political choice, what are the consequences at stake here?For our
startup, for instance, it means that we considered dropping potential R&D
partners from the UK. For the UK economy, the consequences might be
devastating.In general, I am all for removing UK's special privileges, and
their counterproductive attitude towards the EU. But I also do not want to see them
go. The EU would loose a member state, and the UK might desintegrate (Northern
Ireland and Scotland sure want to stay in the EU!).',
time: 1473012423,
type: 'comment' }
{ by: 'wuschel',
id: 12424690,
kids: [ 12424881, 12424995 ],
parent: 12424639,
text:
'I understand, thanks for elaborating on that matter.In a way, a clean
way to do it would to be a call for elections, and a proper mandate - either to
stay in, or stay out. But that might not happen, considering the nature of the
political game.I agree about the reasons to worry, and to have a proper
discussion. Things tend to get out of hand sometimes when it comes to media.',
time: 1473001469,
type: 'comment' }
{ by: 'wuschel',
id: 12424578,
kids: [ 12424639, 12424678, 12425138 ],
parent: 12424280,
text:
'Please correct me if I am wrong - as I understand, the referendum for the
BREXIT is not binding.As such, there is a lot of fuss and hot air about
things that will possibly not materialize. Not to mention all those speculative
business affairs..',
time: 1473000369,
type: 'comment' }
{ by: 'wuschel',
dead: true,
id: 12314690,
parent: 12311523,
text:
'Interesting remark, and it in a way can be observed in our daily lives around
the world when you compare to what older generations said.Could you point me to
some of these essays? I would like to have a look at them.',
time: 1471542211,
type: 'comment' }
{ by: 'wuschel',
id: 12314688,
parent: 12311523,
text:
'Interesting remark, and it in a way can be observed in our daily lives around
the world when you compare to what older generations said.Could you point me to
some of these essays? I would like to have a look at them.',
time: 1471542209,
type: 'comment' }
{ by: 'wuschel',
id: 12292943,
parent: 12292301,
text:
'IMHO this is a very individual matter. An uneven split among founders should
not be red light, as long as it is in the same magnitude.',
time: 1471290956,
type: 'comment' }
{ by: 'wuschel',
id: 12250895,
parent: 12247633,
text:
'The question is: Do you really want to leave earth, the only habitat for us
humans (and other species) that is accessible to us? Live will change and evolve
under other conditions; as such, earth is our home, and unique.I propose saving
this planet, and not messing up another one.',
time: 1470690620,
type: 'comment' }
{ by: 'wuschel',
id: 12214478,
parent: 12214258,
text:
'I found the design of the sample processing robot and the overall design
concept of the automated process very interesting.Some quotes from the
Q&A:-- "We have a lot work to do .."-- ".. I had have
started earlier in the context of building the scientific and medical board
.."-- "We have shown today is the architecture [invention] of a
platform that is capable to run multiple assay methods simultanously.."No
independent study of fingerprint sample tech in the form of primary data e.g.
actual users, customers etc has been shown.Slides can be found at: <a
href="https://www.aacc.org/~/media/files/annual-
meeting/2016/theranosaaccpresentation.pdf"
rel="nofollow">https://www.aacc.org/~/media/files/ann
ual-meeting/2016/thera...</a>',
time: 1470183491,
type: 'comment' }
{ by: 'wuschel',
descendants: 2,
id: 12214258,
kids: [ 12214478, 12214407 ],
score: 2,
time: 1470180817,
title:
'Theranos CEO Holmes Speech at ACC: Miniaturization of Laboratory Testing',
type: 'story',
url: 'https://www.youtube.com/watch?v=n6JRG733ReQ' }
{ by: 'wuschel',
id: 11510377,
kids: [ 11513949 ],
parent: 11510003,
text:
'Could you elaborate, with some examples? I am aware of the risks involved in
using US cloud services, as every data on the cloud is exposed to hostile access to
some point. Basically, keep your mission critical files of the internet.I just
would like to have some sources / explanations to your statement.',
time: 1460810814,
type: 'comment' }
{ deleted: true,
id: 11510035,
parent: 11506258,
time: 1460802012,
type: 'comment' }
{ by: 'wuschel',
id: 11468811,
parent: 11468359,
text:
'I wonder if the 'tick a box per day' model is a proper visualization
of your life. You age, health and knowledge define your potential of doing
and accomplishing things e.g.-- the majority of your top quality relationships
are build in the first third of your life-- you are very attractive for females
between 25-40-- you can learn certain things very fast as a kid-- you age
exponentially after a certain biologic age et cetera',
time: 1460332764,
type: 'comment' }
{ by: 'wuschel',
id: 11421364,
parent: 11420524,
text:
'Not only the capabilities of this tool are limited - so is our understanding of
many of the fundamental concepts that might give us control over the biofactories
that are living cells e.g. think protein folding.',
time: 1459773422,
type: 'comment' }
{ by: 'wuschel',
dead: true,
id: 11172381,
score: 1,
time: 1456374214,
title: 'Atlas robot video from Boston Dynamics',
type: 'story',
url: 'https://youtu.be/rVlhMGQgDkY' }
{ by: 'wuschel',
id: 10975573,
parent: 10974728,
text: 'Sounds great! Thumbs up for leading the way, YC.',
time: 1453838358,
type: 'comment' }
{ by: 'wuschel',
id: 10952071,
kids: [ 10952113 ],
parent: 10943658,
text:
'Interesting read of the introduction - and very good points. Perhaps yew was
also way too hard to come by / expensive for the Scottish?Also, it does
make sense that training long term military personel was reserved to the ruling
feudal class. Still, producing a longbow compatible population (of strong, loyal)
men might have had other costs then political ones. Precision wise, a longbow is
not a real tournament weapon - and you needed tall, strong men to wield it.',
time: 1453461309,
type: 'comment' }
{ by: 'wuschel',
id: 10946804,
parent: 10945715,
text:
'Please explain the downvotes. Sure, the comment was a quick shot comment about
'X for Y' ventures, but I do indeed guess that many current IT unicorns
are not straying so much into bleeding edge technology, but are following a market
grab/lockdown strategy on platforms (www/mobile) that are fairly well
developed. And I do not want to claim that any of those approaches are bad - people
seem to speculate that they can make a lot of money from them.',
time: 1453397755,
type: 'comment' }
{ by: 'wuschel',
id: 10945715,
kids: [ 10946804 ],
parent: 10945508,
text:
'I guess there is just a limited solution space for the current problems, and
many possible points have been farmed at a certain point of time. Until legislative
or technologic changes come in, the eco-system will go more and more into bubble
mode.',
time: 1453389527,
type: 'comment' }
{ by: 'wuschel',
id: 10942078,
parent: 10941018,
text:
'A big problem is the timing in regard to the value that YC offers your for your
equity.We found out that having left an accelerator program, it is difficult
take a potential deal with YC, as the cost of further dilution has to go with
potential higher valuations in SF.In fact, apply for YC first. If you don't
get in, but have a respectable accelerator program and network, consider moving on
and push it. Many roads lead to Rome.',
time: 1453330896,
type: 'comment' }
{ deleted: true,
id: 10871045,
parent: 10871014,
time: 1452343273,
type: 'comment' }
{ by: 'wuschel',
id: 10843150,
kids: [ 10843414 ],
parent: 10843071,
text:
'True. But there are already solutions in place to undermine this anonymity e.g.
the bonus card system (see previous comment).',
time: 1452001090,
type: 'comment' }
{ by: 'wuschel',
id: 10843145,
kids: [ 10843212, 10846184, 10843176, 10843229 ],
parent: 10842985,
text:
'Then I do hope that you do not own a cashback etc bonus card, or your
can be quite sure that your personal consumption related high resolution data will
end up in some buyers pocket.And all that for a cheaper (and cheap) bread-
knife.',
time: 1452000984,
type: 'comment' }
{ by: 'wuschel',
id: 10767185,
parent: 10767141,
text:
'Good point.Ebook readers have not evolved much as they should in usability.
