P. D. Bridge, D. K. Arora, C. A. Reddy, R. P. Elander - Applications of PCR in Mycology (1998, CABI) PDF

APPLICATIONS OF PCR IN MYCOLOGY
Applications of PCR in Mycology
Edited by
P.D. Bridge
CABI BIOSCIENCE UK Centre, Egham, UK
D.K. Arora
Centre for Advanced Study in Botany, Banaras Hindu University, India
C.A. Reddy
Department of Microbiology, Michigan State University, East Lansing, USA
R.P. Elander
Technical Operations Biotechnology Development, Bristol-Myers Squibb
Company, New York, USA
CAB INTERNATIONAL
CAB INTERNATIONAL CAB INTERNATIONAL
Wallingford 198 Madison Avenue
Oxon OX10 8DE New York, NY 10016-4314
UK USA
Tel: +44 (0)1491 832111 Tel: +1 212 726 6490

Fax: +44 (0)1491 833508 Fax: +1 212 686 7993
E-mail: cabi@cabi.org E-mail: cabi-nao@cabi.org
© CAB INTERNATIONAL 1998. All rights reserved. No

part of this publication may be reproduced in any form or by
any means, electronically, mechanically, by photocopying,
recording or otherwise, without the prior permission of the
copyright owners.
A catalogue record for this book is available from the British Library, London, UK
Library of Congress Cataloging-in-Publication Data

Applications of PCR in mycology / edited by P.D. Bridge . . . [et al.].
p. cm.
Includes index.
ISBN 0–85199–233–1 (alk. paper)
1. Mycology. 2. Polymerase chain reaction. I. Bridge, P.D.
QK603.A64 1998
579.5––dc21 97–43094
CIP
ISBN 0 85199 233 1
Typeset in 10/12pt Garamond by Solidus (Bristol) Ltd.

Printed and bound in the UK by the University Press, Cambridge.
Contents
Contributors vii
Preface xi
Abbreviations xiii
1. Polymerase Chain Reaction in Mycology: an Overview 1

V. Edel
2. Gene Cloning Using PCR 21

S.P. Goller, M. Gorfer, R.L. Mach and C.P. Kubicek
3. DDRT–PCR for Screening of Fungal Gene Expression 47

E.P. Benito and J.A.L. van Kan
4. Interpretation of PCR Methods for Species Definition 63

P.D. Bridge and D.K. Arora
5. PCR Applications in Studies of Lichen-forming Fungi 85

A. Crespo, O.F. Cubero and M. Grube
6. Applications of PCR for Studying the Biodiversity of

Mycorrhizal Fungi 107
L. Lanfranco, S. Perotto and P. Bonfante
v
vi Contents
7. PCR Applications in Fungal Phylogeny 125

S. Takamatsu
8. PCR Applications to the Taxonomy of Entomopathogenic

Fungi 153
F. Driver and R.J. Milner
9. Application of PCR in Fungal Biotechnology 187

W.V. Burnett, S.-J.D. Chiang, J.D. Basch and R.P. Elander
10. Application of PCR in Studying Lignocellulose Degradation

by Basidiomycetes 205
C.A. Reddy and T.M. D’Souza
11. PCR Methods for the Detection of Mycotoxin-producing Fungi 243

R. Geisen
12. PCR Diagnostics in Medical Mycology 267

T. Hughes, T.R. Rogers and K. Haynes
13. Applications of PCR in Fungal–Plant Interactions 289

E. Ward, A. Tahiri-Alaoui and J.F. Antoniw
14. PCR as a Tool for the Investigation of Seed-borne Disease 309

D.A. Pearce
15. Future Directions for PCR in Mycology 325

S. Sreenivasaprasad and P.R. Mills
Index 347
Contributors
J.F. Antoniw, Crop and Disease Management Department, Institute for

Arable Crops Research, Rothamsted, Harpenden, Herts AL5 2JQ, UK
D.K. Arora, Department of Botany, Banaras Hindu University, Varanasi
221 005, India
J.D. Basch, Technical Operations Biotechnology Development, Bio/Chem
Division, Bristol-Myers Squibb Company, Syracuse, NY 13221-4755,
USA
E.P. Benito, Area de Genética, Departamento de Microbiologı́a y Genética,
Universidad de Salamanca, Edificio Departamental, Avenida del Campo
Charro, S/N 37007, Salamanca, Spain
P. Bonfante, Dipartimento di Biologia Vegetale dell’Università, Viale
Mattioli 25, I-10125 Torino, Italy
P.D. Bridge, CABI BIOSCIENCES UK Centre, Bakeham Lane, Egham, Surrey
TW20 9TY, UK
W.V. Burnett, Technical Operations Biotechnology Development, Bio/Chem
USA
S.-J.D. Chiang, Technical Operations Biotechnology Development, Bio/
Chem Division, Bristol-Myers Squibb Company, Syracuse, NY
13221-4755, USA
A. Crespo, Departamento de Biologı́a Vegetal II, Universidad Complutense
de Madrid, Ciudad Universitaria, 28040 Madrid, Spain
O.F. Cubero, Departamento de Biologı́a Vegetal II, Universidad Complu-
tense de Madrid, Ciudad Universitaria, 28040 Madrid, Spain
T.M. D’Souza, Department of Microbiology and NSF Center for Microbial
Ecology, Department of Microbiology, Michigan State University, East
Lansing, MI 48824-1101, USA
vii
viii Contributors
F. Driver, CSIRO Division of Entomology, GPO Box 1700, Canberra, ACT

2601, Australia
V. Edel, INRA-CMSE, Laboratoire de Recherche sur la Flore Pathogène dans
le Sol, 17 rue Sully-BV1540 21034 Dijon Cedex, France
R.P. Elander, Technical Operations Biotechnology Development, Bio/Chem
USA
R. Geisen, Bundes Forschungsanstalt für Ernährung, Institut für Hygiene
und Toxikologie, Engessertsr. 20, 76131 Karlsruhe, Germany
S.P. Goller, Abteilung für Mikrobielle Biochemie, Institut für Biochemische
Technologie und Mikrobiologie, Technische Universität Wien, Getreide-
markt 9/172.5, A-1060 Wien, Austria
M. Gorfer, Abteilung für Mikrobielle Biochemie, Institut für Biochemische
M. Grube, Institut für Botanik, Karl-Franzens-Universität Graz, 8010 Graz,
Austria
K. Haynes, Department of Infectious Diseases, Imperial College of Science,
Technology and Medicine, Hammersmith Campus, Du Cane Road,
London W12 0NN, UK
T. Hughes, Department of Infectious Diseases, Royal Postgraduate Medical
School, Hammersmith Hospital, Du Cane Road, London W12 0NN,
UK
J.A.L. van Kan, Department of Phytopathology, Wageningen Agricultural
University, POB 8025, 6700 EE Wageningen, The Netherlands
C.P. Kubicek, Abteilung für Mikrobielle Biochemie, Institut für Bio-
chemische Technologie und Mikrobiologie, Technische Universität Wien,
Getreidemarkt 9/172.5, A-1060 Wien, Austria
L. Lanfranco, Dipartimento di Biologia Vegetale dell’Università and Centro
i Studio, sulla Micologia del Terreno del CNR, Viale Mattioli 25, I-10125
Torino, Italy
R.L. Mach, Abteilung für Mikrobielle Biochemie, Institut für Biochemische
P.R. Mills, Department of Plant Pathology and Microbiology, Horticulture
Research International, Wellesbourne, Warwick CV35 9EF, UK
R. Milner, CSIRO Division of Entomology, GPO Box 1700, Canberra, ACT
2601, Australia
D.A. Pearce, Terrestrial and Freshwater Life Science Division, British
Antarctic Survey, High Cross, Madingley Road, Cambridge CB3 0ET,
UK
S. Perotto, Dipartimento di Biologia Vegetale dell’Università and Centro i
Studio, sulla Micologia del Terreno del CNR, Viale Mattioli 25, I-10125
Torino, Italy
C.A. Reddy, Department of Microbiology and NSF Center for Microbial
Contributors ix
Ecology, Michigan State University, East Lansing, MI 48824-1101, USA

T.R. Rogers, Department of Infectious Diseases, Imperial College of Science,
London W12 0NN, UK
S. Sreenivasaprasad, Department of Plant Pathology and Microbiology,
Horticulture Research International, Wellesbourne, Warwick CV35 9EF,
UK
A. Tahiri-Alaoui, Crop and Disease Management Department, Institute for
Arable Crops Research Rothamsted, Harpenden, Herts AL5 2JQ, UK
S. Takamatsu, Laboratory of Plant Pathology, Faculty of Bioresources, Mie
University, Tsu 514, Japan
E. Ward, Crop and Disease Management Department, Institute for Arable
Crops Research Rothamsted, Harpenden, Herts AL5 2JQ, UK
Preface
Since the initial report of specific DNA amplification using the polymerase
chain reaction (PCR) by Kary Mullis and co-workers in 1985, the number of
different applications of the technique has grown exponentially. The tech-
nique is now considered to be indispensible to molecular biology applica-
tions in every field of modern biology. The PCR technique is extremely
sensitive and makes it possible to greatly amplify selected DNA sequences
from very small quantities of template DNA. Its rapid development and
diverse applications have allowed PCR to join other important molecular
biology techniques, such as Southern blotting, gene cloning, pulsed field gel
electrophoresis, etc., and has literally transformed the way that biologists
think about approaching fundamental and applied biological problems.
Indeed, PCR’s capacity to amplify specific segments of DNA represents a
technology that has revolutionized molecular biology.
The purpose of this book is to highlight the many diverse applications
that PCR has in basic and applied mycology. The editors have assembled an
international group of world-renowned mycologists to illustrate the many
application areas of PCR to their specialized fields of applied mycology. It
is our hope that the comprehension of this material by the readers will
enhance their understanding of the technology and help them to gain new
appreciation for the many potential benefits of PCR application.
The text is composed of 15 chapters devoted to PCR principles and
applications in a variety of diverse mycological areas. The opening chapter
presents a brief overview, and the last chapter (Chapter 15) highlights
potential future directions of PCR in mycology. Chapters 2 and 3 cover the
many uses of PCR in fungal gene cloning and fungal gene expression. The
material presented in Chapter 4 is important because it shows the utility of
xi
xii Preface
PCR in explaining fungal speciation in a more definitive manner. Chapters

5–13 demonstrate the diverse application of PCR to studies of lichen
mycobionts (Chapter 5), mycorrhizal fungi (Chapter 6), entomopathogenic
fungi (Chapter 8), mycotoxin-producing fungi (Chapter 11) and its numer-
ous applications in plant–fungal interactions (Chapter 13). Chapter 7
presents an interesting review of the use of PCR amplification in helping to
determine fungal phylogeny more accurately. Chapters 9 and 10 highlight
practical applications of PCR in fungal lignocellulose degradation and its use
in the development of highly productive strains of industrially important
fungi. Chapters 12 and 14 stress the significance of PCR in medical mycology
and in providing a better understanding of the seed-borne disease state.
We are grateful to the many international authorities and specialists in
mycology who have graciously consented to share their perspectives and
expertise on the diverse applications of PCR amplification in their specialized
mycological fields. We are also indebted to Tim Hardwick of CABI
PUBLISHING for his continuing encouragement and guidance.
R.P. Elander
September 1997
Abbreviations
6-APA 6-aminopenicillanic acid

AFLP amplified fragment length polymorphism(s)
AG anastomosis group
AM arbuscular mycorrhizal
AP-PCR arbitrarily primed PCR
BAL bronchoalveolar lavage
BLO bacteria-like organism
bp base pairs
CBH cellobiohydrolases
CDH cellobiose dehydrogenase
cDNA complementary DNA
CTAB cetyl-trimethyl ammonium bromide
DAF DNA amplification fingerprinting
DD differential display
DDRT–PCR differential display reverse transcription PCR
DENS differential extension with nucleotide subsets
DGGE denaturing gradient gel electrophoresis
DMSO dimethylsulphoxide
dNTPs deoxyribonucleotide triphosphates
ds DNA double-stranded DNA
ECM ectomycorrhizal
EIPCR enzymatic inverse PCR
ELISA enzyme-linked immunosorbent assay
ERIC enterobacterial repetitive intergenic consensus
EST expressed sequence tag
GLOX glyoxal oxidase
xiii
xiv Abbreviations
GM galactomannan
GRAS generally recognized as safe
GUS β-glucuronidase
HV highly virulent
IA invasive aspergillosis
IGS intergenic spacer
IPCR inverse PCR
ISG intraspecific group
ITS internal transcribed spacer
LA latex agglutination
LA-PCR long and accurate PCR
LCR ligase chain reaction
LIC ligase-independent cloning
LIP lignin peroxidase
LM-PCR ligation-mediated PCR
LSU large subunit
MNP manganese-dependent peroxidases
mp most parsimonious
mRNA messenger RNA
NASBA nucleic acid sequence-based amplification
PAH polyaromatic hydrocarbon
PCP Pneumocystis carinii pneumonia
PCR polymerase chain reaction
PDI protein disulphide isomerase
PFGE pulsed-field gel electrophoresis
POAc phenoxyacetic acid
PVA penicillin V amidase
QB Q-beta replicase
RACE rapid amplification of cDNA ends
RAMS random amplified microsatellites
RAPD random amplified polymorphic DNA
RDA representational difference analysis
rDNA ribosomal DNA
REP repetitive extragenic palindromic
REP-PCR repetitive-element based PCR
RFLP restriction fragment length polymorphism
RPCR recombination PCR
RT–PCR reverse transcription PCR
SCAR sequence characterized amplified regions
SDA strand displacement amplification
SEAD selective enrichment of amplified DNA
SQPCR semi-quantitative PCR
SSCP single-strand conformation polymorphism
SSR simple sequence repeat
SSU small subunit
Abbreviations xv
STR short tandem repeat

STS sequence-tagged sites
TB tuberculosis
TdT terminal deoxynucleotide transferase
TLC thin-layer chromatography
Tm melting temperature
TNV tobacco necrosis virus
tPA tissue plasminogen activator
TS thymidylate synthase
VNTR variable non-translated repeats
WV weakly virulent
Polymerase Chain Reaction in 1
Mycology: an Overview
V. Edel
INRA-CMSE, Laboratoire de Recherche sur la Flore Pathogène dans
le Sol, 17 rue Sully-BV1540 21034 Dijon Cedex, France
1.1 Overview of PCR Methods
The polymerase chain reaction (PCR) is a powerful method with widespread

applications in molecular biology. This enzymatic reaction allows in vitro
amplification of specific DNA fragments from complex DNA samples and
can generate microgram quantities of target DNA. Any nucleic acid sequence
can be cloned, analysed or modified, and even rare sequences can be detected
by PCR amplification. Since its development in 1985, the specificity,
sensitivity and speed of this technology have led to the development of many
methods for a wide range of biological research areas and for all classes of
organisms. Extensive applications have been found for PCR in many fields
of mycology, including fungal genetics and systematics, ecology and soil
microbiology, plant pathology, medical mycology, fungal biotechnology and
many others. Moreover, it is certain that fungal studies will continue to
progress with PCR, as numerous improvements, modifications and new
applications are regularly reported.
1.2 PCR: the Standard Method
1.2.1 Principles of PCR

The polymerase chain reaction allows the exponential amplification of
specific DNA fragments by in vitro DNA synthesis (Saiki et al., 1985; Mullis
et al., 1986; Mullis and Faloona, 1987). The standard method requires a DNA
template containing the region to be amplified and two oligonucleotide
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology
(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 1
2 V. Edel
primers flanking this target region. The amplification is based on the use of
a thermostable DNA polymerase isolated from Thermus aquaticus, called
Taq polymerase (Saiki et al., 1988). All PCR reaction components are mixed
and the procedure consists of a succession of three steps which are
determined by temperature conditions: template denaturation, primer
annealing and extension (Fig. 1.1). In the first step, the incubation of the
reaction mixture at a high temperature (90–95°C) allows the denaturation of
the double-stranded DNA template. By cooling the mixture to an annealing
temperature which is typically around 55°C, the target-specific oligonucleo-
tide primers anneal to the 5′ end of the two single-stranded templates. For the
extension step, the temperature is raised to 72°C and the primer–target
hybridizations serve as initiation points for the synthesis of new DNA
strands. The time incubation for each step is usually 1–2 min. This sequence
of three steps corresponds to one cycle of PCR. In the second cycle, the
newly synthesized DNA strands are separated from the original strands by
denaturation and each strand serves again as template in the annealing and
extension steps. Theoretically, n cycles of PCR allow a 2n-fold amplification
of the target DNA sequence. Typically, PCR is carried out for 30–40 cycles.
As all components including the thermostable DNA polymerase are present
in the PCR mixture from the beginning of the reaction, the amplification
procedure can be automated and performed in a thermocycler with pro-
grammed heating and cooling.
1.2.2 PCR reaction components and conditions

The template DNA, oligonucleotide primers, DNA polymerase and deoxy-
ribonucleotide triphosphates (dNTPs) are mixed in an appropriate buffer
containing magnesium ions (as MgCl2). The volume of the reaction mixture
generally ranges from 25 to 100 µl. Standard conditions for the concentration
of the different components are given in Table 1.1. These allow amplification
of most target sequences but can be optimized for each new PCR application
(Innis and Gelfand, 1990). As an example, the starting concentration of
MgCl2 is generally 1.5 mM for amplification with Taq DNA polymerase. If
satisfactory PCR results are not obtained, this concentration can be
optimized: a higher MgCl2 concentration will increase the yield of amplified
products but decreases the specificity; a lower MgCl2 concentration increases
the specificity but decreases the yield. Similarly, the temperature and time
conditions for each step of the reaction, especially the annealing step, should
be optimized for each target sequence and primer pair. The annealing
temperature is generally optimized empirically, by increasing the tem-
perature until the best result is obtained in terms of amplification yield and
specificity.
Classical PCR amplifications require minimal sequence information from
which appropriate primers are selected. Primers are generally 18–28 nucleo-
tides in length and are defined according to the DNA sequences flanking the
PCR in Mycology: an Overview 3
Fig. 1.1. Principle of PCR amplification.

4 V. Edel
Table 1.1. Standard conditions for PCR amplification: concentration of the different PCR
components.
Component Concentration
Template DNA 10–100 ng

Amplification buffer 1/10 of final volume (buffer is supplied 10 × concentrated with
the Taq DNA polymerase)
MgCl2 0.5–5 mM (typically 1.5 mM)
dNTPs 20–200 µM each of dATP, dCTP, dGTP and dTTP
Primer 1 0.1–0.5 µM
Primer 2 0.1–0.5 µM
Taq DNA polymerase 0.5–2.5 units
Sterile distilled water To final volume
Final volume 25–100 µl
region to be amplified. Primers are written in the order 5′→3′ (Fig. 1.2). Two
parameters are important for the primer design: the efficiency and the
specificity of amplification. For instance, an important rule is that no
complementarity between 3′ ends of the primers should exist, to avoid
formation of primer-dimers that would decrease the yield of the amplified
product. General concepts for primer design have been described (Dieffenbach
et al., 1993; He et al., 1994; Rychlik, 1995). The specificity of primer matching
can also be improved by adding particular compounds in the reaction mixture
Fig. 1.2. Schematic representation of a target DNA region to be amplified by PCR and
the sequence of the corresponding oligonucleotide primers.
(Filichkin and Gelvin, 1992) or by using particular experimental conditions

such as ‘touchdown’ PCR (Don et al., 1991) or ‘hot start’ PCR (Chou et al.,
1992). In a touchdown PCR, the first cycle is carried out with an annealing
temperature which is higher than the expected annealing temperature (i.e. 10°C
above). This temperature is then decreased by 1°C every PCR cycle until a
‘touchdown’ at the correct annealing temperature is reached: the remaining
cycles are performed at this temperature. In a ‘hot start’ PCR, at least one of the
essential components of the PCR reaction is physically separated from the
amplification mixture by wax during the initial heat denaturation step. The first
heating step melts the wax and allows complete mixing of all the components.
This ‘hot start’ protocol prevents the non-specific binding of primers during
the initial heat denaturation of the template.
The standard PCR uses Taq DNA polymerase but other thermostable
DNA polymerases are available for PCR amplifications. Recombinant DNA
polymerases have also been developed recently. The choice of DNA
polymerase depends on the PCR application and the properties of the
various enzymes (Arnheim and Erlich, 1992). As an example, the native Taq
DNA polymerase lacks a 3′ → 5′ exonuclease (proofreading) activity and
thus produces single base substitution errors at a relatively high rate (Tindall
and Kunkel, 1988). By using other thermostable DNA polymerases which
have this proofreading function, the fidelity of the DNA amplification can
be increased (Cha and Thilly, 1993). Moreover, PCR is classically used to
amplify target DNA sequences less than 4000 bp in length, but PCR
protocols have recently been developed to amplify longer DNA fragments
(Kainz et al., 1992; Cheng et al., 1994).
1.2.3 Practical considerations in PCR experiments

PCR reactions are classically performed in a final volume of 25–100 µl, in
which small volumes of each reagent have to be added. These multiple
pipetting steps increase the possibility of errors and inaccuracy. As multiple
samples are generally amplified using the same conditions, it is recommended
that a mix containing all reagents for all samples except the template be
prepared, and that this mix is then distributed into individual tubes before
finally adding the template DNA.
Because of the ability of the PCR to amplify DNA sequences present at
a small number of copies, contamination of the template DNA mixture with
a foreign source of DNA can result in the amplification of both the target and
the contaminant, especially when non-specific primers are used. The
presence of PCR products and primers from previous amplifications can also
result in carry-over contaminations. In order to detect false-positive amplifi-
cations due to contamination, each PCR experiment must include a negative
control which contains the same mixture of reagents as the other samples but
without template DNA, so that no amplification should occur in the negative
control. PCR experiments should also include a positive control (with a
6 V. Edel
reference template DNA known to amplify) as false-negative amplifications

can also occur because of problems with the thermocycler, the reagents or
inhibition of the DNA polymerase.
Some precautionary measures should be taken to minimize the risk of
contamination in PCR. A first recommendation is to designate a specific area
of the laboratory and a specific set of pipettors for the preparation of PCR
reactions and always to use sterile tubes and pipette tips and wear disposable
gloves. These precautions can be improved by carrying out PCR reactions in
a hood equipped with ultraviolet light and to use UV irradiation of the hood
before handling PCR components. Furthermore, the different reagents used
for PCR can also become contaminated and to avoid this small aliquots of
stock solutions of primers, dNTPs and buffer, and aliquots of sterile water
should be prepared. This will avoid multiple pipetting from the same stock
tube, and allows the use of new aliquots if a problem should arise. Other
specific procedures have also been proposed to minimize contamination of
reactions, such as the use of dUTP instead of dTTP and uracil DNA
glycosylase (Longo et al., 1990) or gamma-irradiation (Deragon et al., 1990).
1.2.4 Analysis of PCR products

In many applications, PCR products need only to be visualized. They are
separated electrophoretically according to their size on agarose gels, or
polyacrylamide gels if higher resolution is required, and visualized by
ethidium bromide or silver staining. More sensitive detection of the PCR
products can be achieved by hybridization with a specific probe or by
labelling the product either after amplification or directly during PCR using
labelled dNTPs or primers (Lo et al., 1990; Höltke et al., 1995; Inazuka et al.,
1996). Other approaches such as the use of capillary electrophoresis allow
product analysis to be automated (Martin et al., 1993). Capillary electropho-
resis provides a size-selective separation of DNA fragments and results can
be displayed as an electrophoregram. The addition of a standard size ladder
of known concentration to the DNA sample to be analysed allows the
determination of both the size and the quantity of the PCR products.
Once identified, target DNA generated by PCR amplification can be
further characterized by various genetic analyses. Several strategies have been
developed for the direct sequencing of PCR-amplified DNA fragments
(Bevan et al., 1992; Rao, 1994). Instead of sequencing, denaturing gradient gel
electrophoresis (DGGE) can be used for direct analysis of amplified DNA.
This technique is especially useful for the detection of mutations in a target
sequence since it permits the separation of DNA products of the same length
but with different nucleotide sequences and can be used to distinguish single-
base substitutions (Fisher and Lerman, 1983; Sheffield et al., 1989). Similarly,
single-strand conformation polymorphism (SSCP) analysis (Orita et al.,
1989; Fujita and Silver, 1994) is a powerful electrophoretic method for
detecting sequence variations and point mutations in amplified products. In
contrast to DGGE, SSCP analysis is performed in a polyacrylamide gel

under non-denaturing conditions but DNA samples are denatured prior to
electrophoresis. Variation in PCR products can be shown by restriction
endonuclease digestion. The PCR products obtained from different strains
can be digested with several enzymes and their resulting digests separated by
electrophoresis. If sequence differences are located within restriction sites for
particular enzymes, the digestion of the PCR products with those enzymes
will lead to different electrophoretic patterns. This strategy of PCR–
restriction fragment length polymorphism (RFLP) is suitable for screening
large samples and is commonly used in taxonomic and ecological studies.
1.3 PCR-derived Methods
Since the first description of the PCR, several modifications of the original
procedure have been developed. The sensitivity and specificity of the amplifi-
cation have been improved by simple modifications of the standard procedure
such as ‘nested PCR’, in which the PCR product is subjected to a second round
of amplification with a second pair of oligonucleotide primers located
internally to the first pair (Dieffenbach et al., 1993). ‘Quantitative PCR’
methods allow the estimation of the number of target DNA sequences,
generally by competitive PCR with an internal standard (Cross, 1995). Further
developments which are more than simple variations of the original procedure
include modifications of the type of template (RNA instead of DNA) or the
type of primers (randomly chosen instead of target-specific primers), and these
have led to new methods which have increased considerably the range of
applications of PCR technology. Finally, the recent development of in situ PCR
methods is promising for both diagnosis and genetic analysis.
1.3.1 Reverse transcription–PCR (RT–PCR)

PCR has been adapted to amplify RNA sequences such as mRNA and viral
RNA by RT–PCR. Originally, the procedure was based on the reverse
transcription (RT) of the RNA into cDNA by a reverse transcriptase prior
to amplification by Taq polymerase and standard reaction conditions were
described by Kawasaki (1990). Direct RNA amplification with a single
enzyme is also possible by using a particular polymerase (Tth) from Thermus
thermophilus (Myers and Gelfand, 1991). This polymerase has a reverse
transcriptase activity in the presence of manganese ions and a DNA
polymerase activity in the presence of magnesium ions.
RT–PCR is a highly sensitive method that allows the detection and the
analysis of very small amounts of specific RNAs such as previously
undetectable rare transcripts (Ohan and Heikkila, 1993). Moreover, quantita-
tive RT–PCR approaches have been developed for measuring gene expres-
sion (Gilliland et al., 1990; Riedy et al., 1995; Gibson et al., 1996).
8 V. Edel
1.3.2 Random PCR and other PCR fingerprinting methods
In contrast to ‘classical’ PCR, random PCR approaches do not require any

nucleotide sequence information for primer design and allow amplification
of DNA fragments which are of undefined length and sequence. Among
these approaches, random amplified polymorphic DNA (RAPD) analysis
(Williams et al., 1990) was first developed to detect polymorphisms between
organisms despite the absence of sequence information, and to produce
genetic markers and to construct genetic maps. This method has also been
called arbitrarily primed PCR (AP-PCR) (Welsh and McClelland, 1990) and
DNA amplification fingerprinting (DAF) (Caetano-Anollés et al., 1991).
The method is based on the PCR amplification of genomic DNA with a
single short primer with an arbitrary nucleotide sequence. The PCR is carried
out with a low annealing temperature and generates several PCR products
which produce a band pattern after electrophoretic separation.
Because RAPD assays are generally performed under low stringency
conditions (i.e., low annealing temperatures) with non-specific primers, they
are more sensitive than conventional PCR assays to reaction and thermocycle
conditions and thus the concentration of all components in the reaction
mixture must be accurately standardized. Moreover, the quality of template
DNA and the brand of Taq DNA polymerase and thermocycler used are
also factors that can affect the reproducibility of RAPD results (MacPherson
et al., 1993; Tommerup et al., 1995).
Another random PCR approach that has recently been developed for
DNA fingerprinting and genetic mapping is the amplified fragment length
polymorphism (AFLP) technique (Vos et al., 1995). This procedure allows
high stringency PCR amplification of DNA fragments randomly chosen
from restriction fragments. In this technology, genomic DNA is first
digested with a restriction endonuclease and oligonucleotide adaptors are
ligated to the ends of the restriction fragments. Then, a PCR amplification is
performed using primers which include the adaptor sequence, the part of the
restriction site sequence remaining on the fragment, and between one and
five additional nucleotides which are randomly chosen. This step allows
selective amplification of the restriction fragments in which the nucleotides
flanking the restriction site match the additional nucleotides of the primers.
The amplified fragments are analysed by denaturing polyacrylamide gel
electrophoresis to generate the fingerprint. The AFLP technique has two
main advantages: it is similar to RAPD in that it analyses the whole genome
but it differs from RAPD in that it uses stringent PCR conditions and
produces results that are very reproducible. AFLP also has high resolution
and the complexity of the AFLP fingerprint can be planned since the number
of resulting fragments depends on the choice of restriction enzyme and the
number of additional selective nucleotides in the primers.
Other PCR-based methods are intermediate between random PCR
approaches and target-directed amplifications. Indeed, in RAPD analysis,
arbitrary primers which are used generally match repeated elements in the
DNA since a multiple banding pattern is expected in the resulting PCR
fingerprint. PCR fingerprinting methods can also be based on the amplifica-
tion with primers defined according to known repeated elements (Meyer et
al., 1993a; van Belkum, 1994) and this strategy is also termed interrepeat
PCR. Primers can be directed against microsatellites or minisatellites, which
are tandemly repeated motifs of 2–10 bp, or 15–30 bp, respectively (Meyer et
al., 1993b), or against other eukaryotic or prokaryotic repeated motifs (van
Belkum et al., 1993). For instance, PCR primers corresponding to entero-
bacterial repetitive intergenic consensus (ERIC) sequences and repetitive
extragenic palindromic (REP) elements (Versalovic et al., 1991) can be used
to fingerprint the genome of microorganisms. PCR fingerprinting methods
are now widely used to characterize genetic variations within almost any
type of organism including fungi.
1.3.3 In situ PCR

Biological diagnostics have been greatly advanced by both PCR and in situ
hybridization. While the main advantage of PCR is its high sensitivity, in situ
hybridization allows the detection and cytological localization of nucleic
acid sequences in whole cells. In situ PCR, resulting from the combination
of PCR and in situ hybridization, is a powerful method for the identification
and localization of rare DNA sequences or RNA sequences (after RT–PCR)
in whole cells or tissue samples. In situ PCR methods include the following
steps: sample fixation, sample permeabilization to allow penetration of PCR
reagents, in situ amplification, and visualization of the PCR products by in
situ hybridization. Alternatively, PCR products can be visualized directly
when labelled nucleotides are incorporated during the amplification step;
however, the reaction is generally less reliable and less specific by direct in
situ PCR than indirect in situ PCR with hybridization (Long et al., 1993).
Protocols for PCR – in situ hybridization and RT – in situ PCR have recently
been reviewed by Nuovo (1994). In situ PCR has numerous applications in
the identification and localization of specific DNA and RNA sequences in
intact cells, disease diagnosis and quantification, and in the analysis of
infection process and gene expression. Until now, most in situ PCR assays
developed have been concerned with the detection of viral sequences in
infected cells.
1.4 PCR Alternatives
In the last few years, many other methods for nucleic acid amplification have
been developed, such as the ligase chain reaction (LCR), nucleic acid
sequence-based amplification (NASBA), Q-beta replicase (Qβ) amplifica-
tion, or strand displacement amplification (SDA). Further details of these
10 V. Edel
procedures can be found in Winn-Deen (1996). These can be used instead of

or in combination with PCR, and were generally developed for diagnostic
purposes. For instance, LCR (Barany, 1991; Wiedmann et al., 1994) is a DNA
amplification system which involves the use of four oligonucleotide primers
and a thermostable DNA ligase. This method, often combined with PCR, is
a powerful method for the detection of genetic diseases resulting from
mutations since it allows the discrimination of DNA sequences differing in
only a single base pair. The NASBA system (Kievits et al., 1991), was
developed for the detection and amplification of RNA, and requires two
primers and three different enzymes (reverse transcriptase, T7 RNA poly-
merase and RNase H). Unlike PCR, no thermocycler is needed since the
NASBA reaction is performed at a constant temperature. Thus, NASBA is
particularly suitable for diagnostic procedures which involve the analysis of
large numbers of samples in a short time; it has already been applied to the
detection of various viral infections.
1.5 Applications of PCR in Mycology
1.5.1 Starting PCR with fungi

The first stage in PCR is the preparation of the template DNA. Several
protocols for the extraction of nucleic acids from fungi are available. Some
of these allow the isolation of microgram quantities of pure genomic DNA
(Garber and Yoder, 1983; Raeder and Broda, 1985; Rogers and Bendich,
1988) which is suitable for restriction enzyme analysis and other molecular
applications. However, because only small quantities of starting DNA are
required for PCR amplification, simplified and rapid procedures can
generally be used (Lee and Taylor, 1990; Cenis, 1992; Steiner et al., 1995).
DNA can also be extracted from complex environmental samples such as
soils and plants (Porteous et al., 1994; Volossiouk et al., 1995; Zhou et al.,
1996) or clinical samples (Makimura et al., 1994; De Barbeyrac et al., 1996),
allowing direct amplification of fungal DNA from the mixed DNA extracts
by the use of specific primers. These techniques are particularly useful for
ecological studies and for the detection of fungi in various samples without
preliminary isolation.
1.5.2 Taxonomy and characterization of fungi with PCR

One of the first applications of PCR in mycology was described in 1990 by
White et al. and concerned the amplification and direct sequencing of
ribosomal DNA (rDNA) to establish the taxonomic and phylogenetic
relationships of fungi. rDNA sequences are often used for taxonomic and
phylogenetic studies because they are found universally in living cells in
which they have an important function; thus, their evolution might reflect
the evolution of the whole genome. These sequences also contain both
variable and conserved regions, allowing the comparison and discrimination

of organisms at different taxonomic levels. The nuclear rDNA in fungi is
organized as an rDNA unit which is tandemly repeated. One unit includes
three rRNA genes: the small nuclear (18S-like) rRNA, the 5.8S rRNA, and
the large (28S-like) rRNA genes. In one unit, the genes are separated by two
internal transcribed spacers (ITS1 and ITS2) and two rDNA units are
separated by the intergenic spacer (IGS). The last rRNA gene (5S) may or
may not be within the repeated unit, depending on the fungal taxa. The 18S
rDNA evolves relatively slowly and is useful for comparing distantly related
organisms whereas the non-coding regions (ITS and IGS) evolve faster and
are useful for comparing fungal species within a genus or strains within a
species. Some regions of the 28S rDNA are also variable between species.
The development of PCR and the design of primers for the amplification
of the various rDNA regions has considerably facilitated taxonomic studies
of fungi (White et al., 1990). These primers were designed from conserved
regions, allowing the amplification of the fragment they flank in most fungi.
The ITS primers designed by White et al. (1990) have enabled the
determination of many ITS sequences from different fungi and these have
been used to investigate taxonomic and phylogenetic relationships between
species within different genera, such as Colletotrichum (Sreenivasaprasad et
al., 1996a), Phytophthora (Lee and Taylor, 1992) and Penicillium (Lobuglio
et al., 1993). ITS sequences are generally constant, or show little variation
within species but vary between species in a genus, and so these sequences
have been widely used to develop rapid procedures for the identification of
fungal species by PCR–RFLP analysis (Vilgalys and Hester, 1990; Chen,
1992; Edel et al., 1997), and to design species-specific primers (Moukhame-
dov et al., 1994; Beck and Ligon, 1995; Sreenivasaprasad et al., 1996b). At the
intraspecific level, differentiation of closely related fungal strains can be
achieved by comparing more variable DNA regions such as the ribosomal
IGS sequences, for which PCR primers have also been designed (Anderson
and Stasovski, 1992; Henrion et al., 1992; Edel et al., 1995). Mitochondrial
rDNA can also be easily analysed among fungi after amplification with
consensus primers (White et al., 1990).
Random PCR approaches are being increasingly used to generate
molecular markers which are useful for taxonomy and for characterizing
fungal populations. The main advantage of these approaches is that previous
knowledge of DNA sequences is not required, so that any random primer
can be tested to amplify any fungal DNA. RAPD primers are chosen
empirically and tested experimentally to find RAPD banding patterns which
are polymorphic between the taxa studied. The RAPD method has been
successfully used to differentiate and identify fungi at the intraspecific level
(Guthrie et al., 1992; Assigbetse et al., 1994; Nicholson and Rezanoor, 1994)
and the interspecific level (Lehmann et al., 1992). Similarly, PCR fingerprint-
ing with primers that detect hypervariable and repeated sequences has been
used to clarify the taxonomic relationships among both fungal strains and
12 V. Edel
species (Meyer et al., 1993b; van Belkum et al., 1993). As both RAPD and
interrepeat PCR amplify DNA from non-specific primers, they need a pure
DNA template and cannot be used to detect fungi in mixed samples. More
recently, AFLP fingerprinting has been developed to evaluate polymorph-
isms among various organisms, and this has already been applied to the
detection of inter- and intraspecific genetic variation in fungi (Majer et al.,
1996; Mueller et al., 1996). AFLP has several advantages over RAPD in terms
of reproducibility and the level of resolution per reaction, and the method
has great potential for revealing variations among many fungi, especially at
the intraspecific level.
1.5.3 PCR in the detection of fungi

Because of its specificity and sensitivity, PCR is an attractive method for the
detection of fungi. There are already many examples of PCR-based assays
developed for the detection of fungi in both medical and plant pathology.
PCR can be used to detect groups of strains, pathotypes, species or higher
taxa, provided that specific oligonucleotide primers for these taxa are
available. Thus, the development of PCR-based detection procedures
requires knowledge of sequences of at least a part of the target DNA region
in order to design specific primers. The principle of these methods is the
alignment of the sequences from target and non-target organisms and the
selection of primers with mismatches to the non-target organisms but
sufficient homology for efficient priming and amplification of all target
organisms (Dieffenbach et al., 1993).
DNA sequences which are polymorphic between fungal species, such as
ITSs, are good candidates for the detection of a species to the exclusion of all
other species. For example, differences in ITS sequences have been used to
develop PCR-based assays for the detection of many phytopathogenic fungal
species in host plants without previous isolation of the fungi (Moukhamedov
et al., 1994; Beck and Ligon, 1995; Goodwin et al., 1995; Sreenivasaprasad et
al., 1996b). Other sequences of rDNA have been used to design specific
primers, such as 18S rDNA (Di Bonito et al., 1995), 28S rDNA (Fell, 1995)
and mitochondrial rDNA (Li et al., 1994). rDNA sequences have also been
used to develop PCR assays for the detection of fungal species in clinical
samples (Spreadbury et al., 1993; Holmes et al., 1994). As rDNA sequences
are present in high copy number in the fungal genome, their use generally
increases the sensitivity of a detection assay. Sequences unique to the target
organisms can be found by other approaches. Specific primers can be
designed from cloned genomic DNA fragments (Ersek et al., 1994; Doss and
Welty, 1995) or from PCR-amplified specific fragments. Indeed, taxon-
specific markers generated by RAPD or other PCR-fingerprinting methods
can be cloned and sequenced, and these sequence-characterized amplified
regions (SCARs) used to design specific primers for detection assays. An
example of this is the detection of Fusarium species with primers designed
from species-specific SCARs derived from RAPDs (Parry and Nicholson,

1996; Schilling et al., 1996). Finally, taxon-specific fragments generated by
PCR fingerprinting or PCR products with specific sequences can be used as
specific probes in diagnostic assays based on dot-blot hybridizations
(Klassen et al., 1996).
PCR amplification methods with specific fungal primers are powerful
tools not only in diagnostics but also in ecological studies for monitoring
fungi in natural environments, such as water, soil, plant or clinical samples.
Furthermore, the development of specific primers has greatly facilitated
studies on obligate parasites and symbionts. For example, specific amplifica-
tion of mycorrhizal fungal DNA can be performed from colonized plant
roots (Di Bonito et al., 1995).
1.5.4 Genetic analysis and gene manipulations with PCR

