International Journal of Infectious Diseases 74 (2018) 117–122

Contents lists available at ScienceDirect

International Journal of Infectious Diseases

journal homepage: www.elsevier.com/locate/ijid

Virulence-associated genes and molecular characteristics of

non-O1/non-O139 Vibrio cholerae isolated from hepatitis B
cirrhosis patients in China
Fei Jianga,1, RuRu Bib,1, LiHua Denga , HaiQuan Kanga , Bing Gua,b,* , Ping Maa,b,*
a
Department of Laboratory Medicine, The Affiliated Hospital of Xuzhou Medical University, No. 99 West Huaihai Road, Xuzhou, 221002, China
b
Medical Technology Institute, Xuzhou Medical University, 209 Tongshan Road, Xuzhou, 221004, China

A R T I C L E I N F O A B S T R A C T

Article history: Objectives: We aimed to report virulence-associated genes and molecular characteristics of non-O1/non-
Received 26 January 2018 O139 Vibrio cholerae isolated from hepatitis B cirrhosis patients in China.
Received in revised form 24 June 2018 Methods: Patient clinical data including course of disease, laboratory tests, antibiotic treatment and
Accepted 26 June 2018
outcomes were collected. Antimicrobial susceptibility testing was performed and virulence-associated
Corresponding Editor: Eskild Petersen, Aar-
hus, Denmark
genes were detected by PCR. Genetic relatedness among non-O1/non-O139 V. cholerae strains was
investigated by pulsed field gel electrophoresis (PFGE) and multilocus sequence typing (MLST).
Results: All three strains in this study harbored pathogenicity related genes like rtxA, rtxC, toxR, hapA, hlyA
Keywords:
Non-O1/non-O139 V. Cholerae
and ompW whereas they lacked ctxA, ctxB, tcpA, ompU and zot genes. None of them showed resistance to
Extraintestinal infection any antibiotic detected. A new allele of gyrB was submitted to the MLST database and designated as 97.
Virulence-associated genes Two novel sequence types (ST518 and ST519) and ST271 were identified by multilocus sequence typing
PFGE (MLST). PFGE indicated considerable diversity among three non-O1/non-O139 V. cholerae strains.
MLST Conclusions: Three sporadic cases highlight that non-O1/non-O139 V. cholerae can cause opportunistic
invasiveness infection in cirrhosis patients. Pathogenicity may be related to virulence-associated genes.
Timely detection and antibiotic therapy should be paid more attention to in clinic.
© 2018 The Authors. Published by Elsevier Ltd on behalf of International Society for Infectious Diseases.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).

Introduction
V. cholerae is the pathogen that causes cholera and is classified
into more than 200 serogroups based on the somatic O surface
antigen. Only the serogroups O1 and O139 V. cholerae can cause
epidemic or outbreaks, whereas the non-O1/non-O139 serogroups
have also been associated with cholera-like diarrhoea and
systematic infections including septicemia, urinary tract infection
(Chowdhury et al., 2016), peritonitis (Lan et al., 2014), skin and soft
tissue infection (Maraki et al., 2016), meningitis (Hao et al., 2015),
bacterial emphysema (Lai et al., 2012). Though V. cholerae non-O1/
non-O139 serogroups generally lack several major virulence
factors such as cholera toxin (ctx) and toxin-coregulated pilus
(tcp), a number of synergistic factors which play roles in the
infection process have been identified (Singh et al., 2001). These
* Corresponding authors at: Department of Laboratory Medicine, The Affiliated
Hospital of Xuzhou Medical University, 99 West Huaihai Road, Xuzhou, 221002
China.
E-mail addresses: gb20031129@163.com (B. Gu), 672443193@qq.com (P. Ma).
1
The first two authors contributed equally to this work.
factors include the toxin regulatory gene (toxR), toxin coregulated
pilus (tcp), repeats-in-toxin (rtx), hemolysins (hly), outer mem-
brane proteins (ompU) and so on (Ceccarelli et al., 2015;
Schirmeister et al., 2014; Rajpara et al., 2013; Mathur and Waldor,
2004). Clinical infection cases caused by non-O1/non-O139 V.
cholerae have been reported in Vietnam (Lan et al., 2014), Germany
(Schirmeister et al., 2014), India (Rajpara et al., 2013), China (Luo
et al., 2013), USA (Purdy et al., 2010), Italy (Ottaviani et al., 2009),
and Mexico (Lizárragapartida and Quilici, 2009).
In this study, we describe clinical data of three patients and
genotypic characteristics of three strains. Several discriminative
techniques at the species level such as matrix-assisted laser
desorption/ionization time-of-flight mass spectrometry (MALDI-
TOF MS) analysis and ompW gene amplification were evaluated.
Several virulence genes and synergistic factors were investigated
to characterize the pathogenic potential. The heterogeneity of
strains was analyzed by Pulsed-field gel electrophoresis (PFGE) and
Multilocus Sequence Typing (MLST).