Not sure if that is due to their nature as lock-in device, or if there is
some other reason.I am still waiting for a open e-ink ebook reader that has a
good interface for managing a ebook collection.',
time: 1450623688,
type: 'comment' }
{ by: 'wuschel',
id: 10684214,
kids: [ 10684450 ],
parent: 10680127,
text:
'I wonder what the failsafe mechanisms are in regard to infection of the storage
medium with fungi/bacteria that might alter the stored information. In my
humble opinion that might a problem that should be considered when it comes the
actual application of the concept.',
time: 1449371142,
type: 'comment' }
{ by: 'wuschel',
id: 10628594,
parent: 10628083,
text:
'Are the some examples on how to implenent a statically regenerated blog in a
static site?',
time: 1448475390,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 10596674,
score: 2,
time: 1447958988,
title: 'Monitoring online censorship',
type: 'story',
url: 'https://onlinecensorship.org/' }
{ by: 'wuschel',
id: 10590909,
parent: 10590140,
text:
'I am not speaking necessarily about prevented live assaults, but about pre-
emptive action as well.But I get your point. I need to check that article back
then.',
time: 1447882412,
type: 'comment' }
{ by: 'wuschel',
id: 10589300,
kids: [ 10590140, 10590214 ],
parent: 10588944,
text:
'I would disagree with this reasoning.Yes, french HUMINT has heavily
infiltrated extremist organizations, and failed to prevent this attack. It does not
mean that it was the use of encryption that allowed ISIS/extremist
organizations to execute this attack on french soil.The french secret service
approach is fundamentally different from the US, as they historically rely less on
SIGINT.I am not sure where I read it, but in presume the number of prevented
attack is in the thousands.',
time: 1447868462,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 10589258,
score: 1,
time: 1447868175,
title: 'La Paillasse – France\'s First Biohacker Space',
type: 'story',
url: 'http://lapaillasse.org' }
{ by: 'wuschel',
id: 10589252,
parent: 10582302,
text:
'Truly impressive accomplishment. My congratulations.And now imagine that you
actually do not need MIT. In comparison to what you have done, it is another
rigid institution with a more or less rigid structure.I hope the educational
landscape will keep changing, giving more alternative bodies to aquire high end
knowledge, e.g. through hacker spaces, virtual/internet based platforms,
etc.',
time: 1447868111,
type: 'comment' }
{ by: 'wuschel',
id: 10550916,
kids: [ 10551083 ],
parent: 10550575,
text:
'Thanks for the example. Can you compare Hakyll to other static site
generators?',
time: 1447295474,
type: 'comment' }
{ by: 'wuschel',
id: 10550184,
kids: [ 10550575 ],
parent: 10549719,
text:
'Are there any examples of a non-blog use case with Hakyll e.g. a partly static,
partly generated website?How does Hugo compare to Hakyll?',
time: 1447284797,
type: 'comment' }
{ by: 'wuschel',
id: 10550174,
parent: 10550047,
text:
'Interesting.In general: What would be the best approach towards having a
part of the website static (main part), and only the blog/press part being
regenerated?Does Hugo/Pelican/Jekyll/Hakyll etc handle this kind
of functionality?As an alternative, what would be a good light weight CMS these
days (ideally in Python)?',
time: 1447284622,
type: 'comment' }
{ deleted: true,
id: 10549350,
parent: 10548245,
time: 1447276643,
type: 'comment' }
{ by: 'wuschel',
id: 10549340,
parent: 10548245,
text:
'In general, you want to search for the German Question [1]. Germans have
been populating central/eastern european territories for a long time, both as
colonists (think Katherina/Kasachstan/Siebenbuergen-Rumania) and as
remainders of the Holy Roman Empire of German Nation.The French
Revolution [2] and the coming of the Spring of Nations [3] brought the
question back on the table. Throughout this period, but especially around 1848, it
was heavily debated among Germans.Europe, dispite its small size, has a very
exiting and thrilling history. A pity what happened to it in the last century. Mais
c'est la vie, so to say.But back to Austria - of course many an Austrian
loved to be unified into the new German Empire, a technologically moderns society,
the Third Reich, that was prophesized to last for a thousand years. After
the scars of defeat of WWI, and Entente dictation, people looked for a
savior.He came in the form of a failed Austrian artist. History has its
ironies..[1] <a
href="https://en.wikipedia.org/wiki/German_Question"
rel="nofollow">https://en.wikipedia.org/wiki/German_Question</a
>\n[2] <a
href="https://en.wikipedia.org/wiki/French_Revolution"
rel="nofollow">https://en.wikipedia.org/wiki/French_Revolution<
/a>\n[3] <a
href="https://en.wikipedia.org/wiki/Revolutions_of_1848"
rel="nofollow">https://en.wikipedia.org/wiki/Revolutions_of_184
8</a>',
time: 1447276529,
type: 'comment' }
{ by: 'wuschel',
id: 10548493,
kids: [ 10549250 ],
parent: 10545879,
text:
'I wonder in what stage they are in.I once had a side project going to make
spider silk chemically. I am still in awe on how the spider developed this amazing
tool: the cascade of chemical reactions involved, the spider bio-reactor
that spins the chemicals into the spider silk thread. And of course, so little hope
to go anywhere near that with classical chemical means.I agree with
toufka on that one: "It's hard to see unless you look closely,
but this is the beginning of biological nanotechnology."I wonder at
what stage they are, and how the parameters of their material compare to naturally
woven spilder silk.',
time: 1447268658,
type: 'comment' }
{ by: 'wuschel',
id: 10533210,
parent: 10532240,
text:
'The Prora museum on the island of Rügen (the Kraft durch Freude Hotels)
is worth visiting in that regard. It illustrates war planning (tactical and
strategic nuclear strikes) in the case of a soviet attack and the projected
civilian losses.',
time: 1447079756,
type: 'comment' }
{ by: 'wuschel',
id: 10531457,
kids: [ 10531848 ],
parent: 10530454,
text:
'Great article about one of the amazing moments in modern world history. It does
not go enough into detail, but it is already a thrilling read:A country that was
to be the conventional and possibly nuclear battleground between NATO and
Warsaw Pact reunited in a moment of amazing timing."Wir sind ein
Volk!" .. what a powerful slogan, given Germany century old struggle for its
definition and borders. I still remember those cheap east german Trabant
cars suddenly invading West Germany, and people not believing that the decade old
separation was gone.With unification, the border between the two superpower
blocks moved further east, and the power of balance changed in Europe. And the
notion of Germany being a battlefield like Tom Clancy sketched it in one of his
books faded away.The sad part these days was the conflict in the Balcans. I hope
that these documents will be published as well, revealing some of the politcal game
making in that time.',
time: 1447044772,
type: 'comment' }
{ by: 'wuschel',
id: 10528706,
parent: 10525042,
text:
'(Disclaimer/shameless advertisement: I am a co-founder of a project in the
problem domain. We are currently in seed stage, fundraising mode, and are going to
have a look at the U.S. east/west coast soon).I am quite happy to see YC to
jump on the SynBio train. While other specialized accelerators such as
IndieBio [1] have been first in this fairly unclaimed industry sector, I
expect their involvement to trigger a cascade in professional investment that will
help the bulk of us to get more money. In contrary to software (and for a multitude
of reasons), biotech investments have recovered at a much slower pace since the
2008 crash.If I get around to make a solid write up, I would like to compare the
wet/hardware biotech startup accelerator experience. As in software, biotech
tools have made a great improvement and became cheaper by orders of magnitude.
However, the development workflow is still different, and many things such a
reproducibility, lab environment, specialized talent are not as easy to come by in
a lean and fast accelerator program. 3 month to MVP is a true challenge - we were
quite lucky that we made it [2].Biotech can be far more complicated as software
on the business side of things, and going lean is often not really an option (think
production standards, ISO/cGMP). A 1:1 copy of the software accelerator model
is definitely not enough.[1] <a href="http://indie.bio"
rel="nofollow">http://indie.bio</a>\n[2] <a
href="http://sothicbio.science"
rel="nofollow">http://sothicbio.science</a>',
time: 1446996401,
type: 'comment' }
{ by: 'wuschel',
id: 10518662,
parent: 10518135,
text:
'This.Of course I would love to see HN data, but I believe that there is a
fair amount of users that are not located anywhere near Silicon Valley.An
indicator of this would be the fact that many people I know from the EU startup
scene have an HN account. Different age group, background, and profession. Of
course, the sample size is not that large here.',
time: 1446805033,
type: 'comment' }
{ by: 'wuschel',
id: 10517233,
kids: [ 10518034 ],
parent: 10517084,
text:
'It is possibly one of the most diversified tech communities on the planet. As
such it attracts talent. At the end, talent is your most valuable raw material as
an accelerator/startup.HN pulls techies/hackers like a magnet. In a
way, it was the internet exposure to YC/HN/pg's essays that brought
me into the startup world. And in a way, it was always my aspiration to go to
Mountain View and talk to those people that gave me that exposure.:)',
time: 1446771343,
type: 'comment' }
{ by: 'wuschel',
id: 10513819,
kids: [ 10515113, 10516173 ],
parent: 10513369,
text:
'Very interesting. Do you have any source regarding their endeavours, or did you
perhaps have any dealing with them?What is the state of their biotech
scene?',
time: 1446737311,
type: 'comment' }
{ by: 'wuschel',
id: 10513811,
kids: [ 10513983 ],
parent: 10513252,
text:
'Thanks for your feedback. That does remind me my time in the eastern block.
Just a bit harsher. This might very well be a distribution problem e.g. some
sectors being prioritized, and the people being left to their own fate.',
time: 1446737214,
type: 'comment' }
{ by: 'wuschel',
id: 10513116,
kids: [ 10513252, 10513369 ],
parent: 10511308,
text:
'I found it rather surprising to see Cuba being a "major exporter of
medical products" and a "leader in biotechnology".I
can understand the medical tech - it makes sense given the level of cuban medical
education. But biotech? What kind of biotech? Could anyone comment on that?An
article I found [1] mentions some serious products, but what about the regulations?
[1] <a href="https://t.co/yElsLVfZdt"
rel="nofollow">https://t.co/yElsLVfZdt</a>',
time: 1446729659,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 10489940,
score: 2,
time: 1446437142,
title: 'IBM Developing New Blockchain Smart Contract System',
type: 'story',
url:
'http://www.coindesk.com/ibm-developing-new-blockchain-smart-contract-system/' }
{ by: 'wuschel',
descendants: 0,
id: 10210016,
score: 1,
text: '',
time: 1442107577,
title: 'Security contracting firm run as a non-profit',
type: 'story',
url: 'http://www.sonsoflibertyinternational.com/' }
{ by: 'wuschel',
id: 10202450,
kids: [ 10204021 ],
parent: 10202101,
text:
'Very nice.What was your motiviation to give it a go? The lack of options
from AirBnB in this segment?I like the idea of your challenge: 12 Startups in 12
Months. (-: Would love to hear how it works out in the long run.',
time: 1441957343,
type: 'comment' }
{ by: 'wuschel',
id: 10202442,
parent: 10202304,
text:
'A 300 ml mixture of sugars, proteins, water and salts: COFFEE.Disassembled
the entire notebook into small parts, washed it with destilled water, isopropanol,
destilled water, let it dry for a week or so, re-assembled it (don't forget to
make pictures).. et voila, it worked!',
time: 1441957093,
type: 'comment' }
{ by: 'wuschel',
id: 10194838,
parent: 10194008,
text:
'Would there be any users of these knowledge systems that could give any
comments on howa) the user base evolved\nb) how effective this system is in
comparison to existent genomic/synthetic pathway/etc
databasesThanks!',
time: 1441835069,
type: 'comment' }
{ by: 'wuschel',
id: 10192519,
kids: [ 10196447 ],
parent: 10190524,
text:
'Well, the question is, apart from money, what is the motivation for the movie?