The development of PCR methods has greatly facilitated genetic studies in all
organisms. Many PCR-based methods are suitable for the analysis of genetic
variants and to identify genetic markers. Sequence variation can be identified
by analysis of a PCR product using RFLP, DGGE or SSCP, or direct
sequencing and random PCR approaches. The detection of gene mutations
such as deletions, insertions and even single-base substitutions can be achieved
with the development of highly discriminatory methods for analysing and
comparing PCR products. Polymorphisms detected by PCR and especially by
RAPD are also useful for the construction of genetic maps and for genetic
linkage analysis (Erlich and Arnheim, 1992; Tingey and del Tufo, 1993).
Cloning procedures, and thus gene isolation and manipulations, have
also made use of the ability of PCR to produce large amounts of specific
DNA fragments from a complex DNA mixture. Cloning of PCR products
can be performed by using PCR primers that include restriction sites, which
simplify the subsequent insertion and ligation of the cloned DNA fragment
into the vector. Efficient protocols for cloning and analysis of blunt-ended
PCR products have also been described (Costa and Weiner, 1994). Cloning
strategies for genes encoding known proteins can be developed despite the
absence of nucleotide sequence information normally required to design
oligonucleotide primers, by using a mixture of degenerate primers consistent
with the amino acid sequence (Compton, 1990). Degenerate primers may
also be designed on the basis of nucleotide sequence alignment. Furthermore,
inverse PCR approaches allow the isolation of DNA fragments which are
adjacent to a known sequence (Silver, 1991). PCR strategies also allow in
vitro gene construction and have greatly simplified site-directed mutagenesis
(Weiner and Costa, 1994). For instance, PCR can be performed with
oligonucleotide primers that allow both amplification and introduction of a
mutation in the target sequence. This mutation may be an addition, a deletion
or a substitution of nucleotides. The method is powerful enough for the
study of relationships between the structure of a gene and its function.
14 V. Edel
Analysis of gene expression, and detection and quantification of RNA

transcripts can be accomplished by PCR. More recently, differential display
(DD) or DDRT–PCR (DD reverse transcription PCR) (Liang and Pardee,
1992) has been developed for genetic analyses. This technique allows the
identification of differentially expressed mRNAs and the cloning and
characterization of their genes, thus permitting the analysis of alteration of
gene expression and the identification of genes that play important roles in
biological and pathological processes (Liang et al., 1993; Goormachtig et al.,
1995; Benito et al., 1996).
1.6 Conclusions
PCR procedures, from the standard method to its modifications and

improvements, have greatly simplified DNA technologies. PCR-based
methods offer so many possibilities that they are now used in almost all areas
of life sciences. In mycology, many applications have already been described
in taxonomy, phylogeny, population studies and diagnostics, and some
examples have been reported in this chapter. However, PCR applications are
being developed in many other fungal studies, including genetic analyses,
biotechnology and the analysis of fungal–host interactions in both medical
and plant pathology. The following chapters provide current reviews of
many research applications of PCR in all these areas of mycology.
References
Anderson, J.B. and Stasovski, E. (1992) Molecular phylogeny of northern hemisphere

species of Armillaria. Mycologia 84, 505–516.
Arnheim, N. and Erlich, H. (1992) Polymerase chain reaction strategy. Annual
Review of Biochemistry 61, 131–156.
Assigbetse, K.B., Fernandez, D., Dubois, M.P. and Geiger, J.-P. (1994) Differentiation
of Fusarium oxysporum f. sp. vasinfectum races on cotton by random amplified
polymorphic DNA (RAPD) analysis. Phytopathology 84, 622–626.
Barany, F. (1991) The ligase chain reaction in a PCR world. PCR Methods and
Applications 1, 5–16.
Beck, J.J. and Ligon, J.M. (1995) Polymerase chain reaction assays for the detection
of Stagonospora nodorum and Septoria tritici in wheat. Phytopathology 85,
319–324.
Benito, E.P., Prins, T. and Vankan, J.A.L. (1996) Application of differential display
RT–PCR to the analysis of gene expression in a plant–fungus interaction. Plant
Molecular Biology 32, 947–957.
Bevan, I.S., Rapley, R. and Walker, M.R. (1992) Sequencing of PCR-amplified DNA.
PCR Methods and Applications 1, 222–228.
Caetano-Anollés, G., Bassam, B.J. and Gresshoff, P.M. (1991) DNA amplification
fingerprinting using very short arbitrary oligonucleotide primers. Biotechnology
9, 553–557.
Cenis, J.L. (1992) Rapid extraction of fungal DNA for PCR amplification. Nucleic
Acids Research 20, 2380.
Cha, R.S. and Thilly, W.G. (1993) Specificity, efficiency, and fidelity of PCR. PCR
Methods and Applications 3, S18–S29.
Chen, W. (1992) Restriction fragment length polymorphisms in enzymatically
amplified ribosomal DNAs of three heterothallic Pythium species. Phytopathol-
ogy 82, 1467–1472.
Cheng, S., Chang, S.-Y., Gravitt, P. and Respess, R. (1994) Long PCR. Nature 369,
684–685.
Chou, Q., Russell, M., Birch, D.E., Raymond, J. and Bloch, W. (1992) Prevention of
pre-PCR mis-priming and primer dimerization improves low-copy-number
amplifications. Nucleic Acids Research 20, 1717–1723.
Compton, T. (1990) Degenerate primers for DNA amplification. In: Innis, M.A.,
Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols. A Guide to
Methods and Applications. Academic Press, San Diego, pp. 39–45.
Costa, G.L. and Weiner, M.P. (1994) Protocols for cloning and analysis of blunt-
ended PCR-generated DNA fragments. PCR Methods and Applications 3,
S95–S106.
Cross, N.C.P. (1995) Quantitative PCR techniques and applications. British Journal
of Haematology 89, 693–697.
De Barbeyrac, B., Bébéar, C. and Taylor-Robinson, D. (1996) PCR: preparation of
DNA from clinical specimens. Molecular and Diagnostic Procedures in Myco-
plasmology II, 61–64.
Deragon, J.-M., Sinnett, D., Mitchell, G., Potier, M. and Labuda, D. (1990) Use of γ
irradiation to eliminate DNA contamination for PCR. Nucleic Acids Research
18, 6149.
Di Bonito, R., Elliott, M.L. and Desjardin, E.A. (1995) Detection of an arbuscular
mycorrhizal fungus in roots of different plant species with the PCR. Applied and
Environmental Microbiology 61, 2809–2810.
Dieffenbach, C.W., Lowe, T.M.J. and Dveksler, G.S. (1993) General concepts for PCR
primer design. PCR Methods and Applications 3, S30–S37.
Don, R.H., Cox, P.T., Wainwright, B.J., Baker, K. and Mattick, J.S. (1991) ‘Touch-
down’ PCR to circumvent spurious priming during gene amplification. Nucleic
Doss, R.P. and Welty, R.E. (1995) A polymerase chain reaction-based procedure for
detection of Acremonium coenophialum in tall fescue. Phytopathology 85,
913–917.
Edel, V., Steinberg, C., Avelange, I., Laguerre, G. and Alabouvette, C. (1995)
Comparison of three molecular methods for the characterization of Fusarium
oxysporum strains. Phytopathology 85, 579–585.
Edel, V., Steinberg, C., Gautheron, N, and Alabouvette, C. (1997) Evaluation of
restriction analysis of polymerase chain reaction (PCR)-amplified ribosomal
DNA for the identification of Fusarium species. Mycological Research 101,
179–187.
Erlich, H.A. and Arnheim, N. (1992) Genetic analysis using the polymerase chain
reaction. Annual Review of Genetics 26, 479–506.
Ersek, T., Schoelz, J.E. and English, J.T. (1994) PCR amplification of species-specific
DNA sequences can distinguish among Phytophthora species. Applied and
16 V. Edel
Fell, J.W. (1995) rDNA targeted oligonucleotide primers for the identification of
pathogenic yeasts in a polymerase chain reaction. Journal of Industrial Micro-
biology 14, 475–477.
Filichkin, S.A. and Gelvin, S.B. (1992) Effect of dimethyl sulfoxide concentration on
specificity of primer matching in PCR. BioTechniques 12, 828–830.
Fisher, S.G. and Lerman, L.S. (1983) DNA fragments differing by single base-pair
substitutions are separated in denaturing gradient gels: correspondence with
melting theory. Proceedings of the National Academy of Sciences USA 80,
1579–1583.
Fujita, K. and Silver, J. (1994) Single-strand conformational polymorphism. PCR
Garber, R.C. and Yoder, O.C. (1983) Isolation of DNA from filamentous fungi and
separation into nuclear, mitochondrial, ribosomal, and plasmid components.
Analytical Biochemistry 135, 416–422.
Gibson, U.E.M., Heid, C.A. and Williams, P.M. (1996) A novel method for real time
quantitative RT–PCR. Genome Research 6, 995–1001.
Gilliland, G., Perrin, S. and Bunn, H.F. (1990) Competitive PCR for quantitation of
mRNA. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR
Protocols. A Guide to Methods and Applications. Academic Press, San Diego,
pp. 60–69.
Goodwin, P.H., Hsiang, T., Xue, B.G. and Liu, H.W. (1995) Differentiation of
Gaeumannomyces graminis from other turf-grass fungi by amplification with
primers from ribosomal internal transcribed spacers. Plant Pathology 44,
384–391.
Goormachtig, S., Valerio-Lepiniec, M., Szczyglowski, K., Van Montagu, M., Hol-
sters, M. and de Bruijn, F.J. (1995). Use of differential display to identify novel
Sesbania rostrata genes enhanced by Azorhizobium caulinodans infection.
Molecular Plant–Microbe Interactions 8, 816–824.
Guthrie, P.A.I., Magill, C.W., Frederiksen, R.A. and Odvody, G.N. (1992) Random
amplified polymorphic DNA markers: a system for identifying and differ-
entiating isolates of Colletotrichum graminicola. Phytopathology 82, 832–835.
He, Q., Marjamäki, M., Soini, H., Mertsola, J. and Viljanen, M.K. (1994) Primers are
decisive for sensitivity of PCR. BioTechniques 17, 82–86.
Henrion, B., Le Tacon, F. and Martin, F. (1992) Rapid identification of genetic
variation of ectomycorrhizal fungi by amplification of ribosomal RNA genes.
New Phytologist 122, 289–298.
Holmes, A.R., Cannon, R.D., Shepherd, M.G. and Jenkinson, H.F. (1994) Detection
of Candida albicans and other yeasts in blood by PCR. Journal of Clinical
Microbiology 32, 228–231.
Höltke, H.J., Ankenbauer, W., Mühlegger, K., Rein, R., Sagner, G., Seibl, R. and Walter,
T. (1995) The digoxigenin (Dig) system for non-radioactive labelling and detection
of nucleic acids – an overview. Cellular and Molecular Biology 41, 883–905.
Inazuka, M., Tahira, T. and Hayashi, K. (1996) One-tube post-PCR fluorescent
labelling of DNA fragments. Genome Research 6, 551–557.
Innis, M.A. and Gelfand, D.H. (1990) Optimization of PCR. In: Innis, M.A.,
Kainz, P., Schmiedlechner, A. and Strack, H.B. (1992) In vitro amplification of DNA
fragments > 10 kb. Analytical Biochemistry 202, 46–49.
Kawasaki, E.S. (1990) Amplification of RNA. In: Innis, M.A., Gelfand, D.H.,
Sninsky, J.J. and White, T.J. (eds) PCR Protocols. A Guide to Methods and
Applications. Academic Press, San Diego, pp. 21–27.
Kievits, T., van Gemen, B., van Strijp, D., Schukkink, R., Dircks, M., Adriaanse, H.,
Malek, L., Sooknanan, R. and Lens, P. (1991) NASBATM isothermal enzymatic
in vitro nucleic acid amplification optimized for the diagnosis of HIV-1
infection. Journal of Virological Methods 35, 273–286.
Klassen, G.R., Balcerzak, M. and de Cock, A.W.A.M. (1996) 5S ribosomal RNA gene
spacers as species-specific probes for eight species of Pythium. Phytopathology
86, 581–587.
Lee, S.B. and Taylor, J.W. (1990) Isolation of DNA from fungal mycelia and single
spores. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR
pp. 282–287.
Lee, S.B. and Taylor, J.W. (1992) Phylogeny of five fungus-like protoctistan
Phytophthora species, inferred from the internal transcribed spacers of ribosomal
DNA. Molecular Biology and Evolution 9, 636–653.
Lehman, P.F., Lin, D. and Lasker, B.A. (1992) Genotypic identification and
characterization of species and strains within the genus Candida by using
random amplified polymorphic DNA. Journal of Clinical Microbiology 30,
3249–3254.
Li, K.-N., Rouse, D.I. and German, T.L. (1994) PCR primers that allow intergeneric
differentiation of ascomycetes and their application to Verticillium spp. Applied
and Environmental Microbiology 60, 4324–4331.
Liang, P. and Pardee, A.B. (1992) Differential display of eukaryotic messenger RNA
by means of the polymerase chain reaction. Science 257, 967–971.
Liang, P., Averboukh, L. and Pardee, A.B. (1993) Distribution and cloning of
eukaryotic mRNAs by means of differential display: refinements and optimiza-
tion. Nucleic Acids Research 21, 3269–3275.
Lo, Y.-M.D., Mehal, W.Z. and Fleming, K.A. (1990) Incorporation of biotinylated
dUTP. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR
pp. 113–118.
Lobuglio, K.F., Pitt, J.I. and Taylor, J.W. (1993) Phylogenetic analysis of two
ribosomal DNA regions indicates multiple independent losses of a sexual
Talaromyces state among asexual Penicillium species in subgenus Biverticillium.
Mycologia 85, 592–604.
Long, A.A., Komminoth, P., Lee, E. and Wolfe, H.F. (1993) Comparison of indirect
and direct in-situ polymerase chain reaction in cell preparations and tissue
sections. Detection of viral DNA, gene rearrangements and chromosomal
translocations. Histochemistry 99, 151–162.
Longo, M.C., Berninger, M.S. and Hartley, J.L. (1990) Use of uracil DNA glycosylase
to control carry-over contamination in polymerase chain reactions. Gene 93,
125–128.
MacPherson, J.M., Eckstein, P.E., Scoles, G.J. and Gajadhar, A.A. (1993) Variability
of the randon amplified polymorphic DNA assay among thermal cyclers, and
effects of primer and DNA concentration. Molecular and Cellular Probes 7,
293–299.
Majer, D., Mithen, R., Lewis, B.G., Vos, P. and Oliver, R.P. (1996) The use of AFLP
18 V. Edel
fingerprinting for the detection of genetic variation in fungi. Mycological

Research 100, 1107–1111.
Makimura, K., Murayama, S.Y. and Yamaguchi, H. (1994) Detection of a wide range
of medically important fungi by the polymerase chain reaction. Journal of
Medical Microbiology 40, 358–364.
Martin, F., Vairelles, D. and Henrion, B. (1993) Automated ribosomal DNA
fingerprinting by capillary electrophoresis of PCR products. Analytical Bio-
chemistry 213, 30–37.
Meyer, W., Lieckfeldt, E., Kuhls, K., Freedman, E.Z., Börner, T. and Mitchell, T.G.
(1993a) DNA- and PCR-fingerprinting in fungi. In: Pena, S.D.J., Chakraborty,
R., Epplen, J.T. and Jeffreys, A.J. (eds) DNA Fingerprinting: State of the Science.
Birkhäuser Verlag, Basel, pp. 311–320.
Meyer, W., Mitchell, T.G., Freedman, E.Z. and Vilgalys, R. (1993b) Hybridization
probes for conventional DNA fingerprinting used as single primers in the
polymerase chain reaction to distinguish strains of Cryptococcus neoformans.
Journal of Clinical Microbiology 31, 2274–2280.
Moukhamedov, R., Hu, X., Nazar, R.N. and Robb, J. (1994) Use of polymerase chain
reaction-amplified ribosomal intergenic sequences for the diagnosis of Verti-
cillium tricorpus. Phytopathology 84, 256–259.
Mueller, U.G., Lipari, S.E. and Milgroom, M.G. (1996) Amplified fragment length
polymorphism (AFLP) fingerprinting of symbiotic fungi cultured by the
fungus-growing ant Cyphomyrmex minutus. Molecular Ecology 5, 119–122.
Mullis, K.B. and Faloona, F.A. (1987) Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction. Methods in Enzymology 155, 335–350.
Mullis, K.B., Faloona, F.A., Scharf, S.J., Saiki, R.K., Horn, G.T. and Erlich, H.A.
(1986) Specific enzymatic amplification of DNA in vitro: the polymerase chain
reaction. Cold Spring Harbor Symposia on Quantitative Biology 51, 263–273.
Myers, T.W. and Gelfand, D.H. (1991) Reverse transcription and DNA amplification
by a Thermus thermophilus DNA polymerase. Biochemistry 30, 7661–7666.
Nicholson, P. and Rezanoor, H.N. (1994) The use of random amplified polymorphic
DNA to identify pathotype and detect variation in Pseudocercosporella herpo-
trichoides. Mycological Research 98, 13–21.
Nuovo, G.J. (1994) PCR in situ Hybridization. Protocols and Applications, 2nd edn.
Raven Press, New York.
Ohan, N.W. and Heikkila, J.J. (1993) Reverse transcription–polymerase chain
reaction: an overview of the technique and its applications. Biotechnology
Advances 11, 13–29.
Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K. and Sekiya, T. (1989) Detection
of polymorphisms of human DNA by gel electrophoresis as single-strand
conformation polymorphisms. Proceedings of the National Academy of Sciences
USA 86, 2766–2770.
Parry, D.W. and Nicholson, P. (1996) Development of a PCR assay to detect Fusarium
poae in wheat. Plant Pathology 45, 383–391.
Porteous, L.A., Armstrong, J.L., Seidler, R.J. and Watrud, L.S. (1994) An effective
method to extract DNA from environmental samples for polymerase chain
reaction amplification and DNA fingerprint analysis. Current Microbiology 29,
301–307.
Raeder, U. and Broda, P. (1985) Rapid preparation of DNA from filamentous fungi.
Letters in Applied Microbiology 1, 17–20.
Rao, V.B. (1994) Direct sequencing of polymerase chain reaction-amplified DNA.

Riedy, M.C., Timm Jr., E.A. and Stewart, C.C. (1995) Quantitative RT–PCR for
measuring gene expression. BioTechniques 18, 70–76.
Rogers, S.O. and Bendich, A.J. (1988) Extraction of DNA from plant tissues. Plant
Molecular Biology Manual A6, 1–10.
Rychlik, W. (1995) Priming efficiency in PCR. BioTechniques 18, 84–90.
Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and
Arnheim, N. (1985) Enzymatic amplification of β-globin genomic sequences and
restriction site analysis for diagnosis of sickle cell anemia. Science 230,
1350–1354.
Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis,
K.B. and Erlich, H.A. (1988). Primer-directed enzymatic amplification of DNA
with a thermostable DNA polymerase. Science 239, 487–491.
Schilling, A.G., Möller, E.M. and Hartwig, H.G. (1996) Polymerase chain reaction-
based assays for species-specific detection of Fusarium culmorum, F. grami-
nearum, and F. avenaceum. Phytopathology 86, 515–522.
Sheffield, V.C., Cox, D.R., Lerman, L.S. and Myers, R.M. (1989) Attachment of a
40-base-pair G+C-rich sequence (GC-clamp) to genomic DNA fragments by
the polymerase chain reaction results in improved detection of single-base
changes. Proceedings of the National Academy of Sciences USA 86, 232–236.
Silver, J. (1991) Inverse polymerase chain reaction. In: McPherson, M.J., Quirke, P.
and Taylor, G.R. (eds) PCR: a Practical Approach. IRL Press, Oxford,
pp. 137–146.
Spreadbury, C., Holden, D., Aufauvre-Brown, A., Bainbridge, B. and Cohen, J.
(1993) Detection of Aspergillus fumigatus by polymerase chain reaction. Journal
of Clinical Microbiology 31, 615–621.
Sreenivasaprasad, S., Mills, P.R., Meehan, B.M. and Brown, A.E. (1996a) Phylogeny
and systematics of 18 Colletotrichum species based on ribosomal DNA spacer
sequences. Genome 39, 499–512.
Sreenivasaprasad, S., Sharada, K., Brown, A.E. and Mills, P.R. (1996b) PCR-based
detection of Colletotrichum acutatum on strawberry. Plant Pathology 45,
650–655.
Steiner, J.J., Poklemba, C.J., Fjellstrom, R.G. and Elliott, L.F. (1995) A rapid one-tube
genomic DNA extraction process for PCR and RAPD analyses. Nucleic Acids
Research 23, 2569–2570.
Tindall, K.R. and Kunkel, T.A. (1988) Fidelity of DNA synthesis by the Thermus
aquaticus DNA polymerase. Biochemistry 27, 6008–6013.
Tingey, S.V. and del Tufo, J.P. (1993) Genetic analysis with random amplified
polymorphic DNA markers. Plant Physiology 101, 349–352.
Tommerup, I.C., Barton, J.E. and O’Brien, P.A. (1995) Reliability of RAPD
fingerprinting of three basidiomycete fungi, Laccaria, Hydnangium and Rhi-
zoctonia. Mycological Research 99, 179–186.
van Belkum, A. (1994) DNA fingerprinting of medically important microorganisms
by use of PCR. Clinical Microbiology Reviews 7, 174–184.
van Belkum, A., Quint, W.G.V., De Pauw, B.E., Melchers, W.J.G. and Meis, J.F. (1993)
Typing of Aspergillus species and Aspergillus fumigatus isolates by interrepeat
polymerase chain reaction. Journal of Clinical Microbiology 31, 2502–2505.
Versalovic, J., Koeuth, T. and Lupski, J.R. (1991) Distribution of repetitive DNA
20 V. Edel
sequences in eubacteria and application to fingerprinting of bacterial genomes.

Nucleic Acids Research 19, 6823–6831.
Vilgalys, R. and Hester, M. (1990) Rapid genetic identification and mapping of
enzymatically amplified ribosomal DNA from several Cryptococcus species.
Journal of Bacteriology 172, 4238–4246.
Volossiouk, T., Robb, E.J. and Nazar, R.N. (1995) Direct DNA extraction for PCR-
mediated assays of soil organisms. Applied and Environmental Microbiology 61,
3972–3976.
Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Hornes, M., Frijters, A.,
Pot, J., Peleman, J., Kuiper, M. and Zabeau, M. (1995) AFLP: a new technique
for DNA fingerprinting. Nucleic Acids Research 23, 4407–4414.
Weiner, M.P. and Costa, G.L. (1994) Rapid PCR site-directed mutagenesis. PCR
Welsh, J. and McClelland, M. (1990) Fingerprinting genomes using PCR with
arbitrary primers. Nucleic Acids Research 18, 7213–7218.
White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A.,
Wiedmann, M., Wilson, W.J., Czajka, J., Luo, J., Barany, F. and Batt, C.A. (1994)
Ligase chain reaction (LCR)-overview and applications. PCR Methods and
Applications 3, S51–S64.
Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990)
DNA polymorphisms amplified by arbitrary primers are useful as genetic
markers. Nucleic Acids Research 18, 6531–6535.
Winn-Deen, E.S. (1996) Automation of molecular genetic methods. Part 2: DNA
amplification techniques. Journal of Clinical Ligand Assay 19, 21–26.
Zhou, J., Bruns, M.A. and Tiedje, J.M. (1996) DNA recovery from soils of diverse
composition. Applied and Environmental Microbiology 62, 316–322.
Gene Cloning Using PCR 2
Sabine P. Goller, Markus Gorfer, Robert L. Mach
and Christian P. Kubicek
Abteilung für Mikrobielle Biochemie am Institut für Biochemische
Technologie und Mikrobiologie, Technische Universität Wien,
Getreidemarkt 9-172.5, A-1060 Wien, Austria
2.1 Introduction
Since its invention, the polymerase chain reaction (PCR) has revolutionized
the methodology for cloning genes. To clone a gene of interest, only sequence
information of two distinct regions of the gene (or the protein) is needed to
enable the design of primers for the amplification of the intervening
sequence. Following amplification of a putative gene fragment, the respective
PCR product can be used as a homologous probe for cloning the complete
gene from a library. PCR has therefore rapidly replaced the previously used
screening of libraries with oligonucleotide probes. Due to the fast progress
in PCR technologies and applications, further developments today enable
cloning of a complete gene including 5′- and 3′-untranslated regions by PCR
alone. This is particularly important in organisms where the preparation of
genomic DNA in quantities and qualities sufficient for the construction of a
genomic library is difficult. In this chapter we will attempt to review the
current state of gene cloning by PCR.
2.2 Tools Required
2.2.1 Available DNA polymerases

Several commercial suppliers offer a variety of thermostable DNA poly-
merases which differ in their proofreading activity, thermostability and
terminal deoxynucleotide transferase (TdT) activity (i.e., DNA polymerases
which add an additional non-templated nucleotide to the 3′-end of a DNA
22 S.P. Goller et al.
Table 2.1. Features of thermostable DNA polymerases.a,b
Taq Stoffel rTth Pfu Vent Pwo
Optimal extension 75–80 75–80 75–80 72–78 76 72

temperature (°C)
Extension rate at 72°C 2–4 2–4 2–4 0.5–1 1 1–2
(kb min–1)
Reverse transcriptase Minimal Minimal Mn2+ Minimal Minimal Minimal
activity dependent
Half-life (min) at 100°C <5 100 > 120
Half-life (min) at 97.5°C 10 20 2
Half-life (min) at 95°C 40 80 20 d 400
Mg2+-ion PCR optimum 1–4 2–10 1.5–2.5 1.5–2.5 1–6 1.5–4
(mM)
pH optimum for PCR 9.0 9.0 9.0 > 8.0 8.8 8.8
(25°C)
dNTP PCR optimum 40–200 40–200 40–200 100–250 200–400 200
(µM each)
KCl PCR optimum 50 10 75–100 10 10 25
(mM)
Primer PCR optimum 0.1–1 0.1–1 0.1–1 0.1–0.5 0.4 0.3–0.6
(µM)
Longest PCR product > 10 > 10 25 15 7.5
(kb)
dI-containing primers + – –
accepted
5′–3′ exonuclease + – + – – –
activity
3′–5′ exonuclease – – – + + +
activity
Error rate
(mutation frequency 8.0 1.3 2.7 e
per base pair per
cycle × 10-6)
Expandase activityc + + + – – –
Substrate analogues:
dUTP + + + –
deaza-dGTP + + + +
biotin-11-dUTP + + + +
digoxigenin-dUTP + + +
fluorescein-dUTP + + +
ddNTP + + +
bromo-dUTP +
α-thionucleotides + +
Continued on facing page
Table 2.1 continued

a
Taq from Thermus aquaticus; Stoffel, a modified form of recombinant Taq DNA
polymerase, with the N-terminal 289 amino acids containing the 5′→3′ exonuclease
activity removed; Tth, from Thermus thermophilus; Pfu, from Pyrococcus furiosus; Vent
from Thermococcus littoralis; Pwo from Pyrococcus woesei.
b
This table was composed from a number of sources including publications, manuals,
catalogues and data sheets (Lundberg et al., 1991; Hu, 1993; Biotechnology catalogue,
Perkin Elmer, New Jersey, USA; Promega catalogue, Madison, Wisconsin, USA; Pfu DNA
Polymerase Instruction Manual, Stratagene, La Jolla, California, USA, and references
therein; data sheets for Vent DNA polymerase from NEB, New England, USA; Pwo DNA
polymerase from Boehringer Mannheim, Germany). The table is therefore incomplete.
c
Expandase activity refers to the addition of a non-templated nucleotide to the 3′-end of
blunt-ended DNA molecules.
d
Pfu DNA polymerase remains > 95% active following a 1 h incubation at 95°C.
e
Due to different assays to estimate the error rate no direct comparison is possible. The
error rate of Pwo is similar to that of Pfu and Vent polymerases (Cha and Thilly, 1993).
strand). This enables the selection of the optimal polymerase for individual
applications (Table 2.1). Polymerases with proofreading activity such as Pfu
remove 3′-misincorporated nucleotides and so increase the accuracy of the
reaction. Such polymerases may also increase the yield of amplicons as
misincorporated nucleotides can inhibit the activity of the DNA polymerase
(Barnes, 1994a). Conversely, proofreading activity can degrade primers
(Lundberg et al., 1991; Flaman et al., 1994).
2.2.2 Source of DNA

An extensive search of literature from the past 5 years shows that most
instances of the use of PCR in the cloning of fungal genes have used genomic
DNA as a template. Since neither high quantities nor high quality of DNA
are needed, a number of simple and rapid protocols can be used for DNA
extraction. Virtually every type of fungal material can be used as a source of
DNA, and procedures have been adopted for mycelia harvested from liquid
cultures (Gruber et al., 1990), solid media (Lecellier and Silar, 1994), fruiting
bodies, herbarium materials (Bruns et al., 1990) or from archaeological
specimens (Rollo et al., 1995).
2.2.3 Primer design

Design of primers is one of the key steps in the successful cloning of a gene.
However, no absolute rules can be given that will guarantee the amplification
of the desired fragment in sufficient quantities. The following features may
be taken as guidelines for the design of primer pairs: (i) the length of primers
should be between 20 and 30 bases; (ii) the GC content should be around
50%, and G and C nucleotides should preferably be randomly distributed
within the primer. Over-long GC-stretches should be particularly avoided at
the 3′-end of the primer, as this can cause efficient but unspecific priming at
any GC-rich region in the genome (Innis and Gelfand, 1990); (iii) both
primers should have a similar GC content to minimize differences in
annealing at a given temperature; (iv) stretches of poly(dR), poly(dY) and
palindromic sequences should be avoided; (v) the sequences of the two
primers must not be complementary; (vi) the concentration of both primers
in the reaction should be between 0.1 and 0.5 µM. Differences in the
concentration of the two primers should be avoided since this would favour
the amplification of a linear single-stranded fragment.
Several computer programs are available which assist in the calculation
of optimal annealing temperatures, GC-contents, secondary structures,
primer-dimer formation and other properties of primers (e.g. GENE RUNNER
3.00, Hastings Software, Inc., 1994).
Even when the above guidelines are fully considered, primer design is,
however, not straightforward. A given amino acid may be encoded by different
triplets due to the degenerate nature of the genetic code (see Table 2.2). As a
consequence, a mixture of primers (‘degeneration’) instead of a primer with a
defined sequence is required. The degeneracy of the nucleotide triplet encoding
a certain amino acid is an important issue in the design of primers: degenerate
primers enable the amplification of related but distinct nucleic acid sequences
as well as of targets for which only amino acid sequences are available (e.g. from
protein sequence data or from multiple alignment of related sequences from
different organisms). Obviously, the use of protein sequences containing
amino acids with little degeneracy is desirable because it provides the greatest
specificity. No general rules can be given for the degree of degeneracy that
allows successful amplification. Even 1024-fold degenerated primers have
been shown to work well in PCR (Knoth et al., 1988).
Several approaches can be considered for increasing the specificity of the
amplification using degenerate primers (Kwok et al., 1994): (i) the primer
pools may be synthesized as subsets where one contains either a G or C at
a particular position, whereas the other contains either an A or T at the same
position; (ii) the degeneracy of the mixed primer may be reduced by
considering the codon bias for translation. For instance, codons having an A
in the third position (e.g. CTA or TTA for leucine) are used only rarely
(Table 2.2); (iii) degeneracy at the 3′-end of the primer should be avoided,
because single base mismatches may obviate extension; (iv) the inclusion of
deoxyinosine (I) at some ambigous positions may reduce the complexity of
the primer pool. Several experiments have suggested that deoxyinosine might
be an ‘inert’ base (Martin et al., 1985) and its presence in an oligonucleotide
sequence probably will not cause any disturbance in DNA duplex formation
or result in destabilization of the duplex. However, pairing of dI with the
four different bases is not equal: dI:dC >> dI:dA > dI:dT = dI:dG (Ohtsuka
et al., 1985). Furthermore, it has to be taken into account that deoxyinosine
oligonucleotides cannot be used with some DNA polymerases, such as Vent
or Pfu (Knittel and Picard, 1993).
Table 2.2. Codon usage in ascomycetous filamentous fungi.
A. nidulans b A. niger b N. crassa b T. reesei b

Amno
acida Codon Number % Number % Number % Number %
Gly GGG 893 15 178 8 600 9 113 8

Gly GGA 1323 22 386 16 910 13 183 14
Gly GGT 1710 28 863 36 2267 34 240 18
Gly GGC 2091 35 944 40 2981 44 801 60
Glu GAG 3139 59 1019 71 4270 74 433 82
Glu GAA 2221 41 414 29 1463 26 98 18
Asp GAT 2348 47 691 41 2041 40 227 31
Asp GAC 2642 53 991 59 3052 60 510 69
Val GTG 1309 23 498 27 1083 18 205 23
Val GTA 532 9 83 5 370 6 34 4
Val GTT 1597 28 433 24 1474 25 161 18
Val GTC 2167 39 810 44 3075 51 507 56
Ala GCG 1519 20 357 15 1233 15 225 17
Ala GCA 1430 19 266 11 763 10 151 12
Ala GCT 2109 28 770 32 2061 26 286 22
Ala GCC 2460 33 1022 42 3969 49 631 49
Arg AGG 524 10 93 9 849 16 80 13
Arg AGA 537 10 80 7 565 11 39 7
Ser AGT 831 11 216 9 528 8 66 5
Ser AGC 1380 19 531 22 1433 22 316 25
Lys AAG 2930 69 1019 87 4283 84 528 92
Lys AAA 1345 31 159 13 818 16 48 8
Asn AAT 1296 37 282 22 849 23 151 19
Asn AAC 2243 63 984 78 2906 77 632 81
Met ATG 1905 100 493 100 2138 100 261 100
Ile ATA 508 11 36 3 322 7 24 4
Ile ATT 1656 37 385 29 1538 32 214 33
Ile ATC 2354 52 906 68 2881 61 418 64
Thr ACG 1097 20 316 16 1012 18 293 29
Thr ACA 1189 22 190 9 724 13 102 10
Thr ACT 1356 25 474 23 1055 19 200 20
Thr ACC 1720 32 1054 52 2741 50 410 41
Trp TGG 1150 100 412 100 1239 100 244 100
End TGA 41 28 15 26 71 34 6 19
Cys TGT 431 37 119 34 235 22 56 24
Cys TGC 731 63 235 66 825 78 176 76
Continued overleaf
Table 2.2 continued.
A. nidulans b A. niger b N. crassa b T. reesei b

Amno
acida Codon Number % Number % Number % Number %
End TAG 53 36 16 28 34 16 14 44
End TAA 52 36 26 46 103 50 12 37
Tyr TAT 939 37 269 24 758 28 132 25
Tyr TAC 1600 63 869 76 1939 72 400 75
Leu TTG 1157 14 324 15 1191 15 96 10
Leu TTA 496 6 26 1 250 3 5.0 1
Phe TTT 1127 34 243 23 940 27 191 38
Phe TTC 2148 66 834 77 2491 73 309 62
Ser TCG 1247 17 346 15 1200 18 286 22
Ser TCA 1038 14 119 5 515 8 103 8
Ser TCT 1418 19 426 18 1036 16 200 16
Ser TCC 1526 21 732 31 1885 29 318 25
Arg CGG 887 17 148 14 585 11 71 12
Arg CGA 897 17 84 8 428 8 92 16
Arg CGT 1062 20 298 28 1026 20 102 17
Arg CGC 1445 27 376 35 1807 34 209 35
Gln CAG 2268 62 734 77 2553 71 524 81
Gln CAA 1378 38 215 23 1056 29 124 19
His CAT 975 45 190 32 678 31 58 17
His CAC 1176 55 402 68 1497 69 275 83
Leu CTG 1881 24 664 31 1448 18 365 36
Leu CTA 769 10 103 5 409 5 24 2
Leu CTT 1662 21 355 17 1509 19 140 14
Leu CTC 2016 25 653 31 3094 39 379 38
Pro CCG 1142 23 280 21 985 20 192 22
Pro CCA 1103 22 116 9 687 14 102 12
Pro CCT 1399 28 365 27 1169 23 216 25
Pro CCC 1362 27 601 44 2167 43 346 40
a
Three-letter code.
b
Total number of genes used in the derivation of this data: Aspergillus nidulans, 146;
Aspergillus niger, 57; Neurospora crassa, 208; Trichoderma reesei, 32.
2.2.4 Other reaction components

The PCR reaction requires magnesium-chelated dNTPs in a pH-stabilized
environment. The concentration of each of the nucleotides should be in the
range of 50–200 µM and should be balanced. Differences in concentration of
the nucleotides may cause misincorporation and thereby decrease yield and
fidelity of the PCR (Ehlen and Dubeau, 1989). Most suppliers of thermo-
stable DNA polymerases also supply the respective buffers, and hence their
optimization is usually no problem. Changing the Mg2+-concentration from
1 to 10 mM can have dramatic effects on the specificity and yield of an
amplification. The presence of EDTA or other metal ion-chelating agents,
which are used in some DNA extraction procedures (Möller et al., 1992) and
may therefore be carried over, lowers the effective concentration of Mg2+. An
excess of dNTPs has the same effect. The concentration of metal chelators
and total dNTPs should therefore be taken into account when determining
the final Mg2+ concentration required for PCR.
The use of 1–10% (w/v) dimethylsulphoxide (DMSO) in the PCR assay
has been recommended (Scharf et al., 1986; Chamberlain et al., 1988),
because it lowers the melting temperature of the dsDNA and hence facilitates
strand separation. This may be particularly important in the denaturation of
GC-rich DNA and help to overcome difficulties caused by DNA secondary
structures (Hung et al., 1990). However, the use of DMSO is not generally
recommended, as it apparently increases the solubility of the mineral oil
(frequently used as a protectant against evaporation) in the aqueous phase
and thereby inhibits DNA polymerase (Linz, 1991). An alternative to the
mineral oil layer is the use of a thermocycler with an integrated heated lid.
Use of formamide (1.25–10%) can also facilitate primer–template annealing
reactions and lower the denaturing temperature of DNA (Sarkar et al.,
1990).
Glycerol is also frequently included in the reaction system (5–20%,
w/v), because it may improve the yield of the amplicon by stabilizing the
DNA polymerase (Instruction Manual for Pfu DNA Polymerase; Stratagene,
La Jolla, California). A similar stabilization can also be achieved by the
addition of bovine serum albumin (10–100 µg/ml), which has the further
advantage of binding fatty acids and phenolic compounds which may inhibit
the PCR (Pääbo et al., 1988).
2.2.5 Cycling parameters

In a typical PCR reaction, the double-stranded DNA is denatured by
heating the sample to 94–98°C. The primers are allowed to anneal at the
calculated annealing temperature (typically 40–60°C) followed by heating
to the extension temperature (depending on the thermostable DNA
polymerase used, 68–76°C). This cycle is repeated 25–40 times. Normally,
these cycles are preceded by an initial denaturation step of 1–3 min and
followed by a final extension step at the chosen extension temperature
for 5–10 min. To avoid extension of unspecifically annealed primers at
lower temperature while setting up the PCR mixture, a ‘hot start’ is
recommended. This means that the enzyme is added to the reaction
mixture after the initial denaturation step only. ‘Hot start’ has dis-
advantages, however, in that it is laborious when handling many samples
at the same time, and carries the risk of introducing contamination. As

an alternative to ‘hot start’, Taq antibodies can be added to the reaction
mixture. The antibody inhibits Taq polymerase during the setting up of
the reaction mixture only because it is subsequently inactivated at the first
denaturation step. Denaturation should be as short as possible to avoid
inactivation of the thermostable DNA polymerase by prolonged exposure
to elevated temperatures. On the other hand, complete denaturation is an
absolute requirement for high efficiency PCR. For most applications
denaturation times between 30 s and 1 min are recommended. The
thermostability of different thermostable DNA polymerases varies con-
siderably: Pfu DNA polymerase, for instance, is a highly thermostable
enzyme, retaining 94–99% of its polymerase activity after 1 h at 95°C.
Unlike Taq DNA polymerase, denaturing temperatures up to 98°C can
be used successfully with Pfu DNA polymerase to amplify GC-rich
regions (Chong et al., 1994; Nielson et al., 1995). The Vent DNA
polymerase features a half-life of 6.7 h at 95°C and 1.8 h at 100°C. Taq
polymerase has a half-life of only 40 min at 95°C and 10 min at 97.5°C.
The temperature and length of time required for primer annealing
depend upon the base composition (GC content), length and concentration
of the amplification primers. The melting temperature (T m) of a given primer
sequence can easily be calculated by the formula:
T m (°C) = 2 (NA + NT) + 4 (NG + NC)
where N equals the number of primer adenine (A), thymidine (T), guanidine
(G) or cytosine (C) bases. Usually, the applied annealing temperature is 5°C
below the calculated T m, but this has to be optimized individually. Generally,
one annealing step should last for about 1 min.
The extension time depends on the length of the target sequence, the
extension temperature and the type of thermostable DNA polymerase used.
For Taq and Vent polymerase, extension times of 1 min per kb of expected
extension products at 72–75°C are recommended. Pfu DNA polymerase
needs 2 min per kb at 72°C. Using extension times longer than those
calculated is not recommended for DNA polymerases possessing proof-
reading exonuclease activity, as this would result in the degradation of
primers not yet annealed. Too-short extension times, on the other hand,
would decrease the yield of PCR product. To circumvent problems due to
the lowered activity of DNA polymerase because of repeated denaturation
steps, the extension time can be increased continuously from cycle to cycle.
The final extension step is necessary to guarantee that only full length PCR
products are obtained. After optimization of all parameters, the optimal
number of cycles depends mainly on the starting concentration of the target
DNA. Too few cycles gives low product yield, whereas too many cycles
can increase the amount and complexity of non-specific background
products.
2.3 Amplification from RNA (RT–PCR)
For amplification of RNA, cDNA is first synthesized by reverse tran-

scriptase (RT) and then amplified by PCR as the direct amplification of RNA
by commercially available thermostable DNA polymerases is not possible
(Tth thermostable DNA polymerase has been reported to have reverse
transcriptase activity but is not used routinely due to its short half-life; Myers
and Gelfand, 1991). In filamentous fungi, RT–PCR is usually applied to
generate the corresponding cDNA of a previously cloned genomic fragment
used for the confirmation of intron boundaries, and to enable their
expression in both bacteria and yeasts.
In a straightforward approach a cDNA fragment may also be directly
amplified without previous cloning of the respective genomic clone. This
may be necessary if amplification of a desired gene from genomic DNA is
unsuccessful because of the presence of an intron in the sequence region used
for primer design. Furthermore, the complexity of a reverse-transcribed
mRNA pool is lower than that of the complete genome, resulting in a lower
background of co-amplified byproducts. This specificity may be further
increased by the use of a gene-specific oligonucleotide for reverse transcrip-
tion of the mRNA and two gene-specific primers for subsequent PCR
amplification (also see Section 2.5.3). The oligonucleotide primer for reverse
transcription therefore has to be the most 3′-located of the three oligo-
nucleotides.
2.4 RACE: Rapid Amplification of cDNA Ends
The RACE protocol (Frohmann et al., 1988) provides a simple and efficient
method for the cloning of cDNA from a gene when the sequence of only a
single position in the gene (or protein) is known. The design of the 3′-end
primer is based on the predictable sequence of the poly(A)-tail of eukaryotic
mRNA (e.g. oligo-dT), and hence individual sequence information is only
necessary for the 5′-end. This approach has particular advantages if the
sequence of the amino-terminus of a protein can be determined because it
bypasses the need to sequence internal peptide fragments of the protein as
well (e.g. Marx et al., 1995). The method consists of two steps, described in
detail (Fig. 2.1).
The use of oligo-dT primers with a 5′-adaptor sequence containing cleav-
age sites for several restriction enzymes, preferably enzymes with recognition
sites that are found infrequently in genomic DNA such as SfiI, NotI, MluI or
XhoI, is recommended (McClelland and Nelson, 1987); this facilitates subse-
quent cloning procedures. The first step consists of a reverse transcription of
the mRNA as described earlier. The resulting first strand cDNA is then either
purified from RNA by RNase H digestion or used directly for PCR amplifica-
tion with a gene-specific primer and the oligo-dT primer.
Fig. 2.1. Schematic representation of the RACE protocol. Primers: ****TTTT

(dT)17-adaptor, containing recognition sequences for restriction enzymes at the 5′-end.
3′amp (amp refers to amplification), specific to gene of interest, complementary to (–)
strand. 5RT (RT refers to reverse transcription) and 5′amp, specific to gene of interest,
complementary to (+) strand. Open rectangles represent DNA strands actively being
synthesized; shaded rectangles represent DNA previously synthesized. At each step the
diagram is simplified to illustrate only how the new product formed during the previous
step is utilized. A (–) or (+) strand is designated as ‘truncated’ (TR) when it is shorter than
the original (–) or (+) strand, respectively (Frohman et al., 1988).
For the amplification of the 5′-end of cDNA, the mRNA is reverse

transcribed using a gene-specific primer. The product of the first strand
cDNA synthesis is then subjected to homopolymer (poly(A)) tailing, using
terminal polynucleotide transferase. This allows the amplification of cDNA
by means of a gene-specific primer at the 3′-end in combination with a
homopolymer primer complementary to the tail at the 5′-end of the first
strand cDNA. The specificity and efficiency of the amplification reaction can
be increased by using a second gene-specific primer. Again restriction
enzyme recognition sequences can be incorporated into the primer sequences
to facilitate subsequent cloning strategies.
To obtain a full-length cDNA clone, primers for amplification of 5′ and
3′ fragments must be designed to produce overlapping PCR clones. The two
independent clones can be combined to generate a complete cDNA clone by
one additional PCR step using primers hybridizing at the 5′-end of the
5′-RACE fragment and at the 3′-end of the 3′-RACE fragment, respectively,
using both fragments as templates. Because of the overlapping character of
both fragments the internal sequences are used as primers in the first cycles
to generate a full-length cDNA clone. This full-length product is further
amplified by the primers at the extreme 5′- and 3′-ends of the cDNA.
Alternatively, classical cloning procedures can be used to join the two
incomplete fragments.
2.5 Specific Applications
2.5.1 Ramp PCR

In Ramp PCR the annealing temperature is lowered from cycle to cycle,
usually by 2°C during the first few amplification steps (PCR Applications
Manual, Boehringer Mannheim, 1995). This can be useful if the annealing
temperature of a given primer cannot be exactly determined, for example,
because of a high degree of degeneracy. Ramp PCR can also be applied when
primers of widely different T m are used. This is based on the rationale that
annealing must be highly specific especially in the first few cycles, whereas
later cycles are necessary mainly for further amplification.
2.5.2 Long and accurate PCR (LA-PCR)

Amplification of fragments larger than 5 kb by PCR is usually difficult
because of the misincorporation of nucleotides due to premature termination
of the extension product (Barnes, 1994a). To overcome this limitation, Barnes
employed a mixture of two thermostable DNA polymerases, one that is
highly processive, and one exhibiting a 3′ → 5′ exonuclease activity which
allows ‘proofreading’ of the product. A study of different combinations of
various enzymes determined that a mixture of 16 parts KlenTaq (an
exonuclease-free mutant of Taq polymerase) to 1 part Pfu polymerase, which
has a 3′-exonuclease activity, could yield PCR products as large as 35 kb. The
mixture was termed KlenTaqLA-16 and is commercially available (as are
many other optimized combinations of two different thermostable DNA
polymerases). The differences between classical PCR and LA-PCR are given
in Table 2.3.
Table 2.3. Comparison of conditions for LA-PCR and classical PCR to amplify a 35 kb
fragment from λ-DNA (Barnes, 1994b).
LA-PCR Classical PCR
KlenTaqLA-16 Only one enzyme

pH 9.2 pH 8.3
16 mM (NH4 )2SO4, no KCl 50 mM KCl
50 mM Tris 20 mM Tris–HCl
3.5 mM MgCl2 1–2 mM MgCl2
30–40 s 99°C 60 s 95°C
2 ng λ-DNA 20 ng λ-DNA
33 µl reaction volume 100 µl reaction volume
20 cycles 30 cycles
68°C extension temperature 72°C extension temperature
33 nucleotide primers 20–22 nucleotide primers
11–24 min extension (longer at later cycles) 3–10 min extensions
Hot start or Taq antibody start Cold start, no antibody
Filter tips Non-filter tips
UVA + 8 MOPa before template No treatment
a
8 MOP, 8-methoxy-psoralen (for inactivation of contaminating DNA).
2.5.3 PCR with Nested Primers

Even though PCR amplification of a gene with highly degenerate primers
should theoretically lead to a million-fold increase in the abundancy of the
amplicon over the amount of DNA originally present, the yields may be
much lower in practice, and even too low to detect. In many cases the reason
for this is the presence of components inhibiting DNA polymerization,
which necessitate the dilution of the original DNA solution to a very low
level. ‘Nested PCR’ overcomes this problem by performing a second
amplification of the accumulated amplicon using primers annealing within
the previously amplified product (nested primers; Albert and Fenyö, 1990).
Since the first amplification also reduces the nucleic acid complexity, this
method enables a high specificity in the second amplification. Sometimes,
only a single internal primer in the second PCR may suffice. Design of a
nested primer can be based on the addition of as little as three bases to the
3′-end of the first stage primers. Because of this specificity, nested PCR can
be carried out with highly degenerate primers (e.g. 8192-fold; Chen and
Suttle, 1995).
2.5.4 Inverse PCR

Inverse PCR allows the amplification of DNA regions located outside of a
previously characterized sequence (Ochman et al., 1988; Triglia et al., 1988;
Silver and Keerikatte, 1989) and thus enables the direct cloning of a full-
length (e.g. containing also the 5′ and 3′ untranslated regions) gene. This
technique is based on the simple rationale that digestion of a given region of
DNA with restriction enzymes, and the circularization of the respective
fragments before amplification, allows the use of PCR with primers
synthesized in the opposite orientations to those normally used for PCR
(Fig. 2.2). DNA is cleaved by restriction enzymes which have no recognition
site within the gene fragment of interest. DNA fragments are then ligated
under conditions that favour the formation of monomeric circles (Collins
and Weissman, 1984). The circularized DNA molecules can then be used for
PCR amplification either directly or after precipitation of the template DNA
by appropriate salts and ethanol. A similar PCR set-up as described for
genomic DNA can be used.
Fig. 2.2. Application of inverse PCR. The core region is depicted as a jagged line. Filled
and open boxes represent the upstream and downstream flanking regions, respectively,
and restriction enzyme recognition sites are denoted by triangles. Oligonucleotide
primers constructed to anneal to the core region and the direction of DNA synthesis are
shown by arrows. Figure from Ochman et al., (1990) with permission.
2.5.5 Ligation-mediated PCR (LM-PCR)

Ligation-mediated PCR (LM-PCR; Müller and Wold, 1989) requires the
knowledge of only one primer annealing position; the second primer can be
defined by ligating a unique DNA linker to it. One of the most important
and powerful applications of this method is the rapid cloning of promoters
and other upstream regulatory elements that control the expression of

mRNA.
DNA is digested separately with restriction enzymes which generate
blunt ends (e.g. EcoRV, ScaI, DraI, PvuII, SspI) in order to obtain genomic
DNA suitable for addition of the unique linkers. Each batch is then
separately ligated to the specially designed adaptor. The desired fragment is
then amplified in two steps which are based on the same rationale as nested
PCR. In the first step, primers annealing to the linker sequence and to the
respective genomic sequence are used. In the second step, the linker primer
is used together with another which overlaps with the first ‘genomic primer’.
2.6 Cloning of PCR Fragments
Several methods for cloning of PCR-generated DNA fragments have already

been published, and only those most routinely used will be described in this
chapter. For other methods like ligase-independent cloning (LIC) or uracil
DNA-glycosylase (UDG)-treatment of uracil-containing deoxyoligonucleo-
tide primers, the reader is referred to the papers by Aslanidis and De Jong
(1990) and Nisson et al. (1991). In addition, several new techniques are
currently being developed (e.g. regularly published in Promega Notes,
Promega, Madison, Wisconsin, USA) which renders it impossible to give a
complete list of all available methods.
2.6.1 Incorporation of restriction enzyme sites into

deoxyoligonucleotide primers
Incorporation of recognition sequences for restriction enzymes into the
primers is probably the most widely used method for cloning PCR
fragments. The main advantage of this method is that the fragment can be
cloned into a vector construct at precisely the location desired. Any site not
contained within the fragment itself can be incorporated into the primer
design. When amplifying an unknown sequence, restriction sites should be
chosen which occur infrequently in the genome, such as NotI, SfiI, MluI or
XhoI; in addition, recognition sequences for several restriction enzymes can
be incorporated to minimize the chance of cloning an uncomplete PCR
fragment because of an internal restriction site.
To guarantee the direction of the cloned insert, different restriction target
sites on each primer are usually used. Adding bases to the 5′-end of the primer is
the simplest approach and has no effect on the PCR reaction (Scharf et al., 1986;
Kaufman and Evans, 1990). When creating a restriction site by addition of
sequences to the 5′-end of a primer, it is important to consider that restriction
enzymes are endo- (not exo-) nucleases and thus do not usually cleave at the
end of a nucleotide strand. Hence the included restriction site needs to be
prolonged by the addition of several bases. To achieve efficient cleavage, three
additional nucleotide bp are generally sufficient to act as an annealing clamp.