https://doi.org/10.1016/j.ijid.2018.06.021
1201-9712/© 2018 The Authors. Published by Elsevier Ltd on behalf of International Society for Infectious Diseases. This is an open access article under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
118 F. Jiang et al. / International Journal of Infectious Diseases 74 (2018) 117–122

Materials and methods
Bacterial identification
Three non-O1/non-O139 V. cholerae strains were collected from
the ascites and blood of three hospitalized patients in the
Department of Infectious Diseases at a teaching hospital in
Xuzhou, China. Ascites and blood samples were processed using
the BacT/Alert automated system (bioMerieux, France) and
subcultured on Colombia plate containing 5% sheep blood
(KeMaJia, China). Three strains were identified to the species level
by VITEK-2 system (bioMerieux, France) and eventually confirmed
by MALDI-TOF MS (Bruker Daltonik GmbH, Germany) according to
a custom database.
Antimicrobial susceptibility testing
Antimicrobial susceptibility testing was performed by using the
disk diffusion tests (Oxoid) on Mueller Hinton agar (KeMaJia,
China) according to Clinical and Laboratory Standards Institute
guidelines (Wayne, 2015), with the following antibiotics being
included: ampicillin (10 mg), piperacillin (100 mg), amikacin
(30 mg), piperacillin-tazobactam (100 mg/10 mg), trimethoprim-
sulfamethoxazole (1.25 mg/23.75 mg), levofloxacin (5 mg), cipro-
floxacin (5 mg), gentamicin (10 mg), ampicillin-sulbactam (10 mg/
10 mg), ceftazidime (30 mg), cefepime (30 mg), chloramphenicol
(30 mg), imipenem (10 mg). E.coli ATCC25922 was used as the
quality control in parallel.
Molecular detection of virulence genes
The polymerase chain reaction (PCR) assays were carried out to
check the presence of the virulence genes using appropriate
primers. PCR assays were performed using Green Taq Mix (Vazyme
Biotech Co.,Ltd, Nanjing, China). The 50 ml reaction mixture
contained the following: 25 ml Green Taq Mix, 3 ml template
DNA, 2 ml of each primer and 18 ml ddH2O. Each PCR involved an
initial denaturation at 94
C for 5 min, followed by 30 amplification
cycles each consisting of a denaturation at 94
C for 1 min followed
by annealing for 1 min 30 s and an extension at 72
C for 1 min 30s.
Final extension was carried out at 72
C for 10 min. The primer
sequences and temperature of PCR annealing are listed in Table 1.
The primer synthesis and positive product sequencing were
completed by the GenScript Company (Nanjing, China).
Pulsed-field gel electrophoresis (PFGE)
PFGE was carried out as described previously (Parsons et al.,
2007). Total genomic DNA of three strains were digested with NotI.
For gel electrophoresis, 1% Bio-Rad pulsed field certified agarose
gel was made in 0.5X TBE and run in CHEF MAPPER using
multialgorithm mode (block1: initial to final time: 2s–10 s for 13 h,
block2: initial to final time: 20s–25 s for 4.5 h). The gel was stained
with 0.05 mg/ml ethidium bromide for 30 min and destained with
sterile water for 1 h. The banding pattern analysis was performed
by BioNumerics software (version 6.6). The similarity of banding
pattern was calculated using the Dice coefficient. Cluster analysis
was performed using the unweighted pairgroup method with
arithmetic averages (UPGMA). Strains were considered as the same
PFGE type if they possessed 85% similarity.
Multiple locus sequence typing (MLST)
MLST was performed to determine these genotypic character-
izations. Seven housekeeping genes were targeted for MLST
analysis: adk, gyrB, metE, mdh, pntA, purM, and pyrC. PCR assays
were conducted as previously described. PCR amplifications were
carried out under the following conditions: 30 cycles (denatur-
ation at 94
C for 40 sec, annealing at 54
C for 40 sec and extension
at 72
C for 40 sec) proceeded by a 5 min initial denaturation at
94
C and followed by 7 min extension at 72
C. Purified PCR
fragments were sequenced by the GenScript Company (Nanjing,

Table 1
PCR primer sequences, amplicon size and annealing conditions used in this study.

Primer Sequence (50 -30 ) Amplicon size (bp) Annealing conditions References
ctxA-F CTCAGACGGGATTTGTTAGGCACG 302 55
C Nandi et al., 2000
ctxA-R TCTATCTCTGTAGCCCCTATTACG
ctxB-F GGTTGCTTCTCATCATCGAACCAC 460 55
C Olsvik et al., 1993
ctxB-R GATACACATAATAGAATTAAGGATG
tcpA (classical)-F CACGATAAGAAAACCGGTCAAGAG 466 60
C Rajpara et al., 2013
tcpA (El Tor) R1 GATCAGCGACAGCAGCGAAA 466
tcpA (classical) R GATCTGCAAGTGCTACTGCGC
tox R-F TTACTACTCACACACTTTGATGGCATCGTT 901 55
C Tarr et al., 2007
tox R-R TTAATGTTCGGATTAGGACACAACTCAAAAG
hlyA-F CAATCGTTGCGCAATCGCG 265 50
C Rajpara et al., 2013
hlyA-R1 TTGACCTTCAGCATCACT
ompW-F CACCAAGAAGGTGACTTTATTGTG 586 55
C Nandi et al., 2000
ompW-R GAACTTATAACCACCCGCG
ompU-R CCAAAGCGGTGACAAAGC 655 60
C Kumar et al., 2009
ompU-F TTCCATGCGGTAAGAAGC


hap-F GTGAACAACACGCTGGAGAA 700 50 C Syngkon et al., 2010
hap R CGTTGATATCCACCAAAGG
rtxA VC1451-F GATTCTTCCGTTCAAGCTCCG 2571 55
C Schirmeister et al., 2014
rtxA VC1451-R TGGTTCAGGCTGTTGCACAC
rtxC-F CGACGAAGATCATTGACGAC 265 55
C Chow et al., 2001
rtxC-R CATCGTCGTTATGTGGTTGC


zot-F CACTGTTGGTGATGAGCGTTATCG 243 55 C Chatterjee et al., 2009
zot-R TTTCACTTCTACCCACAGCGCTTG
ace-F GCTTATGATGGACACCCTTTA 284 55
C Chatterjee et al., 2009
ace-R GTTTAACGCTCGCAGGGCAAA
rfbO139 cluster-F AGCCTCTTTATTACGGGTGG 449 54
C Schirmeister et al., 2014
rfbO139 cluster-R GTCAAACCCGATCGTAAAGG
rfb O1 cluster-F GTTTCACTGAACAGATGGG 192 54
C
rfb O1 cluster-R GGTCATCTGTAAGTACAAC
 F. Jiang et al. / International Journal of Infectious Diseases 74 (2018) 117–122
China) and analyzed by comparison with sequences obtained from
the MLST database (https://pubmlst.org/vcholerae/).