For sure, Woz would like to set some things straight and tell his perspective on
things. I once stumbled about a comment from Woz regarding the Steve Jobs movie. He
was not very pleased with the narrative of the Jobs film.The comment is
an interesting read, and it can be found at:<a
href="https://plus.google.com/
+CarmsPerez/posts/GnVTvQNgvpf"
rel="nofollow">https://plus.google.com/
+CarmsPerez/posts/GnVTvQNgvpf</a>',
time: 1441817317,
type: 'comment' }
{ by: 'wuschel',
id: 10192477,
kids: [ 10192609 ],
parent: 10192439,
text:
'> I completely agree with that. Outside of IT, there are many areas that
would benefit from some programming knowledge and are currently under-
served.I'd like to emphasize this sentence. There is not just binary code
that is used in software. Great challenges arise in other domains e.g. such as
synthetic biology.',
time: 1441816968,
type: 'comment' }
{ by: 'wuschel',
id: 10191846,
kids: [ 10192283 ],
parent: 10190249,
text:
'Code: The Hidden Language of Computer Hardware and Software by
Charles Petzold is an excellent book I have recently begun to read.
It's even longer that the Bloomberg post, and also such much more detailed and
in-depth (-;In fact, I found the book very enjoyable. It gives a nice pedagogic
twist on how information can processed with hardware.It has been discussed on HN
here: \n<a href="https://news.ycombinator.com/item?id=1936474"
rel="nofollow">https://news.ycombinator.com/item?id=1936474</a>',
time: 1441810913,
type: 'comment' }
{ by: 'wuschel',
id: 10178144,
kids: [ 10180726 ],
parent: 10178074,
text:
'Good point, but I would like to compare the entire educational/job
training spectrum. In Germany, many people decide to go for an apprenticeship or a
position in the dual educational system [1], even if they qualify for the
university path with the matura. These are not counted as university students.I
agree on the remark on baseline quality of university.[1] <a
href="https://en.wikipedia.org/wiki/Dual_education_system"
rel="nofollow">https://en.wikipedia.org/wiki/Dual_education_sys
tem</a>',
time: 1441558123,
type: 'comment' }
{ by: 'wuschel',
id: 10158669,
parent: 10158583,
text:
'My favorite scheme is featuring a more eye friendly, informative website.',
time: 1441196352,
type: 'comment' }
{ by: 'wuschel',
descendants: 1,
id: 10158583,
kids: [ 10158669 ],
score: 3,
text: '',
time: 1441194884,
title: 'Chicken Scheme – A practical and portable scheme system',
type: 'story',
url: 'http://www.call-cc.org/' }
{ by: 'wuschel',
id: 10085399,
parent: 10084848,
text:
'Firefox may be a decent browser, but unfortunatly Mozilla has given in when it
comes to adopting data kraken integration and has embedded software that can make
Firefox en par with Chrome et al in the future.No more good guys, I am afraid.
Mozilla profited greatly from being spread by hackers initially, but now they no
longer qualify for being supported.No source here, I am on a crappy notebook, on
the move.',
time: 1439992313,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 9888351,
kids: [ 9890138 ],
score: 2,
text: '',
time: 1436911091,
title:
'Antha – high-level language to rapidly compose reproducible biology work
flows',
type: 'story',
url: 'https://www.antha-lang.org/' }
{ deleted: true, id: 9888345, time: 1436911006, type: 'story' }
{ by: 'wuschel',
descendants: 0,
id: 9880824,
score: 1,
text: '',
time: 1436819365,
title:
'ZuluCrypt is a simple,feature rich and powerful solution for disk encryption',
type: 'story',
url: 'http://mhogomchungu.github.io/zuluCrypt/' }
{ by: 'wuschel',
id: 9763878,
parent: 9763173,
text:
'Interesting. A so called broad coalition to "verify eyewitness media
and use it in news reporting".Could someone from the media startup
sector comment whether this is a land grab from Google in the news/journalism
sector? There have been quite some endeavours to bring innovative tools into the
land of journalism. This one sounds exciting.',
time: 1435058222,
type: 'comment' }
{ by: 'wuschel',
id: 9616516,
parent: 9616301,
text:
'Weather conditions like this make a difference and lower the
dynamics of the war. Strategically, there are more factors like supply lines, wrong
strategic decisions, and an industrial complex that us sufficient enough to
regenerate the losses [1].[1] <a
href="http://strategicstudiesinstitute.army.mil/pubs/parameters
/Articles/99spring/hooker.htm"
rel="nofollow">http://strategicstudiesinstitute.army.mil/pubs/p
arameters/Ar...</a>',
time: 1432797576,
type: 'comment' }
{ by: 'wuschel',
id: 9540289,
parent: 9540230,
text:
'I agree. The trick will to i) undercut rhino horn prices and ii) make it
undistinguishable from the original. Quite a challenge, but I like the idea.',
time: 1431536273,
type: 'comment' }
{ by: 'wuschel',
id: 9540208,
kids: [ 9540438, 9540230 ],
parent: 9537900,
text:
'There is a start-up that tries to eliminate "the $750 million illegal
rhino horn poaching trade by growing rhino horns made from rhino DNA and 3D printed
keratin".(Disclaimer: I am not affiliated with Pembient).',
time: 1431535662,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 9441070,
score: 1,
text:
'1) What are the leading bio/chem/hardware/medical accelerators?
2) What are the 'packages' of the leading bio/chem/hardware
accelerators e.g. initial funding, percentage of company shares taken,
infrastructure, mentoring program, track record?3) Is it even recommended to
join a accelerator as a bio/chem/hardware team? The parameters money (and
time) to prototype/product are larger as for software solutions - how do
accelerators compete here with, let's say, a solid industry collaboration that
may offer significant infrastructure and know how from the particular technology
sector?I would be happy to hear some opinions, or perhaps, even better, some
hard earned experience.Cheers!',
time: 1430038382,
title:
'Ask HN: Questions about Accelerators for BioChemMed+Hardware',
type: 'story',
url: '' }
{ by: 'wuschel',
descendants: 0,
id: 9423284,
score: 1,
text:
'While there are plenty of accelerators in the software space, a team inclined
to solve a problem in the wetware/hardware domain is much less lucky to land
in a sweet spot that gives some funding and caters to its specific needs.Here
are the questions:1) Does YC offer a special package for teams that come from
the biotech sector e.g. in the form of lab space, access to analytic hardware, etc?
2) What are the leading bio/chem/hardware accelerators?3) What are
the 'packages' of the leading bio/chem/hardware accelerators
e.g. initial funding, percentage of company shares taken, infrastructure, mentoring
program, track record? E.g. Indie.Bio takes 8%, fives roughly 50$ in cash and 50$
for the possibility to use the labs in Cork for 3 months and for accelerator
program participation.4) Is it even recommended to join a accelerator as a
bio/chem/hardware team? The parameters money (and time) to
prototype/product are larger as for software solutions - how do accelerators
compete here with, let's say, a solid industry collaboration that may offer
significant infrastructure and know how from the particular technology sector?I
would be happy to hear some opinions, or perhaps, even better, some hard earned
experience.Cheers!',
time: 1429734091,
title:
'Ask HN: Are accelerators for bio/chem based startups any good?',
type: 'story',
url: '' }
{ by: 'wuschel',
id: 9412854,
parent: 9411182,
text:
'Congratulations for your product launch. It must be great to see so much hard
work finally pay off!Could you tell a bit more about the agri-sensor market, how
you made your feature choices, and what you learned along the way?Cheers!',
time: 1429605767,
type: 'comment' }
{ by: 'wuschel',
id: 9332103,
kids: [ 9332338 ],
parent: 9331931,
text:
'I prefer the Handbook of Mathematics by Bronstein, which is a math
reference bible for most science students in Germany. <a
href="http://www.amazon.com/Handbook-Mathematics-I-N-
Bronshtein/dp/3540434917"
rel="nofollow">http://www.amazon.com/Handbook-Mathematics-I-N-
Bronshtein/dp...</a>',
time: 1428382784,
type: 'comment' }
{ by: 'wuschel',
descendants: 6,
id: 9277054,
kids: [ 9280430, 9280640, 9280096, 9281084, 9280767 ],
score: 82,
time: 1427472072,
title:
'Ciao – Logic, constraint, functional, higher-order, and object-oriented
language',
type: 'story',
url: 'http://ciao-lang.org/' }
{ by: 'wuschel',
id: 9214314,
parent: 9213010,
text:
'Molecular Gastronomy - every time hear this buzzword marketing comes
into my mind."Food chemistry" is not sexy enough, a already occupied
and defined by scholars.',
time: 1426539218,
type: 'comment' }
{ by: 'wuschel',
id: 9183600,
kids: [ 9183806 ],
parent: 9183407,
text:
'There is a shell script in the source that converts the ipython notebook files
into PDF. Unfortunatly, I do not have access to my linux box these days to do the
conversion.',
time: 1426075080,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 9179844,
score: 2,
text: '',
time: 1426014057,
title: 'The Mozart Programming System',
type: 'story',
url: 'http://mozart.github.io/' }
{ by: 'wuschel',
descendants: 0,
id: 9156253,
score: 3,
text: '',
time: 1425633003,
title: 'Kotlin – Statically typed, targeting the JVM/JavaScript',
type: 'story',
url: 'http://kotlinlang.org/' }
{ by: 'wuschel',
descendants: 0,
id: 9133850,
score: 1,
text: '',
time: 1425325441,
title: 'Ceylon-lang: Static types that just work',
type: 'story',
url: 'http://www.ceylon-lang.org/' }
{ deleted: true,
id: 9112137,
parent: 9112130,
time: 1424952195,
type: 'comment' }
{ deleted: true,
id: 9112130,
kids: [ 9112137 ],
time: 1424952070,
type: 'story' }
{ by: 'wuschel',
id: 9106736,
kids: [ 9109024, 9107414 ],
parent: 9106562,
text:
'Quoting Dan Geer: "Convenience, freedom, security - choose
two."Solid cryptography concepts were never easy to implement and use.My
main problem lies not with the Gnu/PG or PGP software implementations, but
with the actual platforms. Do I trust my iPhone/Android/public internet
cafe computer/the family computer? Is it compromised? What about your computer
manufacturer? Lenovo, perhaps? Or Apple?The problem of information safety does
go far beyond software. Neglecting this is not an option.There is certainly life
in the old dog called pgp, but I am yet to be convinced of a mass market
software concept that allows me to have the same level of confidence in its
security as the open source packages I have installed on my offline
computer."The paranoid will survive."',
time: 1424872813,
type: 'comment' }
{ by: 'wuschel',
id: 9106288,
parent: 9104188,
text:
'Well, that is certaily an understandable position. I am very happy that such a
software exists in the open source community, as unpractical it might
be.The trouble, however, does not start with the lack of UI design, or other
impracticalities - for me it starts with the platform I choose to run a PGP type of
software on.Would you trust your Iphone, Android,
Microsoft/Linux/iOS/Lenovo/Dell/et cetera computer with
"really sensitive, mission critical" data?I
don't."The paranoid will survive" is a good sentence to remember.
