The Plant Journal (2009) 60, 518–526 doi: 10.1111/j.1365-313X.2009.03975.

The Arabidopsis ATRIP ortholog is required for a programmed

response to replication inhibitors
Paul R. Sweeney1, Anne B. Britt2 and Kevin M. Culligan1,*
1
Department of Molecular, Cellular and Biomedical Sciences, University of New Hampshire, Durham, NH 03824, USA, and
2
Department of Plant Biology, University of California, Davis, CA 95616, USA

Received 2 June 2009; revised 25 June 2009; accepted 29 June 2009; published online 18 August 2009.
*
For correspondence (fax +603 862 4013; e-mail k.culligan@unh.edu).

SUMMARY

The programmed response to replication inhibitors in eukaryotic cells requires the protein kinase ATR (ataxia
telangiectasia mutated and rad3-related), which is activated primarily through the persistence of replication
protein A (RPA)-bound single-stranded DNA at stalled replication forks and sites of DNA damage undergoing
excision repair. Once activated, ATR initiates a cascade of events, including cell-cycle arrest and induction of
DNA repair, to mitigate the mutagenic effects of DNA replication in the presence of damage and/or blockage.
While many of the molecular regulators of ATR have been determined in yeast and animal cells, little is known
about ATR regulation in plants. To genetically define ATR regulatory pathways in Arabidopsis, we describe
here a genetic screen for identifying mutants that display a characteristic phenotype of Arabidopsis atr null
mutants – hypersensitivity to the replication blocking agent hydroxyurea (HU). Employing this screen, we
isolated a novel mutant, termed hus2 (hydroxyurea-sensitive), that displays hypersensitivity to HU, aphidicolin
and ionizing radiation, similar to atr mutants. In addition, cell-cycle progression in response to replication
blocks and ionizing radiation is defective in hus2, displaying a nearly identical phenotype to atr mutants.
Positional cloning of hus2 reveals a gene sequence similar to yeast Rad26/Ddc2 and ATRIP (ATR interacting
protein), suggesting that hus2 encodes an Arabidopsis ATRIP ortholog.

Keywords: ATRIP, ATR, DNA damage, cell cycle, rad26, Ddc2.

INTRODUCTION
Ataxia telangiectasia mutated and rad3-related (ATR) protein
kinase plays a role in damage response in yeast, animals,
and plants. Activated through binding to single-stranded/
double-stranded (ss/ds)DNA transitions, this kinase induces
checkpoint response and facilitates the reconstruction and
progression of damaged replication forks. This role is con-
served in plants, as Arabidopsis mutants defective in AtATR
are hypersensitive to a variety of replication-blocking agents
(Culligan et al., 2004). atr mutants of Arabidopsis, unlike
those of yeast or mammals, are viable and fully fertile as
homozygotes; this facilitates their extensive phenotypic
analysis, and makes Arabidopsis a useful model for the
study of the function of ATR in checkpoint response.
The mode of binding and activation of ATR at ss/dsDNA
transitions has been elucidated through extensive genetic
and biochemical analysis in yeast and vertebrates (Burrows
and Elledge, 2008; Cimprich and Cortez, 2008). Single-
stranded DNA recruits replication protein A (RPA), the
eukaryotic ssDNA-binding protein. RPA is bound by ATR
interacting protein (ATRIP), which binds ATR. This tethers
ATR to ssDNA, but does not necessarily induce ATR’s kinase
activity. Activation, in vertebrates and fungi, requires the
co-localization of ATR and the 9-1-1 (spRad9, spRad1,
spHus1) checkpoint clamp. This clamp is loaded by
SpRad17/RFC onto ss/dsDNA junctions (at the 5¢ end of the
dsDNA), via a process that also requires RPA. The checkpoint
clamp binds to TOPBP1, which, as it is now co-localized with
ATR, somehow triggers activation of ATR’s kinase activity.
The process through which ATR becomes activated in
plants has not been described, but is presumably similar to
that observed in animals and fungi. Homologs of most of the
players described above have been identified in plants, and in
several cases phenotypic analysis suggests that their func-
tion is conserved (Culligan et al., 2004, 2006; Heitzeberg
et al., 2004; Friesner et al., 2005; Culligan and Britt, 2008).
However, Arabidopsis mutants defective in the Arabidopsis
TOPBP1 homolog, Mei-1, require additional phenotypic
analysis before we can determine whether this protein might
play a role in ATR activation in mitotic cells. In addition,
in silico analysis has failed to reveal an ATRIP homolog.