However, some enzymes, for example NotI, need at least 10 bases of double-
stranded DNA to restrict at its recognition sequence.
One drawback to restriction enzyme site incorporation is the inability to
achieve efficient cleavage. Inhibition of digestion can occur because of the
presence of incompatible polymerase buffers and the molar excess of primers
left over from the PCR reaction. Some restriction enzymes are inhibited by
restriction site-containing primers (Blanck et al., 1995) and therefore, it is
often necessary to purify the fragment before restriction enzyme treatment
(Table 2.4).
Table 2.4. Activities of restriction enzymes in a PCR mix.
Restriction % activity in Restriction % activity in

enzyme PCR mix enzyme PCR mix
ApaI 100 MluI <5

Asp700 10 NaeI 0
Asp718 100 NcoI 50
AviII 30 NotI 0
BamHI 100 NruI 75
BbrPI 100 PstI 90
BfrI 100 PvuI <5
BglII 0 PvuII 100
ClaI 100 SacI 100
DraI 100 SalI 0
EclXI 0 ScaI <5
Eco47III 0 SmaI 100
EcoRI 50 SnaBI 50
EcoRV 10 SphI <5
HindIII 10 SspI 0
HpaI 100 StuI 30
KpnI 50 XhaI 60
KspI 0 XhoI >5
MamI 20
Relative activities of restriction enzymes in a PCR mixture

(10 mM Tris–HCl, 50 mM KCl, 1.5 mM MgCl2, 200 µM
dNTPs, pH 8.3 at 20°C) compared with activity under
optimal conditions (SuRE/Cut buffer Boehringer Mannheim)
(Blanck et al., 1995).
2.6.2 T/A cloning

T/A-cloning relies on the terminal deoxynucleotide transferase activity of
some of the polymerases used in PCR. Clark (1988) showed that some DNA
polymerases and reverse transcriptases contain a terminal deoxynucleotidyl

transferase (TdT) activity that results in the addition of one or more
nucleotides at the 3′-ends of blunt-ended DNA molecules, which is both
nucleotide and polymerase specific (Hu, 1993); e.g., Taq DNA polymerase
extends a single dG nucleotide if the 3′-terminal nucleotide on the fragment
is a dG but adds a dA if the 3′-terminal nucleotide is a dC. A 3′-terminal dT
nucleotide results in the non-addition of a dT and the addition of a dA.
Fragments ending with a dA had an additional dA added to the 3′-ends with
extremely low efficiency by polymerases that were found to have the TdT
activity; there appears to be no consistent patterns for which bases were
added. Pfu DNA polymerase does not show any TdT activity and so this
polymerase cannot be used for amplification of fragments for subsequent
cloning.
The vector into which dA-tailed PCR fragments are to be cloned must
contain a 3′-T overhanging sequence. This can be obtained either by
incubating a blunt-ended vector with Taq DNA polymerase and an excess of
dTTP, or by incubating a blunt-ended vector with dideoxythymidine-
triphosphate (ddTTP) and terminal transferase (Holton and Graham, 1990);
the use of ddTTP ensures the addition of a single dT residue only.
2.6.3 Blunt-end cloning

As with the T/A System, blunt-end cloning does not require the addition of
extra bases to the primer sets. PCR-fragments generated by Taq polymerase
or any other polymerase adding a non-templated nucleotide at the 3′-end
must be treated with Klenow, T4 or Pfu polymerase to generate blunt ends.
The vector must also be blunt-ended (e.g., by cutting with EcoRV or SmaI).
To improve the efficiency of blunt-end cloning, the use of an optimized
blunt-end ligation buffer is recommended. The direction of fragments after
blunt-end cloning is usually not known, but this drawback can be circum-
vented if one of the primers is phosphorylated at the 5′-end, and the other
one is not and therefore still contains the 5′-OH. The vector is cut with the
first restriction enzyme, then dephosphorylated and afterwards cut with the
second restriction enzyme to create two different blunt ends; one with a
5′-OH, the other with a 5′-phosphate. The ligation of the one-sided-
phosphorylated PCR-fragment into the one-sided-dephosphorylated vector
allows unidirectional cloning.
Religation of the vector can be a major problem with blunt end cloning
of PCR-fragments, but this can be avoided by the use of the blunt-end-
generating restriction endonuclease Srf I together with an appropriate vector.
The recognition sequence of SrfI is an 8 bp palindrome. Since it is very
unlikely that such a sequence occurs in the unknown sequence of the gene
of interest, Srf I can be added to the ligation mixture where it cleaves any
religated vector (Simcox et al., 1991; Liu and Schwartz, 1992).
Table 2.5. Examples of fungal genes cloned by PCR.
Primer design
Primer based on
Organism Reference Gene name *dp ndp aa/seq aa/c dna/c
Aspergillus
A. niger Inoue et al., 1991 Proteinase A • •
A. niger Ehrlich et al., 1993 phyB (phytase gene) • •
A niger Jarai et al., 1994 pepD (subtilisin-like protease) • •
A. niger Van den Brink et al., 1995 cprA (NADPH cytochrome P450 • •
oxidoreductase)
A. oryzae Gomi et al., 1993 pepA (acid protease) • •
A. oryzae Lee et al., 1995 nucS (nuclease S1) • •
A. fumigatus Sirakova et al., 1994 Metalloproteinase • •
A. fumigatus Reichard et al., 1995 pep (aspatic proteinase) • •
A. flavus, A. fumigatus Ramesh et al., 1995 mep20 (metalloproteinase) • •
A. parasiticus Feng and Leonard, 1995 pksL1 (polyketide synthase) • •
A. parasiticus Cary et al., 1995 pecA (polygalacturonase) • •
Neurospora
N. crassa Yajima et al., 1991 Photolyase gene • •
N. crassa Mauriceville Young and Marzluf, 1991 nmr (negative-acting nitrogen control gene) • •
N. crassa Stone et al., 1993 gla-1 (glucoamylase) • •
N. crassa Tao and Chen, 1994 eIF-5A (initiation factor 5A) • •
N. crassa Yatzkan and Yarden, 1995 pph-1 (2A protein phosphatase) • •
N. crassa Maier et al., 1995 GTP-cyclohydrolase I gene • •
N. intermedia Young and Marzluf, 1991 nmr (negative-acting nitrogen control gene) • •
Continued overleaf
Table 2.5. continued.
Primer design
Primer based on
Organism Reference Gene name *dp ndp aa/seq aa/c dna/c
N. sitophila Young and Marzluf, 1991 nmr (negative-acting nitrogen control gene) • •
Penicillium
P. chrysogenum Marx et al., 1995 paf (antifungal protein) • •
P. chrysogenum Haas et al., 1995 nre (nitrogen regulatory protein) • •
P. camembertii U-150 Yamaguchi et al., 1991 mdlA (mono- and diacylglycerol lipase) • •
Trichoderma
T. reesei Barnett et al., 1991 bgl1 (β-glucosidase) • •
T. reesei Törrönen et al., 1992 xyn1, xyn2 (xylanase I and II) • •
T. reesei Strauss et al., 1995 cre1 (carbon catabolite repressor protein) • •
T. longibrachiatum González et al., 1992 egl1 (endoglucanase I) • •
T. harzianum Heidenreich and Kubicek, 1994 pyr4 (ornithine-5′-phosphate decarboxylase) • •
Others
Aureobasidium pullulans Li and Ljungdhal, 1994 xynA (xylanase A) • •
Amanita muscaria Kreuzinger et al., 1996 gpd (glyceraldehyde-3-phosphate • •
dehydrogenase)
Boletus edulis Kreuzinger et al., 1996 gpd (glyceraldehyde-3-phosphate • •
dehydrogenase)
Boletus edulis Mehmann et al., 1994 BoeCHS1 (chitin synthase) • •
Botrytis cinerea Causier et al., 1994 chs1 (chitin synthase) • •
Cantharellus ciarius Mehmann et al., 1994 CacCHS1 (chitin synthase) • •
Ceriporiopsis subvermispora Rajakumar et al., 1996 lip (lignin peroxidase) • •
Cochliobolus carbonum Scott-Craig et al., 1990 PGN1 (endopolygalacturonase) • •
Cochliobolus carbonum Nikolskaya et al., 1995 cv-2, cv-7, cv-19 (CPS, cyclic peptide • •
synthase)
Cochliobolus carbonum Murphy and Walton, 1996 alp1 (serin protease) • •
Cortinarius odorifer Mehmann et al., 1994 CooCHS1, CooCHS2 (chitin synthase) • •
Cylindrocladium Nikolskaya et al., 1995 cyl-1, cyl-2, cyl-3 (CPS, cyclic peptide • •
macrosporum synthase)
Diheterospora Nikolskaya et al., 1995 dih-1 (CPS, cyclic peptide synthase) • •
chlamydosporia
Elaphomyces muricatus Mehmann et al., 1994 ElmCHS1, ElmCHS2 (chitin synthase) • •
Fusarium solani Gonzales-Candelas and pelA (pectate lyase) • •
Kolattukudy, 1992
Fusarium oxysporum Sheppard et al., 1994 Bfam 1, Cfam 1, Cfam 2, Ffam 1, Kfam 1 • •
(cellulase family-specific proteins)
Hebeloma crustuliniforme Mehmann et al., 1994 HecCHS1 (chitin synthase) • •
Hebeloma mesophaeum Mehmann et al., 1994 HemCHS1 (chitin synthase) • •
Lactarius deterrimus Mehmann et al., 1994 LcdCHS1 (chitin synthase) • •
Lactarius deterrimus Kreuzinger et al., 1996 gpd (glyceraldehyde-3-phosphate • •
dehydrogenase)
Laccaria laccata Mehmann et al., 1994 LalCHS1, LalCHS2 (chitin synthase) • •
Orpinomyces sp. Chen et al., 1995 cypB (cyclophilin) • • •
Phanerochaete sordida Rajakumar et al., 1996 lip (lignin peroxidase) • •
Phycomyces blakesleeanus Maier et al., 1995 GTP-cyclohydrolase I gene • •
Pleurotus ostreatus Giardina et al., 1995 pox1 (phenol oxidase) • •
Russula adulterina Mehmann et al., 1994 RuaCHS1 (chitin synthase) • •
Rhizopogon vulgaris Mehmann et al., 1994 RhvCHS1, RhvCHS2 (chitin synthase) • •
Tuber uncinatum Mehmann et al., 1994 TuuCHS1 (chitin synthase) • •
Xerocomus badius Mehmann et al., 1994 XebCHS1 (chitin synthase) • •
*dp, Degenerate primers; ndp, non-degenerate primers; aa/seq, primer design based on partial amino acid sequences of the purified protein; aa/c, primer design based on one or more amino acid
sequences from related proteins from other species; dna/cl, primer design based on one or more DNA sequences from related genes from other species.
2.7 Conclusions
The availability of a range of strategies for PCR cloning has revolutionized

the cloning of genes from filamentous fungi. Table 2.5 shows a subset of the
data available from Medline summarizing genes cloned by some of the PCR
strategies outlined in this chapter. While this list is certainly not complete, we
have tried to show representative examples for a wide variety genes,
indicating how strongly PCR has taken over fungal gene cloning. It is also
apparent from Table 2.5 that there has been a strong increase in the number
of publications in recent years, indicating that PCR cloning has now become
an established tool in fungal molecular genetics. In addition (and not shown
here), more sophisticated techniques such as differential display and ligation-
mediated PCR are being applied increasingly to filamentous fungi. It is
anticipated that these advances in methodology will help raise fungal
mycology to the status already reached by the molecular genetics of
unicellular pro- and eukaryotes.
References
Albert, J. and Fenyö, E.M. (1990) Simple, sensitive, and specific detection of human
immunodeficiency virus type I in clinical specimens by polymerase chain
reaction with nested primers. Journal of Clinical Microbiology 28, 1560–1564.
Aslanidis, C. and de Jong, P.J. (1990) Ligation-independent cloning of PCR products
(LIC-PCR). Nucleic Acids Research 13, 6069–6074.
Barnes, W.M. (1994a) PCR amplification of up to 35 kb DNA with high fidelity and
high yield from λ bacteriophage templates. Proceedings of the National Academy
of Sciences USA 91, 2216–2220.
Barnes, W.M. (1994b) Tips and tricks for long and accurate PCR. Trends in
Biochemical Sciences 19, 342.
Barnett, C.C., Berka, R.M. and Fowler, T. (1991) Cloning and amplification of the
gene encoding an extracellular β-glucosidase from Trichoderma reesei: evidence
for improved rates of saccharification of cellulosic substrates. Bio/Technology 9,
562–567.
Blanck, A., Glück, B., Wartbichler, R., Bender, S., Pöll, M. and Brandl, A. (1995)
Activity of restriction enzymes in a PCR mix. Biochemica 2, 16.
Bruns, T.D., Fogel, R. and Taylor, J.W. (1990) Amplification and sequencing of DNA
from fungal herbarium species. Mycologia 82, 175–184.
Cary, J.W., Brown, R., Cleveland, T.E., Whitehead, M. and Dean, R. 1995. Cloning
and characterization of a novel polygalacturonase-encoding gene from Aspergil-
lus parasiticus. Gene 153, 129–133.
Causier, B.M., Milling, R.J., Forster, S.G. and Adams, D.J. (1994) Characterization of
chitin synthase from Botrytis cinerea. Microbiology 140, 2199–2205.
Cha, R.S. and Thilly, W.G. (1993. Specificity, efficiency, and fidelity of PCR. PCR
Methods and Applications 3, 18–29.
Chamberlain, J.S., Gibbs, R.A., Ranier, J.E., Nguyen, P.N. and Caskey. C.T.
(1988) Deletion screening of the Duchenne muscular dystrophy locus via
multiplex DNA amplification. Nucleic Acids Research 16, 11141–11156.

Chen, F. and Suttle, C.A. (1995) Nested PCR with three highly degenerate primers
for amplification and identification of DNA from related organisms. Bio-
Techniques 18, 609–611.
Chen, H., Li, X.-L. and Ljungdahl, L.G. (1995) A cyclophilin from the polycentric
anaerobic rumen fungus Orpinomyces sp. strain PC-2 is highly homologous to
vertebrate cyclophilin B. Proceedings of the National Academy of Sciences USA
92, 2587–2591.
Chong, S.S., Eichler, E.E., Nelson, D.L. and Hughes, M.R. (1994) Robust amplifica-
tion and ethidium-visible detection of the fragile X syndrome CGG repeat using
Pfu polymerase. American Journal of Medical Genetics 51, 522–526.
Clark, J.M. (1988) Novel non-template nucleotide addition reactions catalyzed by
procaryotic and eucaryotic DNA polymerases. Nucleic Acids Research 16,
9677–9686.
Collins, F.S. and Weissman S.M. (1984) Directional cloning of DNA fragments at a
large distance from an initial probe: a circularization method. Proceedings of the
National Academy of Sciences USA 81, 6812–6816.
Ehlen, T. and Dubeau, L. (1989) Detection of ras point mutations by polymerase
chain reaction using mutation-specific, inosine-containing oligonucleotide pri-
mers. Biochemical and Biophysical Research Communications 160, 441–447.
Ehrlich, K.C., Montalbano, B.G., Mullaney, E.J., Dischinger, H.C. and Ullah, A.H.J.
(1993) Identification and cloning of a second phytase gene (phyB) from
Aspergillus niger (ficuum). Biochemical and Biophysical Research Communica-
tions 195, 53–57.
Feng, G.H. and Leonard, T.J. (1995) Characterization of the polyketide synthase gene
(pksL1) required for aflatoxin biosynthesis in Aspergillus parasiticus. Journal of
Bacteriology 177, 6246–6254.
Flaman, J.M., Fribourg, T., Moreau, V., Charbonnier, F., Martin, C., Ishioka, C.,
Friend, S.H. and Iggo, R. (1994) A rapid PCR fidelity assay. Nucleic Acids
Research 22, 3259–3260.
Frohman, M.A., Dush, M.K. and Martin G.R. (1988) Rapid production of full-length
cDNAs from rare transcripts: Amplification using a single gene-specific oligonu-
cleotide primer. Proceedings of the National Academy of Sciences USA 85,
8998–9002.
Gene Runner Version 3.00. Hastings Software, Inc. 1994.
Giardina, P., Cannio, R., Martirani, L., Marzullo, L., Palmieri, G. and Sannia, G.
(1995) Cloning and sequencing of a laccase gene from the lignin-degrading
basidiomycete Pleurotus ostreatus. Applied and Environmental Microbiology 61,
2408–2413.
Gomi, K., Arikawa, K., Kamiya N., Kitamoto, K. and Kumagai, C. (1993) Cloning
and nucleotide sequence of the acid protease-encoding gene (papA) from
Aspergillus oryzae. Bioscience, Biotechnology, Biochemistry 57, 1095–1100.
Gonzales-Candelas, L. and Kolattukudy, P.E. (1992) Isolation and analysis of a novel
inducible pectate lyase gene from the phytopathogenic fungus Fusarium solani f.
sp. pisi (Nectria haematococca, Mating Population VI). Journal of Bacteriology
174, 6343–6349.
Gonzalez, R., Ramon, D. and Perez-Gonzalez, J.A. (1992) Cloning, sequence analysis
and yeast expression of the egl1 gene from Trichoderma logibrachiatum. Applied
Microbiology and Biotechnology 38, 370–375.
Gruber, F., Visser, J., Kubicek, C.P. and DeGraaff, L. (1990) The development of a
heterologous transformation system for the cellulolytic fungus Trichoderma
reesei based on a pyrG-negative mutant strain. Current Genetics 18, 71–76.
Haas, H., Bauer, B., Redl, B., Stöffler, G. and Marzluf, G.A. (1995) Molecular cloning
and analysis of nre, the major nitrogen regulatory gene of Penicillium chryso-
genum. Current Genetics 27, 150–158.
Heidenreich, E.J. and Kubicek, C.P. (1994) Sequence of the pyr4 gene encoding
orotidine-5′-phosphate decarboxylase from the biocontrol fungus Trichoderma
harzianum. Gene 147, 151–152.
Holton, T.A. and Graham, M.W. (1990) A simple and efficient method for direct
cloning of PCR products using ddT-tailed vectors. Nucleic Acids Research 19,
1156.
Hu, G. (1993) DNA polymerase-catalyzed addition of non-templated extra nucleo-
tides to the 3′ end of a DNA fragment. DNA and Cell Biology 12, 763–770.
Hung, T., Mak, K. and Fong, K. (1990) A specific enhancer for polymerase chain
reaction. Nucleic Acids Research 18, 4953.
Innis, M.A. and Gelfand, D.H. (1990) Innis, M.A., Gelfand, D.H., Sninsky, J.J. and
White, T.J. (eds) Optimization of PCRs. In: PCR Protocols: A Guide to Methods
and Applications. Academic Press, San Diego, pp. 3–12.
Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (1990) PCR Protocols, a
Guide to Methods and Applications. Academic Press, San Diego, pp. 16, 31 and
29.
Inoue, H., Kimura, T., Makabe, O. and Takahashi, K. (1991) The gene and deduced
protein sequences of the zymogen of Aspergillus niger acid proteinase A. Journal
of Biological Chemistry 29, 19484–19489.
Jarai, G., Kirchherr, D. and Buxton, F. (1994) Cloning and characterization of the
pepD gene of Aspergillus niger which codes for a subtilisin-like protease. Gene
139, 51–57.
Kaufman, D.L. and Evans G.A. (1990) Restriction endonuclease cleavage at the
termini of PCR products. BioTechniques 9, 304–306.
Knittel, T. and Picard, D. (1993) PCR with degenerate primers containing deoxy-
inosine fails with Pfu DNA polymerase. PCR Methods and Applications 2,
346–347.
Knoth, K., Roberds, S., Poteet, C. and Tamkun, M. (1988) Highly degenerate,
inosine-containing primers specifically amplify rare cDNA using the polymerase
chain reaction. Nucleic Acids Research 22, 10932.
Kreuzinger, N., Podeu, R., Gruber, F., Göbl, F. and Kubicek, C.P. (1996) Identifica-
tion of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd
(glyceraldehyde-3-phosphate dehydrogenase) genes. Applied and Environmen-
tal Microbiology 62, 3432–3438.
Kwok, S., Chang, S.-Y., Sninsky, J.J. and Wang, A. (1994) A guide to the design and
use of mismatched and degenerate primers. PCR Methods and Applications 3,
39–47.
Lecellier, G. and Silar, P. (1994) Rapid methods for nucleic acids extraction from Petri
dish-grown mycelia. Current Genetics 25, 122–123.
Lee, B.R., Kitamoto, K., Yamada, O. and Kumagai, C. (1995) Cloning, character-
ization and overproduction of nuclease S1 gene (nucS) from Aspergillus oryzae.
Applied Microbiology and Biotechnology 44, 425–431.
Li, X.-L. and Ljungdahhl, L.G. (1994) Cloning, sequencing, and regulation of a
xylanase gene from the fungus Aureobasidium pullulans Y-2311-1. Applied and
Linz, U. (1991) Protocol optimization and the need for standardization of the
polymerase chain reaction. Methods in Molecular and Cellular Biology 2,
98–102.
Liu, Z. and Schwartz, L. (1992) An efficient method for blunt-end ligation of PCR
products. BioTechniques 12, 28–30.
Lundberg, K.S., Shoemaker, D.D., Adams, M.W.W., Short, J.M., Sorge, J.A. and
Mathur, E.J. (1991) High-fidelity amplification using a thermostable DNA
polymerase isolated from Pyrococcus furiosus. Gene 108, 1–6.
Maier, J., Witter, K., Gütlich, M., Ziegler, I., Werner T. and Ninnemann H. (1995)
Homology cloning of GTP-Cyclohydrolase I from various unrelated eukaryotes
by reverse transcription-polymerase chain reaction using a general set of
degenerate primers. Biochemical and Biophysical Research Communications 212,
705–711.
Martin, F.H., Castro, M.M., Aboul-ela, F. and Tinoco, I. Jr. (1985) Base pairing
involving deoxyinosine: implication for probe design. Nucleic Acids Research 13,
8927–8938.
Marx, F., Haas, H., Reindl, M., Stöffler, G., Lottspeich, F. and Redl, B. (1995)
Cloning, structural organization and expression of the Penicillium chrysogenum
paf gene encoding an abundantly secreted protein with antifungal activity. Gene
167, 167–171.
McClelland, M. and Nelson, M. (1987) Cleavage specificity of restriction endonu-
cleases: application to megabase mapping of chromosomes. Gene Amplification
and Analysis 5, 257–282.
Mehmann, B., Brunner, I. and Braus, G.H. (1994) Nucleotide sequence of chitin
synthase genes among ectomycorrhizal fungi and its potential use in taxonomy.
Applied and Environmental Microbiology 60, 3105–3111.
Möller, E.M., Bahnweg, G., Sandermann, H. and Geiger, H.H. (1992) A simple and
efficient protocol for isolation of high molecular weight DNA from filamentous
fungi, fruit bodies and infected plant tissues. Nucleic Acids Research 20,
6115–6116.
Müller, P.R. and Wold, B. (1989) In vivo footprinting of a muscle specific enhancer
by ligation mediated PCR. Science 246, 780–786.
Murphy, J.M. and Walton, J.D. (1996) Three extracellular proteases from Cochlio-
bolus carbonum: cloning and targeted disruption of alp1. Molecular Plant–
Microbe Interactions 9, 290–297.
Myers, T.W. and Gelfand, D.H. (1991) Reverse transcription and DNA amplification
by a Thermus thermophilus DNA polymerase. Biochemistry 30, 7661–7666.
Nielson, K., Braman, J. and Kretz, K. (1995) High-fidelity long PCR amplifications
with Pfu DNA polymerase. Strategies 8, 26.
Nikolskaya, A.N., Panaccione, D.G. and Walton, J.D. (1995) Identification of peptide
synthetase-encoding genes from filamentous fungi producing host-selective
phytotoxins or analogs. Gene 165, 207–211.
Nisson, P., Rashtchian, A. and Watkins, P. (1991) Rapid and efficient cloning of Alu-
PCR products using uracil DNA glycosylase. PCR Methods and Applications 1,
120–123.
Ochman, H., Gerber, A.S. and Hartl, D.L. (1988) Genetic applications of an inverse
polymerase chain reaction. Genetics 120, 621–625.
Ochman, H., Medhora, M.M., Garza, D. and Hartl, D.L. (1990) Amplification of
flanking sequences by inverse PCR. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J.
and White, T.J. (eds) PCR Protocols: a Guide to Methods and Applications.
Academic Press, San Diego, pp. 219–227.
Ohtsuka, E., Matsuka, S., Ikehara, M., Takahashi, Y. and Matsubara, K. (1985) An
alternative approach to deoxyoligonucleotides as hybridization probes by
insertion of deoxyinosine at ambiguous codon positions. Journal of Biological
Chemistry 260, 2605–2608.
Pääbo, S., Gifford, J.A. and Wilson, A.C. (1988) Mitochondrial DNA sequence from
a 7000-year old brain. Nucleic Acids Research 16, 9775–9787.
Rajakumar, S., Gaskell, J., Cullen, D., Lobos, S., Karahanian, E. and Vicuna, R. (1996)
lip-like genes in Phanerochaete sordida and Ceriporiopsis subvermispora, white
rot fungi with no detectable lignin peroxidase activity. Applied and Environmen-
Ramesh, M.V., Sirakova, D. and Kolattukudy, P.E. (1995) Cloning and character-
ization of the cDNAs and genes (mep20) encoding homolgous metalloprotein-
ases from Aspergillus flavus and A. fumigatus. Gene 165, 121–125.
Reichard, U., Monod, M. and Rüchel, R. (1995) Molecular cloning and sequencing of
the gene encoding an extracellular aspartic proteinase from Aspergillus fumiga-
tus. FEMS Microbiology Letters 130, 69–74.
Rollo, F., Sassaroli, S. and Ubaldi, M. (1995) Molecular phylogeny of the fungi of the
Iceman’s grass clothing. Current Genetics 28, 289–297.
Sarkar, G., Kapelner, S. and Sommer, S. (1990) Formamide can dramatically improve
the specificity of PCR. Nucleic Acids Research 18, 7465.
Scharf, S.J., Horn, G.T. and Erlich, H.A. (1986) Direct cloning and sequence analysis
of an enzymatically amplified genomic sequences. Science 233, 1076–1078.
Scott-Craig, J.S., Panaccione, D.G., Cervone, F. and Walton, J.D. (1990) Endopolyga-
lacturonase is not required for pathogenicity of Cochliobolus carbonum on
maize. The Plant Cell 2, 1191–1200.
Sheppard, P.O., Grant, F.J., Oort, P.J., Sprecher, C.A., Foster, D.C., Hagen, F.S.,
Upshall, A., McKnight, G.L. and O’Hara, P.J. (1994) The use of conserved
cellulase family-specific sequences to clone cellulase homologue cDNAs from
Fusarium oxysporum. Gene 150, 163–167.
Silver, J. and Keerikatte, V. (1989) Novel use of polymerase chain reaction to amplify
cellular DNA adjacent to an integrated provirus. Journal of Virology 63,
1924–1928.
Simcox, T., Marsh, S., Gross, E., Lernhard, W., Davis, S. and Simcox, M. (1991) SrfI
a new type-II restriction endonuclease that recognizes the octanucleotide
sequence, 5′-GCCC/GGGC-3′. Gene 109, 121–123.
Sirakova, T.D., Markaryan, A. and Kolattukudy, P.E. (1994) Molecular cloning and
sequencing of the cDNA and gene for a novel elastinolytic metalloproteinase
from Aspergillus fumigatus and its expression in Escherichia coli. Infection and
Immunity 62, 4208–4218.
Stone, P.J., Makoff, A.J., Parish, J.H. and Radford, A. (1993) Cloning and sequence
analysis of the glucoamylase gene of Neurospora crassa. Current Genetics 24,
205–211.
Strauss, J., Mach, R.L., Zeilinger, S., Hartler, G., Stoeffler, G., Wolschek, M. and
Kubicek, C.P. (1995) Cre1, the carbon catabolite repressor protein from
Trichoderma reesei. FEBS Letters 376, 103–107.
Tao, Y. and Chen, K.J. (1994) PCR-based cloning of the full lenght Neurospora
eucaryotic initiation factor 5A cDNA: polyhistidine-targetting and overexpres-
sion for protein affinity binding. Biochemical Journal 302, 517–525.
Törrönen, A., Mach, R.L., Messner, R., Gonzalez, R., Harkki, A., Kalkinnen, N. and
Kubicek, C.P. (1992) The two major xylanases from Trichoderma reesei:
Characterization of both enzymes and genes. Bio/Technology 10, 1461–1467.
Triglia, T., Peterson M.G. and Kemp D.J. (1988) A procedure for in vitro amplifica-
tion of DNA segments that lie outside the boundaries of known sequences.
Nucleic Acids Research 16, 8186.
Van den Brink, H.J.M., Van Zeijl, M.J., Brons, J.F., Van den Hondel, C.A.M.J.J. and
Gorcom, R.F.M. (1995) Cloning and characterization of the NADPH cyto-
chrome P450 oxidoreductase gene from the filamentous fungus Aspergillus niger.
DNA and Cell Biology 14, 719–729.
Yajima, H., Inoue, H., Oikawa, A. and Yasui, A. (1991) Coning and functional
characterization of a eucaryotic DNA photolyase gene from Neurospora crassa.
Yamaguchi, S., Mase T. and Takeuchi, K. (1991) Cloning and structure of the mono-
and diacylglycerol lipase-encoding gene from Penicillium camembertii U-150.
Gene 103, 61–67.
Yatzkan, E. and Yarden, O. (1995) Inactivation of a single-2A phosphoprotein
phosphatase is letal in Neurospora crassa. Current Genetics 28, 458–466.
Young, J.L. and Marzluf, G.A. (1991) Molecular comparison of the negative acting
nitrogen control gene, nmr, in Neurospora crassa and other Neurospora and
fungual species. Biochemical Genetics 29, 447–459.
DDRT–PCR for Screening of 3
Fungal Gene Expression
Ernesto P. Benito1 and Jan A.L. van Kan2
1
Area de Genética. Departamento de Microbiologı́a y Genética,
Universidad de Salamanca, Edificio Departamental, Avenida del
Campo Charro S/N. 37007, Salamanca, Spain; 2Department of
Phytopathology, Wageningen Agricultural University, POB 8025,
6700 EE Wageningen, The Netherlands
3.1 Introduction
Every biological process results from selective expression of the genome.

Processes such as cell division and proliferation, differentiation, ageing and
response to stress situations are governed by modulation of the expression of
specific genes or sets of genes. Studies on differential gene expression have
therefore attracted much interest and research effort. Until recently, the
isolation of differentially expressed genes has largely relied on differential
hybridization (Sargent, 1987) and subtractive hybridization procedures (Lee
et al., 1991). These methods are laborious and time-consuming, and usually
require relatively large amounts of starting material. Furthermore, their
sensitivity is limited, only allowing the detection of relatively abundant
mRNAs. In 1992 a new procedure for differential gene expression analysis
was described: ‘differential display reverse transcriptase–polymerase chain
reaction’ (DDRT–PCR) (Liang and Pardee, 1992). This method makes it
feasible to display the full set of mRNAs in a particular cell type and to
compare expression patterns, either with other cell types or with cells
subjected to other experimental conditions. DDRT–PCR possesses several
advantages over subtractive and differential hybridization procedures.
Firstly, it is quicker because probes for Southern and Northern blot analysis
as well as partial sequence information of differentially expressed genes may
be made available in a few days. Secondly, only a small amount of biological
material is required, making this methodology particularly useful when the
amount of starting material is limiting (Zimmermann and Schultz, 1994).
Thirdly, the application of PCR increases the sensitivity and thereby allows
the detection of low abundance mRNAs (Liang and Pardee, 1992). These
48 E.P. Benito and J.A.L. van Kan
features all contribute to the power and utility of this method. Since it was
first described, refinements have been introduced and the procedure has been
applied in a wide variety of biological systems (reviewed by Liang and
Pardee, 1995).
We have applied DDRT–PCR to study gene expression in Botrytis
cinerea, a ubiquitous fungal plant pathogen causing important economic
losses in many agricultural crops (Jarvis, 1977). The aim of this research is to
investigate fungal gene expression in planta during the interaction of B.
cinerea with the host plant, tomato (Lycopersicon esculentum). We assume
that mutual signalling during the interaction results in changes in gene
expression both in the fungus (for activation of mechanisms for penetration
and colonization of the host tissue) and in the plant (for activation of defence
responses). Among the fungal genes whose expression is induced during the
interaction, it is likely that some of the genes are essential for pathogenesis.
To this end, it was decided to undertake a systematic comparison of gene
expression of the fungus in planta and during growth in liquid culture. When
studying such a system, the limiting factor is the small amount of fungal
biomass in the interaction material, particularly during early stages of the
infection process. Therefore a highly sensitive method, such as PCR, is
required.
In this chapter we summarize the principles of DDRT–PCR and
experimental parameters that were considered during the development of the
methodology. Furthermore we describe its application to the analysis of B.
cinerea gene expression in planta. Our results illustrate the high sensitivity
and versatility of the method.
3.2 Principles of DDRT–PCR
The differential display procedure is designed for the identification and

isolation of genes that are differentially expressed in various cell populations
under defined conditions. It combines techniques that are commonly applied
in molecular biological research: reverse transcription, PCR and electropho-
resis in polyacrylamide gels (Fig. 3.1). In the first step, a subpopulation of
mRNAs is reverse transcribed into cDNA by using an ‘anchored’ 3′ primer,
taking advantage of the presence of a poly(A) tail in most eukaryotic
mRNAs. The anchored primer consists of a number of thymidine residues
(usually 11), which anchor it to the poly(A) tail of the mRNA, plus two
additional nucleotides at its 3′-extreme which provide the specificity of the
annealing. Such a primer anneals selectively to mRNAs containing two
nucleotides complementary to those at the 3′-end of the primer immediately
upstream of the poly(A) tail. In total, 12 anchored primers can be designed
(12 different combinations of the last 3′ nucleotides omitting thymidine at the
penultimate position). Thus, 12 cDNA subpopulations need to be generated
if the entire mRNA population is to be analysed. The reduction of template
DDRT–PCR and Fungal Gene Expression 49
Fig. 3.1. Principles of DDRT–PCR (N = adenosine, guanosine or cytosine; M = any

nucleotide).
complexity by using selective anchored primers for cDNA synthesis is an

essential step in the procedure.
PCR is subsequently performed on each of the cDNA subpopulations,
using the same anchored primer applied in cDNA synthesis in combination
with a small (10-mer) upstream primer. Any cDNA species is suitable for
amplification by PCR if the distance between the poly(A) tail and the
position at which an upstream primer anneals is smaller than 2–3 kb. For a
5′ primer of arbitrary nucleotide sequence, annealing positions (if present)
are distributed randomly upstream of the poly(A) tail. The resulting
amplified products represent only parts of a particular mRNA species (3′)
and products derived from various mRNAs will differ in length. If PCR is
performed in the presence of a labelled nucleotide (usually [α-33P]dATP), the
amplified products can be resolved in a polyacrylamide gel and visualized as
discrete bands by autoradiography. The band patterns of samples derived
from different cell types or from cells cultured in different conditions are
analysed in parallel. Fragments of cDNA representing differentially
expressed mRNAs can be recovered from the gel and used to further
characterize the corresponding genes.
3.2.1 Considerations for experimental parameters

Since it was first described in 1992, the differential display methodology has
been applied to a variety of biological systems. Many groups have adapted
the original protocol to their particular systems and requirements. Although
general guidelines can be given, it is our experience that the optimal
conditions must be found by each user when applied to a particular system.
Below, we will discuss briefly the main variations that can be considered in
each step of the differential display procedure and point out the conditions
that we have found most appropriate in our system.
Starting material and reverse transcription

The most critical factor influencing DDRT–PCR analysis is the quality of the
starting material. Protocols for RNA isolation yielding undegraded and
highly purified RNA should be used (guanidinium thiocyanate-based
protocols usually give good results). Both total RNA and poly(A)+-RNA
can be used as template for reverse transcription and nearly identical band
patterns are obtained (Liang et al., 1993). For simplicity, total RNA has been
used in many cases. In our hands, however, better results were obtained using
poly(A)+-RNA, in terms of both the number of bands produced and
reproducibility.
The original protocol made use of anchored primers with two selective
nucleotides for the cDNA synthesis. More recently, protocols have been
described which use anchored primers with two selective nucleotides in
which the penultimate position is degenerate (Liang et al., 1993), or anchored
primers with only one selective nucleotide (Liang et al., 1994). Such primers
have allowed a significant reduction of the number of cDNA synthesis
reactions required for each RNA sample. However, the use of such primers
will generate cDNA populations of higher complexity that serve as templates
in the subsequent PCR step, resulting in bands occupying almost every
position of the gel. This makes the analysis of the band patterns more
complicated. Additionally, as pointed out by Bertioli et al. (1995), a reduction
of template complexity will contribute to an increase in the sensitivity of the
DDRT–PCR procedure for any particular cDNA species.
Polymerase chain reaction

The experimental conditions used for PCR amplifications of complex
templates in the differential display procedure are different from conditions
applied in standard PCR applications. In the original protocol (Liang and
Pardee, 1992), 13 nucleotide-long anchored primers were used in combina-
tion with decamers of arbitrary sequence. Low annealing temperatures in the
PCR profile are required for annealing of short primers but will also allow
mismatches. This appears to be essential for the priming of at least a fraction
of the templates. In our hands, temperatures higher than 42°C resulted in a
drastic reduction in the number of bands detected while temperatures lower
than 40°C produced bands occupying nearly every position in the lane. It
was experimentally determined that the specificity of the amplification
increases when the dNTP concentration is decreased from 200 µM to 2 µM
(Liang and Pardee, 1992). A low dNTP concentration was also essential for
labelling the PCR products to a specific activity high enough for detection
on an autoradiogram.
An average of 120 bands in the size range of 100–600 nucleotides are
consistently detected per primer combination when applied to a higher
eukaryotic system. Assuming that about 15,000 genes are expressed in a
higher eukaryotic cell, theoretical considerations indicate that at a confidence
level of 0.95 the entire mRNA population is displayed, when 12 anchored
primers with two selective nucleotides are used in combination with at least
25 upstream primers (Bauer et al., 1993).
Liskens et al. (1995) reported the use of 5′-extended primers as a means
of enhancing the reproducibility of the differential display technique.
Primers with a length of 22 nucleotides were used in a PCR profile including
a few initial cycles at low annealing temperatures. At low temperatures, these
primers behave in a similar way to the decamer primers used in the original
differential display protocol, since the sequence at the 3′-extreme determines
the priming specificity. Subsequent PCR cycles are performed at higher
annealing temperatures, resulting in very efficient amplification of the
products obtained during the first cycles. This procedure should improve the
signal-to-noise ratio of individual bands. The extended primers can be
designed so that they contain a restriction site at their 5′-end, making
subsequent manipulations easier.
Separation and retrieval of bands