So I better install that PGP-etc on a offline unit and decrypt encrypt my messages
there.',
time: 1424864850,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 9050113,
score: 2,
text: '',
time: 1423934140,
title: 'Hoplon – A simpler way to program the web with Clojure',
type: 'story',
url: 'http://hoplon.io/' }
{ by: 'wuschel',
descendants: 26,
id: 9043561,
kids:
[ 9044733,
9044220,
9045881,
9044110,
9044769,
9044378,
9045924,
9044818,
9044765 ],
score: 54,
time: 1423819772,
title: 'Avail Programming Language',
type: 'story',
url: 'http://www.availlang.org/' }
{ by: 'wuschel',
descendants: 41,
id: 9008472,
kids:
[ 9011067,
9011372,
9010600,
9011250,
9011997,
9011961,
9010958,
9010939,
9010686,
9012620,
9015058 ],
score: 109,
text: '',
time: 1423220132,
title: 'Factor – A practical stack language',
type: 'story',
url: 'http://factorcode.org/' }
{ by: 'wuschel',
descendants: 0,
id: 8819776,
score: 19,
text: '',
time: 1420041077,
title: 'The GDELT Project – A Global Database of Society',
type: 'story',
url: 'http://gdeltproject.org/data.html' }
{ by: 'wuschel',
descendants: 0,
id: 8812134,
score: 3,
text: '',
time: 1419891594,
title: 'The GDELT Project – A Global Database of Society',
type: 'story',
url: 'http://gdeltproject.org/' }
{ by: 'wuschel',
id: 8729673,
parent: 8723026,
text:
'Disclaimer: I am not french.I happen to be in Paris in these days in order
to have a look at the startup and tech scene there.So far I am surprised how
well most french people speak English. Not perfect, of course, but they do not mind
switching to english in a meetup presentation.I can not say much about the
points you mention, though, as I have not been long enough in the city of Paris to
get relevant data.',
time: 1418225811,
type: 'comment' }
{ by: 'wuschel',
id: 8532466,
parent: 8532261,
text:
'The "skin of a rhinoceros" - I liked that the most, as it reflects
the development one makes when being part of a minority, no matter if it is sexual,
financial ethnical or political nature.',
time: 1414671474,
type: 'comment' }
{ by: 'wuschel',
id: 8508266,
parent: 8506406,
text:
'(By sheer coincidence,) I sat next to Mr. Piech in the same Bentley in Paris
this year. We had a short conversation, and it took some time before I realized who
he was. An old man - with a truly sharp mind. The shadow king of VW.',
time: 1414246561,
type: 'comment' }
{ by: 'wuschel',
id: 8501211,
kids: [ 8501291 ],
parent: 8498041,
text:
'I am not into the research field of general artifical intelligence. How does
the "Human Brain Project" fit into this matter? It seems to me like the
EU is directing quite a financial package into the direction of AGI, at least when
it comes to understanding human brain activity and functionality.link: <a
href="https://www.humanbrainproject.eu/"
rel="nofollow">https://www.humanbrainproject.eu/</a>',
time: 1414105582,
type: 'comment' }
{ by: 'wuschel',
id: 8248854,
parent: 8245444,
text:
'In Germany, Call-a-bike (Deutsche Bahn) [1] operates exactly like this. Bikes
can be rented everywhere inside the city, and can be left on every junction within
a city. There are no drop-off/rental stations.So far, I did not have any
problems to find a bike when I needed it.[1] <a
href="http://www.bahn.de/p/view/service/fahrrad/call_a_bike.shtml"
rel="nofollow">http://www.bahn.de/p/view/service/fahr
rad/call_a_bike.shtml</a>',
time: 1409477317,
type: 'comment' }
{ by: 'wuschel',
id: 8196966,
parent: 8155614,
text:
'Hello George,nice to see a chemist, especially one who managed to claim some
market share on his own! With hard/wetware, it is not so easy to get your own
company going.. and would love to have my own company.I am a chemist, with a
Phd in the field of polymer chemistry, thin films and biomaterials. I did a fair
share of small molecule synthesis, polymerizations, simulations and analytics
(QPCR, surface plasmons, etc).PM me, please.',
time: 1408451814,
type: 'comment' }
{ by: 'wuschel',
id: 8183950,
parent: 8183498,
text:
'This looks interesting. Congratulations on your product launch.There is
something similar out there called calepin (1). It uses the python based
pelican static web site generator.\nNot sure what extra features your
solution offers.(1) <a href="http://calepin.co/"
rel="nofollow">http://calepin.co/</a>',
time: 1408134112,
type: 'comment' }
{ by: 'wuschel',
id: 7660644,
kids: [ 7660657, 7660852 ],
parent: 7660465,
text:
'You have a point. How often/long do you wash your car, and how much $ do
you spend on this? I have to admit, I do not wash my car very often. \nPity they
did not report anything about the cost of deploying the "dirtophobic" car
paint film. If one could make it a quickly applicable, inexpensive "spray and
go" option that allows to regenerate a dirt repelling film - why not. But
there must be a reason why "Nissan says it has no plans to offer the paint as
standard equipment, but will consider making it an option".I am also
wondering why they neglected the windows in the video clip. Might be a problem with
transparency of the film, or a difference in the nature of the film adhesion to
regular paint and glass. It is a pity that they did not provide any data on
mechanical stability and film degradation. Without this data, I still do believe
that this is a PR thing. Alas, it is wired.com.',
time: 1398699436,
type: 'comment' }
{ by: 'wuschel',
id: 7660392,
kids: [ 7660983, 7660465, 7661711 ],
parent: 7659726,
text:
'(Disclaimer: I had a fair share of sucker punches with self-cleaning
surfaces..)Approaches towards self cleaning surfaces have been seen in the lab
since a long, long time: They range from photocatalytic concepts (e.g.