518 ª 2009 The Authors

Journal compilation ª 2009 Blackwell Publishing Ltd

Given that ATRIP acts as an obligate cofactor of ATR in
mammals and yeast, we searched for mutants that mimic
the distinctive phenotype of atr lines grown on hydroxyurea
(HU). We identified such a mutant, found it was not allelic
to ATR, and employed map-based cloning to derive its
sequence. Careful analysis of this sequence suggests that
this gene represents the Arabidopsis ATRIP homolog.
Consistent with its proposed role as an obligate cofactor of
ATR, the phenotype of atrip lines is indistinguishable from
that of the atr mutants.
RESULTS
Isolation of hus2, a novel mutant that is hypersensitive
to the replication-blocking agent hydroxyurea
We previously reported a unique root phenotype of atr T-
DNA (null) mutants grown on the replication-blocking agent
HU (Culligan et al., 2004). When grown on HU-containing
plates, atr mutants display root meristem failure resulting in
severely retarded root growth [when compared with wild-
type (WT) growth on HU plates], a highly branched root
structure, and root-hair formation at the tip of the root. From
this phenotype, we developed the following genetic screen
to identify mutants that display a similar short, ‘hairy’ root
phenotype when grown on HU-containing media: Ethyl
methanesulfonate (EMS)-mutagenized (M2) seeds were
germinated on 0.5 mM HU-containing MS plates. After
14 days of growth, seedlings were visually screened for
short, branched, and ‘hairy’ root phenotypes (in comparison
to WT and atr control seedlings grown on HU). Seedlings
mimicking the atr phenotype were then transferred to MS
(no HU) plates and grown for an additional 5–7 days to
determine if root growth is restored. Seedlings that recover
on MS plates are considered positive hus (hydroxyurea
sensitive) mutants since the root-hypersensitive phenotype
is dependent upon on the presence of HU.
From an initial screen of approximately 3000 EMS-mutag-
enized seedlings, we identified 10 hus-like individuals.
Transfer of these putative mutants to MS plates revealed
one seedling that resembled atr-2, termed hus2-1. A back-
cross of hus2-1 was performed to WT (ecotype Columbia),
and the resulting F2 population displayed a 3:1 (WT:HU
hypersensitive) segregation pattern, indicating that the
mutation is recessive. To determine if the hus2-1 mutation
is allelic to atr, we performed a complementation test-cross
to atr-2 (ecotype Columbia). The resulting F1 seeds, germi-
nated on HU-containing plates, display a normal WT-like
phenotype (no HU hypersensitivity), suggesting that hus2-1
is not an allele of atr. Individual hus2-1 mutant lines were
selected from the WT-Columbia backcrossed population, and
grown on MS and HU-containing plates to directly compare
hus2-1 root growth with WT and atr-2. Figure 1 shows no
phenotypic difference between WT, atr-2, and hus2-1 on MS
plates, while on HU plates the hus2-1 and atr-2 seedlings
ª 2009 The Authors
Journal compilation ª 2009 Blackwell Publishing Ltd, The Plant Journal, (2009), 60, 518–526
ATRIP in Arabidopsis 519
No treatment Plus HU
Grown for 5 days Grown for 5 days
WT atr hus2 WT atr hus2
Plus HU Plus HU
Grown for 9 days Grown for 13 days
WT atr hus2 WT atr hus2
Figure 1. Root phenotype comparison of WT, atr-2 and hus2-1.
Seeds of each line were germinated on MS media plates (No treatment) or MS
media plates containing 0.5 mM hydroxyurea (Plus HU), and grown under
standard growth conditions for approximately 2 weeks.
display very similar HU-hypersensitive phenotypes over the
course of 2 weeks (Figure 1) and beyond (not shown).
Positional cloning of hus2-1
The hus2-1 mutant (ecotype Columbia) was crossed to WT
Landsberg erecta (Ler) to create a mapping population for
positional cloning. The resulting F2 seeds were grown on HU
plates and screened for the hus2-1 hypersensitive pheno-
type. Approximately 235 individual seedlings that displayed
the characteristic hairy root phenotype of hus2-1 were
transferred to soil and DNA was isolated for genetic marker
analysis, described below.
To generate a general chromosomal map position, we
employed simple sequence length polymorphism (SSLP)
markers and bulked-segregation analysis (Bell and Ecker,
1994) of 30 individuals from the mapping population (data
not shown). This analysis placed the hus2 mutation on the
long arm of chromosome 5, closest to the SSLP marker
nga76. The map position of hus2 was further refined using
established cleaved amplified polymorphic sequence (CAPS)
markers (Konieczny and Ausubel, 1993) on chromosome 5,
displaying strong linkage to RPS4 (3.1% recombinant) and
moderate linkage to PDC2 (29.8% recombinant) (Figure 2). To
determine if the hus2-1 mutation is located between these
CAPS markers, we developed additional derived (d)CAPS
markers within this region (Table 1). Further analysis showed
that two dCAPS markers, PRS1847 (0.4%, or 1/235 recombi-
nant) and PRS1856 (0.8%, or 2/235 recombinant) were most
closely linked to the hus2 mutation. Individual #38-1 proved
recombinant for marker PRS1847 but non-recombinant for
marker PRS1856. Likewise, individuals #18-2 and #28-2
520 Paul R. Sweeney et al.
(a)
(b)
(c)
Type Name Primers (5¢–3¢)
CAPS KMC45510 5g45510-1: (TTGCAAGATCTGCCAAACAT)
5g45510-2: (TCCCGAGAGATTAAGAGTTTTG)
PRS196 PRS196-1: (TGCATTGGGAACGTCTTAGAT)
PRS196-2: (CACTCAAGAAGTTCAGCTCCAA)
PRS191 KMC191-1: (TCCATCATCATCATCATGTCC)
KMC191-2: (AACTGAGATTTATGCGGCTGA)
dCAPS PRS1847 PRS1847-1: (ACATGTACTAACCATTATGAAAAGTC)
PRS1847-2: (CATTTCACTTCTTCACCTGCATATAAT)
PRS1856 PRS1856-1: (CATAGAACTCTTATTAACTATGTA)
PRS1856-2: (GGGCATGACAAAATTTCTTGCATTTT)
PRS1859 PRS1859-1: (ATATCAAAGTGTTTTGAATGTTAACTT)
PRS1859-2: (TCACATCCTTTCATTCTCTTCTTGACT)
PRS1866 PRS1866-1: (TCCGGCTTCAAGAATATGGTCAAATC)
PRS1866-2: (AATGATCAGCGTCAGTACTAGGAATA)
CAPS, cleaved amplified polymorphic sequence; dCAPS, derived CAPS.
proved to be recombinant for marker PRS1856 but non-
recombinant for marker PRS1847. Based on this, we conclude
that the hus2-1 mutation is located between PRS1847 and
PRS1856, an 86-kb region of chromosome 5.
To identify candidate genes for sequencing (e.g. homo-
logs of known DNA damage response genes), we conducted
Protein-BLAST searches of the approximately 19 genes
Journal compilation ª 2009 Blackwell Publishing Ltd, The Plant Journal, (2009), 60, 518–526
Figure 2. Positional cloning and identification of
the HUS2 (ATRIP) gene.
(a) Schematic diagram showing the genetic
markers [simple sequence length polymorphism
(SSLP), cleaved amplified polymorphic sequence
(CAPS), and derived CAPS (dCAPS)] used in this
study to determine the map position of the HUS2
locus. Nga76 is an SSLP marker and PhyC, Rps4,
Pdc2 and Lfy3 are CAPS markers used to deter-
mine the HUS2 region. Additional dCAPS mark-
ers (denoted as PRS and KMC) were derived from
identified polymorphisms (TAIR) between eco-
types Columbia (Col) and Landsberg erecta (Ler).
No additional polymorphisms between Col and
Ler were identified within the 86-kb HUS2 region
shown.
(b) The intron/exon diagram of HUS2/ATRIP is
derived from wild-type (WT) cDNA analysis of
At5g45610 compared to the full-length predicted
gene (TAIR release 8). The asterisk (*) denotes
the position of the G to A transition mutation
within At5g45610 identified as the hus2 muta-
tion. The bracket below denotes the position of
the predicted coiled-coil region.
(c) Phylogenetic analysis of Rad26/ATRIP protein
sequences. Shown is a neighbor-joining distance
tree based on CLUSTALX alignments of known
Rad26/ATRIP orthologs, a putative rice ATRIP
ortholog (OsJ 005081), and Arabidopsis
At5g45610 (HUS2/ATRIP). Numbers denote the
number of times the branch was found in 1000
bootstrap replicas. The distance branch-length
scale (bottom) denotes 0.2 expected substitu-
tions per sequence position.
Table 1 Marker primers used
Digestion
HaeIII
SspI
HindIII
RsaI
XbaI
SpeI
NdeI
within this region. While many genes displayed similarity
to other known genes, we found no obvious candidates with
similarity to genes predicted to participate in the DNA-
damage response. In addition, several other genes showed
no similarity to any genes with a known function. Thus, we
began to systematically sequence all genes within this
region. From this analysis, only one gene (of a total of eight
ª 2009 The Authors