Polyacrylamide gels provide the resolution needed to analyse the complex
mixtures of amplified cDNAs after PCR. Denaturing polyacrylamide gels
have been used in most applications, although for fragments smaller than 200
nucleotides the band patterns generated are more complex. Many of the
bands appear as doublets representing both strands of each fragment as a
result of the denaturing conditions. Non-denaturing polyacrylamide gels
have been used to reduce the complexity of the band patterns (Bauer et al.,
1993). We have found that a non-denaturing system gives reproducible
patterns and is particularly useful when very complex cDNA mixtures are to
be analysed (Benito et al., 1996).
The bands of interest can easily be recovered from the gel by a simple
boiling method (Zimmerman and Schultz, 1994). They should be reamplified
in reactions containing higher dNTPs concentrations (20 µM) to produce
enough DNA for isolation from agarose gels and subsequent cloning.
AmpliTaq has most frequently been the enzyme of choice. Because this
enzyme adds a single (non-encoded) adenosine to the 3′-end of most of the
reaction products, linearized vectors containing 3′-T overhangs are com-
monly used to clone the PCR products. Cloning strategies based on blunt-
end ligation of PCR products are also used. The cloned fragments can be
used as probes in Northern and Southern blot analyses for the isolation of
the full length cDNA and genomic copies of the gene from libraries.
Furthermore, the sequence of the cloned fragments can yield information
about the nature of the differentially expressed mRNAs that were detected.
Reproducibility and reliability

The DDRT–PCR procedure generates highly reproducible band patterns
with the same RNA sample. More than 95% of the bands are detected in
common in duplicate reactions and most of the differences observed concern
the intensity of the bands (Bauer et al., 1993). To maximize the reproducibil-
ity and accuracy of the method in a given experiment, the samples to be
analysed should preferably be processed in parallel and in an identical
manner. This must be done for every step in the procedure, from RNA
isolation to electrophoresis. The same buffers and reagents and, whenever
possible, the same batch of enzymes should be used for the entire procedure.
In spite of all the precautions taken, false-positive bands are frequently
detected. These include differential bands which fail to detect any mRNA on
Northern blots or bands representing non-induced mRNAs. These bands are
usually non-reproducible and can be generated as a result of the large number
of PCR cycles at low stringency temperatures (Liskens et al., 1995).
Performing the analysis of every RNA sample in duplicate may help to
discriminate between true- and false-positive bands (Liang et al., 1993).
Another source of false-positive bands is the presence of contaminating
chromosomal DNA in the RNA sample co-purified during the extraction
procedure. This is less of a problem when poly(A)+-RNA is used instead of
total RNA for the DDRT–PCR analysis. A DNaseI treatment can be
included in the protocol to remove traces of chromosomal DNA (Liang et
al., 1993). However, this extra treatment may lead to partial RNA degrada-
tion, since DNaseI preparations are never completely free of RNase activity.
3.3 Principles of Differential Display in a Plant–Fungal

Pathogen Interaction
We have applied the DDRT–PCR methodology to the analysis of differential

gene expression in a complex plant–fungus interaction system, Lycopersicon
esculentum–B. cinerea. Since two organisms are present in the interaction,
cDNAs from both will be detected by differential display (Fig. 3.2). Most of
these cDNAs represent fungal or plant genes which are constitutively
expressed. Their origin can be discriminated if the expression pattern of both
organisms displayed during the interaction is compared with the expression
pattern of the fungus grown in vitro and with the expression pattern of a
non-infected tomato plant. Interaction-specific cDNAs are also detected
which represent either fungal genes induced in planta or plant genes induced
in response to the pathogen. Both categories can be discriminated if samples
from control infections with a second pathogen are included in the
comparative gene expression analysis.
3.3.1 The pathosystem B. cinerea–tomato

To investigate the infection process of B. cinerea on detached tomato leaves
we first established a standardized inoculation procedure. Experimental
conditions were designed that determine high infection efficiency by
inducing high germination rates of conidia on the leaves and synchronicity
of the infection in different lesions. Synchronous infection is essential for a
successful temporal analysis of fungal gene expression in planta. Under the
experimental conditions used, the first symptoms are detectable 20 h post-
inoculation (h.p.i.). At this time-point small necrotic lesions start appearing
over the leaf surface. The lesions become darker during the following 48 h
but neither the number of lesions nor their size increases. At 72 h.p.i., about
1–5% of the total number of lesions start to expand and from these lesions
the fungus is able to colonize the whole leaf. At about 120–140 h.p.i. total leaf
necrosis is observed and the fungus sporulates on the surface of the
necrotized plant tissue. We analysed gene expression of the fungus at two
different stages of the infection process: at 16 h.p.i. when no symptom is yet
visible but the fungus has already penetrated the host cells, and at 72 h.p.i.
at the onset of the formation of spreading lesions.
3.3.2 Sensitivity of the DDRT–PCR procedure

In order to determine whether it is possible to detect fungal gene expression in
planta at these time-points, we estimated the proportion of fungal biomass in
leaves during the infection process over time. B. cinerea was inoculated on
tomato leaves which were sampled at different times after inoculation. Equal
amounts of RNA extracted from these samples were electrophoresed, blotted
and hybridized with a probe derived from the B. cinerea β-tubulin (tubA) gene,
Fig. 3.2. Schematic representation of a ‘differential display’ gel indicating the origins of
the bands expected when applying DDRT–PCR to the analysis of a plant–fungal
pathogen interaction.
which is assumed to be expressed constitutively (E.P. Benito and J.A.L. van

Kan, unpublished results). The intensities of the signals detected at different
time-points were compared with the intensity of the signal obtained on RNA
extracted from a B. cinerea liquid culture in vitro. This intensity ratio provides
an estimation of the proportion of fungal RNA/interaction RNA, and
therefore of fungal biomass in the interaction material, during the infection. As
shown in Fig. 3.3A, this proportion is about 3–5% at the time-points analysed.
Fig. 3.3. (A) Estimation of the proportion of fungal biomass on infected tomato leaves
during the infection process. Lanes: B.c., total RNA extracted from B. cinerea cultured in
vitro; L.e., non-infected tomato leaves; I.B.c., B. cinerea-infected tomato leaves sampled at
the indicated time-points (h.p.i.) 0.20 pg of each RNA sample were separated by
acrylamide gel electrophoresis, blotted on to a nylon membrane and hybridized with a B.
cinerea β-tubulin (tubA) gene. The values used to generate the graph in the lower part of
the figure represent the relative intensities of the signal obtained with each time-point
sample in comparison with the signal obtained with the B. cinerea in vitro-cultured
sample. The same filter was probed with a radish 18S rDNA probe (clone pRG3) (Grellet
et al., 1989) to demonstrate equal loading. (B) Sensitivity of the DDRT–PCR procedure.
cDNAs synthesized with primer RT3 on mRNAs from healthy tomato leaves and B.
cinerea grown in vitro were mixed and subjected to PCR amplification using the same
anchored primer in combination with the 10-mer primer P35. Each lane shows the
amplified products obtained using different proportions (ratios indicated above each lane)
of tomato–B. cinerea cDNA mixtures as templates. Reproduced from Benito et al. (1996)
by permission of Kluwer Academic Publishers.
Using DDRT–PCR, is it possible to detect and discriminate fungal

mRNAs within such a complex mRNA mixture containing only 3–5% of
fungal mRNA? We investigated this question by performing a reconstruction
experiment. mRNA from B. cinerea in vitro liquid cultures and from healthy
tomato leaves were reverse transcribed using anchor primer RT3. The plant
cDNA and serial dilutions of the fungal cDNA were mixed and PCR was
performed. As shown in Fig. 3.3B, most of the bands detected using cDNAs
from healthy leaves (lane 1:0) and cDNAs from B. cinerea grown in vitro
(lane 0:1) as template in PCR, are also detected in a single lane when equal
amounts of both cDNAs are mixed and used as template (lane 1:1). When
cDNA from B. cinerea grown in vitro is diluted in relation to cDNA from
healthy leaves, the intensity of the bands representing B. cinerea cDNAs
decreases with increasing dilution, while the intensity of the bands represent-
ing plant cDNAs remains constant (lanes 1:1/10–1:1/100). Even at the
highest dilution tested, several B. cinerea cDNA-derived bands are still
detectable. In the sample with the 1/30 dilution factor a large proportion of
bands representing B. cinerea cDNAs are detected. Since the amount of
fungal cDNA in this sample is comparable to that from an infected leaf in
which 3% of the interaction mRNA is from B. cinerea, we assumed that the
DDRT–PCR procedure was sensitive enough to apply to our experimental
system. However, it must be noted that the weakest bands detected in the B.
cinerea in vitro-grown sample are not detected in the reconstruction sample,
suggesting that some fungal mRNAs expressed at a low level in planta may
be overlooked.
3.3.3 Analysis of the expression pattern in the B. cinerea–tomato

interaction
We initiated the analysis of B. cinerea in planta gene expression. As
mentioned above, samples from control interaction systems are required to
discriminate fungal genes induced in planta from plant genes induced in
response to the pathogen. A useful control interaction in our experimental
approach should mimic as much as possible the plant defence response
induced by B. cinerea. For this purpose, we used two different pathogens: the
fungus Phytophthora infestans and tobacco necrosis virus (TNV). On tomato
leaves, P. infestans induces necrotic spots that appear in the centre of water-
soaked areas at about 50–55 h.p.i., whereas TNV induces small necrotic spots
at 70 h.p.i. For both control pathogens, samples were collected shortly before
symptoms became detectable: 40 h.p.i. for P. infestans-infected leaves and 60
h.p.i. for TNV-infected leaves.
A first set of experiments was performed in order to determine the best
conditions for DDRT–PCR analysis and to test the validity of our experi-
mental approach on a limited number of samples: B. cinerea-infected tomato
leaves collected at 16 h.p.i.; B. cinerea cultured in vitro; non-infected tomato
leaves; and P. infestans-infected tomato leaves.
Figure 3.4A shows a representative example of a differential display gel
obtained. In all experiments duplicate reactions were included of the B.
cinerea–tomato interaction samples (using cDNAs derived from two inde-
pendent reverse transcriptase reactions) to reduce the number of false-
positive bands. An average of 100–120 bands were detected in lanes from
Fig. 3.4. (A) Example of a ‘differential display’ gel. mRNA samples were reverse
transcribed with anchored primer RT2 and PCR amplifications were performed using the
same anchored primer in combination with eight different upstream primers (P1–P8). For
each primer combination samples are as indicated in (B). (B) Detail of the band patterns
obtained by ‘differential display’ with primers RT2 and P1 using cDNAs derived from
mRNAs obtained from: I.P.i., P. infestans–tomato interaction 40 h.p.i.; I.B.c., B. cinerea–
tomato interaction 16 h.p.i. (duplicate reactions, 16 h-1 and 16 h-2); L.e., healthy tomato
leaves; B.c., B. cinerea grown in vitro. The arrows indicate interaction-specific bands.
Reproduced from Benito et al. (1996) by permission of Kluwer Academic Publishers.
plant cDNA samples, while 70–80 bands were detected in samples derived
from B. cinerea grown in vitro. About 15–20% of the latter bands were also
detected in the B. cinerea–tomato interaction lane for most of the primer
combinations. Figure 3.4B shows in detail the patterns obtained with a given
primer combination. In addition to the bands representing constitutively
expressed mRNAs from B. cinerea and tomato, novel bands are detected in
samples derived from B. cinerea-infected tomato leaves (indicated by
arrows). Some of these bands are also detected in samples from P. infestans-
infected tomato leaves (arrows 2 and 3) and probably represent plant defence
genes induced in response to both pathogens. Other bands are apparently
specific to the B. cinerea–tomato interaction and are candidates to represent
B. cinerea mRNAs induced in planta (arrow 1).
In view of the fact that interaction-specific bands were detected, the
analysis was extended including mRNA samples derived from B. cinerea-
infected tomato leaves collected 72 h.p.i. and from TNV-infected tomato
leaves as a second control interaction system. In total, 52 primer combina-
tions were used (two anchored primers and 26 upstream primers) in these
experiments and 22 B. cinerea–tomato interaction-specific fragments were
detected. About 4000 B. cinerea cDNA fragments derived from genes
expressed in vitro were displayed, of which 700–800 were also detected in
interaction samples. Since we have examined only two out of the 12 possible
cDNA subpopulations, the entire analysis should yield about 4000–5000 B.
cinerea cDNA fragments derived from genes expressed in planta.
3.3.4 Further characterization of bands of interest

Further characterization of ‘differential’ bands detected by DDRT–PCR
includes confirmation of differential expression by Northern blot analysis
and cloning to obtain sequence information. In an interaction between two
organisms, the origin of the differentially displayed bands needs to be
determined. To this end, these bands were recovered from the gel,
reamplified, labelled and hybridized to a Southern blot containing HindIII
digests of genomic DNA from tomato and from B. cinerea (we have found
that labelling by PCR is a much more effective procedure for labelling small
DNA fragments such as those obtained in DDRT–PCR analysis than
labelling by ‘random priming’). Four fragments hybridizing with genomic
DNA of B. cinerea were selected for further analysis. It is commonly
observed in differential display analysis that single bands represent several
molecular species of the same size (Callard et al., 1994; Li et al., 1994). To
test this possibility the fragments hybridizing with B. cinerea genomic DNA
were cloned and inserts from individual plasmids were used to confirm the
hybridization pattern on Southern blots. Only inserts reproducing the
hybridization pattern originally obtained were used for in planta gene
expression analysis on a time-course Northern blot. Two of the four
fragments tested appeared to be homogeneous while the other two were
mixtures of at least two different DNA fragments: only one of the fragments
reproduced the initial hybridization pattern whereas the second one
hybridized neither to B. cinerea nor to plant genomic DNA. Northern blot
analysis confirmed differential expression in planta for three of the cDNAs
detected and these are currently characterized in detail. The fourth one did
not detect any signal on the Northern blot, probably due to a low level
of expression.
When large numbers of ‘differential’ fragments are to be tested,
alternative screening procedures based on ‘mass’ analysis can be performed
(Mou et al., 1994). Duplicate filters containing equal amounts of the cDNA
fragments of interest are probed with labelled total genomic DNA to
determine the origin of the cDNAs isolated and with labelled cDNA
synthesized using mRNAs isolated from the sources under investigation.
Many fragments can be processed simultaneously in this way. However, the
method has limitations since frequently, as mentioned above, differential
bands represent a mixture of DNA sequences. In this situation, positive
cDNAs expressed at low levels can be overlooked.
Sequencing of the cloned fragments can provide information about the
nature of the fragments detected through database searches. According to the
principle of the differential display procedure, the fragments displayed
represent the 3′ extreme of the mRNA molecules. Usually the two primers
used to amplify a particular fragment are found at the extremes, thereby
providing information about the orientation of the fragment. A limitation of
the procedure is that the amplified fragments are relatively small and only
represent a (largely untranslated) part of the mRNA, thus restricting the
usefulness of the sequence information obtained (Sompayrac et al., 1995).
Furthermore, fragments often arise as a result of amplification primed by
only one of the two primers used in the PCR (Guimarães et al., 1995). Such
fragments are likely to represent internal regions of the cDNA molecules. In
either case, the reamplified fragments can be used as probes to isolate the full
length cDNA and genomic copies of the genes of interest.
3.4 Perspectives
As predicted by Liang and Pardee in 1992, the differential display

methodology has found a broad range of applications. The potential of the
methodology is enormous. As originally described, the method is only
qualitative (Liang and Pardee, 1992), but modifications have been proposed
which would make the method semiquantitative, with potential applications
in diagnostic procedures (Bauer et al., 1993; Guimarães et al., 1995).
Moreover, it is not limited to the comparison of two mRNA samples, like
subtraction-based methods. Instead it allows the comparison of multiple
mRNA samples, for instance in the analysis of spatial or temporal gene
expression (tissue-specific expression, different developmental stages)
(Utans et al., 1994; Guimarães et al., 1995). Furthermore, its sensitivity is
high, although this is controversial. Bertioli et al. (1995) presented
experimental data suggesting that differential display shows a strong bias
towards high copy number mRNAs. Guimarães et al. (1995), on the
contrary, demonstrated that DDRT–PCR is able to detect low abundance
mRNAs. Our results support the high level of sensitivity of the method,
since induced mRNAs were detected within a subpopulation of mRNAs
which constitutes only 3–5% of the total infected leaf mRNA population
(Benito et al., 1996).
Differential display has become the method of choice to detect and
isolate differentially expressed genes in many biological systems, mainly
higher eukaryotes. Both basic and applied (clinical and medical) areas of
research have benefited from DDRT–PCR in mammalian systems (Utans
et al., 1994; Zimmermann and Schultz, 1994; Liskens et al., 1995; Yeatman
and Mao, 1995) and several groups have reported its successful application
in plants (Goormachtig et al., 1995; Sharma and Davis, 1995; van der Knaap
and Kende, 1995; Wilkinson et al., 1995). Our work presents one of the
first reports on the application of DDRT–PCR to the analysis of differential
gene expression in a lower eukaryote, such as a phytopathogenic fungus.
Fungi have been used as model systems in fundamental (genetics,
biochemistry) and applied (biotechnology, phytopathology, biomedicine)
areas of research in the last decades. Information derived from fungal
systems has provided significant contributions to the understanding of more
complex higher eukaryotic systems. Undoubtedly, DDRT–PCR will be a
useful tool when applied to the analysis of differential gene expression in
processes of basic interest like mating, morphogenesis and dimorphism.
Appleyard et al. (1995) have demonstrated the potential of the differential
display methodology for the isolation of genes of biotechnological interest
from a filamentous fungus, Gibberella fujikuroi. Chen et al. (1996) used
the method to examine the alteration of gene expression of the chestnut
blight fungus (Cryphonectria parasitica) when infected with a virulence-
attenuating hypovirus. We have successfully applied this methodology to
the analysis of differential gene expression in a plant–fungus interaction and
demonstrated that it possesses enough sensitivity to analyse fungal gene
expression in planta. Provided the appropriate controls are included, plant
defence genes induced by a pathogen can also be identified (Benito et al.,
1996), demonstrating the versatility of the methodology. Such a procedure
enables the study of several aspects of plant–pathogen interactions. It is
foreseeable that the DDRT–PCR methodology will find numerous
applications in mycology.
Acknowledgements
We are grateful to Dr Arturo P. Eslava, Dr Paul H. Goodwin and Ir Theo W.

Prins for critical reading of the manuscript. E.P.B. is recipient of an EC
fellowship under the framework of the Training and Mobilitity of Research-
ers Programme (contract no. ERBFMBICT960969).
References
Appleyard, V.C.L., Unkles, S.E., Legg, M. and Kinghorn, J.R. (1995) Secondary
metabolite production in filamentous fungi displayed. Molecular and General
Genetics 247, 338–342.
Bauer, D., Müller, H., Reich, J., Riedel, H., Ahrenkiel, V., Warthoe, P. and Strauss, M.
(1993) Identification of differentially expressed mRNA species by an improved
display technique (DDRT–PCR). Nucleic Acids Research 21, 4272–4280.
Benito, E.P., Prins, T. and van Kan, J.A.L. (1996) Application of differential display
RT–PCR to the analysis of gene expression in a plant–fungus interaction. Plant
Bertioli, D.J., Schlichter, U.H.A., Adams, M.J., Burrows, P.R., Steinbiß, H-H. and
Antoniw, J.F. (1995) An analysis of differential display shows a strong bias
towards high copy number mRNAs. Nucleic Acids Research 23, 4520–4523.
Callard, D., Lescure, B. and Mazzolini, L. (1994) A method for the elimination of
false positives generated by the mRNA differential display technique. Bio-
Chen, B., Gao, S., Choi, G.H. and Nuss, D.L. (1996) Extensive alteration of fungal
gene transcript accumulation and elevation of G-protein-regulated cAMP levels
by a virulence-attenuating hypovirus. Proceedings of the National Academy of
Sciences USA 93, 7996–8000.
Goormachtig, S., Valerio-Lepiniec, M., Szczyglowsky, K., van Montagu, M., Hol-
sters, M. and de Bruijn, F.J. (1995) Use of differential display to identify novel
Sesbania rostrata genes enhanced by Azorhizobium caulinodans infection.
Molecular Plant–Microbe Interactions 6, 715–721.
Grellet, F., Delcasso-Tremousaygue, D. and Delseny, M. (1989) Isolation and
characterization of an unusual repeated sequence from the ribosomal intergenic
spacer of the crucifer Sisymbrium irio. Plant Molecular Biology 12, 695–706.
Guimarães, M.J., Lee, F., Zlotnik, A. and McClanahan, T. (1995) Differential display
by PCR: novel findings and applications. Nucleic Acids Research 23, 1832–1833.
Jarvis, W. (1977) Botryotinia and Botrytis Species: Taxonomy, Physiology and
Pathogenicity. Canada Department of Agriculture. Monograph 15, 195 pp.
Lee, S.W., Tomasetto, C. and Sager, R (1991) Positive selection of candidate tumor
suppressor genes by subtractive hybridization. Proceedings of the National
Academy of Sciences USA 88, 2825–2829.
Li, F., Barnathan, E.S. and Kariko, K. (1994) Rapid method for screening and cloning
cDNAs generated in differential display, application of Northern blot affinity
capturing of cDNAs. Nucleic Acids Research 22, 1764–1765.
Liang, P. and Pardee, A.B. (1995) Recent advances in differential display. Current
Opinions in Immunology 7, 274–280.
eukaryotic mRNAs by means of differential display: refinements and optimiza-
tions. Nucleic Acids Research 21, 3269–3275.
Liang, P., Zhu, W., Zhang, X., Guo, Z., O’Connell, R.P., Averboukh, L., Wang, F. and
Pardee, A.B. (1994) Differential display using one-base anchored oligo-dT
primers. Nucleic Acids Research 22, 5763–5764.
Liskens, M.H.K., Feng, J., Andrews, W.H., Enlow, B.E., Soati, S.M., Tonkin, L.A.,
Funk, W.D. and Villeponteau, B. (1995) Cataloging altered gene expression in
young and senescent cells using enhanced differential display. Nucleic Acids
Research 23, 3244–3251.
Mou, L., Miller, H., Li, J., Wang, E. and Chalifour, L.(1994) Improvements to the
differential display method for gene analysis. Biochemical and Biophysical
Research Communications 199, 564–569.
Sargent, T.D. (1987) Isolation of differentially expressed genes. In: Berger, S.L. and
Kimmel, A.R. (eds.), Methods in Enzymology, Vol. 152. Guide to Molecular
Cloning Techniques. Academic Press, San Diego, pp. 423–432.
Sharma, Y.K. and Davis, K.R.(1995) Isolation of a novel Arabidopsis ozone-induced
cDNA by differential display. Plant Molecular Biology 29, 91–98.
Sompayrac, L., Jane, S., Burn, T.C., Tenen, D.G. and Danna, K.J. (1995) Overcoming
limitations of the mRNA differential display technique. Nucleic Acids Research
22, 4738–4739.
Utans, U., Liang, P., Wyner, L.R., Karnovsky, M.J. and Russel, M.E. (1994) Chronic
cardiac rejection: identification of five upregulated genes in transplanted hearts
by differential mRNA display. Proceedings of the National Academy of Sciences
USA 91, 6463–6467.
van der Knaap, E. and Kende, H. (1995) Identification of a gibberellin-induced gene
in deepwater rice using differential display of mRNA. Plant Molecular Biology
28, 589–592.
Wilkinson, J.Q., Lanahan, M.B., Conner, T.W. and Klee, H.J. (1995) Identification of
mRNAs with enhanced expression in ripening strawberry fruit using polymerase
chain reaction differential display. Plant Molecular Biology 27, 1097–1108.
Yeatman, T.J. and Mao, W. (1995) Identification of a differentially-expressed message
associated with colon cancer liver metastasis using an improved method of
differential display. Nucleic Acids Research 23, 4007–4008.
Zimmermann, J.W. and Schultz, R.M. (1994) Analysis of gene expression in the
preimplantation mouse embryo: use of the mRNA differential display. Proceed-
ings of the National Academy of Sciences USA 91, 5456–5460.
Interpretation of PCR 4
Methods for Species
Definition
P.D. Bridge1 and D.K. Arora2
1
CABI BIOSCIENCES UK Centre, Bakeham Lane, Egham, Surrey,
TW20 9TY, UK; 2Department of Botany, Banaras Hindu University,
Varanasi 221 005, India
4.1 Introduction
The introduction of molecular biological techniques has been a major force

in the areas of systematics and population biology of filamentous fungi.
Unlike the development of taxonomy with bacteria and yeasts, biochemical
techniques did not become fully established in the systematics of filamentous
fungi, and so the changes that brought about the movement from morpho-
logical to molecular characteristics have been very significant. The introduc-
tion of PCR-based methods has significantly increased the level of activity in
fungal systematics. The simplicity of the techniques, coupled with the general
use of particular regions of the genome, has resulted in many important
advances in our understanding of taxonomic groupings as well as the
evolutionary histories and functional properties associated with them.
Hawksworth (1991) and Hawksworth et al. (1995) stated that there were
72,000 accepted fungal species, and that this number was growing rapidly;
only 17% of these were represented in culture collections. One potential
application of PCR-based techniques is their utility in situations where the
sample size is small, and so techniques developed for dried specimens and
environmental samples provide opportunities to obtain information on the
other 83%. Extraction and amplification of dried material from reference
collections is now a relatively straightforward procedure (Taylor and Swann,
1994; Savolainen et al., 1995) and provides many opportunities for examining
both current and earlier species concepts and variability.
The major PCR-based techniques that have been considered at the
species level for fungi are those developed from the rRNA gene cluster and
the random amplification of polymorphic DNA. In addition, some workers
64 P.D. Bridge and D.K. Arora
have considered other conserved and variable gene regions such as chitin
synthase. The literature available for systematic applications of PCR to
fungal systematics continues to grow rapidly and it is unlikely that any
review can be entirely comprehensive and timely. However, we have
attempted to put together, in this chapter, some general examples of recent
developments in this area.
4.2 Species Definitions
Species concepts vary considerably across the range of filamentous fungi, and
in many cases may be considered unsatisfactory. They have not, however,
attracted the same attention as species concepts in some other organisms. In
cases where a meiotic stage of the life cycle can be clearly defined, biological
species can be described which are reproductively isolated (Jeffrey, 1973).
However, this description is not available for the majority of fungi, which
historically have been classified into morphological or phenetic species
(Hawksworth et al., 1995). In some cases ecological species have been
described, based on adaption to a particular niche, or in plant pathology
some species have been defined mainly on host disease symptoms or host
association. Morphological, ecological and pathological species are all,
therefore, defined from phenetic characters, most of which will relate directly
to functional and structural attributes. PCR amplification provides informa-
tion on DNA sequences and so allows the testing of hypotheses about
structure and relationships within phenetically defined species.
In some cases, information on DNA sequences may reinforce existing
phenetic species groupings, and the species in these cases can be described as
polythetic (Hawksworth et al., 1996). However, DNA sequence information
can also provide valuable insights into the evolutionary history of phenetic
species, and this can be important in species where the major functional
characters available relate to some aspect of their environmental niche, such
as in ecological species.
4.3 Ribosomal DNA Gene Cluster
The DNA sequences that encode ribosomal RNAs have been extensively
used to study the taxonomic relationships and genetic variations in fungi
(Bruns et al., 1992; Hibbert, 1992). The ribosomal RNA gene cluster is found
in both nuclei and mitochondria, and consists of highly conserved and
variable regions which include the genes for the small 5.8S, and large rRNA
subunits (White et al., 1990). The fungal nuclear rRNA genes are arranged
as tandem repeats with several hundred copies per genome. The conserved
sequences found in the large subunit (LSU) and small subunit (SSU) genes
have been exploited to study the many relationships among distantly related
PCR for Species Definition 65
fungi (e.g., Gaudet et al., 1989; Bowman et al., 1992a,b; Bruns et al., 1992).
The spacer regions between the subunits, called the internal transcribed
spacers (ITS), and between the gene clusters, called the intergenic spacers
(IGS), are considerably more variable than the subunit sequences, and have
been used widely in studies on the relationships among species within a
single genus or among infraspecific populations (Buchko and Klassen, 1990;
Spreadbury et al., 1990; Nazar et al., 1991; Taylor and White, 1991; Anderson
and Stasovski, 1992; Baura et al., 1992; Kim et al., 1992; Lee and Taylor, 1992;
O’Donnell, 1992; Molina et al., 1993; Erlands et al., 1994, Li et al., 1994;
Buscot et al., 1996).
4.3.1 Spacer regions

There are now many examples of the use of either RFLP or sequence
differences in the different spacer regions for discriminating between closely
related species within a fungal genus. Three genera where there have been
results that highlight this approach are Verticillium, Rhizoctonia and
Fusarium.
4.3.2 ITS region

The ITS consist of two non-coding variable regions that are located within
the rDNA repeats between the highly conserved small subunit, the 5.8S
subunit, and the large subunit rRNA genes. The ITS region is a particularly
useful area for molecular characterization studies in fungi for four main
reasons: (i) the ITS region is relatively short (500–800 bp) and can be easily
amplified by PCR using universal single primer pairs that are complementary
to conserved regions within the rRNA subunit genes (White et al., 1990); (ii)
the multicopy nature of the rDNA repeat makes the ITS region easy to
amplify from small, dilute or highly degraded DNA samples (Gardes and
Bruns, 1993); (iii) the ITS region may be highly variable among morpho-
logically distinct species (Gardes and Bruns, 1991; Gardes et al., 1991; Baura
et al., 1992; Chen et al., 1992; Lee and Taylor, 1992; Gardes and Bruns, 1993)
and so ITS-generated RFLP restriction data can be used to estimate genetic
distances and provide characters for systematic and phylogenetic analysis
(Bruns et al., 1991); and (iv) PCR-generated ITS species-specific probes can
be produced quickly, without the need to produce a chromosomal library
(Sreenivasaprasad et al., 1996) and many researchers have selected sequences
from the ITS region to develop species-specific probes because the sequences
occur in multiple copies and tend to be similar within and variable between
fungal species.
PCR-amplified rRNA ITS sequences have been used for the character-
ization, identification and detection of Verticillium albo-atrum and V.
dahliae (Nazar et al., 1991). In this study the identification of distinct clusters
of non-homologous nucleotides in both the ITS1 and ITS2 regions enabled
the design of specific primers that provided a reliable identification/detection
method of these two important plant pathogens (Nazar et al., 1991). The
same principle was used by Moukhamedov et al. (1993) who used sequences
from amplified regions of the 5.8–28S ITS regions to differentiate V. tricorpus
from other species of Verticillium. The 5.8S sequences were found to be
conserved among these species of Verticillium, but ITS regions of V. tricorpus
were sufficiently distinct to allow species-specific primer sets to be con-
structed which allowed the identification of V. tricorpus from both isolates
in culture and from infected potato stems. The PCR-based protocols
developed by these workers also permitted the quantification of the pathogen
in diseased field plants.
The genus Rhizoctonia consists of a taxonomically diverse group of
species that differ in many significant features, including their sexual and
asexual stages (Sneh et al., 1996). Within the important phytopathological
species R. solani, further intra-specific groups have been designated on the
basis of anastomosis (anastomosis groups; AGs). Anastomosis grouping is a
convenient way of classifying isolates of the species. However, the process is
time-consuming and positive results can be difficult to detect; in addition,
misidentification can occur due to the varied frequency of hyphal anastomo-
sis behaviour. The rRNA genes in Rhizoctonia have been examined in
relation to the different AG-types in order to develop diagnostic protocols,
and to evaluate the characters for phylogenetic relationships (Cubeta et al.,
1996). Originally, RFLP analysis of nuclear rDNA was undertaken with
probes and Southern blotting (Jabaji-Hare et al., 1990; Vilgalys and Gon-
zales, 1990), and more recently, PCR-amplified rRNA has been found to be
useful in examining the genetic relatedness within different AGs of R. solani
and binucleate species of Rhizoctonia (Kanematsu and Naito, 1995; Liu et al.,
1995; Vigalys and Cubeta, 1994; Hyakumachi et al., 1998). One example of
these studies is the restriction analysis of amplified ITS1, ITS2 and 5.8S
rDNA regions of several R. solani subgroups representing AG1 and AG2
undertaken by Liu and Sinclair (1992, 1993). These workers identified six
subgroups within AG1 and five within AG2 on the basis of their ITS-RFLPs.
Recently, Liu et al. (1995) constructed restriction maps from amplified
products by digestion of the 18S, ITS1, ITS2 and 5.8S rRNA regions of 25
R. solani subgroups. However, at this time most subgroups within R. solani
remain largely unresolved. Boysen et al. (1996) used an asymmetric PCR
technique on the ITS1, ITS2 and 5.8S rDNA regions with nine AG4 R. solani
isolates. These data were used in a phylogenetic analysis which identified
three subgroups within AG4. Mazzola et al. (1996) developed species-
specific primers for the detection of R. oryzae by comparing ITS1 and ITS2
sequences from R. oryzae and R. solani AG1, -5, -6 and -8. These primers
were specific to R. oryzae but not to R. solani or binucleate species. This
technique was then used for the detection of R. oryzae from infected wheat
tissues and to differentiate the infection caused by R. solani AG8 on the same
host plant. Hyakumachi et al. (1998) studied the genetic diversity among
three subgroups of R. solani (AG-2-2, IIIB, IV and LP) using a cloned rDNA
probe and RFLP of rDNA-ITS regions. They found that these AG

subgroups could be differentiated from the RFLPs of the amplified ITS
regions.
The genus Fusarium is heterogeneous and the identification of individual
species is based on morphological or biochemical criteria which can in some
cases be difficult and confusing. Edel et al. (1996) differentiated several
strains of F. oxysporum at the species level by RFLP analysis of a region of
ITS and a variable domain of the 28S rDNA. Recently, Schilling et al. (1996)
evaluated sequence variation in the ITS regions of F. avenaceum, F.
culmorum and F. graminearum in order to distinguish between the three
species. They found that the ITS sequences of F. culmorum and F.
graminearum were not polymorphic enough to allow the construction of
species-specific primers; however, sufficient sequence variation was found in
the ITS1 and ITS2 regions of F. culmorum and F. graminearum to distinguish
them from F. avenaceum.
4.3.3 IGS region

In contrast to the ITS region, fewer studies have considered the IGS region.
Arora et al. (1996) used RFLP derived from the IGS, located between the
rRNA gene clusters, to determine variability within the species Verticillium
chlamydosporium and other closely related species. They found that there
was, in general, a low level of heterogeneity in this region within species, and
that distinct IGS types could be associated with particular species. The IGS
region has also been investigated in Fusarium and Appel and Gordon (1995)
found heterogeneity in this region in F. oxysporum on the basis of RFLPs of
the PCR amplified product. Further studies on the IGS region have been
undertaken with Pythium ultimum, where length heterogeneity was found to
be due to subrepeat arrays (Klassen and Buchko, 1990). Similar long
subrepeats have also been reported in the IGS from Puccinia graminins, V.
albo-atrum and V. dahliae (Kim et al., 1992; Morton et al., 1995). In P.
ultimum heterogeneity in the number of conserved subrepeats was found
between isolates of the species (Klassen and Buchko, 1990; Buchko and
Klassen, 1990), whereas in the Verticillium species there was some within-
isolate variation of the less conserved subrepeats, but their overall structure
and organization could be used to distinguish between the species (Morton
et al., 1995).
4.3.4 Identification and diagnosis

As already mentioned, the rDNA ITS regions have been examined from a
wide range of fungi in addition to the three examples given above, and one
of the most common taxonomic uses of the information obtained has been
the development of species-specific probes and primers. The region has, for
example, been used in the taxonomy of Oomycetes, where restriction
patterns from amplified ITS and SSU products have been used to differ-
entiate species of Pythium (Chen, 1992; Chen et al., 1992). Levesque et al.
(1994) also used a DNA fragment from the ITS region to develop a species-
specific probe for P. ultimum for routine identification. In addition, within
the Oomycetes, Lee and Taylor (1992) have sequenced the ITS1 region from
three species of Phytophthora and synthesized species-specific oligonucleo-
tide probes derived from the non-homologous sequences.
Species-specific primers were also developed by Tisserat et al. (1994) for
the diagnosis of turfgrass patch diseases caused by Ophiosphaerella herpo-
tricha and O. korrae without the need to first isolate and culture the fungus
from the diseased tissues. Kageyama et al. (1997) have used species-specific
primers derived from ITS sequences to detect P. ultimum in naturally
infected seedlings. Bunting et al. (1996) used ITS1 sequences to examine the
relationship of Magnaporthe poae to other species in the genus that had
similar growth or phytopathogenic characteristics. Poupard et al. (1993) used
amplified ITS regions in their characterization of Pseudocercosporella herpo-
trichoides isolates. Intraspecific variability in ITS and SSU sequences within
the genus Gremmeniella was studied by Bernier et al. (1994). A rapid
identification method was developed by Vilgalys and Hester (1990) for the
identification of Cryptococcus species from restriction patterns of ITS and
other rDNA regions. Highly sensitive diagnostic assays have also been
developed for Leptosphaeria maculans based on ITS sequence polymorphism
(Xue et al., 1992). PCR–RFLP of ITS has also allowed the discrimination of
Tuber species (Henrion et al., 1994), the identification of species within the
Gaeumannomyces–Phialophora complex (Ward and Akrofi, 1994), Sclero-
tinia species (Carbone and Kohn, 1993), Cylindrocarpon heteronema (Brown
et al., 1993) and Penicillium species (Lobuglio et al., 1993). One further
example of a genus where extensive use has been made of the ITS region at
the species level is Colletotrichum. Sherriff et al. (1994) compared a range of
isolates of Colletotrichum species on the basis of a 886 bp region of the LSU
and the ITS2 regions, and were able to use this information to distinguish
between individual species. Further extensive species characterization has
been undertaken in this genus, leading to the development of a number of
species-specific primers (see Sreenivasaprasad et al., 1992).
At a different taxonomic level, universal primers have been developed
from rDNA sequences which are specific for major groups of fungi. Gardes
and Bruns (1993) designed two taxon-selective primers (ITS1-F and ITS4-B)
from the ITS region which were specific to fungi and basidiomycetes
respectively. The primer ITS-4B when combined with universal ITS1 primers
or with fungal-specific primer ITS-1F, differentiated basidiomycetes from
ascomycetes. Primers ITS1-F/ITS4-B were useful for the detection of
basidiomycete ectomycorrhizae in rust infected tissues and could be used to
study both the distribution of rusts on alternate hosts and ectomycorrhizal
communities. In a separate study Hopfer et al. (1993) used fungal-specific
primers from the SSU for the diagnosis of fungi in human clinical samples.
The examples detailed here are just a few of the rDNA derived species-
specific primers that have been developed to date, and subunit and ITS
sequences are likely to continue to be a major tool in molecular identification
strategies. Sequence databases are growing rapidly and the approaches
discussed here, when combined with sufficient reference data, will provide
major insights into the population structures of fungal communities and the
detection of fungi from the environment.
4.4 Other Gene-based Approaches
Although much of the recent molecular research into fungal taxonomy has
been based on the rRNA gene cluster, other gene sequences have been used
both to group fungi at species level and to develop specific probes. The
amplification and analysis of many functional genes are dealt with in detail
elsewhere in this volume; however, two examples which demonstrate the use
of these techniques in taxonomic studies are detailed here. Mehmann et al.
(1994) used sequence variation in the chitin synthase genes of some
ectomycorrhizal fungi. They found numerous introns within the genes, and
used the deduced amino acid sequences to distinguish between species and
genera. In another gene-based study, Donaldson et al. (1995) used amplifica-
tion products from the H3, H4 and β-tubulin genes of Fusarium strains
associated with conifers. They used RFLP of these products to group isolates
at species level, and also found some heterogeneity within species.
4.5 RAPD and Other Fingerprinting Methods
The random amplified polymorphic DNA (RAPD) fingerprinting assay

detects small inverted nucleotide sequence repeats throughout the genomic
DNA (Welsh and McClelland, 1990; Williams et al., 1990). In RAPD–PCR,
amplification involves only single primers of arbitrary nucleotide sequence.
The principle of RAPD assays are discussed in detail by Hadrys et al. (1992)
and Tingey and del Tufo (1993). In brief, a single primer binds to the genomic
DNA on two different priming sites in an inverted orientation; amplification
between these points results in a discrete product. As each primer can be
expected to amplify several discrete loci in the genome the final result is
generally a profile of amplification products of varying sizes. In addition, at
the primer attachment stage in the amplification the annealing temperature is
kept low which also encourages a degree of primer mismatching, and
increases the potential number of amplification products. RAPD–PCR has
many advantages: (i) no prior information for DNA sequence is needed. The
protocol is relatively simple and quick and only nanogram quantities of
DNA are required to give a PCR product; (ii) the technique is preferred
when the genotypes of a large number of species, population or pathotypes
have to be discriminated. RAPD markers can also be used to analyse the

genotypes of fusion products and parents at different taxonomic levels; (iii)
this is a good tool for creating genetic maps (Judelson et al., 1995) and has
proved to be an efficient method for the identification of molecular markers
(Tingey and del Tufo, 1993); and (iv) the technique is suitable for studying
population genetics and has been successfully used to differentiate among
species and strains within species of plants, bacteria, animals and fungi (see
Williams et al., 1990).
RAPD–PCR assays have been used extensively to define fungal popula-
tions at species, infraspecific, race and strain levels. In general, most studies
have concentrated on infraspecific grouping, although others have been
directed at the species level. Some examples of RAPD–PCR at species level
include the production of species-specific probes and primers from RAPD
data for Fusarium oxysporum f. sp. dianthi, Phytophora cinnamomi, Tuber
magnatum and Glomus mosseae (Dobrowolski and O’Brien, 1993; Lan-
franco et al., 1993, 1995; Manulis et al., 1994). In some RAPD–PCR studies,
band patterns have been used to differentiate both within and between
individual species, as exemplified by species of Metarhizium and Candida
(Lehmann et al., 1992; Bridge et al., 1997a).
In general, RAPD–PCR has been used most widely to discriminate at an
infraspecific level, particularly in the determination of distinct infraspecific
groups such as anastomosis groups in Rhizoctonia solani (Duncans et al.,
1993) and pathogen groups (Crowhurst, 1991; Levey et al., 1991; Guthrie et
al., 1992; Assigbetse et al., 1994; Bidochka et al., 1994; Burmester and
Wostemeyer, 1994; Nicholson and Rezanoor, 1994; Yates-Siilata et al., 1995;
Bridge et al., 1997a; Maurer et al., 1997). Another application of RAPD–PCR
has been in the determination of individual strains within a particular
population, some examples being toxin-producing strains of Aspergillus
flavus (Bayman and Cotty, 1993), and in strain authentication in species of
Trichoderma (Fujimori and Okuda 1994; Schlick et al., 1994).
Single, simple repetitive primers have been designed to amplify the
microsatellite regions of fungal chromosomal DNA (Meyer et al., 1992;
Schlick et al., 1994; Bridge et al., 1997b). In most applications these primers
have given similar levels of specificity to those seen with RAPD, and so
results have been used to group fungi at infraspecific levels (e.g. Bridge et al.,
1997a). However, in some instances microsatellite-primed PCR has been
used to generate species-specific patterns, and one recent example of this is
the work on morels by Buscot et al. (1996) who found considerable
homogeneity from both mono- and polysporic isolates of individual species.
Further repetitive sequences have been examined for use in fungal system-
atics, including primers derived from the M13 bacteriophage internal repeat,
and the bacterial repetitive extragenic palindromic (REP) and enterobacterial
repetitive intergenic consensus (ERIC) sequences (Hulton et al., 1991;
Versalovic et al., 1991; Meyer et al., 1992). These primers have so far provided
differentiation at the infraspecific level, allowing differentiation of closely
related isolates within single species (Edel et al., 1995; Arora et al., 1996;
Bridge et al., 1997b).
4.6 Interpretation of Data
As will already be apparent, a variety of different DNA sequences have been

amplified and used in the determination of fungal species. The information
available from these studies also varies widely, with some studies presenting
full sequences, while others have suggested partially characterized or
uncharacterized DNA fragments as species markers (Carbone and Kohn,
1993; Mehmann et al., 1994; Ward and Akrofi, 1994; Faris-Mokaiesh et al.,
1996). Most filamentous fungi cannot be grouped into traditional biological
species, and the species epithet has been applied at different population levels
between and within different genera. As a result, the degree of variability
observed within one species will not necessarily be comparable with that
found in another. This is not surprising given the large differences in
evoloutionary age among filamentous fungi, and this can be clearly demon-
strated by comparing the variability observed within specific pathogens,
which may be recently evolved, such as species of Colletotrichum (Sreeniva-
saprasad et al., 1992), and the variability in presumably long-established
saprobic species such as lichen-forming fungi (Gargas and Taylor, 1995).
These differences in variability within populations, therefore, make it very
difficult to select any one molecular technique as the definitive method for
defining fungal species. In practice what is occurring within mycology is a
gradual refinement and redefinition of some species with various criteria, in
conjunction with other, often phenotypic, properties.
This redefinition will be particularly useful in matching anamorph and
teleomorph states, as most DNA sequences can be expected to be consistent
between the two states. In cases where an anamorph–teleomorph connection
is suspected this may be confirmed by comparitive sequence analysis of
amplified products as in the placing of Sporothrix schenckii within Ophio-
stoma (Berbee and Taylor, 1992), or as has been demonstrated with
Sclerotinia and Sclerotium which showed 98% sequence homology in the
ITS1 region of rDNA (Carbone and Kohn, 1993).
4.6.1 Sample size