Results
Clinical data
Case 1. A 52-year-old male with abdominal distension for 2
months was admitted to our hospital in October 2015. He had a
history of positive Hepatitis B surface Antigen (HBsAg) for 19 years
and was not treated. In 2013, he was diagnosed with Hepatitis B
cirrhosis with primary hepatocellular carcinoma and interven-
tional therapy was performed. From August 2015, the patient felt
abdominal distension, accompanied by black stool and urine
volume decreased. The patient's symptoms were not relieved by
oral diuretic. After admission, an abdominal ultrasound revealed
large ascites, amount of ascetic fluid, and splenomegaly. On the
third day of admission, the patient presented chills and fever
(39
C) accompanied by diarrhea (4 times a day). A system infection
was considered and blood, ascites and faeces were respectively
collected for culture before the empirical application of Cefodi-
zime. After an incubation period of 12 h, only the ascites cultures
yielded curved Gram-negative rods. V. cholerae (strain screening
number:257) was suspected and identified by the VITEK-2 system.
It was a lack of agglutination with either O1 or O139 antisera,
suggesting the strain was non-O1/O139, which was also confirmed
by the absence of rfbO1 and rfbO139 genes. Cefodizime 2.0 g q12
was prescribed for 9 days and the patient was asymptomatic on
follow up.
Case 2. A 47-year-old male with a 2-month history of abdominal
distension and 1-month history of conscious disturbance was
admitted to our hospital in July 2016. The patient had a 4-year
history of Hepatitis B cirrhosis and was under treatment. In May
2016, he was sent to a local hospital because of abdominal
distension, and abdominal ultrasound indicated cirrhosis com-
bined with splenomegaly. After a few days of treatment, his
symptoms improved and he was discharged. In June 2016, he
experienced sudden conscious disturbance and was transferred to
our hospital for further treatment. In the fifth day of hospitaliza-
tion, the patient’s temperature peaked to 40
C with associated
chills and diarrhea (8 times a day). Blood were collected before
Ceftazidime was administered intravenously. Fecal samples were
not available. After 24 h of incubation, blood cultures showed
uniform β-hemolytic colonies on blood agar plates. Bacterial
colonies were identified as V. cholerae (strain screening num-
ber:235) using the VITEK-2 system. Similar to case 1, the V. cholerae
identified in case 2 was also of non-O1/O139 serogroup. The
patient was prescribed 2.0 g q12 of Ceftazidime for 15 days and he
has no symptoms of fever or diarrhea.
Case 3. A 47-year-old male with a 20-year history of Hepatitis B
was admitted to hospital due to abdominal distension for 10 days
on September 27, 2016. In 2015, the patient was diagnosed with
Hepatitis B cirrhosis with hepatocellular carcinoma and interven-
tional treatment was performed. The patient had been receiving
oral entecavir treatment until now. On September 17, he felt
Figure 1. PFGE profiles, site of infection, sequence type and hourskeeping genes of non-O1/non-O139 V. cholerae strains in this study.
119
abdominal distension accompanied by edema of both lower limbs.
On the second day of admission, the patient was febrile, with a
temperature of 39.9
C and chills. Septicemia was suspected after
evaluating the patient’s initial physical condition. Blood was
collected for culture and empirical moxifloxacin was prescribed.
The next day, the patient had no fever and urged to leave hospital
because of private affairs. The contents of the incubated bottle
showed bacterial growth after 3 days. The organism was identified
as V. cholerae (strain screening number:222) by the VITEK-2
system. Results of slide agglutination tests performed with
polyvalent O1 and O139 antisera were negative.
Bacterial identification and antimicrobial susceptibility testing
MALDI-TOF MS confirmed that all the three strains belonged to
V. cholerae, which was in accordance with biochemical reaction.
MALDI-TOF MS respectively gave identification log scores of 2.303,
2.212 and 2.235 (above 2.0 is considered reliable for species
identification). All three V. cholerae strains were susceptible to all
antibiotics tested.