genes sequenced) was confirmed to have a mutation (G to
A), located in a predicted 3¢ splice site in intron 3 of locus
At5g45610 (Figure 1b). The RT-PCR amplification of WT
(Columbia) cDNA at this locus resulted in a single PCR
product – no splicing variants were identified. This product
included the predicted start (ATG) and stop (UAG) codons
and was approximately 1.9 kb in length. The RT-PCR ampli-
fication of hus2-1 (Columbia) cDNA at the At5g45610 locus
displayed multiple RT-PCR amplification products, suggest-
ing splicing variants, insertions, or deletions in At5g45610
(see below). To characterize the resulting mRNA products,
we cloned and sequenced RT-PCR amplification products
from both WT and hus2-1. This analysis revealed a WT cDNA
with an open reading frame (coding sequence, CDS) of 1941
bases, 39 bases larger than the predicted CDS (TAIR genome
release TAIR8). Comparison of the CDS (Figure S1 in Sup-
porting Information) with the full-length gene sequence
revealed 12 exons (Figure 2b) over 3277 bases of gene
sequence (from the initiating ATG to the TGA stop codon).
This includes an additional 39-base exon (exon 2; Figure 2b)
not present in the predicted CDS (TAIR8, as above), located
489 bases downstream from the initiating ATG of the gene
sequence. Further sequence analysis of RT-PCR amplifica-
tion products of hus2-1 revealed four classes of cDNAs:
Class I cDNA is 119 bp shorter than WT, resulting from mis-
splicing and deletion of exon 3. Class II cDNA contains a
seven-base deletion, resulting from mis-splicing seven
bases into exon 3. Class III cDNA contains a one-base
deletion, resulting from mis-splicing one base into exon 3.
Class IV is 87 bases longer than WT due to a failure of
splicing intron 2. In each case, the resulting reading frame
would lead to a prematurely truncated protein.
Based on previous genomic transcriptional analyses,
At5g45610 appears to be expressed throughout the devel-
oping plant, including roots, leaves, stems, and developing
flowers (Schmid et al., 2005). There was little (less than two-
fold) variation in the level of expression versus 7-day-old
seedlings. In addition, whole-genome transcriptional analy-
ses suggest that At5g45610 is not induced in response to
ionizing (gamma) radiation versus untreated 5-day-old
seedlings (Culligan et al., 2006) or to UV-B light, bleomy-
cin + mitomycin (‘genotoxic stress’), or oxidative stress
versus untreated 18-day-old seedlings (Kilian et al., 2007).
However, At5g45610 appears to be induced in response to
chronic and acute doses of UV-B under different growth
conditions, employing quantitative RT-PCR (Sakamoto
et al., 2009).
To confirm that the hus2-1 phenotype is a result of a defect
in At5g45610, we isolated a homozygous T-DNA insertion
mutant (SALK_077978, insertion in intron 5 of At5g45610) of
this gene (Arabidopsis Biological Resource Center, ABRC).
Indeed, this mutant displayed a similar HU-hypersensitive
phenotype (hairy root) compared with hus2-1 and atr-2 (data
not shown). Complementation analysis between hus2-1 and
ª 2009 The Authors
Journal compilation ª 2009 Blackwell Publishing Ltd, The Plant Journal, (2009), 60, 518–526
ATRIP in Arabidopsis 521
SALK_077978 shows that the resulting F1 seedlings are
hypersensitive to HU, confirming that the hus2-1 mutation
causes a defect in At5g45610 and the resulting HU-sensitive
phenotype. Thus, SALK_077978 is renamed here hus2-2.
The hus2 locus encodes a putative Rad26/ATRIP ortholog
As described above, P-BLAST searches employing
At5g45610 protein sequences revealed no apparent homol-
ogy to any known orthologs of molecular players in the DNA
damage response. No putative kinase domains were iden-
tified (as would be expected for a Chk1 ortholog, for exam-
ple), but the predicted protein does contain an Armadillo-like
(ARM) protein/DNA interaction domain (positions 315–517
of the protein sequence). Additionally, secondary structure
analysis of At5g45610 (including exon 2 identified in our
cDNA analysis) revealed a coiled-coil domain within the
N-terminal region of the protein sequence (Figure S2) that
spans exon 2 (Figure 2b). We reasoned that since the hus2-1
phenotype is nearly identical to atr mutants, the hus2 locus
probably encodes a factor that is important for ATR-depen-
dent responses. Based on this, one likely candidate ortholog
of At5g45610 is ATRIP: ATRIP contains no kinase domains, is
phenotypically similar to ATR (Cortez et al., 2001; Ball and
Cortez, 2005), and contains an N-terminal coiled-coil domain
(Cortez et al., 2001) similar to At5g45610. We therefore
conducted protein sequence alignments (employing CLU-
STALX) of known full-length Rad26 and ATRIP orthologs, and
a rice (Oryza sativa) predicted protein sequence (OsJ 005081)
identified in our P-BLAST searches. We identified in our
alignment a characteristic acidic domain within the N-ter-
minal region of ATRIP protein sequences, shown previously
to act as a checkpoint recruitment domain (CRD) for repli-
cation protein A (RPA70 large subunit) (Ball et al., 2007). A
similar domain is also present in Arabidopsis At5g45610 and
the putative rice predicted sequence (Figure S3). The
resulting phylogenetic analyses employing this alignment
(Figure 2c) show that At5g45610 (AtATRIP) and OsJ 005081
(rice ATRIP) group within other Rad26/ATRIP orthologs,
suggesting that these genes encode ATRIP orthologs.
The hus2-1 mutant is hypersensitive to replication-blocking
agents and ionizing radiation
The atr-2 mutant displays similar hypersensitivity to the
replication-blocking agents HU (at 0.5 mM concentration in
MS media plates) and aphidicolin (at 12 lg ml)1 concentra-
tion in MS media plates). Hydroxyurea and aphidicolin,
however, block replication in fundamentally different ways:
HU inhibits ribonucleotide reductase (RNR) activity causing
a reduction in available deoxyribose nucleotides (dNTPs) for
DNA synthesis, while aphidicolin directly inhibits DNA
polymerase. Because of this difference in replication inhi-
bition, we directly compared hypersensitivity of hus2-1 and
atr-2 growth on HU (0.5 mM) and aphidicolin (12 lg ml)1)
media plates. As shown in Figure 3(a,b), the kinetics of root
522 Paul R. Sweeney et al.