As the level of variability for any particular molecular characteristic will
differ between species, the size of the population considered can be extremely
important. In some cases the sample size will be limited by the number of
isolates available, and in other instances the cosmopolitan nature of the
fungus may require the collection of a wide range of isolates from different
hosts and geographic locations. Examples of this latter case are Fusarium
oxysporum and Beauveria bassiana, which are widespread pathogens of
vascular plants and insects, respectively. Within both of these species PCR-
based methods have been used to identify host specific populations (Kelly et
al., 1994; Neuvéglise et al., 1994; Bentley et al., 1995: Maurer et al., 1997), and
these would need to be represented in any definition of the species. PCR-
based methods have also been used to define much more restricted
populations such as Pneumocystis carinii (Liu et al., 1992), and again
sequence differences have been identified between populations from differ-
ent hosts (Wakefield et al., 1990). The method of analysis used for the data
should be appropriate to the sample size and spread, and studies based on
many isolates of one species and few representatives of many others may
require careful consideration.
4.6.2 RAPD and other fingerprinting methods

RAPD band patterns and other DNA fingerprinting techniques have been
used to define some fungal species, and in these studies species-specific
bands, or combinations of bands, have been described. In these techniques
there is the assumption that bands with identical mobility and staining
intensity are of the same or very similar sequence. In general this is not
always known, and a further problem is the lack of knowledge as to whether
the marker bands consist of coding or non-coding sequences, and as to
whether they may represent genes that could be regarded as under selection.
There is now some evidence in other organisms that RAPD bands may not
be entirely random and that different bands may be homologous (Rieseberg,
1996).
Other features that must be considered when using fingerprinting
methods to define species are the potential for random mutation at the
fingerprint loci and the sensitivity of the target sequences to crossover and
segregation during meiosis (Wu and Magill, 1995). Both of these events have
been reported in fungi and may lead to different patterns being obtained
from parents and progeny. However, the stability of some fingerprinting
methods within some asexually (mitotically) reproducing fungal species has
been established, and fingerprinting methods may, in many cases, give
species-specific bands or band patterns (Dobrowolski and O’Brien, 1993;
Potenza et al., 1994).
4.6.3 Amplification and analysis of the rRNA gene cluster

There have been many applications of the rRNA gene cluster at the species level
with filamentous fungi, ranging from simple size comparisons to extensive
sequence analyses. Interpretation of these data is, however, not always
straightforward as there can be considerable variations between different
fungal species. As previously mentioned, the species Fusarium oxysporum
consists of many different host plant-specific special forms, subdivided into
pathogenic races and vegetative compatibility groups. PCR amplification of
the ITS region of the rRNA gene cluster, and subsequent RFLP analysis, has
been used within this species to designate subspecific groups (Oullet and
Seifert, 1993; Kelly et al., 1994; Bentley et al., 1995). However, within the genus
Colletotrichum, species have been delineated on the basis of very small
differences in these sequences (Mills et al., 1992; Sreenivasaprasad et al., 1992).
The interpretation of rRNA data in fungal taxonomy is further compli-
cated by the presence of introns within the subunit genes. Many insertion
sites have been described in both the large and small subunits and these have
been described as possibly important factors in the evolution of fungi
(Neuvéglise and Brygoo, 1994; Gargas and DePriest, 1996).
A further important consideration concerns the type and copy number
of the rRNA gene cluster itself. While this gene cluster is often described as
‘multi-copy’, in that it may be found in many different parts of the total
fungal genome, the different occurrences are not due to recent copying, and
a mutation in one copy will not necessarily be present at all sites. This
occurrence is generally accepted to be prevented by concerted evolution,
which maintains the homogeneity of the gene cluster and spacer regions
(Hillis and Dixon, 1991; Appel and Gordon, 1995). However, there is a small,
but increasing, number of publications which suggests that more than one
form of the rRNA genes may exist within a single organism. This occurrence
has previously been described in a variety of organisms including bacteria,
nematodes, insects and mammals (Zijlstra et al., 1995; Kuo et al., 1996;
Rainey et al., 1996) and has recently been reported for filamentous and
lichen-forming fungi, where some copies of the rRNA gene cluster are
suspected to contain sequence differences and can include insertion
sequences (DePriest, 1993; Harlton et al., 1995; Sanders et al., 1995). The
significance of these events in the interpretation of data for fungal taxonomy
has not yet been fully investigated. In addition, the likelihood of detecting
such occurrences, given the competitive nature and concentration depend-
ency of the PCR reaction has not been widely considered.
There is an additional single copy rRNA gene cluster located on the mito-
chondrial DNA of fungi. This region has also been used to develop specific
probes and PCR primers for the identification of fungal species (Gardes et al.,
1991; Wakefield et al., 1991; Li et al., 1994). As a ‘single copy’ gene this would be
free from the complications of different forms being present, and, as mitochon-
drial DNA is generally transmitted by uniparental inheritance, the gene would
be expected to be largely free of recombination effects.
Although the above are important considerations which may be relevant
in some areas, many species-specific probes and primers have been designed
for fungi from rRNA gene and spacer sequences.
4.7 Numerical Methods for Representing Species
Numerical methods for representing species can be divided very broadly into
two groups: those that are used merely to group similar organisms (phenetic);
and those that imply some path or measure of evolution (phylogenetic)

(Sneath, 1993).
The development of PCR-based techniques has resulted in the avail-
ability of considerable amounts of DNA sequence data that can be used for
direct taxonomic purposes. However, the raw data as obtained in these
studies can be considered as being phenetic rather than phylogenetic, as the
actual data collected are a series of observed (genomic) properties. In order
to be correctly termed phylogenetic some measure of time would be
required, and this is inferred through the subsequent analyses, rather than
directly recorded with the data (Sneath, 1993). As sequence data or band
patterns can be treated as phenetic characters, then many of the well-
established numerical taxonomy techniques can be utilized to identify or
subdivide species groups. Phylogenetic techniques are covered in detail
elsewhere in this volume.
Most non-phylogenetic analyses of fungal data have been based on
comparing band patterns from RFLP, RAPD or simple repetitive primer
approaches (Assigbetse et al., 1994; Pipe et al., 1995; Fungaro et al., 1996;
Mordue et al., 1996; Waalwijk et al., 1996). In these analyses, individual
bands are considered as equivalent independent characters and so band
patterns are usually converted into binary tables. Similarities are derived
from established coefficients, and the relationships between isolates are most
commonly represented as dendrograms. There are, however, two important
factors that must be taken into account in this type of analysis, the first is the
relevance of matching negative characters, and the second is the suitability of
a hierarchical representation.
4.7.1 Similarity coefficients

The majority of dendrograms derived from fungal DNA fragments have
been derived with one of three coefficients, the simple matching coefficient,
Jaccard’s coefficient and Nei and Li’s genetic distance. The last two of
these coefficients do not consider matching negative results, that is, they
do not consider the absence of a particular band in two organisms as a
similarity, unlike the simple matching coefficient where matching positive
and negative results are considered equally (Sneath and Sokal, 1973; Nei
and Li, 1979; Bridge, 1992). The validity of considering matching negative
characters has been discussed on many occasions (see Sneath and Sokal,
1973; Abbott et al., 1985) but it is perhaps worth further consideration
for solely gel-derived data. When numerical methods are not used and
gel patterns are compared by eye the operator will use the presence and
absence of bands to designate patterns. Therefore, the inclusion of
matching negatives within a numerical system may be considered as
representative of this, and shape coefficients such as the correlation
coefficient have been used in this way in automated gel comparison
software. However, in taxonomic studies matching negative characters may

be acceptable when the characters themselves are relevant and comparison
is meaningful. This may be the case where band patterns are derived from
RFLP data, and absence of bands can be directly related to sequence
information at the restriction site. However, when bands are of unknown
origin, such as in RAPD studies, then their relevance cannot be quantified,
and it would seem most appropriate to use coefficients that discount
matching negatives.
4.7.2 Representation
As described above, numerical values are often clustered to give
dendrograms, and it is important to consider the appropriateness of this
approach. Cluster analysis will always result in the linking of all organisms,
no matter how closely or distantly related. One consequence of this is
the tendency of markers or distantly related organisms to cluster together
as they are similar in that they are different from the rest of the organisms
(see Sneath and Sokal, 1973). This situation can arise when the majority
of the isolates used in a study belong to a single group, and the remainder
are members of different taxa. A further complication can occur with
averaging methods such as UPGMA, where the average value obtained
from similar values (closely related isolates) is representative of the true
similarity, whereas average values obtained from widely different values
(distantly related isolates) may not be truly representative (see Abbott et
al., 1985). The practical outcome of these occurrences is that cluster
analysis is very good at determining relationships within groups and
between closely related groups, but may not give an accurate representation
of more distant relationships. Where data have been obtained from many
members of one or several closely related taxa, cluster anlaysis will be
an appropriate technique. However, when several members of a single
species are compared with small numbers of other species, cluster analysis
may not be appropriate.
An alternative to cluster analysis is the use of one of the non-hierarchical
multivariate techniques such as principal component or principal coordinate
analyses. These techniques place organisms on the basis of the overall
variability contained within the data, and in contrast to clustering, these
techniques provide a more faithful representation of inter-group relation-
ships (see Sneath and Sokal, 1973; Alderson, 1985). Ordination techniques
have, therefore, advantages in determining relationships between species,
particularly where there may be wide differences in similarity values.
Ordination techniques have not been widely used with fungal PCR data,
although one of the few such studies published has shown that ordination
was superior to cluster analysis in arriving at final species level groupings
(Bridge et al., 1997a).
4.8 Conclusions
PCR-based methods offer many new tools that are directly applicable to
fungal systematics at the species level. These tools can be used to delimit and
to determine relationships among species, either by direct comparison or
through phylogenetic analyses. PCR-based methods have given a greater
insight into molecular variability within fungi and have highlighted the need
to consider carefully sampling strategies and sample sizes, prior to making
taxonomic decisions. This insight has also shown that molecular variability
is not constant within different fungal species, and levels of both homo- and
heterogeneity will vary depending upon the species studied. Perhaps
surprisingly, the introduction of PCR-based techniques has not led to a
widespread revision of fungal species names and concepts, and in many cases
existing species concepts have been reinforced. However, the wide range of
molecular heterogeneity found in some species has led to the suggestion that
there may be many more ‘cryptic’ and undescribed species within existing
collections. Where PCR-based methods will have a very significant impact is
in the study of the 83% of known species that do not grow in culture, and
the hope is that these techniques may, in future, provide many answers to
basic questions in systematics and biodiversity that are currently unan-
swered.
References
Abbott, L.A., Bisby, F.A. and Rogers, D.J. (1985) Taxonomic Analysis in Biology.
Columbia University Press, New York.
Alderson, G. (1985) The application and relevance on nonhierarchic methods in
bacterial taxonomy. In: Goodfellow, M., Jones, D. and Priest, F.G. (eds)
Computer-assisted Bacterial Systematics, Academic Press, London, pp. 227–263.
Anderson, J.B. and Stasorski, E. (1992) Molecular phylogeny of Northern Hemi-
sphere species of Armillaria. Mycologia 84, 505–576.
Appel, D.J. and Gordon, T.R. (1995) Intraspecific variation within populations of
Fusarium oxysporum based on RFLP analysis of the intergenic spacer region of
the rDNA. Experimental Mycology 19, 120–128.
Arora, D.K., Hirsch, P.R. and Kerry, B.R. (1996) PCR-based molecular discrimina-
tion of Verticillium chlamydosporium isolates. Mycological Research 100,
801–809.
Assigbetse, K.B., Fernandez, D., Dubois, M.P. and Geiger, J.-P. (1994) Differentiation
of Fusarium oxysporum f. sp. vasinfectum races on cotton by random amplified
polymorphic DNA (RAPD) analysis. Phytopathology 84, 622–626.
Baura, G., Szaro, T.M. and Bruns, T.D. (1992) Gatrosuillus laricinus is a repeat
derivative of Suillus grevellei: molecular evidence. Mycologia 84, 592–597.
Bayman, P. and Coty, P.J. (1993) Genetic diversity in Aspergillus flavus: association
with aflatoxin production and morphology. Canadian Journal of Botany 71,
23–31.
Bentley, S., Pess, K.G. and Dale, J.L. (1995) Genetic variation among a worldwide
collection of isolates of Fusarium oxysporum f. sp. cubense analysed by RAPD–
PCR fingerprinting. Mycological Research 99, 1378–1384.
Berbee, M.L. and Taylor, J.W. (1992) 18S ribosomal RNA gene sequence characters
place the human pathogen Sporothrix schenckii in the genus Ophiostoma.
Experimental Mycology 16, 87–91.
Bernier, L., Hamelin, R.C. and Ouellete, G.B. (1994) Comparison of ribosomal DNA
length and restriction site polymorphsims in Gremmeniella and Ascocalyx
isolates. Applied and Environmental Microbiology 60, 1279–1286.
Bidochka, M.J., McDonald, M.A. St Leger, R.J. and Roberts, D.W. (1994) Differ-
entiation of species and strains of entomopathogenic fungi by random amplifica-
tion of polymorphic DNA (RAPD). Current Genetics 25, 107–113.
Bowman, B.H., Taylor, J.W., Browilee, A.G., Lee, J., Lu, S. and White, T.J. (1992a)
Molecular evolution of the fungi: relationship of basidiomycetes, ascomycetes
and chytridiomycetes. Molecular Biology and Evolution 9, 285–296.
Bowman, B.H., Taylor, J.W. and White, T.J. (1992b) Molecular evolution of the fungi:
human pathogens. Molecular Biology and Evolution 9, 893–904.
Boysen, M., Bojra, M., del Moral C., Salzar, O. and Rubio, V. (1996) Identification
at strain level of Rhizoctonia solani AG4 isolates by direct sequence of
asymmetric PCR products of the ITS regions. Current Genetics 29, 174–181.
Bridge, P.D. (1992) Classification. In: Fry, J.C. (ed.) Biological Data Analysis: a
Practical Approach, IRL Press, Oxford, pp. 219–242.
Bridge, P.D., Prior, C., Sagbohan, J., Lomer, C.J., Carey, M. and Buddie, A. (1997a)
Molecular characterization of isolates of Metarhizium from locusts and grass-
hoppers. Biodiversity and Conservation 6, 177–189.
Bridge, P.D., Pearce, D.A., Rivera, A. and Rutherford, M.A. (1997b) VNTR derived
oligonucleotides as PCR primers for population studies in filamentous fungi.
Brown, A.E., Muthumeenakshi, S., Sreenivasaprasad, S., Mills, P.R. and Swinburne,
T.R. (1993) A PCR primer-specific to Cylindrocarpon heteronema for detection
of the pathogen in apple wood. FEMS Microbiology Letters 108, 117–120.
Bruns, T.D., White, T.J. and Taylor, J.W. (1991) Fungal molecular systematics. Annual
Review of Ecology and Systematics 22, 525–564.
Bruns, T.D., Vilgalys, R., Barns, S.M., Gonzalez, D., Hibbert, D.S., Lane, D.J., Simon,
L, Stickel, S., Szaro, T.M., Weisburg, W.G. and Sogin, M.L. (1992) Evolutionary
relationships within fungi: analysis of nuclear small subunit rRNA sequences.
Molecular Phylogeny and Evolution 1, 231–241.
Buchko, J. and Klassen, G.R. (1990) Detection of length hetrogeneity in the
ribosomal DNA of Pythium ultimum by PCR amplification of the intergenic
region. Current Genetics 18, 203–205.
Bunting, T.E., Plumley, K.A., Clarke, B.B. and Hillman, B.I. (1996) Identification of
Magnaporthe poae by PCR and examination of its relationship to other fungi by
analysis of their nuclear rDNA ITS1 regions. Phytopathology 86, 389–404.
Burmester, A. and Wostemeyer, J. (1994) Variability in genome organization of the
zygomycete Parasitella parasitica. Current Genetics 26, 456–460.
Buscot, F., Wipf, D., Di Battista, C., Munch, J.-C., Botton, B. and Martin, F. (1996)
DNA polymorphism in morels: PCR–RFLP analysis of the ribosomal DNA
spacers and microsatellite-primed PCR. Mycological Research 100, 63–71.
Carbone, I. and Kohn, L.M. (1993) Ribosomal DNA sequence divergence within
internal transcribed spacers 1 of the Sclerotiniaceae. Mycologia 85, 415–427.

Chen, W. (1992) Restriction fragment length polymorphism in enzymatically
ogy 82, 1467–1472.
Chen, W., Hoy, J.W. and Schneider, R.W. (1992) Species-specific polymorphism in
transcribed ribosomal DNA of five Pythium species. Experimental Mycology 16,
22–34.
Crowhurst, R.N., Hawthorne, B.T., Rikkerink, E.H.A. and Templeton, M.D. (1991)
Differentiation of Fusarium solani f. sp. Curcubitae races 1 and 2 by random
amplification of polymorphic DNA. Current Genetics 20, 391–396.
Cubeta, M.A., Vilgayus, R. and Gonzalez, D. (1996) Molecular analysis of ribosomal
RNA genes in Rhizoctonia fungi. In: Sneh, B., Jabaji-Hare, S., Neate, S. and
Dijst, G. (eds) Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology,
Pathology and Disease Control. Kluwer Academic Press, Dordrecht, pp. 81–86.
DePriest, P.T. (1993) Small subunit rDNA variation in a population of lichen fungi
due to optional group I introns. Gene 134, 67–74.
Dobrowolski, M.P. and O’Brien, P.A. (1993) Use of RAPD–PCR to isolate a species
specific DNA probe for Phytophora cinnamomi. FEMS Microbiology Letters
113, 43–48.
Donaldson, G.C., Ball, L.A., Axelrood, P.E. and Glass, N.L. (1995) Primer sets to
amplify conserved genes from filamentous ascomycetes are useful in differ-
entiating Fusarium species associated with conifers. Applied and Environmental
Duncans, S., Barton, J.E. and O’Brien, P.A. (1993) Analysis of variation in isolates of
Rhizoctonia solani by random amplified polymorphic DNA assay. Mycological
Research 97, 1075–1082.
Edel, V., Steinberg, C., Avelange, I., Laguerre, G. and Alabouvette, C. (1995)
Comparison of three molecular methods for the characterization of Fusarium
oxysporum strains. Phytopathology 85, 579–585.
Edel, V., Steinberg, C., Goutheron, N. and Alabouvette, C. (1996) Differentiation of
Fusarium species by restriction fragment length polymorphism analysis of PCR-
amplified ribosomal DNA. First International Fusarium Biocontrol Workshop.
Beltsville Agricultural Research Center, USA, p. 21.
Faris-Mokaiesh, S., Boccara, M., Denis J.-B., Derrien, A. and Spire, D. (1996)
Differentiation of the Ascochyta complex fungi of pea by biochemical and
molecular markers. Current Genetics 29, 182–190.
Fujimori, F. and Okuda, T. (1994) Application of the random amplified polymorphic
DNA using the polymerase chain reaction for efficient elimination of duplicate
strains in microbial screening. I. Fungi. Journal of Antibiotics (Tokyo) 47,
173–182.
Fungaro, M.H.P., Vieira, M.L.C., Pizzirani-Kleiner, A.A. and de Azevedo, J.L. (1996)
Diversity among soil and insect isolates of Metarhizium anisopliae var. anisopliae
detected by RAPD. Letters in Applied Microbiology 22, 389–392.
Gardes, M. and Bruns, T.D. (1991) Rapid characterization of ectomycorrhizae using
RFLP pattern of their PCR amplified-ITS. Mycological Society Newsletter 41,
14.
Gardes, M. and Bruns, T.D. (1993) ITS primers with enhanced specificity for
basidiomycetes application to the identification of mycorrhizae and rusts.
Molecular Ecology 2, 113–118.
Gardes, M, White, T.J., Fortin, J.A., Bruns, T.D. and Taylor J.W. (1991) Identification
of indigenous and introduced symbiotic fungi in ectomycorrhizae by amplifica-
tion of nuclear and mitochondrial ribosomal DNA. Canadian Journal of Botany
69, 180–190.
Gargas, A. and DePriest, P.T. (1996) A nomenclature for fungal PCR primers with
examples from intron-containing SSU rDNA. Mycologia 88, 745–748.
Gargas, A., DePriest, P.T. and Taylor, J.W. (1995) Positions of multiple insertions in
SSU rDNA of lichen-forming fungi. Molecular Biology and Evolution 12,
208–218.
Gaudet, J., Julien, J., Lafay, J.F. and Brygoo, Y. (1989) Phylogeny of some Fusarium
species, as determined by large subunits rRNA sequence comparison. Molecular
Biology and Evolution 6, 227–242.
Guthrie, P.A.I., Magill, C.W., Frederiksen, R.A. and Odvordy, G.N. (1992) Random
Hadrys, H., Balick, M. and Schiewater, B. (1992) Applications of random ampli-
fied polymorphic DNA (RAPD) in molecular ecology. Molecular Ecology 1,
55–63.
Harlton, C.E. and Lévesque, C.A. and Punja, Z.K. (1995) Genetic diversity in
Sclerotium (Athelia) rolfsii and related species. Phytopathology 85, 1269–1281.
Hawksworth, D.L. (1991) The fungal dimension of biodiversity: magnitude, sig-
nificance and conservation. Mycological Research 95, 641–655.
Hawksworth, D.L., Kirk, P.M., Sutton, B.C. and Pegler, D.N. (1995) Ainsworth and
Bisby’s Dictionary of the Fungi, 8th edn. CAB International, Wallingford.
Henrion, B., Chevalier, G. and Martin, F. (1994) Typing truffle species by PCR
amplification of ribosomal DNA spacers. Mycological Research 98, 37–43.
Hibbert, D.S. (1992) Ribosomal RNA and fungal systematics. Transactions of the
Mycological Society of Japan 33, 533–556.
Hillis, D.M. and Dixon, M.T. (1991) Ribosomal DNA: molecular evolution and
phylogenetic inference. Quarterly Reviews in Biology 66, 411–453.
Hopfer, R.L., Walden, P., Setterquist, S. and Highsmith, W.E. (1993) Detection and
differentiation of fungi in clinical specimens using polymerase chain reaction
(PCR) amplification and restriction enzyme analysis. Journal of Medical and
Veterinary Mycology 31, 65–75.
Hulton, C.S.J., Higgins, C.F. and Sharp, P.M. (1991) ERIC sequences: a novel family
of repetitive elements in the genomes of Escherichia coli, Salmonella typhimu-
rium and other enterobacteria. Molecular Microbiology 5, 825–834.
Hyakumachi, M., Mushika, T., Ogiso, Y., Toda, T., Kageyama, K. and Tsuge, T. (1998)
Characterization of a new cultural type LP of Rhizoctonia solani AG2-2 isolated
from warm season turfgrasses, and its genetic differentiation from other cultural
types. Plant Pathology (in Press).
Jabaji-Hare, S.H., Meller, Y., Gill, S. and Charest, P.M. (1990) Investigation of genetic
relatedness among anastomosis groups of Rhizoctonia solani using cloned DNA
probes. Canadian Journal of Plant Pathology 12, 393–404.
Jeffrey, C. (1973) Biological Nomenclature, 2nd edn. Edward Arnold, London.
Judelson, H.S., Spielman, L.J. and Shattock, R.C. (1995) Genetic mapping and non-
Mendelian segregation of mating type loci in the oomycete, Phytophthora
infestans. Genetics 141, 503–512.
Kageyama, K., Ohyama, A. and Hyalcumach, M. (1997) Detection of Pythium
ultimum using polymerase chain reaction with species-specific primers. Plant

Disease 81, 1155–1160.
Kanematsu, S. and Naito, S. (1995) Genetic characterization of Rhizoctonia solani AG
2-3 by analysing restriction fragment length polymorphism of nuclear ribosomal
DNA internal transcribed spacers. Annals of the Phytopathological Society of
Japan 61, 18–21.
Kelly, A., Alcalá-Jiménez, A.R., Bainbridge, B.W., Heale, J.B., Pérez-Artés, E. and
Jiménez-Dı́az, R.M. (1994) Use of genetic fingerprinting and random amplified
polymorphic DNA to characterize pathotypes of Fusarium oxysporum f.sp.
ciceris infecting chickpea. Phytopathology 84, 1293–1298.
Kim, W.K., Zuerucha, T. and Klassen, G.R. (1992) A region of heterogeneity adjacent
to 5S ribosomal RNA genes of cereal rusts. Current Genetics 22, 101–105.
Klassen, G.R. and Buchko, J. (1990) Subrepeat structure of the intergenic region in
the ribosomal DNA of the oomycetous fungus Pythium ultimum. Current
Genetics 17, 125–127.
Kuo, B.A., Gonzalez, I.L., Gillespie, D.A. and Sylvester, J.E. (1996) Human
ribosomal RNA variants from a single individual and their expression in
different tissues. Nucleic Acids Research 24, 4817–4824.
Lanfranco, L., Wyss, P., Marzachi, C. and Bonfante, P. (1993) DNA probes for the
identification of the ectomycorrhizal fungus Tuber magnatum Pico. FEMS
Microbiology Letters 114, 245–251.
Lanfranco, L. Wyss, P, Marzachi, C. and Bonfante, P. (1995) Generation of RAPD–
PCR primers for the identification of isolates of Glomus mosseae, an arbuscular
mycorrhizal fungus. Molecular Ecology 4, 61–68.
Lehmann, P.F., Lin, D. and Lasker, B.A. (1992) Genotypic identification and
characterization of species and strains within the genus Candida by using
random amplified polymorphic DNA. Journal of Clinical Microbiology 30,
3249–3254.
Levesque, C.A., Vrain, C.T. and deBoer, S.H. (1994) Development of a species-
specific probe for Pythium ultimum using amplified ribosomal DNA. Phytopa-
thology 84, 874–878.
Levy, M., Romao, J., Marchetti, M.A. and Hamer, J.E. (1991) DNA with a dispersed
repeated sequence resolves pathotype diversity in the rice blast fungus. The Plant
Cell 3, 95–105.
Li, K.N., Rouse, D.I. and German, T.L. (1994) PCR primers that allow intergeneric
differentiation of ascomycetes and their application to Verticillium spp. Applied
Liu, Y., Rocourt, M., Pan, S., Liu, C. and Leibowitz, M.J. (1992) Sequence and
variability of the 5.8S and 26S rRNA genes of Pneumocystis carinii. Nucleic Acids
Research 20, 3763–3772.
Liu, Z.L. and Sinclair, J.B. (1992) Genetic diversity of Rhizoctonia solani anastomosis
group 2. Phytopathology 82, 778–787.
Liu, Z.L. and Sinclair, J.B. (1993) Differentiation of intraspecific groups within
anastomosis group I of Rhizoctonia solani species complex. Mycologia 85,
797–800.
Liu, Z.L., Domier, L.L. and Sinclair, J.B. (1995) Polymorphism of genes coding for
nuclear 18S rRNA indicates genetic distinctness of anastomosis group 10 from

other groups in Rhizoctonia species complex. Applied and Environmental
Lobuglio, K.F., Pitt, J.I. and Taylor, J.W. (1993) Phylogenetic analysis of two
Manulis, S., Kogan, N., Reuven, M. and Ben-Yephet, Y. (1994) Use of RAPD
technique for identification of Fusarium oxysporum f. sp. dianthi from carnation.
Phytopathology 84, 98–101.
Maurer, P., Couteaudier, Y., Girard, P.A., Bridge, P.D. and Riba, G. (1997) Genetic
diversity of Beauveria bassiana (Bals.) Vuill. and relatedness to host insect range.
Mycological Research 101, 159–164.
Mazzola, M., Wong, O.T. and Cook, R.J. (1996) Virulence of Rhizoctonia oryzae and
R. solani AG-8 on wheat and detection of R. oryzae in plant tissues by PCR.
Mehmann, B., Brunner, I. and Braus, G.H. (1994) Nucleotide sequence variation of
chitin synthase genes among ectomycorrhizal fungi and its potential use in
taxonomy. Applied and Environmental Microbiology 60, 3105–3111.
Meyer, W., Morawetz, R., Borner, T. and Kubicek, C.P. (1992) The use of DNA-
fingerprint analysis in the classification of some species of the Trichoderma
aggregate. Current Genetics 21, 27–30.
Mills, P.R., Sreenivasaprasad, S. and Brown, A.E. (1992) Detection and differentiation
of Colletotrichum gloeosporiodes isolates using PCR. FEMS Microbiology Letters
98, 137–144.
Molina, F.I., Jong, S. and Huffman, J.L. (1993) PCR amplification of the 3 external
transcribed and intergenic spacers of the ribosomal DNA repeat unit in three
species of Saccharomyces. FEMS Microbiology Letters 108, 259–264.
Mordue, J.E.M., Banniza, S., Bridge, P.D. and Rutherford, M.A. (1996) Integrated
biochemical, cultural and numerical methods. In: Sneh, B., Jabaji-Hare, S., Neate,
S. and Dijst, G. (eds) Rhizoctonia Species: Taxonomy, Molecular Biology,
Ecology, Pathology and Disease Control. Kluwer Academic, Dordrecht,
pp. 87–98.
Morton, A., Tabrett, A.M., Carder, J.H. and Barbara, D.J. (1995) Sub-repeat
sequences in the ribosomal RNA intergenic regions of Verticillium alboatrum
and V. dahliae. Mycological Research 99, 257–266.
Nazar, R.N., Hu, X, Schmidt, J., Culham, D. and Robb, J. (1991) Potential use of
PCR amplified ribosomal intergeneic sequences in the detection and differ-
entiation of Verticillium wilt pathogen. Physiological and Molecular Plant
Pathology 39, 1–11.
Nei, M. and Li, W.H. (1979) Mathematical model for studying genetic variation in
terms of restriction endonucleases. Proceedings of the National Academy of
Neuvéglise, C., Brygoo, Y. (1994) Identification of group-I introns in the 28S rDNA
of the entomopathogenic fungus Beauveria brogniartii isolated from insects.
Current Genetics 27, 38–45.
Neuvéglise, C., Brygoo, Y., Vercambre, B. and Riba, G. (1994) Comparative analysis
of molecular and biological characteristics of strains of Beauveria brongniartii
isolates from insects. Mycological Research 98, 322–328.
Nicholson, P. and Rezanoor, H.N. (1994) The use of random amplified polymorphic
DNA to identify pathotype and detect variation in Pseudocercosporella herpo-
trichoides. Mycological Research 98, 13–21.
O’Donnel, K.L. (1992) Ribosomal DNA internal transcribed spacers are highly
divergent in the phytopathogenic ascomycetes Fusarium sambucinum (Gibber-
ella pulicaris). Current Genetics 22, 213–220.
Ouellet, T. and Seifert, K.A. (1993) Genetic characterization of Fusarium grami-
nearum strains using RAPD and PCR amplification. Phytopathology 83,
1003–1007.
Pipe, N.D., Chandler, D., Bainbridge, B.W. and Heale, J.B. (1995) Restriction
fragment length polymorphisms in the ribosomal RNA gene complex of isolates
of the entomopathogenic fungus Metarhizium anisopliae. Mycological Research
99, 485–491.
Potenza, L., Amicucci, A., Rossi, I., Palma, F., DeBellis, R., Cardoni, P. and Stocchi,
V. (1994) Identification of Tuber magnatum pico DNA markers by RAPD
analysis. Biotechnology Techniques 8, 93–98.
Poupard, P. Simonet, P., Carelier, N. and Bardin, R. (1993) Molecular characterization
of Pseudocercosporella herpotrichoides isolates by amplification of ribosomal
DNA internal transcribed spacers. Plant Pathology 42, 873–881.
Rainey, F.A., Ward-Rainey, N.L., Janssen, P.H., Hippe, H. and Stackebrandt, E.
(1996) Clostridium paradoxum DSM7308T contains multiple 16S rRNA genes
with heterogeneous intervening sequences. Microbiology 142, 2087–2095.
Riesberg, L.H. (1996) Homology among RAPD fragments in interspecific compar-
isons. Molecular Ecology 5, 99–105.
Sanders, I.R., Alt, M., Groppe, K., Boller, T. and Wiemken, A. (1995) Identification
of ribosomal DNA polymorphisms among and within spores of the Glomales:
application to studies on the genetic diversity of arbuscular mycorrhizal fungal
communities. New Phytologist 130, 419–427.
Savolainen, V., Cuénoud, P., Spichiger, R., Martı́nez, M.D.P., Crèvecoeur, M. and
Manen, J. (1995) The use of herbarium specimens in DNA phylogenetics;
evaluation and improvement. Plant Systematics and Evolution 197, 87–98.
Schlick, A., Kuhls, K., Meyer, W., Lieckfeldt, E., Borner, T. and Messner, K. (1994)
Fingerprinting reveals gamma-ray induced mutations in fungal DNA: implica-
tions for identification of patent strains of Trichoderma harzianum. Current
Genetics 26, 74–78.
Sherriff, C., Whelan, M.J., Arnold, G.M., Lafay, J.F., Brygoo, Y. and Bailey, J. (1994)
Ribosomal DNA sequence analysis reveals new species groupings in the genus
Colletotrichum. Experimental Mycology 18, 121–131.
Shilling, A.G., Moller, E.M. and Geiger, H.H. (1996) Polymerase chain reaction-
nearum and F. acenaceum. Phytopathology 86, 515–522.
Sneath, P.H.A. (1993) A proposal on metrics for identification using nucleic acid
sequences. FEMS Microbiology Letters 106, 1–8.
Sneath, P.H.A. and Sokal, R.R. (1973) Numerical Taxonomy. W.H. Freeman, San
Francisco.
Sneh, B., Jabaji-Hare, S, Neate, S. and Dijst, G (eds) (1996) Rhizoctonia species:
Taxonomy, Molecular Biology, Ecology, Pathology, and Disease Control. Kluwer

Academic Press, Dordrecht, p. 578.
Spreadbury, C.L., Bainbridge, B.W. and Cohen, J. (1990) Restriction fragment length
polymorphisms in isolates of Aspergillus fumigatus probed with part of the
intergenic spacers region from the ribosomal RNA genes complex of Aspergillus
nidulans. Journal of General Microbiology 136, 1991–1994.
Sreenivasaprasad, S., Brown, A.E. and Mills, P.R. (1992) DNA sequence variation and
interrelationships among Colletotrichum species causing strawberry anthrac-
nose. Physiological and Molecular Plant Pathology 41, 265–281.
Taylor, J.W. and Swann, E.C. (1994) DNA from herbarium specimens. In: Herrman,
B. and Hummel, S. (eds) Ancient DNA. Springer Verlag, Berlin.
Taylor, J.W. and White, T.J. (1991) Molecular evolution of nuclear and mitochondrial
ribosomal DNA region in Neurospora and other Sordariceae and comparison
with the mushroom, Laccaria. Fungal Genetics Newsletter 38, 26.
Tingey, S.V. and del Tufo, J.P. (1993) Genetic analysis with random amplified
polymorphic DNA markers. Plant Physiology 101, 349–352.
Tisserat, N.A., Hulbert, S.H. and Sauer, K.M. (1994) Selective amplification of rDNA
internal transcribed spacer region to detect Ophiosphaerella korrae and O.
herpotricha. Phytopathology 84, 478–482.
Versalovic, J., Koeuth, T. and Lupski, J.R. (1991) Distribution of repetitive DNA
sequences in eubacteria and application to fingerprinting of bacterial genomes.
Vilgalys, R. and Cubeta, M.A. (1994) Molecular systematics and population biology
of Rhizoctonia. Annual Review of Phytopathology 32, 132–155.
Vilgalys, R. and Gonzalez, D. (1990) Ribosomal DNA restriction fragment-length
polymorphisms in Rhizoctonia solani. Phytopathology 80, 151–158.
Vilgalys, R. and Hester, M. (1990) Rapid genetic identification and mapping of
enzymatically amplified ribosomal DNA from several Cryptococcus species.
Journal of Bacteriology 172, 4238–4246.
Waalwijk, C., de Koning, J.R.A., Baaven, R.P. and Gams, W. (1996) Discordant
groupings of Fusarium spp. from sections Elegans, Liseola and Dlaminia based
on ribosomal ITS1 and ITS2 sequences. Mycologia 88, 361–368.
Wakefield, A.E., Pixley, F.J., Banerji, S., Sinclair, K., Miller, R.F., Moxon, E.R. and
Hopkin, J.M. (1990) Amplification of mitochondrial ribosomal RNA sequences
from Pneumocystis carinii DNA of rat and human origin. Molecular Bio-
chemistry and Parasitology 43, 69–76.
Wakefield, A.E., Guiver, L., Miller, R.F. and Hopkin, J.M. (1991) DNA amplification
on induced sputum samples for diagnosis of Pneumocystis carinii pneumonia.
Lancet 337, 1378–1379.
Ward, E. and Akrofi, A.Y. (1994) Identification of fungi in the Gaeumannomyces-
Phialophora complex by RFLPs of PCR-amplified ribosomal DNAs. Myco-
logical Research 98, 219–224.
White, T.J., Bruns, T., Lee, S. and Taylor, J.W. (1990) Amplification and direct
Gelgard, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols: A Guide to
Methods and Applications. Academic Press, New York, pp. 315–322.
Williams, J.G.K., Kubeik, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990)

Wu, B.C. and Magill, C.W. (1995) Spontaneous mutations at fingerprint loci in clonal
lineages of the rice blast fungus. Experimental Mycology 19, 86–90.
Wyss, P. and Bonfante, P. (1993) Amplification of genomic DNA of arbuscular-
mycorrhizal (AM) fungi by PCR using short arbitrary primers. Mycological
Research 97, 1351–1357.
Xue, B. Goodwin, P.H. and Annis, S.L. (1992) Pathotype identification of Lepto-
sphaeria maculans with PCR and oligonucleotide primers from ribosomal
internal transcribed spacer sequences. Physiological and Molecular Plant Pathol-
ogy 41, 179–188.
Yates-Siilata, Sanders, D.M. and Keath, E.J. (1995) Genetic diversity in clinical
isolates of the dimorphic fungus Blastomyces dermatitidis detected by PCR-
based random amplified polymorphic DNA assay. Journal of Clinical Micro-
biology 33, 2171–2175.
Zijlstra, C., Lever, A.E.M., Uenk, B.J. and Van Silfhout, C.H. (1995) Differences
between ITS regions of isolates of root-knot nematodes Meloidogyne hapla and
M. chitwoodi. Phytopathology 85, 1231–1237.
PCR Applications in Studies 5
of Lichen-forming Fungi
A. Crespo1, O.F. Cubero1 and M. Grube2
1
Departamento de Biologı́a Vegetal II, Universidad Complutense de
Madrid, Ciudad Universitaria, 28040 Madrid, Spain; 2Institut für
Botanik, Karl-Franzens-Universität Graz, 8010 Graz, Austria
5.1 Introduction
Analysis of DNA from lichens was rare prior to the development of PCR-
based techniques. In early molecular applications, Blum and Keshevarov
(1986, 1992) used total DNA hybridization to estimate the relationship of the
genera Umbilicaria and Lasallia. Isolation and agarose gel electrophoresis of
DNA from various cultured mycobionts was carried out by Ahmadjian et al.
(1987). With the introduction of PCR (Mullis and Faloona, 1987) during the
last decade the situation changed completely and nucleic acids became easily
accessible sources of new characters. Today, PCR is an important tool for
molecular investigations of mycobiont phylogeny and population genetics.
In this chapter we present an overview of the recent progress of PCR
applications in the study of lichen-forming fungi. Because lichens are a
symbiotic association of a fungus and an alga, they require special
considerations for molecular studies. To date, most molecular work with
lichens has been carried out with nuclear ribosomal genes of the fungal
partner (mycobiont). This chapter, therefore, focuses on the mycobiont:
in the first part we emphasize the specific features of lichens and their
significance for DNA isolation and PCR techniques; an overview of
phylogenetic approaches to lichens is followed by a section on insertions
and introns in ribosomal genes of mycobiont DNA; and the remainder
of our contribution concentrates on population studies and miscellaneous
PCR applications.