TiO2/SiO2/polymer hybrid coatings for house paint) to surfaces with a
mixture of -OH/-CH3/-F (hydro-/lipophilic and mostly repellent) end
groups that can be produces by plasma treatment, and many more.There is a good
reason that very little of these applications have ended up in mass production: The
stability and durability of the film surfaces. Once you get a surface structure
damage on, say, your "lotus effect functionalized" bathtub, house wall,
car body, dirt starts to accumulate on this spot. The german car industry had quite
a bunch of projects with car windows without front wipers (minimum speed 20
km/h to be effective), there have been a lot of projects for self cleaning
house paints using the sun - but so far there is no effective product on the
market. But of course there are a lot of patents..I have no idea if Nissan found
a way to make a cost effective, self cleansing film coating that can stand the test
of gravel, acid, and time. If they succeeded, then it is a true accomplishment. But
for the reasons listed above, I somehow doubt that.',
time: 1398697588,
type: 'comment' }
{ by: 'wuschel',
id: 7643233,
parent: 7636256,
text:
'Combining the scalibility of software startups with biotechnology is a very
interesting approach, indeed. Apart from the different timeframe when it comes to
working with software and wetware (e.g. lab work with biomaterials), I wonder how
easy it will be to get people and know-how on board. In Europe, young scientists
(speak: PhD-slaves) are often bound to their research institutes when it comes to
the exploitation of the IP generated by their research. They may end up with
publications or patents, but usually it is the partners from industry that bring
the product to the market. How does this compare to the U.S.?',
time: 1398375583,
type: 'comment' }
{ by: 'wuschel',
descendants: 0,
id: 7451118,
score: 1,
text:
'Hello,I would like to know what your experiences are with new co-founders
joining a running team.Usually, there is lots of experience on the side of the
core team, and critical information that needs to be communicated to the new kid on
the block. Also, the new guy should have some time to get to know the working
culture and product of the company.How much time do you give co-founders until
they have to perform as you expect? Do they have to make magic from day 1 on? If a
trial period is an option, how long should it be? What would be critical factors to
kill the new guy, what mistakes are forgivable?Any after-action reports on this,
or perhaps some best practices?Note that this question does not necessarily
relate to a specialized position in the company (e.g. a front end developer), but
can be a position of a generalist type of person that should assist the
CEO.Cheers!',
time: 1395526262,
title: 'Ask HN: Time to get it right when joining a startup',
type: 'story',
url: '' }
{ by: 'wuschel',
id: 7251688,
parent: 7251559,
text:
'I would love to see an alternative to Google - and I am trying hard to give DDG
a chance.But: The quality of the search results just is not there (yet?). Thus I
am mostly using the !g parameter prefix when starting a search.Also, I am not
how strong the impact on privacy is. If DDG would be a german company and I would
have read the TAC, maybe I could sleep better..',
time: 1392639270,
type: 'comment' }
{ by: 'wuschel',
id: 7217240,
parent: 7217158,
text:
'I haven't seen that yet, could be a fun thing to have. I just found an
implementation of Tinylisp in go. It would be fun to have all the funky goroutines
in a schemish design..<a href="http://www.oki-osk.jp/esc/golang/lisp.html"
rel="nofollow">http://www.oki-
osk.jp/esc/golang/lisp.html</a>On another note, there is Chicken
Scheme, which compiles to C and produces executable files. Nice stuff!www.call-
cc.org/',
time: 1392121504,
type: 'comment' }
{ by: 'wuschel',
id: 7195634,
parent: 7186304,
text: 'Hi,thanks for the papers! I will have a look on them.',
time: 1391769361,
type: 'comment' }
{ by: 'wuschel',
id: 7194126,
kids: [ 7195098, 7194718, 7194432 ],
parent: 7193658,
text:
'Very interesting pictures. Most photographs I have seen have been taken in
black and white, and show the destroyed city in 1944/'45.My family had
many tragic memories of the ruins of Warsaw, for they were bound with the jewish
ghetto uprising and the following uprising by the AK (armia krajowa, underround
army).On another note, many cities still show signs of the destructive effect on
war on the jewels of our civilizaton: The battle for Berlin also had a great toll
on the city and its inhabitants, and the battle for Stalingrad (Wolgograd) had the
worst effect on the population of the city: just left a single, half destroyed
house and very few survivors were left. But many more civilian deaths and
destruction of settlement took place during the war - the fires of Hamburg and
Dresden, the destruction of Hiroshima and Nagasaki, and the Blitz on english cities
are well known, but the destruction of smaller settlements and villages are not
mentioned that often.These were terrible days. We should be thankful for the
peace we have.',
time: 1391734825,
type: 'comment' }
{ by: 'wuschel',
id: 7183773,
kids: [ 7186304 ],
parent: 7182776,
text:
'Sorry, but could you back up your statements with facts? This sounds to me as a
rather generic statement.I have no idea about the adaptive capabilities of tuna,
nor do I know the actual change in pH values, or levels of chemical
pollution.Overfishing and the collapse of ecosymstems in the ocean is major
factor (see also whales, sharks, etc).',
time: 1391609595,
type: 'comment' }
{ by: 'wuschel',
id: 7123630,
parent: 7123395,
text:
'Hy looks like fun. On more scheme/lisp derivative on the block. It would
be great to see it on IPython.',
time: 1390705031,
type: 'comment' }
{ by: 'wuschel',
id: 7081020,
parent: 7079739,
text:
'An alternative to Racket would be Chicken Scheme. But again,
anything that has R5RS included will do fine.I would not go with R7RS, but this
is just a personal preference. Seems bloated to me.',
time: 1390054083,
type: 'comment' }
{ by: 'wuschel',
id: 6948413,
parent: 6945292,
text:
'Thank you very much. That was a good kick-off into this difficult topic.',
time: 1387665923,
type: 'comment' }
{ by: 'wuschel',
id: 6948385,
parent: 6947760,
text:
'Neat.Does anyone have a epub/mobi version of this book?',
time: 1387665484,
type: 'comment' }
{ by: 'wuschel',
descendants: 2,
id: 6939168,
kids: [ 6945292 ],
score: 1,
text:
'Hi there,I am thinking about boarding a freshly founded company that is
about to launch its prototype product into the cruel market.While I do not
belong to the 0day crew, I will be the second full-time person dedicated his life
blood to the project. The project has been going on since quite some time, has
formed a legal entity and got a very good deal for 15% of its shares.Most
likely, there are not going to be hires, so I will be responsible for a good deal
of the initial development of the company.Could you point me to recources where
I could read about experiences in fixing founder/co-founder/first
employees contract?Where are the foreseen and unforeseen pitfalls when joining a
startup (except tricky contracts a la loss of shares when leaving the company, 11
year old founders, werewolf team members, etc)?Commiting to a startup full-time
is not like working in a real company, and I would clearly leave other
opportunities that are linked to my background on the table. As such, I would like
to get a fair deal - and to get this, I need data for comparison or any shared
experiences.I thought about making an anonymous Google spreadsheet questionaire
with a couple of parameters to choose and gather some data - and get some first
hand hints here (=Cheers!',
time: 1387500843,
title:
'Ask HN: Is there a FAQ/Guideline on co-founder shares/contracts?',
type: 'story',
url: '' }
{ by: 'wuschel',
id: 6910227,
parent: 6907684,
text:
'Hello Maria,of course you are right: we do possess very advanced tools,
starting from the actual design of drugs that target certain receptors selectively,
medical trials, production and quality control. What I meant by "we do not
understand the brain and thus are not able to design more sophisticated methods to
treat this terrible decease" was the fact that most of the time, we are
treating symptoms, for we are not sure what the actual causes are.It is great
what we can do, but (IMHO) pharmaconeurology still has a long way to go.The
actual process of choosing a drug for a patient is somewhat black voodoo magic: If
A does not work/has bad side effects, B is prescibed, etc.And of course,
due to the nature of our organism, it is impossible (?) that a pharaceulogically
active compound has just one system effect/side effect e.g
"Aspirin".--On a side note: could you PM me in which field you are
active as an entrepreneur? My email is in my account description.Cheers!',
time: 1387131577,
type: 'comment' }
{ by: 'wuschel',
id: 6907381,
kids: [ 6907684 ],
parent: 6907338,
text:
'I am sorry for you and wish you the very best.I would not condemn anti-
psychotic medication just because1. we do not understand the brain and thus are
not able to design more sophisticated methods to treat this terrible decease2.
many patients suffer from terrible side effects.Thanks to some new generation
anti-psychotic drugs (e.g. Risperidol, Abilify, etc) many a person who has the
misfortune to suffer from psychosis can return to their daily live - and by this I
mean that the person can do more then just 'function'. Of course, his
ability to do so depends on the severity of psychosis and dosis of medication. I
know a person who learned to live with his psychosis and has greatly improved his
quality of life in the recent two years.. to such a degree that he may complete his
(ambitious) studies and get a job. Medication was one of the key factors for his
well being, other were a long series of psychologic treatments and support from his
surrounding.It also true that in societies where the access to anti-psychotic
drugs is restricted (e.g. lack of a pharmaceutical industry) a completely different
development of the person is observed, not necessarily in a negative way. However,
the nature of psychosis is deeply connected with genetic (hard) and enviromental
(soft) factors, such as family, society, experience as a child, etc - so no actual
comparison can be made between those patient groups.Right now, there is no
solution to this phenomenon of brain disfunction, and research has a long way to go
to understand the structural changes in the brain of psychotic persons during their
beginning adolescence and possible treatment.At the end, stigmatization of
psychosis should be avoided, as should be any general magic recipe - every patient
is a single case who deserves the best treatment and support from his family and
friends.',
time: 1387060261,
type: 'comment' }
{ by: 'wuschel',
id: 6814564,
kids: [ 6814865, 6814893, 6818030 ],
parent: 6812499,
text:
'(Disclaimer: I am a python that found a new home in the scheme world)Clojure
is a Lisp. Lisp based languages are great.However:One of the problems with
clojure - or rather with its home or ecosystem - is the fact that it requires a
very high activation energy to get going. Grasp the concept of functionial
programming, cc/call, macros, totally different syntax than your previous
imperative language of choice, and last but not the giant blob that is called Java
platform with all the traps regarding project management, IDEs, building,
compiling, deploying etc. I know that there are great tools such an Leiningen or
LightTable, but they only make the whole process of transition more
manageable.Now, I know that Java is a huge benefit for all that want to make use
of its gazillion tools. But if You are not into Java, then Clojure might give you
some hickups.In comparison to Clojure, Python also allows for some functional
programming, gives the eager disciple an easy going start. Most of libraries are
written in Python (or exist in a fast, a C-esque implementation) and are very easy
to grasp. I can not say that for the Java enviroment Clojure has been born
into.I frown at java lingo error tracebacks in the REPL, and to bring a external
Java library into play is even more problematic. Any thoughts on this how to remedy
this problem without getting involved into Java?I wish there would be some kind
of Index of how to use certain Java libraries from Clojure, or an index of Clojure
wrapping packages. It might make life a bit easier.Finally, I claim that for
now, I am quite happy with my choice to migrate from Clojure to Chicken
Scheme/picolisp. You can get quite a bunch of Clojure data types from the good
package repository. It compiles without setting your hair on fire. And it is really
simple, as the language basics are small.I will keep an eye on Clojure. but I
must say that Julia is as appealing to me when it comes to the choice of future
language.',
time: 1385648225,
type: 'comment' }
{ by: 'wuschel',
id: 6811107,
parent: 6810543,
text:
'There are many arguments for and against Bitcoin. Only time will tell.But I
have three comments:1. Personally,I would probably be - out of self interest
- a strong supporter of Bitcoin if I had any, or would have belonged to the first
miners. But I have no BTC, and such I only observe as a bystander how this
technology develops.2. Energy and intrinsic value of BTCFor me, the argument
that cryptocurrencies can be made out of thin air and thus BTC is just some digital
data does not hold. Gold can be mined from many sources as well (e.g. in can be
found in the oceans as Au2+). Or another currency can be created and
printed/minted. \nHowever, with a currency such as BTC it takes a lot of
energy to fire up such a system until a certain level of penetration is reached,
and it takes energy to maintain it. Actually, this is one of the greatest drawbacks
I see: every BTC that is created now now will be more expensive in terms of energy
cost. I prefer a one time energy and material cost for the creation of a currency,
and minimal energy/material costs that come with its operations.3.