(a) (b)

(c) (d)

Figure 3. Root growth analysis of Arabidopsis wild-type (WT) and mutant lines in response to replication blocking agents and DNA damage.
In all graphs ‘n.t.’ denotes no treatment controls, HU denotes addition of hydroxyurea, APH denotes addition of aphidicolin, and 100 Gy denotes 100 gray of gamma
radiation. Error bars denote standard errors of the mean.
(a) Seeds were germinated on standard MS plates (n.t.) or plates containing 0.5 mM HU.
(b) Seeds were germinated on standard plates (n.t.) or plates containing 12 lg ml)1 of aphidicolin.
(c) Seeds were germinated on standard MS plates or plates containing 0.25 mM HU.
(d) Seeds were germinated on standard MS plates, grown for 5 days under standard conditions, and irradiated with 100 Gy of gamma radiation or left untreated
(n.t.). All plates were returned to the growth chamber and root lengths determined post-irradiation.

growth inhibition is similar in WT for both HU and aphidic-
olin at these concentrations. Moreover, both atr-2 and hus2-
1 mutants display similar retarded root-growth kinetics over
the time course of 13 days for both HU and aphidicolin,
suggesting that both replication-blocking agents have
similar inhibitory growth effects on both mutants.
To determine whether hus2-1 and atr-2 have synergistic
effects in response to replication-blocking agents and
DNA damage, we constructed a hus2-1 atr-2 double
mutant and directly compared root growth with each
single mutant and WT. As is shown in Figure 3(c), the
double mutant displays similar hypersensitivity to HU
compared with the hus2-1 and atr-2 single mutants.
Likewise in Figure 3(d), the double mutant displays similar
hypersensitivity to ionizing radiation (gamma radiation)
as the single mutants atr-2 and hus2-1, and all are
less hypersensitive than atm-2. This suggests that, in
response to replication-blocking agents and DNA damage
(double-strand breaks, DSBs), Arabidopsis ATRIP and ATR
participate in the same genetic pathway.
The hus2-1 mutant is defective in cell-cycle checkpoint
response
To determine if the Arabidopsis ATRIP plays a central role in
regulating G2 progression in response to replication blocks
and DNA damage, we established a hus2-1 mutant line
containing a CyclinB1;1:GUS promoter–reporter fusion
construct to monitor G2 progression. In this construct,
transcription of the GUS protein is driven by the CyclinB1;1
promoter, and the degradation of GUS is driven by the
Cyclin B mitotic destruction box (Colon-Carmona et al.,
1999). The CyclinB1;1 promoter is normally activated in