86 A. Crespo et al.
5.2 Characteristic Features of Lichens
As emphasized in the Dictionary of the Fungi (Hawksworth et al., 1995),

lichens are a biological and not a systematic group of fungi. Hawksworth and
Honegger (1994) provided the definition of a lichen as ‘an ecologically
obligated, stable mutualism between an exhabitant fungal partner and an
inhabitant population of extracellularly located unicellular or filamentous
algal or cyanobacterial cells’. Lichens are not the only possible fungal/algal
or fungal/cyanobacterial symbioses (Table 5.1) but they signify one of the
most successful multibiont associations with a worldwide distribution.
Lichens are particularly remarkable in the diverse morphological features
shown by the composite organism. The thalli of certain lichens are among the
most complex structures to have evolved in fungi (Douglas, 1994). The fungal
partners in lichens are not known to occur in a free-living form, rather they
dominate the overall morphology of the vegetative and fertile structures of the
symbiotic associations. Nevertheless, there is an interplay between the
partners during ontogeny, as different morphologies of thalli may develop by
the interaction of a single fungus with cyanobacteria or with green algae (James
and Henssen, 1976). Another characteristic feature of almost all lichens is the
longevity of the thalli and/or the fruiting bodies. Consequently, the long-term
exposure to environmental conditions and the complex organization of thalli
may result in a high degree of plasticity of lichens.
The scientific name that is applied to the lichen association strictly refers
to the fungal partner alone (ICBN, art. 13.1d; Greuter et al., 1994). Hence,
Table 5.1. Different forms of fungal/algal symbioses. From Hawksworth (1988).
Number of bionts Examples
Two-biont symbioses
Mycobiont as inhabitant Mycophycobioses
Fungal parasites of algae
Mycobiont as exhabitant Lichens
Three-biont symbioses
Two photobionts: one mycobiont Cephalodia
Blue-green/green morphotypes
Algicolous lichens
Bryophilous lichens
Two mycobionts: one photobiont Lichenicolous fungi
Mechanical hybrids
Four-biont symbioses
Three photobionts: one mycobiont Cephalodia
Two photobionts: two mycobionts Lichenicolous lichens
Three mycobionts: one photobiont Fungi on lichenicolous fungi
Five or more biont symbioses Mechanical hybrids
Study of Lichen-forming Fungi 87
the classification and systematics of lichens refer to the relationships among

lichen-forming fungi, independent of their symbiotic photosynthetic part-
ners, which have separate algal or cyanobacterial names. The combined
association has no name and naming a lichen is synonymous to naming the
fungal partner in a lichen association. As a consequence of this, molecular
systematic studies have focused on the lichen mycobiont.
5.3 General Remarks on Molecular Work with Lichens
The molecular study of lichen symbioses has been impeded by several

problems. Both mechanical isolation of sufficient starting material and axenic
cultivation of lichen-forming fungi were cumbersome and impractical
approaches for earlier molecular studies. Through the application of PCR, it
is now possible to undertake investigations with minute amounts of living or
even herbarium material. However, several points must be kept in mind in
molecular studies: (i) lichens often grow in dense associations with other
individuals or other species. Additionally, they may often be difficult to
separate from their substrate. Therefore, lichen material intended for DNA
isolations must be examined carefully to avoid exogenous contaminants, such
as substrate particles (e.g. bryophytes) or DNA from other fungi (see Petrini
et al., 1990). In addition, an important source of undesired DNA may be the
occurrence of inhabitant lichenicolous fungi. The algal or cyanobacterial
partner is usually not problematic if discrimatory DNA isolation or PCR
techniques are used; (ii) lichens are well known for their ability to synthesize
high amounts of diverse secondary compounds including polysaccharides.
High concentrations of various polysaccharides may inhibit the efficiency of
PCR and so isolation techniques must be optimized to eliminate secondary
compounds in general and polysaccharides in particular; (iii) PCR anomalies
may occur when working with the rDNA of mycobionts. A pair of primers,
which works well for many other isolations, may not always amplify the
target region even if fresh material is used. Conversely, multiple PCR
products may occur even when contamination by other fungal species can be
excluded. These phenomena may be due to the presence of optional
insertions at priming sites. Because insertions are frequently found in rDNA
of mycobionts, they require further consideration and will be described in
greater detail later.
5.4 DNA Isolation and PCR Amplification from Lichens
As indicated briefly above, careful dissection of lichen material is important

to eliminate DNA of other organisms in general, and that of fungal
cohabitants in particular. Both lichenicolous fungi, of which there are about
1000 described species, and lichenicolous lichens, frequently occur on or in
88 A. Crespo et al.
lichens as parasites or commensals (Hawksworth et al., 1995). Microscopic

examination prior to dissection of material may confirm the quality of the
starting material. Amplification of genomic material from the photosynthetic
partner can be circumvented by two approaches. First, fungal material may
be isolated mechanically from the lichen thallus, or second, oligonucleotide
primers are selected which exclusively amplify fungal DNA.
5.4.1 Mechanical isolation of fungal material

Purely fungal structures are almost always present in lichens. These include
hymenia in fruiting bodies, or pycnidia, thalloconidia, rhizines, rhizino-
morphs, cilia, medullae, and cortical structures (Fig. 5.1). Successful isola-
tions from podetia (DePriest and Been, 1992), basidiomata (Lutzoni and
Vilgalys, 1995a), ascomata (Grube et al., 1995) and rhizines (Crespo et al.,
1997a) have been described.
5.4.2 Discriminatory molecular techniques

The most elegant and common approach to amplifying mycobiont DNA is
by using fungal-specific oligonucleotides as PCR primers. Using this
Fig. 5.1. Examples of algal-free material used for molecular studies with lichen
mycobionts. (A) Decorticated podetium of Cladonia. (B) Chondroid medulla of Usnea. (C)
Ascomatal structures. (D) Cortical layers, medulla, and rhizines. (E) Mycobiont cultures.
approach, it is possible to isolate DNA from the total lichen, including the
algal/cyanobacterial partner without time-consuming dissection of fungal
material. Under appropriate PCR conditions, it is often sufficient to have
only one fungal-specific primer in the primer pair. About nine fungal-specific
primers suitable for work with lichens have already been designed by
comparative analysis of small subunit (SSU) rDNA sequences (Gargas and
Taylor, 1992; Gardes and Bruns, 1993; Gargas and DePriest, 1996). These
primers also allow selective amplification of fungal internal transcribed
spacer (ITS) regions. To date, in the lichen-forming fungi, the nuclear large
subunit (LSU) rRNA gene is currently being investigated with fungal-
specific primers (P. Clerc, Genève, 1995, personal communication; M. Grube,
unpublished work).
Standard DNA isolation protocols which are useful for a wide range of
fungi, for example that described by Lee and Taylor (1990), may not be
optimal for certain lichens. DNA extraction from lichens must consider the
high concentration of polysaccharides present in many species. Armaleo and
Clerc (1991) used column purification in their DNA isolation protocols to
eliminate PCR and restriction enzyme inhibitors. Their method II also
included an enzymatic treatment for the degradation of polysaccharides.
More recently, addition of CTAB (cetyl-trimethyl ammonium bromide) to
the extraction buffer has proved to be very efficient for DNA isolation from
lichens (Armaleo and Clerc, 1995; Crespo et al., 1997a). A protocol described
by Grube et al. (1996) relies on the selective affinity of DNA to glass powder
and was used to isolate DNA from ascomata.
Optimal yield of isolated DNA is generally achieved with fresh lichen
material. However, fresh material is not always accessible and herbarium
collections may provide important material for molecular studies. It has been
demonstrated that intact DNA can be isolated from mushrooms that have
been stored in herbaria for several decades (Bruns et al., 1990; Taylor and
Swann, 1994). The DNA degradation rate of herbarium material varies
among different lichens and it is usually difficult to get sufficient DNA of
Usnea species if the sample is more than 10 years old (data not shown),
whereas it has been possible to get considerable amounts of PCR product
from DNA of a 30-year-old specimen of Multiclavula mucida (GenBank acc.
no. 23542; Gargas et al., 1995a).
Usually, PCR conditions follow manufacturer’s guidelines but they may
be optimized depending on primer sequence and target sequence length.
Addition of compounds such as dimethyl sulphoxide to the PCR buffer is
not considered to improve results. A large number of primers are now
available for the PCR amplification of nuclear ribosomal genes of fungi
(Gargas and DePriest, 1996; Lutzoni and Vilgalys, 1995a) and a standardized
nomenclature for these has been proposed by Gargas and DePriest (1996).
Such primers are complementary to the conserved regions of the SSU rDNA,
and also to the 5′ region of the LSU rDNA and all have successfully been
applied to the PCR amplification of SSU, ITS regions and LSU rDNA of
90 A. Crespo et al.
lichen-forming fungi. However, 12 of the primers span positions of optional

insertions and may fail to amplify if an insertion is disrupting a priming site
(Gargas and DePriest, 1996). In such cases, it is advisable to amplify the
target region with a different pair of primers. The primers used for PCR may
also be applied for the direct sequencing of amplification products. Today,
cycle sequencing has become the most popular technique for obtaining
sequences from PCR products of lichen-forming fungi, and automated
sequencing systems now allow sequence information to be obtained in a
relatively short time.
5.5 Molecular Evolution in Lichens
About 13,500 or two-fifths of all ascomycetes occur as lichens and 13 of the

46 orders of ascomycetes include lichen-forming fungi (Hawksworth et al.,
1995). Investigation of phylogenetic relationships among lichen-forming
fungi is therefore important for a better understanding of fungal evolution in
general. The integration of lichen-forming mycobionts into the system of
Eumycota has been particularly considered by molecular studies on the
phylogenetic origins of the lichen symbioses, and an Eumycota phylogeny
based on parsimony analysis of SSU rDNA sequences has been constructed
by Gargas et al. (1995a). In this study five origins of lichenization were
detected within the true fungi. Two origins of the lichen state were found in
the ascomycetes where the lichen habit arose in groups with both sapro-
phytic and parasitic relatives. Ongoing research is concentrating on a
refinement of the Eumycota phylogeny by including other lichen groups
(Gargas and DePriest, 1996).
Molecular-phylogenetic studies focusing on the SSU rDNA gene have
also been carried out at various lower taxonomic levels. These are of special
significance in groups where morphological characters are limited, or
convergent morphological evolution is expected. Wedin (1996) has presented
a phylogenetic hypothesis of four families of Caliciales. He demonstrated
that representatives of Sphaerophoraceae form a monophyletic group within
the Lecanorales. However, the core group of Caliciales including Caliciaceae,
Mycocaliciaceae and Sphinctrinaceae was not monophyletic. Whereas Cal-
iciaceae form a separate monophyletic group within the Lecanorales, the two
other families appear as a monophyletic group basal to a clade formed by
representatives of Eurotiales and Onygenales. Stenroos and DePriest (1996)
provided a phylogeny of stipitate lichens encompassing Cladoniaceae,
Cladiaceae, Siphulaceae, and Stereocaulaceae. According to their hypothesis,
these families form a monophyletic group within the Lecanorales. Tehler
(1995a, 1995b) and Myllis and Tehler (1996) carried out a phylogenetic
analysis of Arthoniales and emphasized that some groups based on morpho-
logical data were corroborated by molecular results whereas others were
clearly not. Eriksson and Strand (1995) studied the relationships of Solorina,
Peltigera and Nephroma and found that Solorina and Peltigera were closely
related and should be kept in the same family, Peltigeraceae, whereas
Nephroma was distinct and that its placement in a separate family, Nephro-
mataceae, was supported by molecular characters. Marsh et al. (1994)
investigated the cladistic relationships within the family Ramalinaceae. The
preliminary analyses contributed to the understanding of generic concepts in
Ramalinaceae and showed that Dievernia and Ramalinopsis were more
closely related to each other than either is to Nieblia.
Søchting and Lutzoni (1996) investigated the SSU rDNA variation in the
Teloschistaceae. They showed that the genus Xanthoria is polyphyletic and
includes lineages related to Caloplaca subgen. Gasparrinia and subfruticose
Caloplaca species. A phylogenetic analysis of the Umbilicariaceae was
undertaken by Bobrova and Ivanova (1996). According to their hypothesis,
Lasallia does not form a sister group to Umbilicaria. The latter appears to be
paraphyletic, contradictory to the current morphological concept. Lutzoni
and Vilgalys (1995a) and Lutzoni (1996) undertook a phylogenetic analysis
of Omphalina, including lichen-forming and free-living species. The
sequence data based on ITS and LSU rDNA data suggested that the lichen-
forming Omphalina species are a monophyletic group.
With the increasing number of sequences available, several other
challenging issues of lichen evolution can be addressed by molecular
methods. For example, the taxonomic position of sterile or otherwise poorly
understood species can now be evaluated. Hoffmann (1996) analysed DNA
from the sterile lichen Normandina pulchella and from co-occurring
perithecia referred to as Lauderlindsaya borreri. The latter is sometimes
regarded as the fertile stage of Normandina. The preliminary results suggest
that Normandina is an ascomycete genus, but different from the lichenico-
lous Lauderlindsaya.
A classic debate in lichenology regarding the reproductive mechanisms
and their impact on species evolution has been developed through the
discussion about species pairs or ‘Artenpaare’ (Poelt 1970; Culberson and
Culberson, 1973; Tehler 1982) and reviewed by Mattsson and Lumbsch
(1989). Species pairs are parallel taxa with similar thallus morphology, where
one taxon is fertile and the other is sterile, propagating via soredia, isidia or
analogous organs. The relationships between species pairs have been investi-
gated using ITS sequences (Lohtander and Tehler, 1996). A cladistic analysis
of Dendrographa species suggests that the apomictic strains in this genus
originated repeatedly from a fertile primary species (A. Tehler, Salzburg,
1996, personal communication).
Recently, efforts have been made to combine molecular and morpho-
logical evidence in lichen phylogenetic studies (Eriksson and Strand, 1995;
Lutzoni and Vilgalys, 1995a, b; Tehler, 1995a, b; Lutzoni, 1997). The topol-
ogy of phylogenetic trees from morphological and molecular data sets may
differ significantly and there are several strategies that may be used to obtain
single phylogenies. The taxonomic congruence method involves separate
92 A. Crespo et al.
analyses of different data sets and subsequent consensus analysis, whereas the
method of total evidence uses both data sets in a combined analysis. Tehler
(1995b) discussed the logical difficulties of applying taxonomic congruence
and demonstrated the limitations of this method in a phylogenetic analysis
of the Arthoniales. Alternatively, Lutzoni and Vilgalys (1995b) proposed that
data sets should be analysed separately and be tested if any conflict arose
between them. As trees are constructed from samples of data, one important
reason for topological differences may be sampling error. If the differences
can be explained by sampling error, the morphological and molecular data
sets may be combined in phylogenetic analyses. Available tests for evaluating
heterogeneity between data sets (e.g. Rodrigo’s test, T-PTP test, and Kishino
and Hasegawa test) have been compared by Lutzoni and Vilgalys (1995b).
They showed that only the method of Rodrigo et al. (1993) explicitly
addressed the question of sampling error.
5.6 Insertions and Introns
It has already been mentioned that PCR results are dependent on the
presence or absence of insertions at oligonucleotide priming sites (Gargas
and DePriest, 1996). Such insertion sequences, which may differ in length,
are found at a high frequency in the ribosomal genes of the mycobiont and
they may increase the length of the SSU rDNA by as much as 100%. To date,
17 insertion positions have been described from the nuclear SSU rDNA, and
13 of them are known from lichen-forming fungi (Table 5.2). Seven insertion
positions are so far known from the nuclear LSU rDNA, although only one
of them is also found in lichen mycobionts. Multiple insertions may be found
in a single species, and seven insertions have been found in the SSU rDNA
of Lecanora dispersa (Gargas et al., 1995b).
Many of these insertions can be classified as group I introns (subgroup
IC; Michel and Westhof, 1990) by sequence analysis. In a pioneering work,
DePriest and Been (1992) showed that group I introns have a variable
distribution in the rDNA of the Cladonia chlorophaea complex. As
detailed later, this variability is of importance for lichen population studies.
When transcribed, group I introns share a common secondary
structure and, by their intricate RNA folding, they may act as ribozymes,
which catalyse their own excision from their host genes. DePriest and Been
(1992) pointed out that the group I introns present in C. chlorophaea do
not splice under standard in vitro conditions typically used for self-splicing
experiments with other group I introns. This phenomenon is in accordance
with a lack of structural elements that are usually found in self-splicing
introns (Jaeger et al., 1996; Lehnert et al., 1996). For example, one
characteristic feature of introns at positions 1046, 1199, 1210, 1389, and
1516 from Cladonia is a relatively short P5 region. This character is also
found in homologous introns of other lichen-forming fungi, e.g. in
Table 5.2. Presence of insertions in nuclear SSU rDNA (based on Gargas et al., 1995b; Grube et al., 1996, and aunpublished data). Positions are
according to E. coli numbering.
Insertion position 114 287 323 392 516 531 789 943 956 1046 1052 1199 1210 1389 1506 1512 1516
Lichen-forming fungi + + – + + – + + – + – + + + +a + +
Other organisms – – + – + + – + + + + + – – + + –
94 A. Crespo et al.
Fig. 5.2. Putative secondary structure of a group IC intron at position 1210 in the nuclear
SSU rDNA of Lecanora muralis. Representation according to Cech et al. (1994).
Lecanora (Fig. 5.2). DePriest and Been (1992) suggested that trans acting
factors are required for correct splicing because the Cladonia introns are
missing in mature rRNA.
In addition to group I introns, an increasing number of relatively short
insertions of less than 100 nucleotides in length has been described in lichen-
forming and free-living fungi (Rogers et al., 1993; Untereiner et al., 1995;
Grube et al., 1996). These short insertions are located at known intron
positions, and some of them disrupt essential regions of mature rRNA.
Rogers et al. (1993) showed, by RT–PCR, that short insertions are cut out
from mature transcripts, although the splicing mechanisms remain unclear.
Gargas et al. (1995b) used the term degenerate introns for short insertions
and Grube et al. (1996) suggested that they may be the vestiges of initially
complete introns, which lack the P3–P9 regions.
Phylogenetic relationships of various insertion site lineages of introns
have been investigated for green algae by Bhattacharya et al. (1994, 1996),
who showed an apparent monophyly of introns at positions 1506 and 1512,
respectively. Generally, the introns at homologous positions have almost
identical sequences in the conserved regions of the catalytic core. Increased
sequence variation is, however, observed at peripheral regions. The sequence
of the P2 region, considered as a spacer by Peyman (1994), and the P9 region
are the most variable parts of the introns. Additionally, by analysing the
known lichen introns, Bhattacharya et al. (1996) suggested that the closer
relationships of introns at position 1199 and 287 and of introns at position
1210 and 1389 may be due to an ancient lateral transfer of an intron. This
view is underlined by similarities of the 5′ flanking regions and the P10
pairing in each of the lineages.
We prepared a preliminary phylogenetic analysis of introns at position
1516, which are frequently found in Lecanorales (Fig. 5.3). Introns at this posi-
tion from various representatives of Lecanorales can be aligned and parsimony
analysis shows partial incongruency with the current classification of the
lichens studied. The Cladonia introns appeared together with introns from
Lecanora and Parmelia. This branch represented a sister group to introns from
Physconia. According to the current concept of the Lecanorales, Cladonia
would be a basal clade in this selection of taxa. The incongruency might be due
to horizontal transfer of introns within the Lecanorales. This is also consistent
with the theory of ‘late introns’, i.e. introns which are inserted secondarily into
a particular position during rDNA evolution (see DePriest 1995). As introns in
each of the genera group together it is probable that horizontal transfer of
divergent introns is an ancient or rare event in Lecanorales. Conversely, there is
evidence for a considerable rate of intron mobility within populations of a
single species (see below).
It is still unclear whether introns are evenly distributed throughout the
ribosomal repeat. It has repeatedly been observed that more than one
fragment is amplified even from DNA of a single thallus (unpublished work).
That these phenomena are due to the presence of lichenicolous fungi can be
96 A. Crespo et al.
Fig. 5.3. Phylogenetic analysis of introns at position 1516 from various representatives of
the Lecanorales. Strict consensus tree from three most parsimonious trees found using
the branch and bound algorithm of the PAUP program (Swofford, 1991). The Tetrahymena
thermophila intron (Tt.LSU) was used as an outgroup.
excluded by microscopic examination. On the other hand it is possible that

a lichen thallus is occasionally composed of more than one individual since
fusion of different lichen thalli and mechanical hybridization can be observed
occasionally in nature (see below). Alternatively, DePriest (1993a, b), Gargas
et al. (1995b) and Crespo et al. (1997a) mentioned that more than one repeat
type had been found even in single individuals of mycobionts. Gargas et al.
(1995b) stated that the variable occurrence of insertions in the rDNA-repeat
may produce anomalous PCR amplifications. We occasionally observe that
even in those cases where a single intron-containing product was amplified,
an intron-less product is obtained when a primer is used that spans the intron
position, and which does not, therefore, amplify repeat units that contain the
intron (unpublished results; see Gargas and DePriest, 1996). The reasons for
these phenomena are unclear; however this is a challenging issue for future
research. It is also important in this context to consider that the number of
rDNA repeat units may change during vegetative growth (Pukkila and
Skrzynia, 1993) and that meiotic recombination of rDNA is suppressed in
certain fungi (Cassidy et al., 1984; Russell et al., 1988).
5.7 Genetic Variability of Populations
Lichen species may exhibit a high degree of morphological variation (Poelt,

1994). In many cases, this variation is apparently due to different ecological
conditions. On the other hand, numerous examples are known where
significantly different morphotypes of the same species grow side-by-side
(Poelt, 1994). This indicates that certain phenotypic variation is also inherited
as a genetic trait, which is also the case for chemical polymorphisms
(Culberson et al., 1988). However, whereas there is now evidence that
secondary compounds are produced by the mycobiont alone, it has not been
estimated how much of the morphological variation may be attributed to
different populations of photobionts within a lichen thallus. Independent
genetic characters are therefore of great importance for lichen population
studies.
Ribosomal DNA offers characters for direct investigation of mycobiont
populations. Great variability of fungal rDNA within a lichen population
was first demonstrated by DePriest and Been (1992). A single mat (about the
size of a hand) of C. chlorophaea was composed of 13 different genotypes.
A detailed analysis of these genotypes was presented by DePriest (1994) by
using restriction site patterns and Southern hybridization. The sharing of
restriction patterns suggests that some chemotypes may be polymorphisms
of a single species in the C. chlorophaea complex. Significant size polymor-
phism of PCR products already show that this tremendous variation is due
to the variable occurrence of insertions. Sequence analysis indicates that most
insertions are group I introns in the coding regions of the rDNA.
DePriest (1995) used the information of the different genotypes to
address questions of intron mobility in the C. chlorophaea complex. The
phylogenetic hypothesis based on rDNA types suggests that it is most
parsimonious to consider that both insertion and deletion of group I introns
occur in rDNA of C. chlorophaea.
In different species of lichens, the heterogeneity of populations may
vary. Whereas single mats of C. chlorophaea consist of many SSU rDNA
genotypes, individual mats of Cladina subtenuis are genetically uniform
(Beard and DePriest, 1996). However, different mats of Cladina may be
assigned to various genotypes. Three size classes of PCR products from the
3′ region of the SSU rDNA were detected among separate mats due to the
presence of optional group I introns. Different PCR size-classes have also
been described in a population study of Parmelia sulcata (Crespo et al.,
1997b, 1998). In this study, PCR products from the ITS regions including the
terminal region of the SSU and LSU rDNA were amplified. A significant
increase in product size – of c. 200 nucleotides – was due to the presence of
an intron at position 1516 in P. sulcata. Similar size variations were also
observed in the related species Parmelia saxatilis (Fig. 5.4). In Physconia, the
frequency of group I introns at position 1516 varied among different species
(Cubero and Crespo, 1996). However, no correlation has yet been observed
98 A. Crespo et al.
Fig. 5.4. Length variation of PCR products from Parmelia saxatilis. Lanes 1 and 7, 100 bp
ladder; lane 2, a specimen from Spain (Casa de Campo); lanes 3 and 4, material from
England (New Forest, Hampshire); lanes 5 and 6, specimens from England (Sheffield). Lane
5 shows a significantly larger product (850 nucleotides) due to the presence of a group I
intron.
between the different intron frequencies and morphological variation, sexual

mechanisms or ecological amplitude of species.
LaGreca (1996) presented a population study on the Ramalina amer-
icana complex, which included morphologically identical but chemically
different races. Cladistic analysis of ITS sequence data suggested that the
species complex consisted of two distinct groups. This grouping was also
correlated with differences in chemical diversity and geographic distribution.
The two groups were also supported by analyses of a second data set based
on sequences of introns at position 1516 in the nuclear SSU rDNA.
An alternative approach to the study of lichen populations is possible
using the random amplification of polymorphic DNA (RAPD) technique
(Williams et al., 1990). Short primers are used to randomly amplify fragments
which are interpreted as genetic markers. This technique may be applied to
estimate variation over complete genomes. The only available RAPD study
with lichens (Cubero et al., 1995) showed complex banding patterns with
significant differences between populations from distant sites (Fig. 5.5).
Further work is needed to evaluate the significance of RAPD analysis for
population studies in lichens.
5.8 Miscellaneous Molecular Studies
Some miscellaneous studies address further issues of molecular lichenology.

Glacier-covered lichens may serve as a source of ancient DNA. Gargas et al.
Fig. 5.5. Random amplification of polymorphic DNA (RAPD) from Parmelia saxatilis
(Cubero et al., 1995). Lanes 1 and 2, specimens from Antarctica (South Settlands,
Livingston Island); lanes 3, 4 and 5, specimens from Spain (Sierra de Aillón); lanes 6, 7 and
8, specimens from Spain (Ávila, Sierra de Gredos).
(1994) have isolated DNA from specimens of Umbilicaria cylindrica that

were recently exposed after the glacier receded. Radiocarbon dating sug-
gested that this material had been under the ice for 1300 years. Successful
PCR amplification of DNA was possible from such apparently well
preserved material. Therefore mummified lichens can be used to investigate
sequence variation over historical time periods.
Armaleo and Clerc (1991) analysed different photomorphs of single
lichen-forming fungi in the genera Pseudocyphellaria and Sticta. Fragments
2.2 kb in length were amplified from the 5′ region of nuclear LSU rDNA.
The products were then digested by restriction enzymes. Subsequent agarose
gel analysis of the restriction fragments showed a ‘near identity’ of the
different photomorphs. The similarity of the restriction patterns can be
interpreted as molecular evidence that the corresponding photomorphs
belong to the same fungal species.
PCR product length may also be used to detect distinct genetic individuals
in lichen associations. Both partners of the lichen symbiosis may consist of
more than one individual. This was suggested by indirect evidence from
morphological and isozyme analyses (summarized by Fahselt, 1996) and
mechanical hybridization between different initial thalli is a common explana-
tion for such multisymbioses (see Fig. 5.10 in Honegger, 1996). Fahselt (1996)
suggested that if intrathalline electrophoretic differences are generated by
multiple symbionts, it is likely that they are related to the mycobiont, since
100 A. Crespo et al.
fungal biomass predominates in lichen thalli. Further evidence for this

hypothesis is found by rDNA size polymorphisms within thalli of P. sulcata.
Multiple amplification products were found with a frequency of 7% (n = 261
thalli; A. Crespo, unpublished work) in single thalli using fungal-specific
primers (ITS1F and ITS4; Gardes and Bruns, 1993). PCR products of different
length have been amplified from DNA isolations along a gradient through a
thallus (Fig. 5.6). These data may indicate that more than one fungal rDNA
genotype is present in a single thallus of P. sulcata.
5.9 Conclusions
PCR is a powerful technique for the investigation of the genetic variation in

nuclear rRNA genes of lichen-forming fungi. The newly available sequence
analyses contribute much to our understanding of lichen phylogeny. More
representatives of the different orders of ascomycetes will be sequenced and
this will clarify our views on the evolutionary origins of lichenization.
Investigations at lower taxonomic levels will improve our knowledge
about evolution within and among lichen populations, species, genera, and
families. It is now possible to link genetic information with that of
morphological and chemical characters to study convergent evolution in
different groups of lichen-forming fungi.
The frequency of insertions and introns is regarded as a useful character for
population studies on lichens. The sequence diversity of mycobiont introns
will also offer new information about the molecular evolution of ribozymes.
Future work will include investigations of various, yet poorly exploited
Fig. 5.6. PCR products of different length within a single thallus of Parmelia sulcata. Lanes
1–4 show PCR products from isolations along a gradient through a thallus 3 cm in
diameter. Lanes 5 and 10 are used as spacers. Lanes 6–9 show uniform PCR products
from four isolations along a gradient through a second thallus. Lanes 11–14 show uniform
but longer PCR products from four isolations along a gradient through a third thallus. The
three specimens were from Casa de Campo, Madrid, Spain.
genes. The ITS regions, LSU rDNAs and protein genes will be important
additional sources of characters for phylogenetic studies. Beside further
studies on ribosomal genes, a major challenge for the next years will be to
study directly the genes which contribute to the tremendous chemical
diversity of lichen compounds. Armaleo and Miao (1996), Miao and Davies
(1998) and Miao et al. (1996) have already made advances in this direction.
Acknowledgements
The support and advice of D.L. Hawksworth in the review of this

manuscript is gratefully acknowledged. The authors are grateful to L. Jaeger
for revision of the folding of the Lecanora muralis intron. We thank U. Arup
for help in the laboratory and L.L.G. Sancho and U. Trinkaus for comments
on the manuscript. This work was supported by ANT 94-0905, AMB94-
1209, APC-0020 and PB 93-1129-C0201 from the Ministerio de Educación
y Ciencia, Spain and by P11806-GEN from the Fonds zur Förderung der
Wissenschaftlichen Forschung, Austria.
References
Ahmadjian,V., Chadeganipour, M., Koriem, A.M. and Paracer, S. (1987) DNA and
protoplast isolations from lichens and lichen symbionts. Lichen Physiology and
Biochemistry 2, 5–15.
Armaleo, D. and Clerc, P. (1991) Lichen chimeras: DNA analysis suggests that one
fungus forms two morphotypes. Experimental Mycology 15, 1–10.
Armaleo, D. and Clerc, P. (1995) A rapid and inexpensive method for the purification
of DNA from lichens and their symbionts. Lichenologist 27, 207–213.
Armaleo, D. and Miao, V. (1996) Towards a molecular analysis of lichen polyketide
biosynthesis. IAL3 Abstracts, Salzburg, 92 pp.
Beard, K.H. and DePriest, P.T. (1996) Genetic variation within and among mats of the
reindeer lichen, Cladina subtenuis (des Abb.) Hale and W.Culb. Lichenologist 28,
171–182.
Bhattacharya, D., Surek, B., Rüsing, M., Damberger, S. and Melkonian, M. (1994)
Group I introns are inherited through common ancestry in the nuclear-encoded
rDNA of Zygnematales (Charophyceae). Proceedings of the National Academy
Bhattacharya, D., Friedl, T. and Damberger, S. (1996) Nuclear-encoded rDNA group
I introns; origin and phylogenetic relationships of insertion site lineages in the
green algae. Molecular Biology and Evolution 13, 978–989.
Blum, O.B. and Kashevarov, G.P. (1986) The DNA homologies as a proof of the
legitimacy of the establishment of the lichen genus Lasallia Merat (Umbilicar-
iaceae). Doklady Akademii Nauk Ukrainskoi SSR, Ser. B 1986, 61–64 (in
Russian).
Blum, O.B. and Kashevarov, G.P. (1992) The DNA homologies as a proof of the
legitimacy of the establishment of the lichen genera Lasallia Merat, Cladina
(Nyl.) Harm. and Pseudevernia Zopf. In: Karnefelt, I. (ed.) IAL2 Abstracts,
Lund, p. 1.
Bobrova, V.K. and Ivanova, N.V. (1996) The distribution of group I introns in the
SSU rDNA among the representatives of the lichen family Umbilicariaceae.
IAL3 Abstracts, Salzburg, p. 98.
from fungal herbarium specimens. Mycologia 82(2), 175–184.
Cassidy, J.R., Moore, D., Lu, B.C. and Pukkila, P.J. (1984) Unusual organization and
lack of recombination in the ribosomal RNA genes of Coprinus cinereus.
Current Genetics 8, 607–613.
Cech, T.R., Damberger, S.H. and Gutell, R.R. (1994) Representation of the secondary
and tertiary structure of group I introns. Structural Biology 1, 273–280.
Crespo, A., Bridge, P.D. and Hawksworth, D.L. (1997a) Amplification of fungal
rDNA-ITS regions from non-fertile specimens of the lichen-forming genus
Parmelia. Lichenologist 29(3), 275–282.
Crespo, A., Bridge, P.D., Cubero, O.F. and Hawksworth, D.L. (1997b) Determina-
tion of genotypic variability in the lichen-forming fungus Parmelia sulcata.
Bibliotheca Lichenologica (in press).
Crespo, A., Bridge, P.D., Hawksworth, D.L., Grube, M. and Cubero, O.F. (1998)
Recolonization by one of three rRNA genotypes of Parmelia sulcata following
SO2 amelioration. Botanical Journal of the Linnaean Society 68, 73–79.
Cubero, O.F. and Crespo, A. (1996) Genetic variability in populations of Physconia
enteroxantha (Nyl.) Poelt. IAL3 Abstracts, Salzburg, p. 151.
Cubero, O.F., Crespo, A. and Ochando, M.D. (1995) Aplicación de la técnica de
RAPD a estudios en lı́quenes. Resumenes del XI Simposium Nacional de
Botánica Criptogámica, Santiago de Compostela, p. 231.
Culberson, W.L and Culberson, C.F. (1973) Parallel evolution in lichen-forming
fungi. Science 180, 196–198.
Culberson, C.F., Culberson, W.l. and Johnson, A. (1988) Gene flow in lichens.
American Journal of Botany 75, 1135–1139.
DePriest, P.T. and Been, M.D. (1992) Numerous group I introns with variable
distribution in the ribosomal DNA of a lichen fungus. Journal of Molecular
Biology 228, 315–321.
DePriest, P.T. (1993a) Small subunit rDNA variation in a population of lichen fungi
due to optional group I introns. Gene 134, 67–74.
DePriest, P.T (1993b) Molecular innovations in lichen systematics: The use of
ribosomal and intron nucleotide sequences in the Cladonia chlorophaea com-
plex. The Bryologist 96, 314–325.
DePriest, P.T. (1994) Variation in the Cladonia chlorophaea complex II: ribosomal
DNA variation in a southern Appalachian population. The Bryologist 97, 117–126.
DePriest, P.T. (1995) Phylogenetic analyses of the variable ribosomal DNA of the
Cladonia chlorophaea complex. Cryptogamic Botany 5, 60–70.
Douglas, A.E. (1994) Symbiotic Interactions. Oxford University Press, Oxford.
Eriksson, O.E. and Strand, A. (1995) Relationships of the genera Nephroma, Peltigera
and Solorina (Peltigerales, Ascomycota) inferred from 18S rDNA sequences.
Systema Ascomycetum 14(1), 33–38.
Fahselt, D. (1996) Individuals, populations and population ecology. In: Nash III, T.H.
(ed.) Lichen Biology. Cambridge University Press, Cambridge, pp. 181–198.
basidiomycetes. Application to the identification of mycorrhizae and rust.

Gargas, A. and DePriest (1996) A nomenclature for fungal PCR primers with
examples from intron-containing SSU rDNA. Mycologia 88, 745–748.
Gargas, A. and Taylor, J.W. (1992) Polymerase chain reaction (PCR) primers for
amplifying and sequencing nuclear 18S rDNA from lichenized fungi. Mycologia
84, 589–592.
Gargas, A., DePriest, P.T. and Ivanova, N. (1994) Glacier-covered lichens: sources of
ancient DNA. IMC5 Abstracts. Vancouver, p. 69.
Gargas, A., DePriest, P.T., Grube, M. and Tehler, A. (1995a) Multiple origins of lichen
symbioses in fungi suggested by SSU rDNA phylogeny. Science 268, 1492–1495.
Gargas, A., DePriest, P.T. and Taylor, J.W. (1995b) Positions of multiple insertions in
208–218.
Greuter, W., Barrie, F.R., Burdet, H.M., Chaloner, W.G., Demoulin, V., Hawksworth,
D.L., Jørgensen, P.M., Nicolson, D.H., Silva, P.C., Trehane, P. and McNeill, J.
(1994) International Code of Botanical Nomenclature (Tokyo Code). Adopted by
the Fifteenth International Botanical Congress, Yokohama. August–September
1993. [Regnum Vegetabile 131] Koeltz Scientific Books, Königstein.
Grube, M., DePriest, P.T., Gargas, A. and Hafellner, J. (1995) DNA isolation from
lichen ascomata. Mycological Research 99, 1321–1324.
Grube, M., Gargas, A. and DePriest, P.T. (1996) A small insertion in the SSU rDNA
of the lichen fungus Arthonia lapidicola is a degenerate group I intron. Current
Genetics 29, 582–586.
Hawksworth, D.L. (1988) The variety of fungal–algal symbioses, their evolutionary
significance, and the nature of lichens. Botanical Journal of the Linnaean Society
96, 3–20.
Hawksworth, D.L. and Honegger, R. (1994) The lichen thallus: a symbiotic and
phenotype of nutritionally specialized fungi and its response to gall producers.
In: Williams, M.A.J. de. (ed.) Plant Galls: Organisms, Interactions, Populations.
Clarendon Press, Oxford.
Bisby’s Dictionary of the Fungi. CAB International, Wallingford.
Hoffmann, N. (1996) SSU rDNA sequence data support Normandina pulchella as a
sterile ascomycete. IAL3 Abstracts. Salzburg. p. 106.
Honegger, R. (1996) Morphogenesis. In: Nash III, T.H. (ed.) Lichen Biology.
Cambridge University Press, Cambridge, pp. 65–87.
Jaeger, L., Michel, F. and Westhof, E. (1996) The structure of group I ribozymes.
Nucleic Acids and Molecular Biology 10, 33–51.
James, H.M. and Henssen, A. (1976) The morphological and taxonomic significance
of cephalodia. In: Brown, D.H., Hawksworth, D.L. and Bailey, R.H. (eds)
Lichenology: Progress and Problems. Academic Press, London.
LaGreca, S. (1996) A phylogenetic evaluation of chemical variation in the Ramalina
americana complex and a preliminary molecular phylogeny for the genus
Ramalina. IAL3 Abstracts. Salzburg. p. 112.
Protocols: a Guide to Methods and Applications. Academic Press, San Diego,
pp. 282–287.
Lehnert, V., Jaeger, L., Michel, F. and Westhof, E. (1996) New loop–loop tertiary
interactions in self-splicing introns of subgroup IC and ID: a complete 3D model
of the Tetrahymena thermophila ribozyme. Chemistry and Biology, 993–1009.
Lohtander, K. and Tehler, A. (1996) Species pair studies in Dirina and Dendrographa
based on molecular data. IAL3 Abstracts. Salzburg, p. 114.
Lutzoni, F. and Vilgalys, R. (1995a) Omphalina (Basidiomycota, Agaricales) as a
model system for the study of coevolution in lichens. Cryptogamic Botany 5,
71–81.
Lutzoni, F. and Vilgalys, R. (1995b) Integration of morphological and molecular data
sets in estimating fungal phylogenies. Canadian Journal of Botany 73 (suppl. 1),
S649–S659.
Lutzoni, F. (1996) Phylogeny of lichen- and non-lichen-forming omphalinoid
mushrooms and the utility of testing for combinability among multiple data sets.
Systematic Biology 46, 373–406.
Marsh, J., DePriest, P.T., Gargas, A. and Nash III, T. (1994) A cladistic analysis of the
genera of the lichen family Ramalinaceae based on 18S rDNA sequences. IMC5
Abstracts. Vancouver. p. 133.
Mattsson, J. and Lumbsch, H.T. (1989) The use of species pair concept in lichen
taxonomy. Taxon 38(2), 238–241.
Miao, V. and Davies, J. (1998) Molecular diversity of polyketide biosynthesis genes
in lichens. In: Baltz, R.H. and Hegeman, G.D. (eds) Proceedings of GMBIM-6,
American Society for Microbiology (in press).
Miao, V., Glass, N.L. and Lee, A. (1996) A genetic approach to understand polyketide
metabolism in lichens. IAL3 Abstracts. Salzburg. p. 36.
Michel, F. and Westhof, E. (1990) Modelling of the three-dimensional architecture of
group I catalytic introns based on comparative sequence analysis. Journal of
polymerase-catalysed chain reaction. Methods in Enzymology 155, 355–350.
Myllis, L. and Tehler, A. (1996) A phylogeny of Arthoniales based on SSU rDNA
data. IAL3 Abstracts. Salzburg. p. 120.
Petrini, O., Hake, U. and Dreyfuss, M.M. (1990) An analysis of fungal communities
isolated from fruticose lichens. Mycologia 82, 444–451.
Peyman, A. (1994) P2 functions as a spacer in the Tetrahymena ribozyme. Nucleic
Acids Research 22, 1383–1388.
Poelt, J. (1970) Das Konzept der Artenpaare bei den Flechten. Vorträge aus dem
Gesamtgebiet der Botanik herausgegeben von der deutschen botanischen Gesell-
schaft, n.s. 4, 187–198.
Poelt, J. (1994) Different species types in lichenized ascomycetes. In: Hawksworth,
D.L. (ed.) Ascomycete Systematics: Problems and Perspectives in the Nineties.
Plenum Press, New York.
Pukkila, P.J. and Skrzynia, C. (1993) Frequent changes in the number of reiterated
ribosomal RNA genes throughout the life cycle of the basidiomycete Coprinus
cinereus. Genetics 133, 203–211.
Rodrigo, A.G., Kelly-Borges, M., Bergquist, P.R. and Bergquist, P.L. (1993) A
randomisation test of the null hypothesis that two cladograms are sample
estimates of a parametric phylogenetic tree. New Zealand Journal of Botany 31,
257–268.
Rogers, S.O., Yan, Z.H., Shinohara, M., LoBuglio, K.F. and Wang, C.J.K. (1993)
Messenger RNA intron in the nuclear 18S ribosomal RNA gene of deuter-
omycetes. Current Genetics 23, 338–342.
Russell, P.J., Petersen, R. and Wagner, S. (1988) Ribosomal DNA inheritance and
recombination in Neurospora crassa. Molecular General Genetics 211, 541–544.
Søchting, U. and Lutzoni, F. (1996) Phylogenetic relationships among members of the
Teloschistaceae based on the nuclear ribosomal small subunit. IAL3 Abstracts.
Salzburg. p. 126.
Stenroos, S. and DePriest, P.T. (1996) Phylogeny of the lichen families Cladoniaceae,
Cladiaceae, Siphulaceae and Stereocaulaceae: evidence from nuclear rDNA
sequences. IAL3 Abstracts. Salzburg. p. 88.
Swofford, D.L. (1991) PAUP: Phylogenetic Analysis using Parsimony, Version 3.1.
Computer program distributed by the Illinois Natural History Survey, Cham-
paign, Illinois.
Taylor, J.W. and Swann, E.C. (1994) DNA from herbarium specimens. In: Herrman,
B. and Hummel, S. (eds) Ancient DNA. Springer-Verlag, Berlin.
Tehler, A. (1982) The species pair concept in lichenology. Taxon 31, 708–714.
Tehler, A. (1995a) Arthoniales phylogeny as indicated by morphological and rDNA
sequence data. Cryptogamic Botany 5, 82–97.
Tehler, A. (1995b) Morphological data, molecular data, and total evidence in
phylogenetic analysis. Canadian Journal of Botany 73 (suppl. 1), S667–S676.
Untereiner, W.A., Straus, N.A. and Malloch, D. (1995) A molecular-
morphotaxonomic approach to the systematics of the Herpotrichiellaceae and
allied black yeasts. Mycological Research 99, 897–913.
Wedin, M. (1996) Phylogeny and evolution of Caliciales s.lat. as shown by ribosomal
DNA sequences. IAL3 Abstracts. Salzburg. p. 10.
Williams, J.G.K., Kubelik, A.R., Lavak, K.J., Rafalski, J.A. and Tingey, S.V. (1990)
Applications of PCR for 6
Studying the Biodiversity of
Mycorrhizal Fungi
L. Lanfranco, S. Perotto and P. Bonfante
Dipartimento di Biologia Vegetale dell’Università and Centro di
Studio sulla Micologia del Terreno del CNR, Viale Mattioli 25,
I-10125 Torino, Italy
6.1 Introduction
Mycorrhizal fungi are a heterogeneous group of about 6000 species