Detection of virulent genes
All three V. cholerae strains carried rtxC, ompW, toxR, hapA and
hlyA genes, while only two strains isolated from blood carried the
rtxA gene. Genes of ctxA, ctxB, tcpA, zot and ace were not detected in
all three V. cholerae strains.
Genetic relatedness between non-O1/non-O139 V. cholerae strains
PFGE differentiated the three V. cholerae strains into three
distinct PFGE types (Figure 1). Similarly, MLST also differentiated
the three strains into three sequence types. A novel sequence type
(ST518) with a new allele of gyrB (97) and the other novel sequence
type (ST519) were respectively assigned for non-O1/non-O139 V.
cholerae257 and non-O1/non-O139 V. cholerae222. Both of them
were submitted to the MLST database. The strain of non-O1/non-
O139 V. cholerae235 was assigned ST271 (https://pubmlst.org/
vcholerae/). Two sequence types (ST518 and ST271) did not form a
clonal complex and were in fact singletons while one (ST519)
formed a clonal complex with two other sequence types (ST562
and ST268). The relationship between three strains and other STs in
the database is shown in Figure 2.
Discussion
Infections with V. cholerae non-O1/non-O139 serogroups
typically arise from water sources, such as ingestion of contami-
nated seafood and exposure to coastal waters. The most common
symptoms of infection caused by this pathogen are mild to
moderate gastroenteritis, bacteremia, ear and wound infections
(Petsaris et al., 2010). In this study, we report three cases of
extraintestinal infection caused by nontoxigenic non-O1/non-
O139 V. cholerae in hepatitis B cirrhosis patients. Virulence-
associated genes were detected to analyze the potential
120 F. Jiang et al. / International Journal of Infectious Diseases 74 (2018) 117–122
Figure 2. Population snapshot by eBURST analysis for non-O1/non-O139 V. cholerae strains in this study against the entire non-O1/non-O139 V. cholerae MLST database. The
STs identified in this study are labled with red circles. The relative size of yellow points indicates the prevalence of STs and lines between STs connect SLVs.
pathogenicity and molecular characteristics were investigated by
PFGE and MLST.
Three middle-aged male patients were diagnosed with hepati-
tis B cirrhosis associated with multiple complications. All three
patients had symptoms of fever and two had diarrhea when they
were admitted to the hospital. Bacterial culture identified non-O1/
non-O139 V. cholerae as pathogenic bacteria in clinical laboratory.
Studies have shown that infections caused by non-O1/non-O139 V.
cholerae are more common in patients with immunodeficiency,
especially in patients with cirrhosis, diabetes mellitus, hemato-
poietic disease and cancer (Khan et al., 2013; Hou et al., 2011; Choi
et al., 2003; Suk et al., 2006). The exact pathogenesis mechanism of
extraintestinal infections is not clearly understood. Possible
reasons could be pre-existing disruption of mucosal barrier,
achlorhydria, simultaneous infection with an invasive pathogen,
translocation of viable V. cholerae via M cells and hemolysin
production (Jabeen et al., 2010). The predisposing factor was often
raw or uncooked seafood consumption, exposure of wounds to
seawater as well as drinking impure water (Marinello et al., 2017;
Lukinmaa et al., 2006; Tamura et al., 2013). The patients in our
study were clearly diagnosed with hepatitis B cirrhosis, which is
consistent with the susceptibility factors of V. cholerae infection.
But it is difficult to determine the source of the pathogen because
of the exact history of raw/uncooked seafood consumption or
exposure to contaminated water in our patients remains unknown.
As a potential pathogen, invasive infections caused by non-O1/
non-O139 V. cholerae are rare but fatal. A literature review reported
that one-third of patients with non-O1/non-O139 V. cholerae
bacteremia died (Deshayes et al., 2015). Thus, timely detection of
non-O1/non-O139 V. cholerae and antibiotics therapy and main-
taining an electrolyte balance in diarrhea patients are important in
effective clinical management. MALDI-TOF MS, as a high-through-
put identification method (Cherkaoui et al., 2010; van Veen et al.,
2010), successfully identified three V. cholerae strains to the species
level with high confidence. All three strains were found to be
susceptible to all antibiotics tested and the first two patients
recovered after Cefodizime treatment. Multidrug-resistant V.
cholerae stains have been increasingly reported worldwide
(Kitaoka et al., 2011). In China, the El Tor biotype of the O1
serogroup caused three multiyear cholera epidemics (1961-1964,
1977-1989 and 1993-2001) (Wang et al., 2012). After the third
epidemic, downward trends of four antibiotics (nalidixic acid,
tetracycline, nitrofurantoin and TMP-SMX) were apparent in the
sensitivities of strains to these antibiotics. In contrast to V. cholerae
O1 serogroup, V. cholerae O139 serogroup strains isolated from
patient samples showed high rates of resistance to erythromycin,
streptomycin, polymyxin B, ampicillin, tetracycline, chloramphen-
icol, nalidixic acid, nitrofurantoin and even to ciprofloxacin (Yu
et al., 2012; Garg et al., 2000; Pan et al., 2008). The mechanisms of
antimicrobial resistance are associated with intrinsic resistance,
acquired genetic determinants of resistance and mutations.