ª 2009 The Authors

Journal compilation ª 2009 Blackwell Publishing Ltd, The Plant Journal, (2009), 60, 518–526
 ATRIP in Arabidopsis 523

Figure 4. The GUS stained root tips of WT, atr-2 and hus2-1 containing the CyclinB1;1-GUS construct.
Seeds of all lines were germinated on MS plates and grown for 5 days. Seedlings were subsequently transferred to plates containing 0.5 mM hydroxyurea (HU),
12 lg ml)1 of aphidicolin or to MS (no treatment) plates.

mid-S to G2, thus GUS expression denotes cells in the mid-S
to mid-M phase of the cell cycle. As demonstrated previ-
ously, Arabidopsis ATR (but not ATM) plays a central role in
regulating G2 progression in response to replication-block-
ing agents – unlike WT, atr single mutants fail to accumulate
S/G2-phase cells (as determined by CyclinB1;1:GUS accu-
mulation) when grown on aphidicolin (Culligan et al., 2004).
To test the role of ATRIP in this response, we compared
CyclinB1;1:GUS accumulation in 5-day-old WT, hus2-1,
and atr-2 seedlings after transfer to aphidicolin-containing
plates. As seen in Figure 4, WT shows an accumulation of
CyclinB1;1:GUS throughout the meristem after transfer to
aphidicolin (2 and 4 days post-transfer), but both atr-2 and
hus2-1 are defective in this response.
Previously, we demonstrated that although HU and
aphidicolin elicit similar hypersensitivity responses in atr
mutant seedlings versus WT seedlings, HU did not induce
increased meristematic GUS expression in WT. This is
probably due to the different mechanisms with which HU
and aphidicolin block replication, and may represent an
additional (G1) checkpoint induced by HU (Culligan et al.,
2004). Nonetheless, GUS accumulation did not differ

Figure 5. The GUS stained root tips of c-irradiated WT and mutant lines. Seeds of all lines were germinated on MS plates and grown for 5 days before irradiation.
Root tips were isolated from >12 individuals for GUS staining at each time point following irradiation (two representative examples are shown). N.D. denotes not
determined.