Penetration and access.I wonder if it might not have been better to distribute
all BTC among all of mankind. That way, everyone would be in possession of an
instant amount of currency and could readily engage in trading. The early mining
process support the creation and distribution of bitcoin but gives extreme gains to
early adopters. A better initial distribution might have helped to position BTC as
the dominating cryptocurrency. Right now any follow up can beat BTC if it excels
the parameters that define the adoption and usage rate of the currency as trading
medium.',
time: 1385586054,
type: 'comment' }
{ by: 'wuschel',
id: 6795923,
kids: [ 6796240 ],
parent: 6795826,
text:
'I find DuckDuckGo to be a nice alternative to Google, although I have to switch
to google.com for certain searches.As for email - if I can not connect with
IMAP, I am still using the plain old HTML web interface for GMail. The new one has
too much clutter. But I am also searching for an alternative with good uptime.As
such, Gmail is the only thing that keeps me connected with google. Any
alternatives?',
time: 1385404605,
type: 'comment' }
{ by: 'wuschel',
id: 6793276,
parent: 6792491,
text:
'Nothing new - it sounds like the german schuelerVZ (facebook for pupils).I
always wonder what happens to a user base of such a website once it gets older and
crosses the magic line - in this example, if maximum of the user distribution gets
older than 30.',
time: 1385373496,
type: 'comment' }
{ by: 'wuschel',
id: 6781127,
kids: [ 6781206 ],
parent: 6781054,
text:
'IF bitcoin will materialize as common internet currency, these guys/girls
will have some jolly good time. Until this happens this list is is nothing but a
high-score in a web based game, for there is no way to exchange your BTC into real
currency.Of course, anyone who has invested in BTC is highly interested to push
the hype button and spread the word of BTC as universal payment system. This is the
only way to bring more hard currency into the BTC cashflow.',
time: 1385133237,
type: 'comment' }
{ by: 'wuschel',
id: 6777234,
parent: 6777007,
text:
'Thank you for posting this.I am looking into Lisp based languages these
days, and as such I find it always good to get more basic information on language
semantics.There are a couple of things however that make a transition to Clojure
very hard, and I think it would do some good if more information about these
obstacles could be written down:1) A lot of work needs to be invested to get a
IDE going. I wasted a lot of time with emacs and Sublime Text 2/SublimeREPL
before settling for Light Table. Note: I find the first two choices to be excellent
editors, it is just that it is hard to get them going the way one wants to.2)
The JVM is said to be one of Clojures greatest assets. For me - I started
programming with Python - reading java lingo error tracebacks and browsing the
source code of JVM packages is very unpleasent experience.An introduction on how
to tackle the JVM library 'problem' in an efficient way a la Python would
be great.3) Compilation to JAR, running a service on GAE/Amazon without
loosing much time on JVM startup and other practical things might be a nice to have
in your guide.4) Since multithreading is one of the key characteristics that
sets Clojure apart from other lisp/scheme based languages e.g. the easy but
great Chicken Scheme, it would be great to have a good look on parallel computing
in the tutorial.Cheers!',
time: 1385065598,
type: 'comment' }
{ by: 'wuschel',
id: 6774941,
parent: 6774397,
text:
'You are right, I should have been more precise.What I meant to say is that
prostitution is one way to satisfy the unfulfilled sex drive a man has. I was not
talking about feelings, but about a - so to say - intrinsic biological potential to
find a mate and copulate. \nA man will consider the offer of a prostitute on a
simple sexual basis if he is attracted to her. It is a biological drive that each
individual seeks to have satisfied. If this drive is not satisfied, the stimulus
for attraction can be lower.Of course, there is also a strong emotional factor
involved, ethical components, fears (e.g. STDs, being caught etc). But I was not
referring to that.Please note that I was not trying to picture men as animals -
on the contrary, I was just trying to show that male sexual behaviour has strong
biological components. As does the sexual behaviour of women.I would like to
know what factors are the most important in the rejection of a prostitute's
offer, as I think that prostitution it is part of a deep sociological process. It
would not surprise me if the hygienic component would be the strongest one.',
time: 1385045943,
type: 'comment' }
{ by: 'wuschel',
id: 6774359,
kids: [ 6774397 ],
parent: 6774176,
text:
'Nice post, however, I would not agree to this statement:"Anecdotally I
do get the feeling that prostitutes as a profession are mainly serving an older
generation though, so I'm not sure if they remain economically viable
anyway."Prostitution is tied to the nature of the sexuality of men - which
is likely not going to change in the next time. There is a strong demand for
uncomplicated, quick, cheap sexual satisfaction within the male population, and
prostitutes cater to this demand. The image of the 60 year old unemployed client is
wrong.There was a nice article in the last FAS (Frankfurter Allgemeine
Sonntagszeitung 17.11.2013, a leading German newspaper) that reported on a biased
podium discussion of a well known stone age feminist. I found the article to be
nice because it discussed the needs of prostitutes e.g. respect of the customer,
hygienic business practices, safe environment, etc.',
time: 1385037481,
type: 'comment' }
{ by: 'wuschel',
id: 6769784,
parent: 6769261,
text:
'I am not into flying, but last time I was a passenger I remember that a
helicopter engine needs a certain cooldown time after landing which could be around
30 minutes. In this time the engine needs continue running. My guess is that the
electric motors in the Volocopters do not have this requirement.But again, I am
not a helicopter specialist.',
time: 1384971182,
type: 'comment' }
{ by: 'wuschel',
id: 6769753,
kids: [ 6769889 ],
parent: 6769659,
text:
'I agree: A bit more background information would be good. But I confess I am
interested.I fooled around a bit with a nucleotide sequence of Homo sapiens mRNA
for prepro cortistatin like peptide, complete cds.|len=368, as taken from <a
href="http://www.genomatix.de/online_help/help/sequence_formats.html"
rel="nofollow">http://www.genomatix.de/online_help/help/se
quence_formats.ht...</a>ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCC
ACCGCTGCCCTGCC\n\tCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAA
GCAGC\n\tCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG\n\t
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC\n\tCTGCAGGAA
CTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG\n\tTTTAATTACAGACCTGAA
After some (random) clicking on some nucleotide spots this sequence got me this,
assuming that the "standard" genetic code handles homo sapiens mRNA:ID
VIRT5672 Unreviewed; 66 AA.\n\tAC VIRT5672;\n\tDE
Translation of nucleotide sequence generated on ExPASy\n\tDE on 20-Nov-2013 by
87.150.48.254.\n\tCC -!- This virtual protein sequence will automatically be
deleted\n\tCC from the server after a few days.\n\tDR SWISS-2DPAGE;
VIRT5672; VIRTUAL.\n\tSQ SEQUENCE 66 AA; 6E48167C288239C3 CRC64.\n\t
GARHWPGRST QTTKRGKSGG CFSLFLPLPA YARCLGRWGH PPGAGQRWPW PRRAAAAGGR\n\t
GTMASC\n\t//Sequence in FASTA
format>VIRT5672\n\tGARHWPGRSTQTTKRGKSGGCFSLFLPLPAYARCLGRWGHPPGAGQRWPWPRRAAAAG
GR\n\tGTMASCWhat (concrete) applications does it have except being a theoretical
transcoder?',
time: 1384970956,
type: 'comment' }
{ by: 'wuschel',
id: 6769670,
parent: 6769558,
text:
'Well, as research goes, $ does not guarantee to reach a specific outcome (it
does help tremendously, though).But there is a lot work done nowadays when it
comes to batteries, fuel cell membranes and solar cells - so let us hope something
will come out of it.',
time: 1384970296,
type: 'comment' }
{ deleted: true,
id: 6769200,
parent: 6768540,
time: 1384966868,
type: 'comment' }
{ by: 'wuschel',
id: 6754852,
kids: [ 6754900 ],
parent: 6754825,
text:
'Sorry, what I meant was the TraceBack. It helped a great deal when learning
programming and hunt those nasty bugs:<pre><code> Traceback (most recent call
last):\n File "C:/Users/wuschel/Desktop/error-
track.py", line 3, in <module>\n newstrin = teststrin + 3\n
TypeError: cannot concatenate 'str' and 'int'
objects\n</code></pre>\nIn clojure, you get those error reports in java lingo - I
don't know how fast you can get use to that kind of error messages when you do
not know Java. Now, this one is obvious, but it just should serve as an
example:<pre><code> clojure.lang.Compiler$CompilerException: \n
java.lang.RuntimeException: clojure.lang.Compiler$CompilerException:
java.lang.RuntimeException: Unable to resolve symbol: b in this context, compiling:
(null:4:1)</code></pre>',
time: 1384790042,
type: 'comment' }
{ deleted: true,
id: 6754851,
parent: 6754806,
time: 1384790024,
type: 'comment' }
{ by: 'wuschel',
id: 6754806,
kids: [ 6754851, 6754825 ],
parent: 6754762,
text:
'(Confession: I am a novice to clojure/scheme/JVM myself.)I admit
that I have not tried kibit yet. However, LightTable/REPL is a great tool for
this endeavour. If only clojure could have an error tracking report that would be
comparable to the wonderful implementation that can be found with the python IDLE..
but I guess that is too much to ask?',
time: 1384789525,
type: 'comment' }
{ by: 'wuschel',
id: 6754778,
parent: 6754154,
text:
'I find LightTable to be a great tool when it comes to get a first impression of
clojure. Installing, configuring and getting the grasp of emacs, or configuring
Sublime Text with SublimeREPL can be a lot of hassle under Windows based OS.