Several genetic elements, including R plasmids, the class I integron
and the SXT element, have been reported to be closely associated
with the spread of genetic elements by mediating antibiotic
resistance in V. cholerae (Pan et al., 2008; Dalsgaard et al., 2000;
Hochhut et al., 2000). In contrast, most non-O1/non-O139 V.
cholerae strains were sensitive to the third-generation cephalo-
sporins, fluoroquinolones, piperacillin/tazobactam, tetracyclines,
chloramphenicol according to the previous studies (Chowdhury
et al., 2016; Hao et al., 2015; Lu et al., 2014). A few strains were
resistant to third-generation cephalosporins because of carrying
gene encoding extended-spectrum-lactamase (ESBL) (Ismail et al.,
2013; Petroni et al., 2002). NDM-1 metalloenzyme mediated
carbapenemase resistance in Vibrio spp. has been reported in
clinical and environmental isolates in India and Vietnam (Darley
et al., 2012; Walsh et al., 2011; The et al., 2015). VIM-1 and VIM-4
 F. Jiang et al. / International Journal of Infectious Diseases 74 (2018) 117–122
genes can be spread by the broad-host-range IncA/C transmissible
plasmid to cause increasing resistance to β-lactamase, cepha-
losporins and carbapenemase (Aberkane et al., 2015). So the
treatment plan should be executed according to the antimicrobial
susceptibility testing results.
Though strains in our study were found to be non-toxigenic
because of lacking major enteric toxin encoding genes like ctxA
(encoding cholera toxin A subunit), ctxB (encoding cholera toxin B
subunit), tcpA (encoding toxin-coregulated pilus for classical/El
Tor), ompU (encoding a porin in the outer membrane), zot
(encoding zonula occludens toxin) and ace (encoding accessory
cholera enterotoxin), they harbored pathogenicity related genes
like rtxA (encoding repeat toxin A subunit), rtxC (encoding repeat
toxin C subunit), toxR (toxin regulatory gene), hapA (encoding
hemagglutinin protease), hlyA (encoding El Tor-like hemolysin)
and ompW (encoding the outer membrane protein specific for V.
cholerae), which improve V. cholerae pathogenicity and play a
synergistic role in infection progress. OmpW gene is highly
conserved in V. cholerae and can be used for the identification of
this microorganism (Nandi et al., 2000).
Further analysis of heterogeneity in three strains used by PFGE
and MLST revealed different patterns among three strains. To our
surprise, the MLST results demonstrated that two novel sequence
types (ST518 and ST519) in our study were distinguished from the
reported sporadic clone (Hao et al., 2015; Luo et al., 2013; Lu et al.,
2014; Zhang et al., 2016) and the dominant clone of non-O1/non-
O139 V. cholerae in China (ST80) (Luo et al., 2013). ST 519 has 2
single locus variants (SLVs) which were different from ST562 and
ST268 in adk housekeeping gene. ST518 and ST271 have no SLV. The
other sequence type (ST271) was first discovered in Zhejiang
province, China and the strain caused septicemia in an immuno-
compromised patient (Zhang et al., 2016). This ST271 non-O1/O139
strain was sensitive to β-lactam, carbapenems, aminoglycosides,
and antibiotics and carried several virulence-associated genes
including hlyA, toxR, hap, rtxA and nanH. In this study, three strains
were considered to be sporadic cases because they are not similar
to other sequence types in the database (Figure 2). Perhaps in one
country, sequence type of non-O1/non-O139 V. cholerae has
obvious regional features, which requires further investigation.
Conclusions
In this study, extraintestinal infections of nontoxigenic non-O1/
non-O139 V. cholerae are highlighted in hepatitis B cirrhosis
patients. The pathogenicity and invasiveness of non-O1/non-O139
V. cholerae may be related to some virulence-associated genes.
Although infections caused by non-O1/non-O139 V. cholerae were
sporadic, we still remind clinicians to be aware of the possibility of
this pathogen infection, especially in cirrhosis patients because of
the prevalence of hepatitis B in China.
Acknowledgments
We thank Dr. Yingying Hao (Shandong Provincial Hospital) for
her constant support and advice.
Conflict of interest
We declare that we have no conflict of interest.
Ethical approval
Approval was not required.
121
References
Aberkane S, Compain F, Barraud O, Ouédraogo AS, Bouzinbi N, Vittecoq M, et al. Non-
O1/Non-O139 Vibrio cholerae avian isolate from France cocarrying the bla (VIM-
1) and bla (VIM-4) genes. Antimicrob Agents Chemother 2015;59(10):6594, doi:
http://dx.doi.org/10.1128/AAC.00400-15.
Ceccarelli D, Chen A, Hasan NA, Rashed SM, Huq A, Colwell RR. Vibrio cholerae non-
O1/non-O139 carrying multiple virulence factors and V. cholerae O1 in the
Chesapeake Bay, Maryland. Appl Environ Microbiol 2015;81(6):1909–18, doi:
http://dx.doi.org/10.1128/AEM.03540-14.
Chatterjee S, Ghosh K, Raychoudhuri A, Chowdhury G, Bhattacharya MK,
Mukhopadhyay AK, et al. Incidence, virulence factors, and clonality among
clinical strains of non-O1, non-O139 Vibrio cholerae isolates from hospitalized
diarrheal patients in Kolkata, India. J Clin Microbiol 2009;47(4):1087, doi:http://
dx.doi.org/10.1128/JCM.02026-08.