ª 2009 The Authors

Journal compilation ª 2009 Blackwell Publishing Ltd, The Plant Journal, (2009), 60, 518–526
524 Paul R. Sweeney et al.
between the atr-2 mutant and the hus2-1 mutant at both 2
and 4 days post-transfer (Figure 4).
To determine the role of ATRIP in regulating cell-cycle
progression in response to ionizing radiation (DNA damage)
versus ATR and ATM, we established hus2-1 atr-2 and hus2-
1 atm-2 double mutants containing the CyclinB1;1:GUS
construct (see above). As shown in Figure 5, ionizing
radiation (100 Gy of gamma radiation) induces GUS expres-
sion throughout the meristem in WT seedlings during a time
course of 8–72 h. The atm-2 mutant displays similar accu-
mulation throughout the time course, but at 24 h post-
irradiation, atr-2 mutants show significantly reduced expres-
sion up to 72 h post-irradiation. Additionally, the atr-2 atm-2
double mutant displays no significant accumulation either at
the early time point (8 h) or later (48 h). Taken together, this
suggests that ATR and ATM act synergistically to regulate
the S/G2 checkpoint represented by the accumulation of
GUS in WT meristematic cells: ATM regulates early (<8 h)
checkpoint activation while ATR regulates the maintenance
of the checkpoint (>8 h), as previously described (Abraham,
2001; McGowan and Russell, 2004; Culligan et al., 2006;
Cimprich and Cortez, 2008). Comparison of hus2-1 and atr-2
GUS accumulation shows similar kinetics, whereby GUS
expression is similar to WT at 8 h post-irradiation but is
dramatically reduced by 24–48 h post-irradiation. Combina-
tion of hus2-1 and atr-2 (the hus2-1 atr-2 double mutant)
reveals essentially no differences in GUS accumulation
versus either single mutant, while combination of hus2-1
and atm-2 (the hus2-1 atm-2 double mutant) reveals essen-
tially no difference in GUS accumulation versus the atr atm
double mutant. Taken together, these data suggest that
ATRIP and ATR participate in the same genetic pathway
regulating the S/G2 checkpoint response to DNA damage
and replication blocks, and both ATRIP and ATR act syner-
gistically with ATM to regulate the DNA damage (DSB) G2
checkpoint.
hus2-1 causes complete sterility in an atm background
We have previously shown that atr mutants are completely
fertile, while atm mutants are semi-sterile (Garcia et al.,
2003; Culligan et al., 2004). However, combination of atr
and atm mutants results in complete sterility, failure of
meiotic synapsis, and a failure of univalent separation
during anaphase I (Culligan and Britt, 2008). To determine
if hus2-1 displays similar sterility effects as atr in an atm
background, we analyzed overall seed production (fertility)
in the hus2-1 single mutant and the hus2-1 atm double
mutant (described above) in comparison to WT, the atr-2
and atm-2 single mutants, and the atr-2 atm-2 double
mutant. Both hus2-1 and atr-2 displayed normal seed pro-
duction versus WT (approximately 50 seeds per silique),
while atm-2 displayed reduced seed production (approxi-
mately 6 seeds per silique). However, the hus2-1 atm
double mutant displayed complete sterility (0 seeds for
Journal compilation ª 2009 Blackwell Publishing Ltd, The Plant Journal, (2009), 60, 518–526
>1000 siliques) similar to the atr-2 atm-2 double mutant.
This suggests that ATR and ATRIP have similar roles dur-
ing meiotic progression.
DISCUSSION
The protein kinase ATR plays a central role in cellular
responses to DNA damage and replication blocks, including
regulation of the cell cycle, induction of repair, transcrip-
tional regulation, and, in animals, apoptosis. The molecular
pathways through which ATR activates these responses
have been, to a large extent, resolved in yeast and animals
(Zou et al., 2002; Zou and Elledge, 2003; Burrows and Ell-
edge, 2008; Cimprich and Cortez, 2008; Mordes et al., 2008;
Xu et al., 2008). In Arabidopsis, many orthologs of these
ATR-dependent pathways have been identified and charac-
terized through reverse genetic approaches (Garcia et al.,
2003; Culligan et al., 2004; Heitzeberg et al., 2004; De
Schutter et al., 2007; Culligan and Britt, 2008). Although
these approaches have proven fruitful, the identity of many
key players in the ATR-dependent pathway remains unclear,
leaving the question of whether plant DNA damage
response pathways are highly similar to those found in
yeasts and animals. To address this, forward genetic
approaches can be employed to identify additional molec-
ular players that are not obvious orthologs of known genes.
This approach is particularly useful in Arabidopsis, since null
alleles of key players in the DNA damage response (e.g. ATR)
are not lethal. We describe here the isolation of a novel
Arabidopsis mutant, hus2, from a forward-genetic screen for
mutants that are hypersensitive to the replication-blocking
agent HU and phenotypically similar to atr mutants.
Our sequence and phylogenetic analysis of the resulting
predicted HUS2 protein sequence strongly suggest that
HUS2 encodes an ortholog of yeast Rad26/Ddc2 and human
ATRIP. Protein-BLAST searches with the HUS2 sequence
revealed similarity to a single undefined (unknown) rice
putative protein, showing similarity throughout the entire
length of the sequence. No other similar sequences were
found in the Arabidopsis genome, suggesting that HUS2 is
single-copy with no additional homologous loci. Although
BLAST searches revealed no similarity to other defined
genes in yeast or animals, our phylogenetic analysis shows
that the putative rice ATRIP and Arabidopsis HUS2 protein
sequence falls within a clade that includes the mammalian
and fly (Drosophila) ATRIP sequences, with strong boot-
strap support. Inspection of the HUS2 protein sequence
further reveals a predicted N-terminal coiled-coil region,
similar to all other known ATRIP orthologs, which is
essential for ATRIP oligomerization, stable ATR–ATRIP
complex formation, and ATR–ATRIP checkpoint activation
(Cortez et al., 2001; Ball and Cortez, 2005). Although we
present no data showing direct interaction with ATR, our
sequence analysis strongly suggests that HUS2 is an ATRIP
ortholog.
ª 2009 The Authors