LightTable helped me to save a lot of time here.',
time: 1384789224,
type: 'comment' }
{ by: 'wuschel',
id: 6738987,
parent: 6738732,
text:
'Yes, the potential and kinetic energy of the oceans is an amazing source of
energy.I hope a 'rigorous 3 year' testing program is sufficient to
justify a large scale deployment of these platforms in different habitats. They do
mention that 'a few' of the metrics monitored showed naturally highly
variable and lacked the statistical power to confindently rule out undetected
changes. Also, I have the impression that they just checked the deployment of one
platform?Did they also publish the data somewhere?',
time: 1384517592,
type: 'comment' }
{ by: 'wuschel',
id: 6725186,
parent: 6718654,
text:
'There is a difference between using a chemistry set to learn something about
the world through analytics and creation/change of matter, and to play around
with it.I agree with csmuk wholeheartedly that it is the supervision that
counts. A chemistry kit can be a great learning tool, but it is not something that
should be taken as a toy to play around.We all play, make mistakes, and learn
due to those mistakes. But with chemistry those mistakes could show in the form of
a hospital visit, chemical pollution, or long term poisoning. I had the fortune to
survive an explosion in a lab unscathed, and I will not forget the day I saw my
collegue burn 2 meters from me.Proper training in chemistry is important for
reasons of safety and for scientific understanding and reasoning. But let us face
it, most people do not like chemistry at all in school. But blowing stuff up and
making drugs a la Breaking Bad is cool. When I read the words RDX, CCl4, conc.
H2SO4, Methylamine - a bit of TiCl4 perhaps - etc in this thread I imagine the kid
with sparks in his eyes who wants to blow stuff up on new years eve.So, how can
one include proper attitude towards the materials inside this Chemistry Set without
proper supervision?',
time: 1384351580,
type: 'comment' }
{ by: 'wuschel',
id: 6721572,
kids: [ 6721779 ],
parent: 6720307,
text:
'Theory is one thing, hands-on experimental scientific evidence another, not
speaking about a possible route of synthesis and purification of polyaromatic
cyclic hydrocarbons.Does anyone know what problem/model was used for the
calculations? I find it strange that there are many details about the hardware, but
no information about the problem set in the field of organic solar cells.',
time: 1384293908,
type: 'comment' }
{ by: 'wuschel',
id: 6701923,
kids: [ 6705743 ],
parent: 6701208,
text:
'I am sorry - this is something I do not understand. Where is the problem in
deflation? You can always pay in fractions of a bitcoins, e.g. nanobitcoins,
picobitcoins, etc.There is not really an agreement in the ivory towers that a
limited amount of currency is a bad thing per se.Could someone explain this to
me?',
time: 1384012413,
type: 'comment' }
{ by: 'wuschel',
id: 6701875,
kids: [ 6702016 ],
parent: 6701785,
text:
'Interesting. Could you propose such an extension by posting a code sample e.g.
in scheme?',
time: 1384011528,
type: 'comment' }
{ by: 'wuschel',
id: 6698385,
parent: 6696655,
text:
'As always, university press super hype press releases without any useful
hyperlinks. This must be corrected:Lit:<pre><code>
http://dl.acm.org/citation.cfm?id=2493486\n
http://www.faqs.org/patents/app/20090233237\n</code></pre>
\nInteresting read, but then again I agree that this is a prototype only protocol
with little use because of the fragile nature of the circuits. \nAnd as for
prototyping, aren't there software suites around that bring sufficient
capability in this regard?',
time: 1383937512,
type: 'comment' }
{ by: 'wuschel',
id: 6695746,
parent: 6694490,
text:
'Agreed. I love those fluff words like "breakthrough". It sounds like
"Blitzkrieg" to me. It is amazing how much clueless re-reporters can
dilute the information density and usefulness of the initial abstract.',
time: 1383914509,
type: 'comment' }
{ by: 'wuschel',
id: 6685565,
parent: 6681238,
text:
'Happy to see more alternatives to Gmail. I am still using Gmail with the old
HTML interface, as the new one is cluttered with all kinds of stuff I do not
need. \nStay with KISS, when it comes to functionality and interface, with optional
integration of PGP. \nI wanted to quit using google services for long, but it is
only now that I get active in that regard (e.g. duckduckgo as search engine). As
such, I am searching an alternative for the1. web based storage of emails\n 2. a
good web interface.As for 1., I stil have not found anything really interesting
that comes for free.As for 2., I was once using Mutt and found it quite
efficient, and am now thinking to try out sup. However, there is still this feeling
that there could be a better client when it comes to usability and ease of
installation. Using Mutt on Windows can be really annoying.',
time: 1383772663,
type: 'comment' }
{ by: 'wuschel',
id: 6685070,
parent: 6682397,
text:
'> But I do wish there was more on embedded, enterprise, real time and game
development.I guess that is everyone's bias towards the home turf. I wish
there would be more biotechnology, chemical technology, etc.But I must admit
that I am greatly surprised how many of those folks can be found here. The
diversity, culture and competence of the HN community is really something.',
time: 1383768065,
type: 'comment' }
{ by: 'wuschel',
id: 6668080,
parent: 6667354,
text:
'+1 for your post. As an addendum: He had such respect in the german community
after World War I for his deeds in R&D and industrial chemistry (chemical
weapons, fertilizer, munitions) that he was able resist nazi influence in his
research institute - albeit only for some time.',
time: 1383566301,
type: 'comment' }
{ by: 'wuschel',
id: 6664763,
parent: 6664434,
text:
'Hi hershel,thanks for your links/lit.I was not trying to to stomp
down any intiative towards employing 3D printers in chemistry - on the contrary, I
find these are very interesting tools that I was watching with envy in my final
years of university life. I just wanted to point out some of the problems that can
not be solved easily by just making use of a 3D printer:<pre><code> 1. control
of reaction \n 2. purification\n 3. analytics\n</code></pre>\nare as important as
choosing the recipe of the reaction because side-reactions can be found most of the
time with synthesis e.g. due to imperfect reaction conditions, reactant aging,
nature of reaction (kinetic vs thermodynamic control), steric factors, solvent,
many factors that are difficult to control etc. Quite unfortunate, I know.Not
sure what the current resolution of the printers is - I was following this exciting
idea for some time, but until now I could not figure out a concept that would allow
to bootstrap a 3D printing system that provides some interest value proposition to
a specific customer segment. I guess we will see many more projects with 3D
printers in the respective journals.As for medicine, I would not gulp any stuff
that has been made by a 3D printing system - quality control is the one of the
things the pharmaceutical does right. It costs a lot of $ but is necessary in order
to be confident enough that the compounds you are making are really the compounds
you wanted to create.',
time: 1383509053,
type: 'comment' }
{ by: 'wuschel',
id: 6664713,
kids: [ 6665185 ],
parent: 6664444,
text:
'Hello XorNot,I remember having read some papers regarding the modification
of InkJet Systems for combinatorial chemistry. But papers are always one thing,
out-of-ivory-tower application another.Do you have any contact details? I could
not find them in your profile.',
time: 1383508518,
type: 'comment' }
{ by: 'wuschel',
id: 6664362,
kids: [ 6664434, 6664444 ],
parent: 6664076,
text:
'> BTW , the researchers behind research started this research by building a
DIY 3D printer[1] , which is pretty cool.Funky. If I still were in my phd
slavery time, I would try to have a go with a 3D printing project. Thank you for
pointing out the literature. Do you have more to show?> talks about getting
some short list of base materials \n> which you can synthesize many materials
from. \n> Is that theoretically possibleWhy not. But I would add the
assumption that you get a repertoire of click reactions [A], otherwise optimization
of reaction condications in regard to
thermodynamics/kinetics/byproducts/etc might kill your 3D printing
lab fun.The question is what the main benefit of the 3D infrastructure is when
it comes to chemical synthesis. On a first glimpse, producing your own chemicals in
your printer sounds like fun. But why not buy them in the first place? Once a
synthetic route is explored, chemical manufacturers take over the task to scale up
production or produce chemicals on demand.Unlike mentioned in your article [1],
solid phase synthesis is already in use in industry and blurs the line between
reaction container and reaction.Let me make some random guesses: There is
definalty huge potential in 3D printing once it leaves the current domain of base
materials. One could print solid state batteries, logic circuits (organic
electronics), matrix like containers for combinatorial chemistry. I think there is
a huge benefit materials research / prototyping when it comes to 3D
printing.However, the problem with chemistry is that many parameters play an
important role in reactions e.g. the effectivity of stirring, solvent choice - and
that solid analytics are a must-have. After all, every chemist has had a
'Monday Morning' reaction.<pre><code> [A]
http://en.wikipedia.org/wiki/Click_chemistry</code></pre>',
time: 1383503482,
type: 'comment' }
{ by: 'wuschel',
id: 6663986,
kids: [ 6664076 ],
parent: 6663401,
text:
'I like the idea - although I would like to point out that there is no such
thing as a 'general' reaction container in chemistry.There are
automated reaction/deposition systems that are used in combinatorial
chemistry. Many of them are in use in the pharmaceutical industry, or solid state
chemistry.I built a small multi-reactor for high temperature synthesis with
("only") 8 reaction tubes myself, and had a bit of hassle when it came to
the injection and stirring. As such, I think the 3D printing technology with its
fine control for delivery will definatly have some application in this field, as
pointed out in the comment in stackexchange.As with the the microsystem based
synthesis which uses micro-sized reaction volumes/object features to enhance
e.g. removal of thermal energy in an reaction, this technology has good potential
to find some niche application, e.g. screening of optimal reaction conditions.