Cherkaoui A, Hibbs J, Emonet S, Tangomo M, Girard M, Francois P, et al. Comparison
of two matrix-assisted laser desorption ionization-time of flight mass
spectrometry methods with conventional phenotypic identification for routine
identification of bacteria to the species level. J Clin Microbiol 2010;48(4):1169,
doi:http://dx.doi.org/10.1128/JCM.01881-09.
Choi SM, Lee DG, Kim MS, Park YH, Kim YJ, Lee S, et al. Bacteremic cellulitis caused
by non-O1, non-O139 Vibrio cholerae in a patient following hematopoietic stem
cell transplantation. Bone Marrow Transplant 2003;31(12):1181–2, doi:http://
dx.doi.org/10.1038/sj.bmt.1704044.
Chow KH, Ng TK, Yuen KY, Yam WC. Detection of RTX toxin gene in Vibrio cholerae by
PCR. J Clin Microbiol 2001;39(7):2594, doi:http://dx.doi.org/10.1128/
JCM.39.7.2594-2597.2001.
Chowdhury G, Joshi S, Bhattacharya S, Sekar U, Birajdar B, Bhattacharyya A, et al.
Extraintestinal infections caused by non-toxigenic Vibrio cholerae non-o1/non-
o139. Front Microbiol 2016;7(11):144, doi:http://dx.doi.org/10.3389/
fmicb.2016.00144.
Dalsgaard A, Forslund A, Petersen A, Brown DJ, Dias F, Monteiro S, et al. Class 1
integron-borne, multiple-antibiotic resistance encoded by a 150-kilobase
conjugative plasmid in epidemic Vibrio cholerae O1 strains isolated in
Guinea-Bissau. J Clin Microbiol 2000;38(10):3774–9.
Darley E, Weeks J, Jones L, Daniels V, Wootton M, Macgowan A, et al. NDM-1
polymicrobial infections including Vibrio cholerae. Lancet 2012;380
(9850):1358, doi:http://dx.doi.org/10.1016/S0140-6736(12)60911-8.
Deshayes S, Daurel C, Cattoir V, Parienti JJ, Quilici ML, Blanchardière ADL. Non-O1,
non-O139 Vibrio cholerae, bacteraemia: case report and literature review.
Springerplus 2015;4(1):575, doi:http://dx.doi.org/10.1186/s40064-015-1346-3.
Garg P, Chakraborty S, Basu I, Datta S, Rajendran K, Bhattacharya T, et al. Expanding
multiple antibiotic resistance among clinical strains of Vibrio cholerae isolated
from 1992-7 in Calcutta, India. Epidemiol Infect 2000;124(3):393–9.
Hao YY, Wang YL, Bi ZW, Sun BX, Jin Y, Bai YY, et al. A case of non-O1/non-O139 Vibrio
cholerae septicemia and meningitis in a neonate. Int J Infect Dis 2015;35:117–9,
doi:http://dx.doi.org/10.1016/j.ijid.2015.05.004.
Hochhut B, Marrero J, Waldor MK. Mobilization of plasmids and chromosomal DNA
mediated by the SXT element, a constin found in Vibrio cholerae O139. J Bacteriol
2000;182:2043–7.
Hou CC, Lai CC, Liu WL, Chao CM, Chiu YH, Hsueh PR. Clinical manifestation and
prognostic factors of non-cholerae Vibrio, infections. Eur J Clin Microbiol Infect
Dis 2011;30(6):819–24, doi:http://dx.doi.org/10.1007/s10096-011-1162-9.
Ismail H, Smith AM, Tau NP, Sooka A, Keddy KH. Cholera outbreak in South Africa,
2008-2009: laboratory analysis of Vibrio cholerae O1 strains. J Infect Dis
2013;208 Suppl 1(Suppl. 1):S39, doi:http://dx.doi.org/10.1093/infdis/jit200.
Jabeen K, Siddiqui J, Zafar A, Shakoor S, Ali N, Zaidi AK. Vibrio cholerae O1 bacteremia
in Pakistan: analysis of eight cases. Trans R Soc Trop Med Hyg 2010;104(8):563–
5, doi:http://dx.doi.org/10.1016/j.trstmh.2010.04.004.
Khan S, Kumar A, Meparambu D, Thomas S, Harichandran D, Karim S, et al. Fatal
non-O1, non-O139 Vibrio cholerae septicaemia in a patient with chronic liver
disease. J Med Microbiol 2013;62(6):917–21, doi:http://dx.doi.org/10.1099/
jmm.0.049296-0.
Kitaoka M, Miyata ST, Unterweger D, Pukatzki S. Antibiotic resistance mechanisms
of Vibrio cholerae. J Med Microbiol 2011;60(4):397–407, doi:http://dx.doi.org/
10.1099/jmm.0.023051-0.
Kumar P, Jain M, Goel AK, Bhadauria S, Sharma SK, Kamboj DV, et al. A large cholera
outbreak due to a new cholera toxin variant of the Vibrio cholerae O1 El Tor
biotype in Orissa, Eastern India. J Medi Microbiol 2009;58(2):234–8, doi:http://
dx.doi.org/10.1099/jmm.0.002089-0.