In Saccharomyces cerevisiae, null mutants of Ddc2 (the
ATRIP orthologous gene) are synthetically lethal, but can be
suppressed in a sml1 mutant background, similar to mec1
(the ATR/ATM homolog) mutants. In this background, loss of
Ddc2 causes hypersensitivity to DNA-damaging and repli-
cation-blocking agents, and G2/M checkpoint defects. These
effects are strikingly similar to mec1 sml1, suggesting that
Ddc2 and Mec1 have very similar roles in the DNA damage
response. Indeed, Ddc2 and Mec1 physically interact to form
a complex, and phosphorylation of Ddc2 is dependent upon
active Mec1 (Paciotti et al., 2000). In mammals, loss of
ATRIP results in embryonic lethality similar to loss of ATR.
Although no null alleles of ATRIP have been described in
animals, siRNA studies reveal strikingly similar phenotypes
between ATR conditional knockout cell lines and cell lines
with reduced expression of ATRIP, including defects in G2
checkpoint regulation and Chk1 phosphorylation (Cortez
et al., 2001). Based on these phenotypic effects in yeast and
mammals, and expression and interaction studies of ATR
and ATRIP, it has been suggested that ATRIP represents an
obligate subunit of ATR (Cimprich and Cortez, 2008).
Employing Arabidopsis null mutant lines of ATR and
ATRIP, we find here that both mutant lines show a nearly
identical phenotype in hypersensitivity to replication-block-
ing agents and ionizing radiation. Mutant combinations of
atr and hus2 display no significant additive hypersensitivity
effects in response to replication blocks or ionizing radiation,
suggesting that both ATR and ATRIP participate in the
same genetic pathway in Arabidopsis, similar to yeast and
animals. In addition, we show that atr and hus2 display very
similar S/G2 checkpoint responses to replication blocks and
ionizing radiation. For example, atr and hus2 each display
early G2 arrest in response to ionizing radiation, but fail to
maintain this response at 24 h. The mutant combination of
hus2 with atm displays a similar phenotype to the double
mutant atr atm; both double mutant lines failed to arrest in
G2 during both early (8 h) and later (24+ h) time points.
Finally, both atr atm and hus2 atm are completely sterile,
suggesting that ATRIP plays a similar role during meiotic
double-strand break processing as has been suggested for
Arabidopsis ATR in an atm background (Culligan and Britt,
2008). Altogether, our data suggest that in Arabidopsis, as
in yeast and animals, ATRIP acts in complex with ATR to
regulate cellular responses to replication blocks and DNA
damage.
EXPERIMENTAL PROCEDURES
Arabidopsis growth conditions
Arabidopsis seeds were surface sterilized in 10% bleach and
washed with double-distilled water (ddH2O) before sowing on 1%
phytagel agar plates containing 1· MS salts (Sigma-Aldrich, http://
www.sigmaaldrich.com/) pH 5.8. The resulting plates were incu-
bated at 4C for 2–3 days and further grown under cool-white
lamps filtered through Mylar (Golden State Plastics, Sacramento,
ª 2009 The Authors
Journal compilation ª 2009 Blackwell Publishing Ltd, The Plant Journal, (2009), 60, 518–526
ATRIP in Arabidopsis 525
CA) at an intensity of 100–150 lmol m)2 sec)1 with a 24-h daylight
period at 22C.
Molecular mapping
The hus2-1 mutant (ecotype Col) was crossed to WT Ler to generate
a mapping population segregating Col and Ler polymorphisms. At
least 235 HU-hypersensitive plants were identified from the F2
generation of this cross, and DNA isolated from each individual.
Previously established SSLP (Bell and Ecker, 1994) and CAPS
genetic markers (Konieczny and Ausubel, 1993; Lukowitz et al.,
2000) were employed to determine a general map position for hus2.
For fine mapping, additional CAPS and dCAPS markers were
generated as shown in Table 1.
cDNA analysis of the hus2 locus
Total RNA was extracted from bulked 5-day-old seedlings
employing a RNeasy RNA isolation kit (Qiagen, http://www.
qiagen.com/). The RNA samples were treated with DNase (DNase
set, Qiagen) and quantified. Synthesis of cDNA was performed
using an Invitrogen SuperScript First-Strand synthesis kit
(Invitrogen, http://www.invitrogen.com/). One microgram of total
RNA from WT and hus2 mutant seedlings was reversed tran-
scribed employing random hexamer primers according to the
manufacturer’s protocol. Polymerase chain reactions (RT-PCR)
were performed with various primers that spanned the hus2 locus
to determine the cDNA structure of the At5g456100 coding region.
The resulting RT-PCR products were inserted into the pCR2.1
cloning vector employing an Invitrogen TOPO cloning kit (Invitro-
gen) and sequenced at the University of New Hampshire, Hubbard
Center for Genome Studies (Durham, NH, USA) using standard
dye-terminator protocols.
Gamma irradiation
Seeds were surface sterilized and sown on MS agar plates (as
above), and incubated at 4C for 2 days. Plates were then
transferred to a 21C growth chamber and grown vertically for
5 days. Irradiated samples received a final dose of 100 Gy of
gamma radiation employing a 60Co source (Massachusetts Insti-
tute of Technology, http://web.mit.edu/) with a dose rate of
approximately 210 Gy min)1. Non-irradiated samples (controls)
were treated identically but not exposed to the irradiator. After
irradiation, all plates were promptly returned to the growth
chamber.
Histochemical staining of Arabidopsis roots
GUS staining of lines containing the CyclinB1;1-GUS construct was
performed as described previously (Preuss and Britt, 2003). Briefly,
tissues were immersed in 50 mM NaPO4 (pH 7.2), 0.5 mM K3Fe(CN)6,
0.5 mM K4Fe(CN)6, and 2 mM X-GLUC (Fisher, http://www.fishersci.
com/) and incubated at 37C for 3 h. Tissues were subsequently
washed in 70% ethanol (EtOH), and resuspended in 70% EtOH
overnight before mounting on glass microscope slides.
ACKNOWLEDGEMENTS
We thank Daniel Lynch for assistance in mapping hus2, and Ayako