belonging to the Zygo-, Asco- and Basidiomycotina. They are grouped into
a number of different types depending on their morphological relationships
with the host plants, which comprise about 240,000 plant species.
Mycorrhizal fungi occupy different niches during their life cycle: they reside
in the rhizosphere as spores, hyphae and propagules, they occupy the
rhizoplane during their interaction with the root, and finally develop inside
the root tissues during the symbiotic phase (Bianciotto and Bonfante, 1998).
Despite the diversity of the taxa involved, mycorrhizal fungi share
substantial features. They live in close association with the roots and
accomplish their life cycle due to the establishment of symbiotic
relationships. During the interaction, a bidirectional transfer of mineral
nutrients and carbon occurs, ensuring a continuous flow of nutrients
between the partners (Smith and Read, 1997). There is extensive literature
on the molecular, cellular and physiological aspects of mycorrhizal fungi
(Allen 1992; Gianinazzi and Schuepp, 1994; Bonfante and Perotto, 1995;
Martin et al., 1995; Harrison, 1997). The positive effects of mycorrhizal
fungi on plant nutrition, health and soil stability have valuable agro-
biotechnological importance for low-input agriculture. However, previous
knowledge of the biological diversity of mycorrhizal fungi in the
rhizosphere is important to the potential exploitation of these fungi in agro-
biotechnological systems. For example, the physiological traits and
effectiveness of mycorrhizal fungi differ widely, depending on their
taxonomic position and (at a lower rank) on the individual isolate. PCR-
108 L. Lanfranco et al.
based techniques have been used to provide molecular tools for the
identification of both endo- and ectomycorrhizal fungi when their
morphological characters are ambiguous or missing. They have also been
used to examine relations between closely related species and populations
of a single species, a level of resolution usually beyond the reach of classic
morphological studies.
6.2 Molecular Tools to Study Biodiversity
According to Bruns and Gardes (1993), the ideal region of choice for PCR
amplification should be: (i) present in all fungi of interest; (ii) easy to amplify;
(iii) preferentially amplified from fungi, when plant and fungal DNAs are
mixed; and (iv) variable enough to enable probes to be designed for several
taxonomic hierarchies (species, genera, families). Genes coding for ribosomal
RNA (rDNA) satisfy many of these criteria, and have been extensively
analysed. Repeated copies of rDNA genes are present in the genome of both
prokaryotes and eukaryotes. They are highly conserved and composed of
different regions (Fig. 6.1). The ribosomal coding regions are the best
conserved, the internal transcribed spacers (ITS) display a certain degree of
variation, and the intergenic spacers (IGS) are the most variable regions.
Amplification of these regions is normally followed by restriction fragment
length polymorphism (RFLP) analysis of the PCR-generated fragments.
Other PCR-based techniques have also been used to study the bio-
diversity of mycorrhizal fungi. Random amplification of polymorphic DNA
(RAPD) is based on the use of short oligonucleotides of random sequence.
This technique has proved to be a powerful tool in revealing genetic
differences between closely related organisms, and has been extensively used
in ecological studies to investigate the biodiversity of natural populations
(Hadrys et al., 1992; Foster et al., 1993).
PCR amplification of regions containing microsatellites has been less
commonly used in mycorrhizal research. Microsatellites are a special class of
tandem repeats that involve a base motif of 1–10 bp repeated up to 100 times
(Tautz, 1993) and dispersed over many genomic loci. They are present in
eukaryotic genomes and have been used in individual identification, parent-
age testing, population genetic studies, genome mapping and in the screening
Fig. 6.1. Scheme showing a rDNA repeat. The positions corresponding to the annealing
sites for several primers are shown by arrows.
Study of Mycorrhizal Fungi 109
of genomic libraries. Their exceptionally high mutation rate makes micro-

satellites very informative for determining relationships between closely
related species (Bowcock et al., 1994; Goldestein and Clark, 1995).
The aim of this chapter is to review the recent literature on PCR
techniques applied to mycorrhizal symbionts, and to discuss their implica-
tions in soil microbial ecology.
6.3 PCR-based Methods to Investigate Population Dynamics

of Ectomycorrhizal Fungi
More than 5000 species of ectomycorrhizal (ECM) fungi are associated with
the secondary roots of Gymnosperms and Angiosperms (Molina et al., 1992).
One of the major objectives of current research is to understand the structure
and dynamics of these fungal communities (Dahlberg and Stenlid, 1995).
ECM fungi in fact display a great diversity even in small monoculture forests,
which are typically occupied by 20–35 species (Bruns, 1995). Prior to the
introduction of PCR methods, community studies focused on the presence
of sporocarps with the assumption that their production reflected the
abundance of symbiotic mycelia (Dahlberg and Stenlid, 1995). The presence
of ECM fungi can also be evaluated through their morphological identifica-
tion on mycorrhizal root apices: however, caution should be used because the
extent of intraspecific morphological variations between taxa and in the same
taxon on different hosts or in different environments is not well known
(Egger, 1995). The PCR methods have advantages when applied to any stage
in the life cycle of a mycorrhizal fungus including fruiting bodies, mycor-
rhizas, extraradical mycelia and isolated mycelia growing in vitro.
The nuclear and mitochondrial genes encoding structural rRNAs have
been used to identify ECM fungi (Gardes et al., 1991). Bruns and Gardes
(1993) designed probes by the alignment of partial sequences of the
mitochondrial large subunit rRNA gene (mt-LSU), which were specific for
several taxa within the suilloid group of the Boleta. The probes were targeted
at Suillus, Rhizopogon, and Gomphidius, and their specificity was determined
by testing their ability to hybridize to PCR amplified fragments from 84
basidiomycete species. The probes were mostly useful in the identification of
suilloid fungi at the generic level.
The original universal primers designed by White et al. (1990) to amplify
the nuclear ITS region have been followed by primers for the amplification
of specific taxa. Gardes and Bruns (1993) designed two taxon selective
primers intended to be specific for fungi (ITS1-F) and Basidiomycetes (ITS4-
B) respectively, though they can often amplify plant DNA. One limitation
in the use of the ITS region is that the level of intraspecific variability is not
uniform for all species. On the other hand, the ITS region is, in general,
sufficiently variable to allow the clear discrimination between distantly
related species and related genera. The increasing number of available
sequences of ribosomal genes has also allowed the construction of phyloge-

netic trees. For example Kretzer et al. (1996) have revised the genus Suillus
by analysing 38 isolates belonging to many species. On this basis, they
proposed a phylogenetic tree and suggested interesting relationships between
the EMF and their host plants.
The development of PCR-based protocols has initiated many pro-
grammes for the investigation of the extent of biological diversity in field
conditions. In a study carried out in a Norwegian spruce forest in Sweden,
Erland (1995) used the universal primers ITS1 and ITS4 to amplify the ITS
region from DNA extracted from mycorrhizal tips. Five major RFLP
patterns were found from the amplified products and one was identified as
typical of Tylospora fibrillosa. This fungus was present in at least 21% of the
mycorrhizal roots tested, and was regarded as one of the most abundant
mycorrhizal fungi. Similarly, Karen et al. (1996) compared RFLP patterns of
ITS products amplified from mycorrhizal roots with those obtained from
fruiting bodies of reference species. In this investigation, the fruiting body
inventory indicated that the clear-cut planted forest had the lowest diversity
and species richness, despite the fact that it showed the highest number of
fruiting bodies. A forest of 150- to 200-year-old trees produced less fruiting
bodies, but examination of mycorrhizal tips revealed several species which
did not form epigeous fruiting bodies. In conclusion, the results suggested
that forestry management affects fruiting body diversity more than mycor-
rhizal diversity (Karen et al., 1996). Another interesting study of natural
ECM populations was performed by Gardes and Bruns (1996). They
examined the species diversity of a community in a forest of Pinus muricata
in order to determine the above- and below-ground correspondence, in
terms of species composition, spatial frequency and abundance. ITS-RFLP,
taxon-specific oligonucleotide probes, and sequence analysis were applied to
fruiting bodies and mycorrhizal tips sampled over a 4-year period. Over 45
fungal species were identified and grouped according to three patterns: (i)
some, such as Russula xerampelina, were well represented both above and
below ground; (ii) some, such as Suillus pungens, were mostly found as
epigeous fruiting bodies; (iii) some, such as Russula amoenolens were not
represented in the above-ground species. These results demonstrated that
ECM fungal species change their resource allocation towards the production
of either fruiting bodies or ectomycorrhizae in the same environment.
Moreover, it is clear that there is no correspondence between above- and
below-ground fungal structures (Gardes and Bruns, 1996).
The fate of an introduced ECM strain has been followed in a long-
standing study by the group of Martin and Le Tacon, who monitored the
presence of Laccaria bicolor strain S238N, an isolate known to improve the
growth of Douglas fir and Norwegian spruce in nurseries. To evaluate the
competitivity and persistence of the isolate after transplantation, the myco-
trophic status of the forest trees was examined morphologically and
determined by ribotyping between 1 and 10 years after planting out. Laccaria
was present in 90% of the mycorrhizal tips after 1 year, but in only 3% after
4 years, since it had been widely replaced by local strains. However, in other
forest sites, Laccaria persisted for at least 10 years. These results showed that
the destiny of an inoculated strain depends on the host plant, the presence of
competitive local strains, and/or the climatic conditions (Henrion et al.,
1994b; Di Battista et al., 1996; Selosse et al., 1996).
In southern Europe, truffles have been the subject of intense application
studies since the 1970s due to the outstanding commercial value of some
species (Chevalier, 1994). Identification of truffles during their symbiotic
phase is one of the major topics in this kind of research. The fruiting bodies
are usually identified on the basis of the structure of the peridium and gleba,
size and shape of their spores and asci, and their wall ornamentation.
However, these features are lost when the hyphae of the mantle and Hartig
net develop on the plant root. Many fruiting bodies have been easily
identified with primers which amplify the ITS regions (Henrion et al., 1994a;
Lanfranco et al., 1995a; Paolocci et al., 1995), whereas many difficulties
remain when mycorrhizal roots are considered. ITS primers often amplify
plant DNA and, therefore, can give rise to complex patterns (Mello et al.,
1996).
Strategies can be developed to allow the exclusive amplification of fungal
DNA from species of interest. For example, sequences of ITS fragments
amplified from fruiting bodies have been analysed in order to design specific
primers which permit the exclusive detection of the fungus of interest (Mello
et al., 1997) (Fig. 6.2). These specific sequences generally work at the species
level, but only when the degree of intraspecific variation of the ITS region is
low, as has already been demonstrated for some truffle species (Guillemaud
et al., 1996).
PCR amplification of single copy genes is an alternative approach. For
example, Kreuzinger et al. (1996) have successfully used this method on a
1.2 kb fragment of the gene encoding glyceraldehyde-3-phosphate de-
hydrogenase. The amplified fragments from Boletus, Lactarius, and Amanita
were distinguished by RFLP analysis and Southern blot hybridization, while
fluorescent DNA probes could easily be used in slot-blot experiments. This
approach is an original way for quickly developing inexpensive probes to
detect ECM fungi of ecological and economic value.
6.4 Arbuscular Mycorrhizal Fungi: from the Development

of Specific Probes to Ecological and Genetic Analysis
Arbuscular mycorrhizal (AM) fungi are obligate endosymbionts that colo-
nize the roots of almost 80% of land plants. They belong to the Order
Glomales (Morton and Benny, 1990), and consist of least 150 species, usually
identified by their spore morphology (Walker, 1992). Simon et al. (1992,
1993a, b) were the first to apply PCR techniques to AM fungi in a study of
Fig. 6.2. Design of specific primers for Tuber species. (A) Amplification products with
ITS1 and ITS4 primers on DNA extracted from the fruiting bodies of ten Tuber species.
Lanes: 1, pBR 322 digested with HinfI; 2, T. magnatum; 3, T. borchii; 4, T. maculatum; 5,
T. melanosporum; 6, T. macrosporum; 7, T. rufum; 8, T. aestivum; 9, T. brumale; 10, T.
excavatum; 11, T. ferrugineum; 12, no DNA. (B) On the basis of the ITS sequence,
specific primers were designed for T. borchii and used to amplify a single band of 432 bp
from fruiting bodies (lane 2), ectomycorrhizae (lane 3) and mycelium (lane 4). No
amplification is obtained from other truffle species (lanes 5–11).
the nuclear gene encoding the small subunit rRNA. From the complete 18S
sequence of two AM species (Glomus intraradices and Gigaspora margarita),
they designed a primer (VANS1) that only amplified Glomales species, when
used in combination with universal primers. This combination has success-
fully amplified the fungal DNA in mycorrhizal roots colonized by Glomus
vesiculiferum (Simon et al., 1992). When more 18S sequences from other AM
species became available, family specific primers were also designed and used
on mycorrhizal roots. The amplified products were then subjected to single-
strand conformational polymorphism (SSCP) analysis to detect sequence
differences (Simon et al., 1993b).
The sequence data of the small ribosomal subunit from 12 isolates of
glomalean fungi have been used to map the phylogenetic relationships

between AM fungi (Simon, 1996). The results confirmed the validity of the
taxonomic grouping and allowed Simon et al. (1993a) to construct a
molecular clock, by estimating the divergence times between glomalean
families and genera.
The development of molecular markers for the identification of individ-
ual spores has been an important step for investigating species diversity of
AM fungi in the rhizosphere of natural communities (Clapp et al., 1995;
Sanders et al., 1995, 1996; Dodd et al., 1996). Sanders et al. (1995) developed
a protocol for PCR amplification with the universal primers ITS1 and ITS4,
followed by RFLP to characterize the ITS region from single AM fungus
spores. The ITS region, which is approximately 600 bp long, showed clear
differences between species only after RFLP; the restriction patterns were
reproducible for individual spores of a given species. However, when the
technique was applied to spores from a Swiss grassland, the results were
much more complex: ten individual spores belonging to the same morpho-
logical Glomus group produced ten different patterns, suggesting a high
genetic diversity between individual spores.
Clapp et al. (1995) used PCR and genus-specific primers designed from
18S rDNA to investigate the fungal composition of mycorrhizal roots
collected in the field. They introduced the selective enrichment of amplified
DNA (SEAD) technique, based on the principle of subtractive hybrid-
ization, to remove interfering plant-derived DNA. Three genera of AM
fungi, Acaulospora, Scutellospora and Glomus, were detected in bluebell
roots. While the presence of the first two genera was expected on the basis
of the spores found in the soil around the roots, Glomus spores were very
rare in the rhizosphere, suggesting that the presence of an endophytic fungus
does not always correlate with the presence of propagules.
Alternative PCR-based strategies have been devised to identify AM
fungi during the sporal and symbiotic phases. Short arbitrary oligonucleo-
tides were used as primers for the amplification of DNA extracted from
spores of AM fungi in RAPD experiments (Wyss and Bonfante, 1993;
Lanfranco et al., 1997). RAPD analysis is a very sensitive tool for the
detection of genetic differences between individuals. A non-polymorphic
band was identified as a marker for eight isolates of Glomus mosseae. The
fragment (about 650 bp long) was cloned and sequenced, and a pair of
specific primers were designed (Lanfranco et al., 1995b). These specifically
amplified not only the DNA from G. mosseae spores, but also from roots of
pea, clover, leek and onion plants when they were colonized by G. mosseae
isolates. In addition, they allowed G. mosseae to be distinguished from the
closely related species G. coronatum: interestingly, the two species were not
distinguishable by ITS amplification techniques (Fig. 6.3) (Dodd et al.,
1996).
Highly repeated sequences are also widespread in the fungal genome.
Their presence has been demonstrated in AM fungi by two approaches:
Fig. 6.3. Genome analysis on AM fungi. (A) Amplification products with ITS1 and ITS4
primers on DNA extracted from AM fungi. A single band of about 500–560 bp was
obtained when the following isolates were investigated: 1, Glomus coronatum; 2, G.
mosseae; 3, G. versiforme; 4, G. flavisporum; 5, Gigaspora margarita. Different patterns
were obtained after RFLP analysis with HinfI. (B) RAPD analysis performed using the
primers OPA-7, OPA-11 and OPA-18 (Operon Technologies, USA) on: 1, Glomus
coronatum; 2, G. mosseae; 3, Gigaspora margarita. Highly polymorphic patterns, which
allow a clear separation between G. coronatum and G. mosseae were obtained. M,
λ DNA digested with HindIII and EcoRI (from Dodd et al., 1996 by permission of New
Phytologist, Cambridge University Press).
Longato and Bonfante (1997) have used primers designed on microsatellite

sequences, such as (CT)8 , (GACA)4 , (TGTC)4 , to obtain species-specific
amplification profiles. This approach has proved to be a reliable and
technically simple method for assaying genetic variability. Zézé et al. (1996)
have isolated a highly repeated sequence from a partial genomic library of
Scutellospora castanea. This DNA fragment has been shown to be specific for
this species by Southern blot hybridization, and by PCR assays with
oligonucleotides derived from the sequence.
Molecular markers targeted to the ribosomal genes have provided new
information. Sanders et al. (1995) have shown that a single spore of G.
mosseae contains at least two different ITS sequences. Moreover, a third ITS
variant has been found by Franken and Gianinazzi-Pearson (1996) by
sequencing a ribosomal clone from a genomic phage library of G. mosseae.
Lloyd-MacGilp et al. (1996) have made it clear that ITS heterogeneity is
normal within Glomus spores. They obtained two sequences from single
spores of three G. mosseae isolates and one isolate of G. dimorphicum, and
three sequences from a single G. coronatum spore. Interestingly, the sequence
divergence between isolates from distant continents is scarcely greater than
that within single spores. The authors concluded that the sequence variants
have evolved over a long time-scale relative to the rate at which these fungi
spread across the world.
Some recent data obtained from the Gigasporaceae have shown a similar
situation for this family. Three ITS sequences have been identified by cloning
the amplified ITS fragment from Gigaspora margarita (L. Lanfranco,
unpublished work), although it should be noted that these were obtained
from a multispore DNA preparation. More compelling is the finding of
different 18S sequences in a single spore of Scutellospora collected in an oak
woodland in the north of England (J.P. Clapp, unpublished work, cited by
Sanders et al., 1996). These results show a high level of genetic variability in
genes belonging to the same genome (Sanders et al., 1996) and in organisms
thought to be asexual. The many questions they raise have been discussed in
detail by Sanders et al. (1996) who suggest that the multinucleate spores and
hyphae of Glomales may be the products of heterokaryotic processes, and
the variability of ITS sequence may be related to asexual reproduction.
In conclusion, PCR-based molecular markers for the identification of
AM fungi allow both the investigation of their biodiversity in the rhizo-
sphere and within the roots, and the elaboration of a phylogenetic frame-
work. These methods have also opened the way to an understanding of AM
fungal genetics.
6.5 PCR-based Methods to Analyse the Complexity of

Ericoid Mycorrhizal Fungal Populations
Ericaceous plants associate with soil fungi to form a distinctive type of
mycorrhiza, termed ericoid mycorrhiza (Perotto et al., 1995). The specific
features of this symbiosis make ericoid mycorrhizal plants successful in
colonizing low-mineral, acidic organic soils high in toxic metal ions, where
a crucial role in plant nutrition has been ascribed to the saprotrophic
capabilities of the mycorrhizal endophyte. The endophytes isolated so far
belong to the ascomycetes, although basidiomycetes have been observed by

electron microscopy inside naturally colonized roots (Bonfante, 1980). Few
fungal species have been identified as partners of this mycorrhiza: Hymeno-
scyphus ericae was the first (Read, 1974), and several Oidiodendron species
have also been demonstrated to be mycorrhizal in several parts of Europe
and North America (Couture et al., 1983; Dalpé, 1986; Douglas et al., 1989;
Perotto et al., 1996a). However, the taxonomic position of most isolates is
unknown, because they do not form identifiable reproductive structures.
Isolates of H. ericae are usually hard to identify, as they often grow as sterile
mycelia in pure culture.
Investigation of the genetic diversity of ericoid fungi has greatly
benefited from PCR techniques as a means of overcoming the difficulties of
morphological identification. By coupling molecular methods and traditional
taxonomy, new tools have been provided for the study of ericoid mycor-
rhizal fungi. PCR–RFLP analysis of different regions of the ribosomal genes
has been used to investigate the identity and diversity of ericoid fungi.
Examination of the small subunit of the ribosomal genes of the hyphomycete
Scytalidium vaccinii revealed its close taxonomic relationship with H. ericae
(Egger and Siegler, 1993), while RFLP analysis of the ITS region amplified
from mycelia colonizing Calluna vulgaris roots has demonstrated that the
root of a single plant harbours several populations of mycorrhizal and non-
mycorrhizal fungi (Perotto et al., 1996a). Investigation of mycelia isolated
from Gaultheria shallon roots (Monreal et al., 1996) has also revealed the
contemporary presence of fungi with different ITS restriction patterns.
RAPD analysis has enabled a higher resolving power to be used in the
investigation of the genetic polymorphism of isolates sharing the same ITS-
RFLP pattern (Perotto et al., 1996a). Results of PCR amplification with
about ten random primers on about 80 mycorrhizal mycelia isolated from C.
vulgaris growing in five neighbouring sites have shown a high polymorphism
in Oidiodendron maius isolates, even those derived from the same plant, and
a lower variability within populations of sterile mycelia (Fig. 6.4). These data
indicate that the root system of a single plant of C. vulgaris is a complex
mosaic where several populations of mycorrhizal fungi coexist, each repre-
sented by a variable number of genetically distinct individuals (Perotto et al.,
1996a). The ecological significance of this promiscuous association is not
clear. However, several ericoid isolates produce specific isoforms of extrac-
ellular enzymes useful for nutrition in vitro (Perotto et al., 1997). Thus, an
association with several fungi may be a way of broadening the metabolic
capabilities of mycorrhizal roots in the exploitation of difficult substrates.
Analysis of ribosomal genes in ericoid fungi has revealed an unusual
feature in their organization in many isolates. Amplification using universal
primers designed to both the 18S and the 28S subunits has yielded DNA
fragments which were often much larger in size than expected (Egger et al.,
1995; Perotto et al., 1996b). Sequencing of these fragments has revealed that
this discrepancy was due to the insertion of group I introns.
Fig. 6.4. DNA fingerprints of Oidiodendron maius isolates after PCR–RAPD amplification
using short arbitrary primer OPA-14. Isolates may be divided into several groups on the
basis of their DNA banding.
Group I introns have four conserved regions involved in the formation

of secondary structures that are important for splicing. These elements are
quite rare in the nuclear ribosomal genes of eukaryotes. They occur
sporadically in a few fungal species and in algae, but their role has not been
elucidated (Johansen et al., 1996). Interestingly, they are abundant in the
polyphyletic group of lichen-forming fungi (Gargas et al., 1995).
The distribution and sequence of group I introns are highly variable in
ericoid fungi. One intron element inserted in the region towards the 3′ end
of the small ribosomal subunit in H. ericae is well characterized (Egger et al.,
1995) and a number of additional insertions have been found in this and other
ericoid fungal isolates (Perotto, unpublished work), suggesting that this may
be a common feature. Although their role is not known, introns certainly
increase the genetic diversity of ericoid fungi.
In conclusion, PCR-based techniques are a powerful tool for the study
of ericoid fungi: the identification of isolates through specific fingerprinting
methods is quickly overcoming the lack of morphological characters often
encountered with these fungi.
6.6 The Interactions between Mycorrhizal Fungi and

Endosymbiotic Bacteria
External hyphae of mycorrhizal fungi encounter many other soil micro-
organisms in the rhizosphere, and a network of interactions is created
(Azcon-Aguilar and Barea, 1992). PCR has also been of great assistance in
this field, particularly in the investigation of the interactions between
mycorrhizal fungi and bacteria. The surface of both ECM and AM fungi can
be colonized by soil bacteria that use the hyphae as a specific substrate
(Bianciotto et al., 1996a; Schelkle et al., 1996). Furthermore, the cytoplasm
of AM fungi harbours structures called bacteria-like organisms (BLO).
Identification of these bacterial endosymbionts has been hampered because
they cannot be grown on cell-free media. Amplification and partial sequenc-
ing of the 16S rDNA region of endosymbiotic bacteria, followed by database
searches for sequence similarity and phylogenetic analyses, have now
unambiguously placed the symbiont of Gigaspora margarita among the
pseudomonads of rRNA group II (Bianciotto et al., 1996b). The endo-
symbiont was identified as a member of the genus Burkholderia. The
sequence of the gene coding for the small subunit rRNA has been used to
design two primers (BLOf and BLOr) specific for the Burkholderia
endosymbiont of Gi. margarita. These primers were tested for their
specificity on a number of free-living bacteria, and then used on resting
spores, external mycelium and clover roots mycorrhized with Gi. margarita
in order to follow the fate of BLOs during the fungal life cycle. Spores of
different origins belonging to Glomaceae, Gigasporaceae and Acaulospor-
aceae, were analysed by confocal microscopy using a fluorescent dye specific
for the visualization of bacteria to determine whether other AM fungi
possess bacterial endosymbionts. In addition, PCR amplifications with
eubacterial primers (704f/1495r) and with BLOf/BLOr were performed on
DNA preparations from spores of different isolates. All spores, with one
exception, contained intracellular bacteria, although their number and shape
greatly differed among the different species. In addition, the BLOf/BLOr
primers were found to amplify only a DNA fragment from Gigasporaceae
spores (Bianciotto et al., 1996c).
In conclusion, these experiments suggest that intracellular bacteria are
not a sporadic phenomenon but may be a general feature of AM spores. Their
presence raises many questions about their role in mycorrhizal functions and
about evolutionary processes and it has been suggested that they may be
organelle precursors (Holzman, 1996).
6.7 Areas that Need Further Developments
Despite the huge progress of recent years, many problems remain unre-
solved; most of these are of a technical nature. For example, it is important
to improve the level of amplification for samples collected in the field; at
present this level is unsatisfactory (Harris, 1996). This is probably caused by
the presence of inhibitory substances.
Another important point that has rarely been tackled is the quantification
of DNA in the samples. Simon et al. (1992) were the first to propose a protocol
for estimation of the amount of AM fungi living inside the plant roots by
amplifying the sample with different concentrations of an internal standard.
Edwards et al. have developed an alternative protocol and tested the possibility
of evaluating the effect of rhizosphere bacteria on the development of AM
fungi (S.G. Edwards, A.H. Fitter and J.P.W. Young, 1997, personal commu-
nication). A more precise scenario of the competitive colonization of roots by
mycorrhizal fungi will only be available when it is possible to quantify the
presence of one fungal genome with respect to another.
6.8 Conclusions
The development of PCR-based techniques has allowed us to better define

the presence and role of mycorrhizal fungi in the rhizosphere, which is a
complex niche where microorganisms develop and interact with each other.
Because of PCR-based techniques (Fig. 6.5), many crucial questions about
phylogenesis, identification and polymorphisms of mycorrhizal fungi have
begun to be answered. For example, the extent of diversity in natural
populations has been probed and shown to be greater than previously
thought. Several symbiotic fungi are often present, not only in the same
environment, but on the same root irrespective of its size. The thin roots of
Ericales are a good illustration of this phenomenon. The dynamics of the
resident fungal population have also been directly evaluated, as well as the
fate of introduced strains selected for their physiological properties. It is clear
that the ability of these strains to survive depends on the environment, as well
as on their interactions with other soil microorganisms.
Fig. 6.5. A flow chart showing the most important PCR-based strategies that have been
used to investigate the genome of mycorrhizal fungi.
The genetics of mycorrhizal fungi is still in its infancy, particularly in the

case of AM fungi, which are intractable organisms due to their obligate
biotrophic nature. PCR-based techniques have allowed us to investigate
these organisms inside the roots, to elaborate a phylogenetic framework and
to give an insight into their genetics for the first time. Molecular tools have
revealed an unexpected level of variability in the ribosomal genes in
individual isolates. The discovery of several introns in the ribosomal genes of
ericoid mycorrhizal fungi suggests similar conclusions, as such features are
also a source of genetic variability.
Further technical developments are still needed to solve specific prob-
lems in mycorrhizal research. However, despite these current limitations
PCR-based techniques have so far provided an invaluable contribution to the
definition of the mycorrhizal fungal dimension in the rhizosphere.
Acknowledgements
Experimental results discussed in this review are based on researches funded

by the following Italian and European projects: (i) Target Project: Bio-
tecnologia della micorrizazione (CNR-Italian Regions); (ii) Special Project,
Biodiversità in Aree del Mediterraneo, INC-CNR; (iii) Special project:
Diagnostici (MIRAAF); (iv) ECC Biotechnology Project (IMPACT Project,
Contract No BIO2-CT93-0053); (v) ECC AIR Project (MYCOMED,
Contract N. AIR2-CT94-1149).
References
Allen, M.F. (1992) Mycorrhizal Functioning. Chapman and Hall, New York London.
Azcon-Aguilar, C. and Barea, J.M. (1992) Interactions between mycorrhizal fungi and
other rhizosphere microorganisms. In: Allen, M.F. (ed.) Mycorrhizal Function-
ing. Chapman and Hall, New York, pp. 163–198.
Bianciotto, V. and Bonfante, P. (1998) Presymbiotic versus symbiotic phase in
arbuscular endomycorrhizal fungi. In: Varma, A. and Hock, B. (eds) Mycorrhiza
2nd edn. Springer Verlag, Berlin, (in press).
Bianciotto, V., Minerdi, D., Perotto, S. and Bonfante, P. (1996a) Cellular interactions
between arbuscular mycorrhizal fungi and rhizosphere bacteria. Protoplasma
193, 123–131.
Bianciotto, V., Bandi, C., Minerdi, D., Sironi, M., Tichy, H.V. and Bonfante, P. (1996b)
An obligately endosymbiotic fungus itself harbors obligately intracellular
bacteria. Applied and Enviromental Microbiology 62, 3005–3010.
Bianciotto, V., Bandi, C., Minerdi, D., Sironi, M. and Bonfante, P. (1996c) Spores of
different isolates of arbuscular mycorrhizal fungi contain intracellular bacteria.
Abstracts of the 6th International Fungal Spore Conference. Universitat
Konstanz. August 25–29.
Bonfante P. (1980) Occurrence of a basidiomycete in living cells of mycorrhizal hair
roots of Calluna vulgaris. Transactions of the British Mycological Society 75,

320–325.
Bonfante, P. and Perotto, S. (1995) Strategies of arbuscular mycorrhizal fungi when
infecting host plants. New Phytologist (Tansley Review, N.82) 130, 3–21.
Bowcock, A.M., Ruizlinares, A., Tomfohrde, J., Minch, E., Kidd, J.R. and Cavalli-
Sforza, L.L. (1994) High resolution of human evolutionary trees with polymor-
phic microsatellites. Nature 368, 455–457.
Bruns, T.D. (1995) Thoughts on the processes that maintain local species diversity of
ectomycorrhizal fungi. Plant and Soil 170, 63–73.
Bruns, T.D. and Gardes, M. (1993) Molecular tools for the identification of
ectomycorrhizal fungi-taxon-specific oligonucleotide probes for suilloid fungi.
Chevalier, G. (1994) Evolution des recherches sur les plants mycorhizes par la truffe
et perspectives de development. Giornale Botanico Italiano 128, 7–18.
Clapp, J.P., Young, J.P.W., Merryweather, J.W. and Fitter, A.H. (1995) Diversity of
fungal symbionts in arbuscular mycorrhizas from a natural community. New
Phytologist 130, 259–265.
Couture, M., Fortin J. A. and Dalpè, Y. (1983) Oidiodendron griseum Robak: an
endophyte of ericoid mycorrhiza in Vaccinium spp. New Phytologist 95,
375–380.
Dalhlberg, A. and Stenlid, J. (1995) Spatiotemporal patterns in ectomycorrhizal
populations. Canadian Journal of Botany 73 (1), S1222–S1230.
Dalpè, Y. (1986) Axenic synthesis of ericoid mycorrhiza in Vaccinium angustifolium
ait. by Oidiodendron species. New Phytologist 103, 391–396.
Di Battista, C., Bouchard, D., Genere, B., Martin, F. and Le Tacon, F. (1996) Monitoring
the persistence of the ectomycorrhizal basidiomycete Laccaria bicolor S238N on
Douglas fir and Norway Spruce in nursery and forest sites by PCR. Abstracts of the
First International Conference on Mycorrhizae. Berkeley, p. 42.
Dodd, J.C., Rosendahl, S., Giovannetti, M., Broome, A., Lanfranco, L. and Walker,
C. (1996) Inter- and intraspecific variation within the morphologically-similar
arbuscular mycorrhizal fungi, Glomus mosseae and Glomus coronatum. New
Phytologist 133, 113–122.
Douglas, G.C., Heslin, M.C. and Reid, C. (1989) Isolation of Oidiodendron maius
from Rhododendron and ultrastructural characterization of synthesized mycor-
rhizas. Canadian Journal of Botany 67, 2206–2212.
Egger, K.N. (1995) Molecular analysis of ectomycorrhizal fungal communities.
Canadian Journal of Botany 73(1), S1415–S1422.
Egger, K.N. and Siegler, L. (1993) Relatedness of the ericoid endophytes Scytalidium
vaccinii and Hymenoscyphus ericae inferred from analysis of ribosomal DNA.
Egger, K.N., Osmond, G. and Goodier, J.L. (1995) Sequence and putative secondary
structure of group I intron in the nuclear encoded ribosomal RNA genes of the
fungus Hymenoscyphus ericae. Biochimica et Biophysica Acta 1261, 275–278.
Erland (1995) Abundance of Tylospora fibrillosa ectomycorrhizas in a south Swedish
Spruce forest measured by RFLP analysis of the PCR-amplified rDNA ITS
region. Mycological Research 99, 1425–1428.
Foster, L.M., Kozak, K.R., Loftus, M.G., Stevens, J.J. and Ross, I.K. (1993) The
polymerase chain reaction and its application to filamentous fungi. Mycological
Research 97, 769–781.
Franken, P. and Gianinazzi-Pearson, V. (1996) Construction of genomic phage

libraries of the arbuscular mycorrhizal fungi Glomus mosseae and Scutellospora
castanea and isolation of ribosomal genes. Mycorrhiza 6, 167–173.
Basidiomycetes: application to identification of mycorrhizae and rusts. Molec-
ular Ecology 2, 113–118.
Gardes, M. and Bruns, T.D. (1996) Community structure of ectomycorrhizal fungi in
a Pinus muricata forest: above and below-ground views. Canadian Journal of
Botany 74, 1572–1583.
Gardes, M., White, T.J., Fortin, J.A., Bruns, T.D. and Taylor, J.W. (1991) Identifica-
tion of indigenous and introduced symbiotic fungi in ectomycorrhizae by
amplification of nuclear and mitocondrial ribosomal DNA. Canadian Journal of
Botany 69, 180–190.
Gargas, A., DePriest, P. and Taylor, J.W. (1995) Position of multiple insertions in SSU
rDNA of lichen-forming fungi. Molecular Biological Evolution 12, 208–218.
Gianinazzi, S. and Schuepp, H. (1994) Impact of Arbuscular Mycorrhizas on
Sustainable Agriculture and Natural Ecosystems. Birkhauser Verlag, Basel.
Goldestein, D.B. and Clark, A.G. (1995) Microsatellites variation in North American
populations of Drosophila melanogaster. Nucleic Acids Research 19, 3882–3886.
Guillemaud, T., Raymond, M., Callot, G., Cleyet-Marel, J.C. and Fernandez, D.
(1996) Variability of nuclear and mitochondrial ribosomal DNA of a truffle
species (Tuber aestivum). Mycological Research 100, 547–550.
Harris, W.J. (1996) Simultaneous detection of microorganisms in soil suspension
based on PCR amplification of bacterial 16S rRNA fragments. BioTechniques 21,
463–471.
Harrison, M. (1997) Vesicular-arbuscular mycorrhizal symbiosis, an underground
symbiosis. Trends in Plant Science 2, 54–60.
Hadrys, H., Balick, M. and Schierwater, B. (1992) Applications of random amplified
polymorphic DNA (RAPD) in molecular ecology. Molecular Ecology 1, 55–63.
Henrion, B., Chevalier, G. and Martin, F. (1994a) Typing truffle species by PCR
amplification of the ribosomal DNA spacers. Mycological Research 98, 37–43.
Henrion, B., Di Battista, C., Bouchard, D., Vairelles, D., Thompson, B. D., Le Tacon,
F. and Martin, F. (1994b) Monitoring the persistance of Laccaria bicolor as an
endomycorrhizal symbiont of nursery-grown douglas fir by PCR of the rDNA
intergenic spacer. Molecular Ecology 3, 571–580.
Holzman, D. (1996) Bacteria in fungi may be organelle precursors. American Society
of Microbiology News 62, 621–622.
Karen, O., Dahlberg, A., Finlay, R., Jonsson, L., Jonsson, M. and Nylund, J.E. (1996)
Diversity of ectomycorrhizal fungi- managed vs unmanaged forests. Abstracts of
the First International Conference on Mycorrhizae. Berkeley. p.69.
Kretzer, A., Li, YN., Szaro, T. and Bruns, T.D. (1996) Internal transcribed spacer
sequences from 38 recognized of Suillus sensu lato phylogenetic and taxonomic
implications. Mycologia 88(5), 776–785.
Kreuzinger, N., Podeu, R., Gruber, F., Gobl, F. and Kubicek, C.P. (1996) Identifica-
tion of some ectomycorrhizal basidiomycetes by PCR amplification of their
GDP (glyceraldehyde-3-phosphate dehydrogenase) genes. Applied and Envi-
ronmental Microbiology 62, 3432–3438.
Johansen, S., Muscarella, D.E. and Vogt, V.M. (1996) Insertion elements in ribosomal
DNA. In: Zimmermann, R.A., Dahlberg, A.E. (eds) Ribosomal RNA: Structure,
Evolution, Processing and Function in Protein Biosynthesis. CRC Press, Boca

Raton, pp. 89–110.
Lanfranco, L., Arlorio, M., Matteucci, A. and Bonfante, P. (1995a) Truffles – Their life
cycle and molecular characterization. In: Stocchi, V., Bonfante, P. and Nuti, M.
(eds) Biotechnology of Ectomycorrhizae. Plenum Press, New York, pp. 139–149.
Lanfranco, L., Wyss, P., Marzachi’, C. and Bonfante, P. (1995b) Generation of
RAPD–PCR primers for the identification of isolates of Glomus mosseae, an
arbuscular mycorrhizal fungus. Molecular Ecology 4, 61–68.
Lanfranco, L., Perotto, S., Longato, S., Mello, A., Cometti, V. and Bonfante, P. (1997)
Molecular approaches to investigate biodiversity in mycorrhizal fungi. In:
Varma, A. (ed.) Manual for Mycorrhizae. Springer Verlag, Berlin (in press).
Lloyd-MacGilp, S.A., Chambers, S.M., Dodd, J.C., Fitter, A.H., Walker, C. and
Young, J.P.W. (1996) Diversity of the ribosomal internal transcribed spacers
within and among isolates of Glomus mosseae and related mycorrhizal fungi.
Longato, S. and Bonfante, P. (1997) Molecular identification of mycorrhizal fungi
by direct amplification of microsatellite regions. Mycological Research 101,
425–432.
Martin, F., Laurent, P., de Carvalho, D., Burgess, T., Murphy, P., Nehls, U. and Tagu,
D. (1995) Fungal gene expression during ectomycorrhiza formation. Canadian
Journal of Botany 73 (1), S541–S547.
Mello, A., Nozenzo, C., Meotto, F. and Bonfante, P. (1996) Rapid typing of truffle
mycorrhizal roots by PCR amplification of the ribosomal DNA spacers.
Mycorrhiza 6, 417–422.
Mello, A., Garnero, L., Longato, S., Perotto, S. and Bonfante, P. (1997) Rapid typing
of Tuber borchii mycorrhizae by PCR amplification with specific primers.
Abstracts of the 19th Fungal Genetics Conference. California. March 1997.
Molina, R., Massicotte, H. and Trappe, J.M. (1992) Specificity phenomena in
mycorrhizal symbioses: community – ecological consequences and practical
implications. In: Allen, M.F. (ed.) Mycorrhizal Functioning. Chapman and Hall,
New York, pp. 357–417.
Monreal M., Berch S., Barbee, M. and Pirseyed, M. (1996) Identification of ericoid
mycorrhizal fungi using molecular methods. Abstracts of the First International
Conference on Mycorrhizae. Berkeley. p. 88.
Morton, J.B. and Benny, G.L. (1990) Revised classification of arbuscular mycorrhizal
fungi (Zygomycetes): a new order, Glomales, two new suborders, Glomineae
and Gigasporineae, and two new families, Acaulosporaceae and Gigasporaceae,
with an emendation of Glomaceae. Mycotaxon 37, 471–491.
Paolocci, F., Angelini, P., Cristofari, E., Granetti, B. and Arcioni, S. (1995)
Identification of Tuber spp. and corresponding ectomycorrhizae through
molecular markers. Journal of Science Food and Agriculture 69, 511–517.
Perotto, S., Peretto, R., Faccio, A., Schubert, A., Varma, A. and Bonfante, P. (1995)
Ericoid mycorrhizal fungi: cellular and molecular bases of their interactions with
the host plant. Canadian Journal of Botany 73 (suppl), S557–S568.
Perotto, S., Actis-Perino, E., Perugini, J. and Bonfante, P. (1996a) Molecular diversity
of fungi from ericoid mycorrhizal roots. Molecular Ecology 5, 123–131.
Perotto, W.S., Bandi, C., Young, P. and Bonfante P. (1996b) Identification of introns
in the nuclear ribosomal genes of ericoid mycorrhizal fungi. Abstracts of the First
International Conference on Mycorrhizae. Berkeley. p. 96.
Perotto, S., Cometti, V., Coisson, J.D. and Bonfante, P. (1997) Production of pectin-
degrading enzymes by ericoid mycorrhizal fungi. New Phytologist 135, 151–162.
Read, D.J. (1974) Pezizella ericae sp. nov., the perfect state of a typical mycorrhizal
endophyte of the Ericaceae. Transactions of the British Mycological Society 63,
381–383.
Sanders, I.R., Alt, M., Groppe, K., Boller, T. and Wiemken, A. (1995) Identification
of ribosomal DNA polymorphisms among and within spores of the Glomales:
application to studies on the genetic diversity of arbuscular mycorrhizal fungal
communities. New Phytologist 130, 419–427.
Sanders, I.R., Clapp, J.P. and Wiemken, A. (1996) The genetic diversity of arbuscular
mycorrhizal fungi in natural ecosystems – a key to understanding the ecology
and functioning of the mycorrhizal symbiosis. New Phytologist 133, 123–134.
Schelkle, M., Ursic, M., Farquhar, M. and Peterson, L. (1996) The use of laser
scanning confocoal microscopy to characterize mycorrhizas of Pinus strobus L.
and to localize associated bacteria. Mycorrhiza 6, 431–440.
Selosse, M.A., Jacquot, D., Martin, F. and Le Tacon, F. (1996) Genetic structure of
Laccaria spp. populations: ten-years’ persistence without introgression of an
introduced strain in natural populations. Abstracts of the First International
Conference on Mycorrhizae. Berkeley. p.108.
Simon, L. (1996) Phylogeny of the Glomales: deciphering the past to understand the
present. New Phytologist 133, 95–101.
Simon, L., Lalonde, M. and Bruns, T.D. (1992) Specific amplification of 18S fungal
ribosomal genes from vesicular-arbuscular endomycorrhizal fungi colonizing
roots. Applied and Environmental Microbiology 58, 291–295.
Simon, L., Bousquet, J., Lévesque, R.C. and Lalonde, M. (1993a) Origin of
endomycorrhizal fungi and coincidence with vascular land plants. Nature 363,
67–69.
Simon, L., Lévesque, R.C. and Lalonde, M. (1993b) Identification of endomycor-
rhizal fungi colonizing roots by fluorescent Single-Strand Conformation
Polymorphism-Polymerase Chain Reaction. Applied and Environmental Micro-
biology 59, 4211–4215.
Smith, S. E. and Read, D.J. (1997) Mycorrhizal Symbiosis. Academic Press, London.
Tautz, D. (1993) Notes on the definition and nomenclature of tandemly repetitive
DNA sequences. In: Pena S.D.J., Chakraborty, R., Epplen J.T. and Jeffreys, A.J.
(eds) DNA Fingerprinting: State of Science. Birkhauser, Basel, pp. 21–28.
Walker, C. (1992) Systematics and taxonomy of the arbuscular endomycorrhizal fungi
(Glomales) – a possible way forward. Agronomie 12, 887–897.
Wyss, P. and Bonfante, P. (1993) Amplification of genomic DNA of arbuscular-
mycorrhizal (AM) fungi by PCR using short arbitrary primers. Mycological
Research 97, 1351–1357.
Zézé, A., Hosny, M., Gianinazzi-Pearson, V. and Dulieu, H. (1996) Characterization
of a highly repeated DNA sequence (SC1) from the arbuscular mycorrhizal
fungus Scutellospora castanea and its detection in planta. Applied and Environ-
mental Microbiology 62, 2443–2448.
PCR Applications in Fungal 7
Phylogeny
S. Takamatsu
Laboratory of Plant Pathology, Faculty of Bioresources, Mie
University, Tsu 514, Japan
7.1 Introduction
Historically, the phylogeny of fungi has been inferred from various

phenotypic characters, e.g. morphological, physiological and developmental
characters, and/or chemical components such as secondary metabolites.
The recent development of molecular techniques has enabled the derivation
of fungal phylogenies based on the analyses of proteins or nucleic acids,
e.g. isozyme analysis, DNA–DNA hybridization, electrophoretic karyo-
typing, restriction fragment length polymorphism (RFLP), and DNA
sequencing. However, these molecular techniques have been difficult to
apply to obligate parasites from which only small amounts of fungal
materials are available, or to rare taxa which are available only as herbarium
specimens. The polymerase chain reaction (PCR) developed in the mid
1980s (Saiki et al., 1985; Mullis et al., 1986; Mullis and Faloona, 1987)
made possible the amplification of particular nucleotide sequences from
very small amounts of starting materials. In addition, relatively impure
DNA extracts can be used for PCR. PCR-based techniques have enabled
the construction of molecular phylogenies for obligate parasites and rare
taxa, and as PCR techniques have led to simplified molecular procedures,
they have also increased the availability of phylogenetic studies for many
fungi. This chapter reviews some of the recent advances that have been
made through the application of PCR methods to phylogenetic studies
of fungi.