Lai CC, Liu WL, Chiu YH, Gau SJ, Hsueh PR. Spontaneous bacterial empyema due to
non-O1, non-O139 Vibrio cholerae in a cirrhotic patient with hepatocellular
carcinoma. Diagn Microbiol Infect Dis 2012;73(1):84, doi:http://dx.doi.org/
10.1016/j.diagmicrobio.2012.01.011.
Lan NPH, Nga TVT, Yen NTT, Le TD, Tuyen HT, Campbell JI, et al. Two cases of
bacteriemia caused by nontoxigenic, non-O1, non-O139 Vibrio cholerae isolates
in Ho Chi Minh City, Vietnam. J Clin Microbiol 2014;52(10):3819–21, doi:http://
dx.doi.org/10.1128/JCM.01915-14.
Lizárragapartida ML, Quilici ML. Molecular analyses of Vibrio cholerae O1 clinical
strains, including new nontoxigenic variants isolated in Mexico during the
cholera epidemic years between 1991 and 2000. J Clin Microbiol 2009;47
(47):1364–71, doi:http://dx.doi.org/10.1128/JCM.00720-08.
Lu B, Zhou H, Li D, Li F, Zhu F, Cui Y, et al. The first case of bacteraemia due to non-O1/
non-O139 Vibrio cholerae in a type 2 diabetes mellitus patient in mainland
122 F. Jiang et al. / International Journal of Infectious Diseases 74 (2018) 117–122
China. Int J Infect Dis 2014;25:116–8, doi:http://dx.doi.org/10.1016/j.
ijid.2014.04.015.
Lukinmaa S, Mattila K, Lehtinen V, Hakkinen M, Koskela M, Siitonen A. Territorial
waters of the Baltic Sea as a source of infections caused by Vibrio cholerae non-
O1, non-O139: report of 3 hospitalized cases. Diagn Microbiol Infect Dis
2006;54(1):1–6, doi:http://dx.doi.org/10.1016/j.diagmicrobio.2005.06.020.
Luo Y, Ye J, Jin D, Ding G, Zhang Z, Mei L, et al. Molecular analysis of non-O1/non-
O139 Vibrio cholerae isolated from hospitalised patients in China. BMC Microbiol
2013;13(1):52, doi:http://dx.doi.org/10.1186/1471-2180-13-52.
Maraki S, Christidou A, Anastasaki M, Scoulica E. Non-O1, non-O139 Vibrio cholerae
bacteremic skin and soft tissue infections. Infect Dis 2016;48(3):171–6, doi:
http://dx.doi.org/10.3109/23744235.2015.1104720.
Marinello S, Marini G, Parisi G, Gottardello L, Rossi L, Besutti V, et al. Vibrio cholerae
non-O1, non-O139 bacteraemia associated with pneumonia, Italy 2016.
Infection 2017;45(2):237–40, doi:http://dx.doi.org/10.1007/s15010-016-0961-
4.
Mathur J, Waldor MK. The Vibrio cholerae ToxR-regulated porin OmpU confers
resistance to antimicrobial peptides. Infect Immun 2004;72(6):3577, doi:http://
dx.doi.org/10.1128/IAI.72.6.3577-3583.2004.
Nandi B, Nandy RK, Mukhopadhyay S, Nair GB, Shimada T, Ghose AC. Rapid method
for species-specific identification of V. cholerae using primers targeted to the
gene of outer membrane protein OmpW. J Clin Microbiol 2000;38(11):4145.
Olsvik O, Wahlberg J, Petterson B, Uhlén M, Popovic T, Wachsmuth IK, et al. Use of
automated sequencing of polymerase chain reaction-generated amplicons to
identify three types of cholera toxin subunit B in Vibrio cholerae O1 strains. J Clin
Microbiol 1993;31(1):22.
Ottaviani D, Leoni F, Rocchegiani E, Santarelli S, Masini L, Trani VD, et al. Prevalence
and virulence properties of non-O1 non-O139 Vibrio cholerae strains from
seafood and clinical samples collected in Italy. Int J Food Microbiol 2009;132
(1):47–53, doi:http://dx.doi.org/10.1016/j.ijfoodmicro.2009.03.014.
Pan JC, Ye R, Wang HQ, Xiang HQ, Zhang W, Yu XF, et al. Vibrio cholerae O139
multiple-drug resistance mediated by Yersinia pestis pIP1202-like conjugative
plasmids. Antimicrob Agents Chemother 2008;52(11):3829–36, doi:http://dx.
doi.org/10.1128/AAC.00375-08.
Parsons MB, Cooper KL, Kubota KA, Puhr N, Simington S, Calimlim PS, et al. PulseNet
USA. standardized pulsed-field gel electrophoresis protocol for subtyping of
Vibrio parahaemolyticus. Foodborne Pathog Dis 2007;4(3):285, doi:http://dx.
doi.org/10.1089/fpd.2007.0089.
Petroni A, Corso A, Melano R, Cacace ML, Bru AM, Rossi A, et al. Plasmidic extended-
spectrum beta-lactamases in Vibrio cholerae O1 El Tor isolates in Argentina.
Antimicrob Agents Chemother 2002;46(5):1462.