Sakamoto for critical reading of this manuscript. This work was
supported by Undergraduate Research Fellowships (UROP and
SURF) from the University of New Hampshire to PRS, DOE grant DE-
FG02-05ER15668 to ABB and KMC, and NSF grant MCB-0818603 and
USDA ARS (HATCH) grant NH00488 to KMC. This is scientific
contribution number 2397 from the New Hampshire Agricultural
Experiment Station.
526 Paul R. Sweeney et al.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the online
version of this article:
Figure S1. Predicted coding sequence (CDS) of At5g45610.
Figure S2. COILS prediction output of At5g45610 (HUS2) and human
ATRIP.
Figure S3. Predicted acidic checkpoint recruitment domain within
the N-terminal regions of ATRIP protein sequences.
Please note: Wiley-Blackwell are not responsible for the content or
functionality of any supporting materials supplied by the authors.
Any queries (other than missing material) should be directed to the
corresponding author for the article.
REFERENCES
Abraham, R. (2001) Cell cycle checkpoint signaling through the ATM and ATR
kinases. Genes Dev. 15, 2177–2196.
Ball, H.L. and Cortez, D. (2005) ATRIP oligomerization is required for ATR-
dependent checkpoint signaling. J. Biol. Chem. 280, 31390–31396.
Ball, H.L., Ehrhardt, M.R., Mordes, D.A., Glick, G.G., Chazin, W.J. and Cortez,
D. (2007) Function of a conserved checkpoint recruitment domain in ATRIP
proteins. Mol. Cell. Biol. 27, 3367–3377.
Bell, C. and Ecker, J. (1994) Assignment of 30 microsatellite loci to the linkage
map of Arabidopsis. Genomics, 19, 137–144.
Burrows, A.E. and Elledge, S.J. (2008) How ATR turns on: TopBP1 goes on
ATRIP with ATR. Genes Dev. 22, 1416–1421.
Cimprich, K.A. and Cortez, D. (2008) ATR: an essential regulator of genome
integrity. Nat. Rev. Mol. Cell Biol. 9, 616–627.
Colon-Carmona, A., You, R., Haimovitch-Gal, T. and Doerner, P. (1999) Spatio-
temporal analysis of mitotic activity with a labile cyclin-GUS fusion protein.
Plant J. 20, 503–508.
Cortez, D., Guntuku, S., Qin, J. and Elledge, S.J. (2001) ATR and ATRIP:
partners in checkpoint signaling. Science, 294, 1713–1716.
Culligan, K.M. and Britt, A.B. (2008) Both ATM and ATR promote the efficient
and accurate processing of programmed meiotic double-strand breaks.
Plant J., 55, 629–638.
Culligan, K.M., Tissier, A. and Britt, A.B. (2004) ATR regulates a G2-phase cell-
cycle checkpoint in Arabidopsis thaliana. Plant Cell, 16, 1091–1104.
Culligan, K.M., Robertson, C.E., Foreman, J., Doerner, P. and Britt, A.B. (2006)
ATR and ATM play both distinct and additive roles in response to ionizing
radiation. Plant J. 48, 947–961.
De Schutter, K., Joubes, J., Cools, T. et al. (2007) Arabidopsis WEE1 kinase
controls cell cycle arrest in response to activation of the DNA integrity
checkpoint. Plant Cell, 19, 211–225.
Friesner, J.D., Liu, B., Culligan, K. and Britt, A.B. (2005) Ionizing radiation-
dependent gamma-H2AX focus formation requires ataxia telangiectasia
Journal compilation ª 2009 Blackwell Publishing Ltd, The Plant Journal, (2009), 60, 518–526
mutated and ataxia telangiectasia mutated and Rad3-related. Mol. Biol.
Cell, 16, 2566–2576.
Garcia, V., Bruchet, H., Camescasse, D., Fabienne, G., Bouchez, D.L. and
Tissier, A. (2003) AtATM is essential for meiosis and the somatic response
to DNA damage in plants. Plant Cell, 15, 119–132.
Heitzeberg, F., Chen, I., Hartung, F., Orel, N., Angelis, K. and Puchta, H. (2004)
The Rad17 homologue of Arabidopsis is involved in the regulation of DNA
damage repair and homologous recombination. Plant J. 38, 954–968.
Kilian, J., Whitehead, D., Horak, J., Wanke, D., Weinl, S., Batistic, O., D’An-
gelo, C., Bornberg-Bauer, E., Kudla, J. and Harter, K. (2007) The AtGenEx-
press global stress expression data set: protocols, evaluation and model
data analysis of UV-B light, drought and cold stress responses. Plant J. 50,
347–363.
Konieczny, A. and Ausubel, F. (1993) A procedure for mapping Arabidopsis
mutations using co-dominant ecotype-specific PCR-based markers. Plant J.
4, 403–410.
Lukowitz, W., Gillmor, C.S. and Scheible, W.R. (2000) Positional cloning in
Arabidopsis. Why it feels good to have a genome initiative working for you.
Plant Physiol. 123, 795–805.
McGowan, C.H. and Russell, P. (2004) The DNA damage response: sensing
and signaling. Curr. Opin. Cell Biol. 16, 629–633.
Mordes, D.A., Glick, G.G., Zhao, R. and Cortez, D. (2008) TopBP1 activates
ATR through ATRIP and a PIKK regulatory domain. Genes Dev. 22, 1478–
1489.
Paciotti, V., Clerici, M., Lucchini, G. and Longhese, M.P. (2000) The checkpoint
protein Ddc2, functionally related to S. pombe Rad26, interacts with Mec1
and is regulated by Mec1-dependent phosphorylation in budding yeast.
Genes Dev. 14, 2046–2059.
Preuss, S.B. and Britt, A.B. (2003) A DNA damage induced cell cycle check-
point in Arabidopsis. Genetics, 164, 323–334.
Sakamoto, A., Lan, V.T.T., Puripunyavanich, V., Hase, Y., Yokota, Y., Shi-
kazono, N., Nakagawa, M., Narumi, I. and Tanaka, A. (2009) A UVB-
hypersensitive mutant in Arabidopsis thaliana is defective in the DNA
damage response. Plant J. doi: 10.1111/j.1365-313X.2009.03974.x.
Schmid, M., Davison, T.S., Henz, S.R., Pape, U.J., Demar, M., Vingron, M.,
Scholkopf, B., Weigel, D. and Lohmann, J.U. (2005) A gene expression map
of Arabidopsis thaliana development. Nat. Genet. 37, 501–506.
Xu, X., Vaithiyalingam, S., Glick, G.G., Mordes, D.A., Chazin, W.J. and
Cortez, D. (2008) The basic cleft of RPA70N binds multiple checkpoint
proteins, including RAD9, to regulate ATR signaling. Mol. Cell. Biol. 28,
7345–7353.
Zou, L. and Elledge, S.J. (2003) Sensing DNA damage through ATRIP recog-
nition of RPA-ssDNA complexes. Science, 300, 1542–1548.
Zou, L., Cortez, D. and Elledge, S.J. (2002) Regulation of ATR substrate
selection by Rad17-dependent loading of Rad9 complexes onto chromatin.
Genes Dev. 16, 198–208.
ª 2009 The Authors