However, note that these optimization procedures have to be done again when scaling
synthesis up to the synthesis of larger volumes.',
time: 1383498721,
type: 'comment' }
{ by: 'wuschel',
id: 6660556,
kids: [ 6660822 ],
parent: 6660088,
text:
'> The mining of rare elements isn't constrained by resources, only
cost.Ok, I am not an expert on the topic of REE mining, consumption and
recovery, but I would say that availibility and access of mining sites are a strong
factor e.g. at some point of rare earth element consumption the parties mining
these elements might be able to dictate prices. I am pretty sure that RE mined in
China might have a special tax for export.Might be interesting to look up some
cost information regarding the recycling and mining processes.',
time: 1383423066,
type: 'comment' }
{ by: 'wuschel',
id: 6659481,
kids: [ 6660088 ],
parent: 6659305,
text:
'Depends which elements you want to recover. The main problem is the economic
aspect of recovery - this is due to the fact that one has to collect the materials
from a multitude of electronic devices and bring them through a chemical
purification process.Rising rare element prices might change this in the
future.Addendum: quick google search gave <a href="http://www.molycorp.com/"
rel="nofollow">http://www.molycorp.com/</a> as a developer of
recycling technology.',
time: 1383406465,
type: 'comment' }
{ by: 'wuschel',
id: 6616889,
parent: 6616584,
text:
'Chemist here, just musing @ breakfast, so I am not backing any of that stuff
with literature research.I understand you would like to have a permanent cooling
effect. Unfortunatly, materials that undergo conformational/phase transition
processes do not require a permanent feed of thermal energy e.g.<pre><code> A +
dT --> A' conversion with heating\n A' -> A + dT fall back to
original state with cooldown\n\n with dT temperature difference (thermal energy)\n
and A and A' the respective states of the material.\n</code></pre>\nAs such
you would need a material that uses the thermal energy for some other effect e.g.
radiation of light, permanent conformational movement creation of electric
potential etc. The trouble I see here is that the effiency of energy conversion is
fairly low with the current polymers. And the price tag.Ok, here is a crazy
idea, but not sure if it is not impractical or even stupid (; . Maybe use of
superadsorbing polymers with a specific thermoresponsive behaviour somewhere around
the working temperature of the athlete would give you a higher cooling effect. Once
the athlete heats up, the polymer becomes more hydrophilic, allowing for more sweat
to enter the fabric. Hopefully, the wet fabric would have a better thermal energy
flow than the dry fabric. Basically, you make a supersoaking sweatshirt. But then
again, maybe you just use a hydrophilic fabric?',
time: 1382781909,
type: 'comment' }
{ by: 'wuschel',
id: 6601213,
parent: 6600738,
text: 'Thanks!',
time: 1382557771,
type: 'comment' }
{ by: 'wuschel',
id: 6568830,
parent: 6562748,
text:
'> .. patient is NOT the one who pays directly for the drug ..Ok, I can
accept this argument. Basically, there is an incentive to trick the system.
Unfortunatly, I am not a doctor, and as such I do not have the experience to judge
the effectiveness of various medical treatments and give an example how well or bad
the pharmaceutical industry is really treating us.What is the the real gain of
our health risk insurance systems? I know enough people who are dependent on daily
medication of strong systemic substances, and they can live a life without too much
suffering while not worrying that this flow of medicine might stop because their
bank account is empty. In some way, society has to step in when individuals - even
in large amount - fail to live within the system.Having said that, how would it
be possible to improve this status quo?',
time: 1382052089,
type: 'comment' }
{ by: 'wuschel',
id: 6568056,
parent: 6564945,
text:
'Excuse me, but have you been to the Valley? I have not. But I have been in
Berlin, and I can assure you that I have seen my fair share of hipster copycats.
Not that there are not rock solid tech companies operating in the region. It is
just my impression the startup scene in the german capital is a bit one sided:
mostly marketing, media and marketplace platforms. Is that the future of mankind?
I have found a few people that have a tech/scientific background and take
up the fight in the startup scene, but so far all but one them have moved to the
US.I would be greatly interested to connect and meet with people from
technology/science that would like undertake a venture in wet-/soft-
/hard-ware. But alas, there are few of them into the startup scene in Germany,
for most a heading to the industry sector after their
dissertation/master.So, if you are one of the above --> contact me.',
time: 1382043319,
type: 'comment' }
{ by: 'wuschel',
id: 6561154,
kids: [ 6562748 ],
parent: 6558897,
text:
'> [..] tropical islands [..] manipulating the studies results [..]I did
not want to argue with you that there is no dirty business in pharmaceuticals or
chemistry. All I am saying is that dirty tricks and evil strategies are found
throughout the industry, and not only in the medical sector. It is just in the
medical sector that one sees the most dramatic consequences.Go to car
development, pre-emptive war, OS software, taxi drivers, banks, and I am sure you
will find some good examples of low humans can fall.',
time: 1381946737,
type: 'comment' }
{ by: 'wuschel',
id: 6558864,
kids: [ 6558897 ],
parent: 6558251,
text:
'It is sad to see that people have such a bad attitude towards the
pharmaceutical and chemical industries. Many of my friends work in that sector, and
I assure you that their motivation and interest in the their work comes in part
from helping people.Give me one industial sector where greed - nature of man -
is not a problem.',
time: 1381918786,
type: 'comment' }
{ by: 'wuschel',
id: 6552391,
parent: 6550750,
text:
'I have only skimmed this article and thus will not comment on its contents, BUT
I wonder what is the software package that has been use to generate the article
layout?',
time: 1381831490,
type: 'comment' }
{ by: 'wuschel',
id: 6541914,
parent: 6541294,
text:
'It's really tricky^n to boot one up. Like bio computers, this is still
pretty much ivory tower technology.',
time: 1381653530,
type: 'comment' }
{ by: 'wuschel',
id: 6534756,
parent: 6480720,
text:
'Very interesting topic. I wish it would go on and not vanish in nothingness..',
time: 1381514474,
type: 'comment' }
{ by: 'wuschel',
id: 6532862,
parent: 6502476,
text:
'Well, lets look at that from the perspective of a possible co-founder: I can
not find any founder that would resonate with my technological background, skill
set and desired professionalism.When you live in a startup hub, matching people
for startups this might be an easier thing to accomplish, but in the in which I
live right now..',
time: 1381497520,
type: 'comment' }
{ by: 'wuschel',
id: 6523947,
parent: 6523607,
text:
'Nice work. Although I must say that "visually intuitive web commenting and
discussion" is not correct, at least not for me. I was a bit puzzled when
staring at your UI. The introduction video cleared things up.For sure you
learned a lot in UI design and implementation. That is worth a lot when building
your next thing."My problem? WHAT THE !?#*@ DO I DO NOW?!"No idea,
but I like the idea of introducing a simplistic visualisation of
popularity/impact factor/etc of a post or comment.',
time: 1381353553,
type: 'comment' }
{ by: 'wuschel',
id: 6518618,
parent: 6518069,
text:
'Hi,thanks for your comment. I was by no means speaking about an escape - I
would probably go to Myanmar or the Falkslands to achieve that - but to get better
exposure to technologically oriented entrepreneurs. Although I must say that
probably you are right about the impending culture shock, or whatever you might
mean by 'rude surprise'.',
time: 1381276023,
type: 'comment' }
{ by: 'wuschel',
descendants: 3,
id: 6517965,
kids: [ 6518069, 6520232 ],
score: 2,
text:
'Hi,I am searching for maximum exposure to people of technology/startup
background.The thing is: As a soon to be PhD in Chemistry with experience in
biotechnology I am a rather exotic bird in the business. I am a self taught python
programmer, and had plenty of different jobs as side projects. Chance got me
involved with the startup world and gave me some steep learning curve in the field
with two failed projects (gastronomy point of sales system, luxury goods marketing
and distribution company) in Berlin, Germany.Unfortunately, getting in touch
with the right people is the biggest problem: It is hard to assemble the right team
in Germany, as most graduates with technical skills make a run for the large
companies of the well paying industrial sector. Also, the city of Berlin, the so
called "Silicon Valley" of Germany, is not the super shiny place it
seems. There is a lot going on there in terms of startups, but it is mostly on-line
marketing/sales/media/advertisement, a territory discovered long
ago.I am not afraid to get my hands dirty and "wet" - on the contrary,
I love science, and love the stuff companies like mc10 inc do. However, I am well
aware of the advantages of IT based products over chem/bio/medical
products when it comes to development, risk and initial investment.I can think,
work hard, communicate, I love technology. So, where do I have to go to get the
maximum exposure and build a good startup raft? Is the Valley something for me?
Shall I buy a ticket and just fly there, like I did it with Berlin? Is there any
place in Europe that could be compared to it?I would be grateful for any
directions, contacts, hubs etc, that could speed up my
search.Regards,<pre><code> piotr\n\n pioja at gmx dot net</code></pre>',
time: 1381267713,
title: 'HowTo for exotic birds in the Valley?',
type: 'story',
url: '' }
----------------------
Karma: 1089
Comments (Non Deleted): 240
Stories Published (Non Deleted): 36
Stories scrore (total): 1516
----------------------

Wuschel

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Wuschel

Uploaded by

Copyright:

Available Formats

> skill-importer@1.0.

You might also like