Petsaris O, Nousbaum JB, Quilici ML, Le CG, Payan C, Abalain ML. Non-O1, non-O139
Vibrio cholerae bacteraemia in a cirrhotic patient. J Med Microbiol 2010;59
(10):1260–2, doi:http://dx.doi.org/10.1099/jmm.0.021014-0.
Purdy AE, Balch D, Lizárragapartida ML, Islam MS, Martinezurtaza J, Huq A, et al.
Diversity and distribution of cholix toxin, a novel ADP-ribosylating factor from
Vibrio cholerae. Environ Microbiol Rep 2010;2(1):198–207, doi:http://dx.doi.
org/10.1111/j.1758-2229.2010.00139.x.
Rajpara N, Vinothkumar K, Mohanty P, Singh AK, Singh R, Sinha R. Synergistic effect
of various virulence factors leading to high toxicity of environmental V. cholerae
non-O1/non-O139 isolates lacking ctx gene: comparative study with clinical
strains. PLoS One 2013;8(9)e76200, doi:http://dx.doi.org/10.1371/journal.
pone.0076200.
Schirmeister F, Dieckmann R, Bechlars S, Bier N, Faruque SM, Strauch E. Genetic and
phenotypic analysis of Vibrio cholerae non-O1, non-O139 isolated from German
and Austrian patients. Eur J Clin Microbiol Infect Dis 2014;33(5):767–78, doi:
http://dx.doi.org/10.1007/s10096-013-2011-9.
Singh DV, Matte MH, Matte GR, Jiang S, Sabeena F, Shukla BN, et al. Molecular
analysis of Vibrio cholerae O1 O139, non-O1, and non-O139 strains: clonal
relationships between clinical and environmental isolates. Appl Environ
Microbiol 2001;67(2):910–21, doi:http://dx.doi.org/10.1128/AEM.67.2.910-
921.2001.
Suk JH, Lee NY, Lee JH, Oh WS, Peck KR, Song JH. Vibrio cholerae non-O1, non-O139
isolated from pleural effusion following total gastrectomy. J Korean Med Sci
2006;21(5):944–5, doi:http://dx.doi.org/10.3346/jkms.2006.21.5.944.
Syngkon A, Elluri S, Koley H, Rompikuntal PK, Saha DR, Chakrabarti MK, et al. Studies
on a novel serine protease of a DhapADprtV Vibrio cholerae O1 strain and its role
in hemorrhagic response in the rabbit ileal loop model. PLoS One 2010;5(9), doi:
http://dx.doi.org/10.1371/journal.pone.0013122.
Tamura S, Taniguchi F, Nakamoto C, Nakamoto H, Arakawa E, Fukuchi T, et al. Fatal
diarrheal disease caused by Vibrio cholerae O67 in a patient with myelodys-
plastic syndrome. Intern Med 2013;52(14):1635–9.
Tarr CL, Patel JS, Puhr ND, Sowers EG, Bopp CA, Strockbine NA. Identification of
Vibrio isolates by a multiplex PCR assay and rpoB sequence determination. J Clin
Microbiol 2007;45(1):134–40, doi:http://dx.doi.org/10.1128/JCM.01544-06.
The DT, Ngoc NNT, Cat NTN, An HK, Quang NT, Hoang NV, et al. Isolation of New
Delhi metallo-β-lactamase 1-producing Vibrio cholerae, non-O1, non-O139
strain carrying ctxA, st, and hly, genes in southern Vietnam. Microbiol Immunol
2015;59(5):262–7, doi:http://dx.doi.org/10.1111/1348-0421.12248.
van Veen SQ, Claas EC, Kuijper EJ. High-throughput identification of bacteria and
yeast by matrix-assisted laser desorption ionization-time of flight mass
spectrometry in conventional medical microbiology laboratories. J Clin
Microbiol 2010;48(3):900–7, doi:http://dx.doi.org/10.1128/JCM.02071-09.
Walsh TR, Weeks J, Livermore DM, Toleman MA, et al. Dissemination of NDM-1
positive bacteria in the New Delhi environment and its implications for human
health: an environmental point prevalence study. Lancet Infect Dis 2011;11
(5):355, doi:http://dx.doi.org/10.1016/S1473-3099(11)70059-7.
Wang R, Lou J, Liu J, Zhang L, Li J, Kan B. Antibiotic resistance of Vibrio cholerae O1 El
Tor strains from the seventh pandemic in China, 1961-2010. Int J Antimicrob
Agents 2012;40(4):361–4, doi:http://dx.doi.org/10.1016/j.ijantimi-
cag.2012.06.010.
Wayne PA. Methods for antimicrobial dilution disk susceptibility testing of
infrequently isolated or fastidious bacteria. 3rd ed. CLSI Guideline M45. Clinical
and Laboratory Standards Institute; 2015.
Yu L, Zhou Y, Wang R, et al. Multiple antibiotic resistance of Vibrio cholerae
serogroup O139 in Chinafrom 1993 to 2009. PLoS One 2012;7(6)e38633, doi:
http://dx.doi.org/10.1371/journal.pone.0038633.
Zhang Q, Qian DL, Li FY, Li KC, Xia F, Dai QF. Analysis on the main virulence genes and
molecular typing of non-O1/non-O139 Vibio cholerae in bloodstream infection.
Clin J Infect Dis 2016;34(12):732–7, doi:http://dx.doi.org/10.3760/cma.j.
issn.1000-6680.2016.12.007.