126 S. Takamatsu
7.2 Sequence Analysis from Small Samples
7.2.1 DNA extraction

A number of methods have been developed for the rapid isolation of fungal
DNA (Biel and Parrish, 1986; Zolan and Pukkila, 1986; Taylor and Natvig,
1987; Lee et al., 1988; Möller et al., 1992). Most of these are applicable
to molecular phylogenetic analysis when large amounts of fungal materials
can be obtained. However, a small amount of starting material is required
for PCR-based sequence analysis, and sufficient single-copy genomic
sequences can be routinely amplified from 1 µg of total DNA (Saiki et
al., 1988). Lee and Taylor (1990) simplified an earlier method for total
DNA isolation and used it for the amplification of multicopy genes from
small quantities of fungal materials (Lee et al., 1988). They reported that
rDNA sequences could be successfully amplified from a single spore of
Neurospora tetrasperma. In molecular phylogenetic analysis, sequence data
are often required from herbarium collections, especially when they
concern rare taxa. Bruns et al. (1990) applied Lee and Taylor’s method
to 35 collections of dried fungal materials stored under a variety of
conditions for 1–50 years. They successfully amplified the mitochondrial
large subunit rRNA gene from all of the specimens, and 16 specimens
were subsequently sequenced.
Walsh et al. (1991) developed a method utilizing a chelating resin for
extracting DNA from forensic-type samples for PCR. The method was
simple, rapid, did not include organic solvents and did not require multiple
tube transfers. This method has proved applicable to the extraction of DNA
from small amounts of fungal materials, and Hirata and Takamatsu (1996)
have used the method to obtain the rDNA internal transcribed spacer (ITS)
regions from several obligately parasitic powdery mildew fungi.
7.2.2 PCR amplification

A variety of oligonucleotide primers have been designed for the amplification
of rDNA sequences from a wide range of fungal materials (e.g. White et al.,
1990). Amplification using these primer sets, followed by direct sequencing
has considerably shortened the time required to perform phylogenetic
studies.
In addition to universal primers, many kinds of primer sets for the
amplification of rDNA have been developed for particular groups of fungi;
two examples of this are lichenized fungi (Gargas and Taylor, 1992) and slime
moulds (Rusk et al., 1995).
In most cases simple thermal cycling parameters have proved sufficient
to amplify rDNA sequences; however, two sequential reactions using nested
primers can improve the efficiency of amplification from small quantities of
DNA (Hirata and Takamatsu, 1996).
Applications in Fungal Phylogeny 127
7.2.3 Sequence analysis

Two methods are in general use for sequencing PCR-amplified DNA
fragments. One procedure involves cloning. Although cloning procedures
have become more straightforward, considerable effort is still required
especially when obtaining sequence data from large numbers of individuals.
Another disadvantage of the cloning methods is that mutations can be
introduced by the DNA polymerase during synthesis. Taq DNA polymerase
lacks editing functions and incorporates an incorrect nucleotide at a rate of
2 × 10–4 nucleotides per PCR cycle. This rate of misincorporation translates
into an overall error frequency of one per 400 bp after 30 cycles of
amplification (Saiki et al., 1988). However, conditions can be optimized to
reduce this error frequency to less than one substituion in 15,000 bp (Gelfand
and White, 1990). As a result a consensus sequence, based on several cloned
PCR products, has to be determined for each sample in order to distinguish
mutations present in the original sequence from any random misincorpora-
tion of nucleotides introduced by the polymerase during PCR.
The second procedure involves direct sequencing of PCR product
without cloning. This generates a consensus sequence at each nucleotide and
minimizes possible errors from misincorporation. Since the procedure does
not involve the cloning of the PCR product, the time required for
comparative sequencing studies is significantly reduced. As a result, direct
sequencing is being widely used for phylogenetic studies based on DNA
sequences (Lott et al., 1993; Morales et al., 1993; Zambino and Szabo, 1993;
Saenz et al., 1994; Nishida and Sugiyama, 1994).
7.2.4 Construction of phylogenetic trees

Many computer packages have been developed for phylogenetic studies, and
six of the more widely used are described here.
CLUSTAL W
The program CLUSTAL W (Thompson et al., 1994) has a multiple sequence
alignment function that works well with large numbers of either nucleic acid
or protein sequences. The program also constructs phylogenetic trees by the
neighbour-joining method of Saitou and Nei (1980), but does not draw the
tree. Confidence intervals on the tree are calculated using a bootstrap
procedure similar to that described by Felsenstein (1985).
MACCLADE
MACCLADE (Maddison and Maddison, 1992) is a program for analysing
character evolution. It has a graphical spreadsheet editor for entering and
editing data matrices, a tree window for viewing and manipulating trees,
charting facilities, and other features. Although MACCLADE does not have a
sophisticated search algorithm to find the best tree, it can be complemented
by PAUP (see below) as the two packages are compatible.
128 S. Takamatsu
MEGA
MEGA (molecular evolutionary genetics analysis; Kumar et al., 1993) is a
phylogeny inference package that utilizes various distance methods and
parsimony. Various other statistics are included for the analysis of DNA,
RNA and protein sequence data.
PAUP
PAUP version 3 (Swofford, 1993) is probably the most sophisticated program
for inferring phylogenies using parsimony analysis, with many options and
good compatibility with MACCLADE. Version 3 itself is currently not
available, but the new program, PAUP version 4, will be released in the
summer of 1998. Version 4 will include parsimony, distance matrix, invar-
iants, and maximum likelihood methods.
PHYLIP
PHYLIP (Felsenstein, 1989) includes programs for parsimony, distance matrix,
and maximum likelihood methods for a variety of data types, including
molecular sequences (DNA and protein), gene frequencies, continuous
characters, discrete (0, 1) characters and restriction sites. It also includes
programs for plotting phylogenies and consensus trees.
PUZZLE
PUZZLE is a package that uses maximum likelihood to reconstruct phyloge-
netic trees from sequence data. It implements a fast tree search algorithm
(quartet puzzling; Strimmer and von Haeseler, 1996) that allows analysis of
large data sets and automatically assigns estimations of support to each
internal branch. Rate heterogeneity is incorporated in all models of substitu-
tion. All model parameters including rate heterogeneity can be estimated
from the data by maximum likelihoods. PUZZLE also computes pairwise
maximum likelihood distances as well as branch lengths for user specified
trees, and offers a novel method, likelihood mapping, to investigate the
support of internal branches without computing an overall tree.
7.3 Methods for Phylogenetic Analysis
7.3.1 DNA sequence analysis

DNA sequence analysis has become the most useful method for inferring
phylogenetic relationships between organisms. Bruns et al. (1990) described
the benefits of using DNA sequences for phylogenetic analysis as being ‘the
large number of characters compared can substantially increase the resolving
power’. One can also observe the mode of sequence variation, that is, whether a
change is a transversion or transition, silent or selected, and one can measure
the degree of nucleotide bias; results from different laboratories can be
compared directly, and the publication of sequences and their deposition in

electronic databases (GenBank, EMBL and DDBJ) allows the confirmation of
results and their application to other taxa without the need to obtain strains or
clones, or to repeat experiments. Some DNA regions which have proved useful
for sequence analysis for phylogenetic studies are described below.
Nuclear and mitochondrial rDNA

The nuclear rRNA genes (rDNA) of eukaryotes are arranged in tandemly
repeated clusters with each cluster containing the genes for the small subunit
(18S), 5.8S, and large subunit (25–28S) rRNA (Gerbi, 1985). These genes
show little sequence divergence between closely related species and are useful
for phylogenetic studies among distantly related organisms (Jorgensen and
Cluster, 1988; Bruns et al., 1991; Hillis and Dixon, 1991; Illingworth et al.,
1991; Taylor et al., 1993). Studies of the secondary structure of the rRNA
have shown that eukaryotic large subunit rRNAs are composed of a
conserved ‘core’ that has a similar secondary structure to prokaryotic
rRNAs, and interspersed ‘divergent domains’ that appear to have no
prokaryotic homologue (Michot et al., 1984; Hillis and Davis, 1987; Michot
and Bachellerie, 1987). DNA sequences of the divergent domains of the
nuclear large subunit rDNA are useful for determining phylogenies of
relatively closely related organisms. Within each repeat, the conserved
regions are separated by two internal transcribed spacers (ITS), which show
higher rates of divergence (Jorgensen and Cluster, 1988; Ritland et al., 1993;
Schlötterer et al., 1994). A third spacer, the large intergenic spacer (IGS), is
found between the 3′ end of the 28S and the 5′ end of the 18S genes. These
spacer regions evolve faster than the subunit genes and can be useful for
studying closely related organisms, such as among species within a genus or
among populations (Jorgensen and Cluster, 1988; Bruns et al., 1991; Ritland
et al., 1993; O’Donnell, 1992; Hsiao et al., 1994, 1995; Yan et al., 1995;
Kusaba and Tsuge, 1994, 1995). The mitochondrial rRNA genes evolve
approximately 16 times faster than the nuclear rDNA (Bruns and Szaro,
1992), and so are useful for phylogenetic studies at an intermediate
taxonomic level (Bruns et al., 1991; Simon et al., 1994).
Protein genes
Protein coding genes have some advantages over rRNA genes and spacers in
that the alignment of the sequence is less problematic (Bruns et al., 1991).
Protein sequences also lend themselves to differential weighting of bases by
codon position, and third position sites can provide a relatively good estimate
of the neutral substitution rate. Elongation factor-1a protein genes (Hase-
gawa et al., 1993; Baldauf and Palmer, 1993; Nordnes et al., 1994), actin genes
(Baldauf and Palmer, 1993; Fletcher et al., 1994), β-tubulin genes (Baldauf
and Palmer, 1993; Edlind et al., 1996), glyceraldehyde-3-phosphate dehy-
drogenase genes (Martin et al., 1993), and nitrate reductase genes (Zhou and
Kleinhofs, 1996) have been used for phylogenetic analyses of eukaryotes
130 S. Takamatsu
including fungi. Actin genes (Cox et al., 1995; Wery et al., 1996), chitin
synthase genes (Mehmann et al., 1994; Karuppayil et al., 1996), elongation
factor-1a protein genes (Shearer, 1995), β-tubulin genes (Li and Edlind,
1994), and orotidine 5′-monophosphate decarboxylase genes (Radford, 1993)
have been used in fungal studies. However, none of these, with the exception
of chitin synthase was PCR-mediated, as universal primers have not yet been
developed for most of these genes.
7.3.2 PCR–RFLP
RFLP analysis has been a useful tool in phylogenetic studies with a variety of
organisms (Michelmore and Hulbert, 1987; Bruns et al., 1991). RFLP of ampli-
fied fragments (PCR–RFLP) is now widely used for both fungal phylogeny
and taxonomy (Chen, 1992; Liu and Sinclair, 1992; Bernier et al., 1994; Bun-
yard et al., 1994, 1996; Hopple and Vilgalys, 1994; Appel and Gordon, 1995;
Donaldson et al., 1995; Erland, 1995; Harrington and Wingfield, 1995; Sappal
et al., 1995; Buscot et al., 1996; Chiu et al., 1996; Edel et al., 1996; Guillemaud et
al., 1996; Waalwijk et al., 1996; Leal et al., 1997). PCR–RFLP is a simple and
inexpensive method compared with traditional RFLP or sequence analyses as
it avoids the need for blotting, probing and/or sequencing. ITS or IGS regions
have mainly been used for PCR–RFLP as these regions are highly polymorphic
and can be easily amplified by PCR using universal primers.
7.3.3 RAPD and AP-PCR

Random amplification of polymorphic DNA (RAPD; Williams et al., 1990)
or arbitrarily primed polymerase chain reaction (AP-PCR; Welsh and
McClelland, 1990) is a simple and rapid method for detecting genetic
diversity. Genetic diversity is assessed by amplification at low stringency
with a single short primer of arbitrary sequence. The technique has been used
to detect genetic variations among strains or isolates within a species
(Goodwin and Annis, 1991; Cooke et al., 1996; Hseu et al., 1996; Boyd and
Carris, 1997; Jeng et al., 1997; Maurer et al., 1997; Pei et al., 1997;
Jungehülsing and Tudzynski, 1997). The amplification conditions need to be
rigorously standardized in order to obtain reproducible and consistent
results, as the fragment pattern obtained is highly sensitive to concentrations
of Mg2+, DNA polymerase, primers and template DNAs, and to cycling
temperatures (Bruns et al., 1991).
7.4 PCR-derived Phylogenetic Studies
7.4.1 Broad ranging studies

Bruns et al. (1992) used 18S rDNA sequences to investigate evolutionary
relationships within the fungi. The inferred tree topologies were in general
agreement with traditional classifications in that the Chytridiomycota and

Zygomycota were recovered as basal groups within the kingdom, the
Ascomycota and Basidiomycota appeared as a derived monophyletic group,
relationships within the Ascomycota were concordant with traditional orders
and divided the hemi- and euascomycetes into distinct lineages, and the
Basidiomycota was divided into two groups, the holobasidiomycetes and
phragmobasidiomycetes.
Berbee and Taylor (1993, 1995) calibrated the rate of 18S rDNA
sequence change by relating the normalized per cent substitution associated
with phylogenetic events to fungal fossils, the ages of fungal hosts, and the
ages of symbionts. Their calculations suggested that fungal 18S rDNA
undergoes substitutions at about 1% per lineage per 100 million years. Based
on these calculations these authors suggested that the terrestrial fungi
diverged from the chytrids approximately 550 million years ago, and that
ascomycetes split from basidiomycetes approximately 400 million years ago,
after plants invaded the land. Similarly, mushrooms, many ascomycetous
yeasts, and common fungi in the genera Penicillium and Aspergillus may have
evolved after the origin of angiosperm plants, during the last 200 million
years. Simon et al. (1993) used a different set of ecological and fossil
calibrations to estimate the origin of the vesicular–arbuscular mycorrhizae at
353–462 million years ago.
Van der Auwera et al. (1994, 1995) and van der Auwera and de Wachter
(1996) studied the phylogenetic relationship of oomycetes, hyphochy-
triomycetes, and chytridiomycetes based on the sequences of rDNA
including the 28S rRNA gene from Phytophthora megasperma, Hyphochyt-
rium catenoides, and Blastocladiella emersonii. Their results showed: (i) the
hyphochytriomycetes formed a monophyletic group with the oomycetes and
heterokont algae, and that they were probably the closest relatives of the
oomycetes, and (ii) that the chytridiomycetes were true fungi and not
protists. Within the fungal clade, B. emersonii formed the first line of
divergence, and the oomycete and hyphochytriomycete cluster appeared as
a sister group of the fungal clade. These authors suggested that a possible
common ancestor of the fungi, straenopiles, and alveolates, may have been a
zoosporic fungus, which would mean that zoosporic fungi were paraphyletic
instead of polyphyletic as previously suggested.
7.4.2 Filamentous ascomycetes

Nishida and Sugiyama (1993) sequenced the 18S rDNA from Taphrina
wiesneri and Saitoella complicata in order to determine the phylogenetic
placement of the major groups of higher fungi. They suggested that there
were at least two major evolutionary lineages in the ascomycetes, and that T.
wiesneri and S. complicata form a monophyletic branch that diverged prior
to the separation of other ascomycetes. Nishida and Sugiyama (1994)
sequenced the 18S rDNA from T. populina and Protomyces lactucae-debilis
132 S. Takamatsu
and compared these sequences with 75 sequences from other ascomycetes.

Their phylogenetic analysis divided the Ascomycota into three major
lineages: the hemiascomycetes, the euascomycetes, and a new line which
included Taphrina and Protomyces, which they called the archiascomycetes.
Eurotiales and related species

The genera Penicillium and Aspergillus have been the subject of several
phylogenetic analyses (LoBuglio et al., 1993, 1994; Peterson, 1993; Pitt, 1993;
Verweij et al., 1995). Berbee et al. (1995) used 18S, 5.8S rDNA and ITS
sequences to test whether Penicillium was monophyletic and to examine its
relationship with the ascomycete family Trichocomaceae. Their results
showed that Penicillium was not a monophyletic genus. The phylogenetic
trees constructed by them showed Eupenicillium javanicum (which has a
Penicillium anamorph) grouping with Neosartorya fischeri and Eurotium
rubrum (which have Aspergillus anamorphs), rather than with Talaromyces
flavus var. macrosporus or Talaromyces bacillisporus, two species with
Penicillium anamorphs. Conversely, the genus Aspergillus was recovered as
an apparently monophyletic group.
Phylogenetic relationships between strictly mitotic species in the genus
Penicillium and Aspergillus, and closely related meiotic species have been
considered based on sequences from the mitochondrial small subunit rDNA,
and the nuclear ITS and 5.8S rDNA (LoBuglio et al., 1993; Geiser et al.,
1996). In both cases meiotic and strictly mitotic taxa were often recovered
clustered together, indicating that multiple independent losses of teleo-
morphs had occurred in both genera.
Verweij et al. (1995) investigated the phylogenetic placement of four
species of Aspergillus based on 18S rDNA sequences. The species sequenced
showed a very close intergeneric relationship to species of the genera
Paecilomyces and Penicillium, and also to Eurotium rubrum and Monascus
purpureus.
18S rDNA sequences were used by Bowman et al. (1992, 1996) to
investigate possible relationships between four species of human pathogenic
fungi placed in the Onygenales, and seven non-pathogenic fungi that were
thought to be their nearest relatives on the basis of morphological features.
The result showed that the pathogens were interspersed among the non-
pathogenic fungi, which suggested that pathogenicity had arisen multiply
within this group. The phylogenetic relationship of several human
pathogenic fungi in Onygenales was also investigated by Harmsen et al.
(1995).
Pyrenomycetes
There are two main views on the classification of the Clavicipitales within the
unitunicated perithecial ascomycetes. One is that the Clavicipitales is a sister
group to the Hypocreales, and the other is that it is a member of, or a near
relative to, the Xylariales. The 18S rDNA sequences support the placement
of the Clavicipitales as a monophyletic sister group to the Hypocreales

(Spatafora and Blackwell, 1993).
Acremonium is generally considered to be a highly polyphyletic form-
genus which includes the clavicipitaceous grass endophytes. Glenn et al.
(1996) used 18S rDNA sequences to investigate relationships within Acre-
monium, and they found that the genus was polyphyletic, with affiliations to
at least three ascomycetous orders. Most of the species examined from the
sections Acremonium, Gliomastix, and Nectrioidea appeared related to the
Hypocreaceae, and the grass endophytes of sect. Albolanosa, and other taxa
from the Clavicipitaceae formed a monophyletic group derived from within
the Hypocreales. The thermophilic Acremonium alabamense, however,
appeared to be derived from within the Sordariales. In order to eliminate
some of the heterogeneity within Acremonium, while also emphasizing the
unique biological, morphological, and ecological characteristics of the grass
endophytes, they proposed that the anamorphs of Epichloë and closely
related asexual grass endophytes be reclassified into the new form-genus
Neotyphodium. Within the genus Epichloë, Schardl et al. (1991) used
sequences of the ITS regions to examine relationships between E. typhina and
its anamorphs, including endophytic mycosymbionts of various grasses of
the subfamily Pooideae. These results indicated that the non-pathogenic
endophytes have not necessarily co-evolved with their host species and that
they arose from E. typhina on multiple occasions.
Rehner and Samuels (1994) used eukaryotic-specific divergent regions of
18S rDNA to investigate the phylogeny of Gliocladium. Their results
indicated that Gliocladium was polyphyletic and that G. penicillioides, G.
roseum, and Trichoderma virens (G. virens) were genetically distinct.
Rakotonirainy et al. (1994) used two divergent regions of 28S rDNA to
investigate phylogenetic relationships within the genus Metarhizium, one of
the most ubiquitous entomogenous fungal genera. The results obtained from
sequence analysis were also confirmed by isoenzyme polymorphisms.
Partial sequences of 18S and 28S rDNA were used by Seifert et al. (1997)
to suggest that Spicellum roseum and Trichothecium roseum formed a single
monophyletic group allied to the Hypocreales, although they found sister
group relationships to be unclear.
Phylogenetic relationships within four species of Phialophora were
considered by Yan et al. (1995) from RFLPs and sequence analysis of the 5.8S
and ITS rDNA of 51 isolates. Clustering based on similarity values produced
groups that were consistent with morphological species designations in each
case. Bryan et al. (1995) assessed the relatedness of a number of Gaeumanno-
myces and Phialophora isolates by comparison of 18S, 5.8S rDNA and ITS
sequences. They found that G. graminis var. tritici, G. graminis var. avenae,
and G. graminis var. graminis could be distinguished from each other by
nucleotide sequence differences in the ITS regions. The G. graminis var. tritici
isolates can be further subdivided into R and N isolates [correlating with
ability (R) or inability (N) to infect rye]. Isolates of Magnaporthe grisea
134 S. Takamatsu
included in the analysis showed a surprising degree of relatedness to

members of the Gaeumannomyces–Phialophora complex.
Hausner et al. (1993) used partial 18S and 28S rDNA sequences in a
phylogenetic analysis of Ophiostoma. 18S rDNA sequence data suggested
that Ophiostoma should remain the sole genus of the Ophiostomataceae,
although there was not sufficient information for parsimony analysis to
generate tree topologies with consistently high levels of statistical support.
The sequences of the 5′ terminus of the 28S rDNA were also determined to
examine phylogenetic relationships within the genus, and these data failed to
support the subdivision of the genus based on either ascospore characters or
the nature of the anamorph.
Sherriff et al. (1994) used 28S rDNA and ITS sequences to investigate the
relatedness of a range of isolates of Colletotrichum, selected to represent the
major morphological forms of the genus. They found that the species
investigated could be divided into two groups. The first group, consisting of
C. lindemuthianum, C. malvarum, C. orbiculare, and C. trifolii, was distinct
from all the other species, and their DNA was highly homologous. They
concluded that this group may represent a single species. The second group
consisted of isolates of C. gloeosporioides which showed greater divergence
in their DNA sequences than those of the first group, and it was concluded
that isolates included within C. gloeosporioides represented more than one
species. Sherriff et al. (1995) also compared sequences of ITS2 regions of
isolates of C. graminicola from maize, sorghum and Rottboellia. The results
indicated that the isolates from maize represented a species which was
distinct from the isolates obtained from sorghum and Rottboellia. They
recommended that the isolates from maize should be regarded as C.
graminicola, and that those from sorghum and Rottboellia should be
considered C. sublineolum.
Guadet et al. (1989), Peterson (1991) and O’Donnell (1993) investigated
the phylogenetic relationships of Fusarium species using partial sequences of
the 28S rDNA. Both Guadet’s and O’Donnell’s data showed Gibberella to
be monophyletic, and O’Donnell suggested that Nectria was paraphyletic
and that Fusarium was polyphyletic. O’Donnell (1992) also showed that
there was a high degree of intraspecific variation in the ITS sequences of F.
sambucinum. Edel et al. (1996) characterized 87 strains belonging to 18
species of Fusarium by PCR–RFLP analysis of ITS regions and variable
domains of the 28S rDNA. Data from the RFLP analysis showed 23 rDNA
haplotypes among the strains investigated. The groupings obtained by the
restriction analysis were, on the whole, in agreement with other molecular
and morphological classification criteria.
Waalwijk et al. (1996a, b) compared 13 species from Fusarium sections
Elegans, Liseola and Dlaminia using the DNA sequences and RFLPs of the
two ITS regions. These studies showed that although the ITS1 data were
similar for most species (except F. beomiforme and F. polyphialidicum),
species grouping based on the ITS2 sequences formed two distinct clusters
that did not coincide with the section boundaries. O’Donnell and Cigelnik
(1997) used a cladistic analysis of sequences obtained from multiple unlinked
loci to consider the evolutionary history of the Gibberella fujikuroi complex.
Gene phylogenies inferred from the mitochondrial small subunit rDNA,
nuclear 28S rDNA, and the β-tubulin gene were generally concordant,
providing strong support for a fully resolved phylogeny of all biological and
most morphological species. However, a discordant gene tree was obtained
from the ITS2 region. Ingroup taxa within the ITS2 gene tree formed two
groups, designated type I and type II as reported by Waalwijk et al. (1996a).
Interestingly, sequence analysis demonstrated that every strain tested from
the ingroup species had both types of ITS2. Only the major ITS2 type,
however, was discernible when PCR products were amplified and sequenced
directly with conserved primers, and the minor ITS2 type was only recovered
when ITS2 type-specific primers were used. Distribution of the major ITS2
type within the species lineages showed a homoplastic pattern of evolution,
and so obscured true phylogenetic relationships. O’Donnell and Cigelnik
(1997) suggested that the ancestral ITS2 types may have arisen following an
ancient interspecific hybridization or gene duplication which occurred prior
to the evolutionary radiation of the G. fujikuroi complex.
Appel and Gordon (1995, 1996) used RFLP analysis and partial sequences
of the rDNA IGS region to investigate relationships among isolates of
Fusarium oxysporum, including F. oxysporum f. sp. melonis and non-
pathogenic strains. They found that the IGS haplotype and sequence correlated
with vegetative compatibility group (VCG) and mtDNA haplotype in most
isolates within F. oxysporum f. sp. melonis, but could not be used to differ-
entiate among races. However, a race 1 isolate which was associated with VCG
0131 had greater affinity with VCG 0134 based on both mtDNA and
IGS haplotype. Two IGS sequence types were found in this race 1 isolate,
one suggesting an affiliation with VCG 0131 and the other similar to isolates
in VCG 0134. Appel and Gordon (1996) suggested this result may indicate past
somatic or sexual interactions between F. oxysporum f. sp. melonis, VCGs 0131
and 0134. Non-pathogenic isolates that were vegetatively compatible with the
pathogenic ones were not closely related to the pathogen based on IGS
sequence data, and so non-pathogenic and pathogenic isolates may share
common alleles at vegetative compatibility loci by coincidence rather than
because of recent clonal derivation from a common ancestor.
Discomycetes
Evolutionary relationships of apothecial ascomycetes (discomycetes) have
been examined from 18S rDNA sequences (Gargas and Taylor, 1995). They
obtained a most parsimonious tree that supported the monophyly of the
orders Pezizales, Leotiales, and Lecanorales. However, there was no support
for monophyly of the representative Caliciales.
Gargas et al. (1995) reported the presence of insertions (group I introns)
in the nuclear small subunit rDNA of lichen-forming fungi. Of the 11
136 S. Takamatsu
insertion positions they reported, six positions were known only from the
lichen-forming fungi. They considered the possible phylogenetic significance
and distribution of insertions in eukaryotic organisms.
O’Donnell et al. (1997) examined the phylogenetic relationships among
ascomycetous truffles and true and false morels based on sequences from 18S
and 28S rDNA. Parsimony analysis of the combined data set gave a single
most parsimonious tree, indicating that the hypogeous ascomycetous truffle
and truffle-like taxa studied represent at least five independent lineages
within the Pezizales.
Phylogenetic relationships between the genera Plicaria and Peziza have
been examined from sequences of the rDNA ITS1 region, the divergent D1
and D2 domains of the 28S subunit, and a region near the 5′ terminus of the
18S subunit (Norman and Egger, 1996). Parsimony analysis showed that
Plicaria was a monophyletic group. However, several Peziza taxa that shared
a number of morphological characters with Plicaria were closely related. The
authors suggested that Plicaria should be recognized as a separate genus,
although Peziza is paraphyletic if Plicaria is maintained. A phylogenetic
analysis has also been made of Sarcoscypha species (Sarcoscyphaceae, Pezi-
zales), based on ITS sequences (Harrington and Potter, 1997).
Carbone and Kohn (1993) sequenced the ITS1 region from 40 isolates of
Sclerotiniaceae and three outgroup isolates in Leotiaceae in a study of the
phylogenetic relationships among the Sclerotiniaceae. Their results sup-
ported their hypothesis that there was a sclerotial lineage, and suggested that
this lineage had evolved relatively recently. However, they could not resolve
the phylogenetic relationships among the non-sclerotial taxa due to their
highly divergent ITS1 sequences.
Loculoascomycetes
Berbee (1996) sequenced the 18S rDNA of 16 species from seven families in
the loculoascomycete orders Pleosporales, Dothideales, and Chaetothyriales
in an examination of evolution within the order.
Leptosphaeria maculans is an important plant pathogen and isolates from
Brassica spp. can be divided into two pathotypes: highly virulent (HV) and
weakly virulent (WV) (McGee and Petrie, 1978). In addition to pathoge-
nicity, HV and WV isolates differ in cultural characters and toxin production
(Koch et al., 1989), and are also distinguishable by RAPD (Goodwin and
Annis, 1991; Schäfer and Wöstemeyer, 1992), RFLPs (Koch et al., 1991), and
electrophoretic karyotyping (Taylor et al., 1991). Xue et al. (1992) and
Morales et al. (1993) independently sequenced the 5.8S rDNA and ITS
regions from HV and WV isolates. Although the 5.8S rDNA sequences were
identical between the HV and WV isolates, both ITS sequences were very
divergent. Morales et al. (1993) showed that each pathogenicity group was
statistically different from each other and that the WV isolates were more
closely related to the Thlaspi isolates than to the HV isolates. Xue and
Goodwin (1994) found insertions in domain V of the mitochondrial large
rDNA of L. maculans. Most of the inserted sequence was highly homolo-

gous (90%) between pathotypes, indicating that they were closely related,
but the insertion in the WV pathotype had an additional 49 bp at the 3′
terminus of the insert. The 49 bp region contained a repetitive 7 bp sequence
and had a higher GC content than the rest of the insert. The phylogenetic
relationships among several Leptosphaeria species have been determined
from the sequences of the 18S and 5.8S rDNA and ITS regions (Morales et
al. 1995), and Khashnobish and Shearer (1996) used both morphological
characters and ITS2 and partial 28S rDNA sequences to investigate phyloge-
netic relationships in some Leptosphaeria and Phaeosphaeria species. They
showed that the Phaerosphaeria species formed a natural group while
Leptosphaeria sensu lato was paraphyletic.
Jasalavich et al. (1995) investigated the phylogenetic relationships
between three Alternaria species pathogenic to crucifers, A. alternata, and
Pleospora herbarum from the sequences of 18S and 5.8S rDNA subunits and
the ITS regions. They showed that all of the Alternaria species were closely
related, and that Pleospora also appeared to be more closely related to
Alternaria than to Leptosphaeria. Kusaba and Tsuge (1995) sequenced the
ITS of some Alternaria species, including seven that were known to produce
host-specific toxins. Phylogenetic analysis of the sequence data by the
neighbour-joining method showed that the seven toxin-producing fungi
formed a monophyletic group together with A. alternata. Conversely, the
species of Alternaria that were clearly distinguishable from A. alternata by
morphological features were also clearly separated from A. alternata on the
basis of their ITS sequences. Based on these findings, and previous work
(Kusaba and Tsuge, 1994), the authors suggested that isolates of Alternaria
which produced host-specific toxins were pathogenic variants of the single
variable species A. alternata.
Other filamentous ascomycetes

The Erysiphales (powdery mildews) have been classified in both the
Pyrenomycetes and the Plectomycetes on the basis of their morphological
features. However, analysis of their 18S rDNA sequence has shown that they
are distinct from both groups (Saenz et al., 1994).
Phylogenetic relationships of the imperfect mycorrhizal fungus Ceno-
coccum geophilum within ascomycetes have been considered from 18S
rDNA sequences (LoBuglio et al., 1996). Parsimony and distance analyses
placed C. geophilum as a basal, intermediate lineage between the two
Loculoascomycete orders, the Pleosporales and the Dothidiales, strongly
suggesting that Elaphomyces was of Plectomycete origin. This result contra-
dicted the original hypothesis that Elaphomyces was the closest relative of C.
geophilum, and also suggested that there were at least four independent
lineages of mycorrhizal fungi among the ascomycetes included in the study.
Nishida et al. (1993) demonstrated that there were two group I introns
in the 18S rRNA coding region of Protomyces inouyei (archiascomycetes).
138 S. Takamatsu
Comparison of the two introns of P. inouyei with those of other group I

intron-containing higher fungi showed that intron A of P. inouyei was
located in the same position as an intron in Pneumocystis carinii, while intron
B occupied an insertion site also found in Ustilago maydis. They suggested
these group I introns may be subject to horizontal transfer.
7.4.3 Basidiomycetes
Swann and Taylor (1993) sequenced the 18S rDNA from nine basidiomy-
cetes and aligned them with ten other basidiomycetes and three ascomycete
sequences. The phylogentic tree showed that the basidiomycetes fell into
three major lineages: the Ustilaginales smuts, simple septate basidiomycetes,
and hymenomycetes which formed a basal unresolved trifurcation. Suh and
Sugiyama (1994) also suggested that there were three lineages in the
basidiomycetes.
Agaricales
Hibbett et al. (1995) investigated the phylogenetic relationships of the
shiitake mushroom from ITS sequences. Their ingroup consisted of seven
isolates of Lentinus edodes, nine isolates of L. lateritia, and five isolates of
L. novaezelandieae. They found four independent lineages of shiitake in
Asia–Australasia, and this provided some support for the morphologically
based species concepts. There was a strong correlation between the
geographic origins of the isolates within each lineage, and a biogeographic
interpretation of the ITS tree suggested that the centre of origin for shiitake
in the Asia–Australasia region was in the South Pacific. Chiu et al. (1996)
studied the genetic diversity of cultivated strains of shiitake used in China
using AP-PCR, RAPD and PCR–RFLP of ITS regions. The results
indicated that cultivated strains of shiitake in China are genetically very
homogeneous, very like cultivated strains of Agaricus bisporus and
Volvariella volvacea.
Hibbett and Vilgalys (1993) also investigated the phylogenetic relation-
ships of Lentinus, using morphological characters and sequences from the
divergent regions of the 28S rDNA. They found that although Lentinus sensu
Pegler was not monophyletic, the genus consisted of three separate mono-
phyletic groups. These largely corresponded to Neolentinus, Panus, and
Lentinus sensu stricto, with the latter apparently derived from the Poly-
poraceae, suggesting that lamellae are products of convergent evolution.
The confused taxonomy of the genus Armillaria has precluded a clear
understanding of the biology of the major species. Anderson and Stasovski
(1992) have used IGS sequences to investigate the phylogenetic relationships
of several northern hemisphere species of Armillaria. The majority of
northern hemisphere species were found to be closely related to one another,
relative to A. mellea and A. tabescens. The majority of the northern
hemisphere species were divided into two groups, one composed of A.
ostoyae, A. gemina and A. borealis, and the other consisting of A. lutea, A.

calvescens, A. cepistipes, A. sinapina, species IX and species X.
Hinkle et al. (1994) determined the complete 16S-like rRNA coding
regions of the fungal symbiont of five genera of attine (leaf-cutting) ants and
two free-living fungi. The phylogenetic tree generated from this data placed
the attine fungal symbionts as homobasidiomycetes in the order Agaricales.
Comparison of the topology of the attine fungal symbiont phylogenetic tree
with a tree based on attine ant morphology suggested that there had been a
long co-evolution of leaf-cutting attine ants and their fungal symbionts.
Phylogenetic relationships within the coprinoid taxa and some close
relatives have been studied from PCR–RFLP of nuclear large subunit rDNA
and the ITS2 region (Hopple and Vilgalys, 1994). These authors suggested
that the genus Coprinus was at least paraphyletic and probably polyphyletic
and that Psathyrella was derived from within Coprinus. The results also
suggested that the two secotioid taxa were closely related to Coprinus
comatus and that Bolbitius was a sister genus to Coprinus.
Bunyard et al. (1996) used PCR–RFLP of the 26S and 5S rDNA, and the
IGS between the 26S and 5S rDNA for a phylogenetic study of Agaricus
species. They found that the most closely related species to A. bisporus were
A. excellens, A. chionodermus and A. caroli.
Gastromycetes
ITS regions from 47 isolates belonging to 38 recognized species of Suillus
sensu lato have been sequenced in a phylogenetic analysis using parsimony
as well as distance methods (Kretzer et al., 1996). The results suggested that
the genera Boletinus and Fuscoboletinus, that are often considered within S.
sensu lato, were not monophyletic, and that isolates of Suillus granulatus
derived from either North America or Europe and Asia are polyphyletic and
may represent at least two different species. This study also showed that
within Suillus sensu lato, mycorrhizal associations with Larix were a
primitive association and that host changes to Pinus and Pseudotsuga
occurred only once. Baura et al. (1992) used ITS sequences to propose that
Gastrosuillus laricinus was a recent derivative of Suillus grevillei.
Aphyllophorales
The phylogenetic relationships within Ganoderma and the G. lucidum
species complex have been considered from sequences of ITS regions and the
divergent domain D2 of the 25S rDNA (Moncalvo et al., 1995a, b).
Parsimony analysis of this data identified six lineages in the G. lucidum
complex. It was suggested that each lineage represented one or more putative
species, however, there was little correlation between rDNA gene phylogeny
and morphology within the species complex. Hseu et al. (1996) also
attempted to differentiate isolates of the G. lucidum complex using RAPD
analysis. However, data from RAPDs did not distinguish the same clades as
ITS and it seems likely that while ITS sequences can be used to identify
140 S. Takamatsu
species within the G. lucidum complex, RAPDs can be used to differentiate

between isolates which have identical ITS sequences.
PCR–RFLP analyses have been used for phylogenetic studies and
species identification with several kinds of mushrooms and ectomycorrhizae.
Gardes et al. (1991) considered variations in the length, RFLP, and primary
sequence of the PCR-amplified ITS regions and mitochondrial large subunit
rDNA ingroupings of ectomycorrhizal fungi, particularly in the genus
Laccaria.
Uredinales
Relatively few molecular phylogenies have been proposed for the rust fungi.
Zambino and Szabo (1993) used the sequences of ITS regions to investigate
phylogenetic relationships among strains and formae speciales of Puccinia
coronata, P. graminis, P. recondita and other cereal and grass rusts and related
species. They showed that isolates of P. graminis and P. coronata from
various hosts each consisted of a distinct cluster, but that strains of the P.
recondita species complex isolated from various hosts did not. In compar-
isons among formae speciales of P. graminis and P. coronata, the formae
speciales that had identical ITS sequences were those that were already
known to be closely related by crossing, isozyme, and host range studies.
However, in some cases the relationships among formae speciales based on
sequence data contradicted the current taxonomy of the cereal rusts.
Chen et al. (1993) considered the relationship between variation in
virulence and RAPD patterns in 115 single-uredospore isolates from 23
collections of P. striiformis. They found there was little apparent association
between virulence and RAPD patterns, indicating that the RAPD poly-
morphisms were independent of virulence.
Other basidiomycetes
Eleven anastomosis groups (AG 1–10 and AG BI) have been recognized in
Rhizoctonia solani, and 25 intraspecific groups (ISGs) have been recognized
within these on the basis of isoenzymes and ITS polymorphisms (Liu and
Sinclair, 1992, 1993; Liu et al., 1993). Liu et al. (1995) found four major
groups from RFLP analysis of 18S rDNA of 161 isolates of the 25 ISGs, and
maximum parsimony and likelihood analyses showed that AG 10 isolates
were distinct and only distantly related to the majority of the other AGs.
7.4.4 Zygomycetes
Phylogenetic studies on zygomycetes are comparatively rare compared with
those on other fungal groups. Nagahama et al. (1995) determined the 18S
rDNA sequences for four representative species of the Entomophthorales
and the trichomycete Smittium culisetae. Their analysis included ten pre-
viously published reference sequences and showed that the seven zygomy-
cete species investigated formed four clusters. The four entomophthoralean
species were recovered in two clusters, with Basidiobolus ranarum in one

cluster with Chytridium, Spizellomyces and Neocallimastix, while the
remaining three entomophoralean species, Conidiobolus coronatus, Entomo-
phthora muscae and Zoophthora radicans, formed a second cluster with
Mucor. Glomus etunicatum was found to be a basal clade to the ascomycetes
and basidiomycetes, and Smittium culisetae was placed close to the diver-
gence of Entomophthorales from the chytrid–Glomus–ascomycete–
basidiomycete clade. The results also suggested that flagellae had been lost
independently in several lineages in the tree and that there was considerable
phylogenetic divergence within the chytrids.
Geosiphon pyriforme is the only known example of endocytobiosis
between a fungus and a cyanobacterium. Gehrig et al. (1996) used 18S rDNA
sequences to investigate the taxonomic and evolutionary relationships of G.
pyriforme to fungi forming arbuscular mycorrhiza (Glomales). The Glo-
males, including Geosiphon, formed a single clade distinct from groups of
zygomycetes and G. pyriforme was placed at the ancestral base of the
Glomales. Geosiphon is able to form a ‘primitive’ symbiosis with a unicellular
photoautotrophic organism, and based on their phylogeny the authors
suggested that a hypothetical association of a Glomus-like fungus with a
green alga may have occurred as a stage in the evolution of the land plants.
7.4.5 Oomycetes, Hyphochytriomycetes

The PCR–RFLP of the nuclear large subunit rDNA, ITS regions, and
mitochondrial large subunit rDNA of three heterothallic Pythium species, P.
heterothallicum, P. splendens and P. sylvaticum, were determined by Chen
(1992). The ITS of both P. heterothallicum and P. splendens was about 850
bp long, and the ITS for P. sylvaticum was about 1020 bp long; each length
variant showed distinct RFLP banding patterns. A phylogenetic analysis
based on the variable restriction sites in the ITS region showed that the
heterothallic species did not form a monophyletic group, suggesting that
heterothallism does not represent a distinct species lineage in the genus.
Briard et al. (1995) determined the nucleotide sequences of a divergent
region of 28S rDNA from 23 species of Pythiaceae, and compared these to
assess phylogenetic relationships. Although a high level of diversity was
found within Pythium, Phytophthora appeared to be very homogeneous.
They found that there was a strict correlation between groups of species
within Pythium defined by molecular taxonomy and those defined on the
basis of the morphology of sporangia.
The sequences of the ITS regions from Phytophthora species have been
independently determined by several authors. Lee and Taylor (1992) used
ITS sequences in a phylogenetic study of five Phytophthora species: P.
palmivora, P. megakarya, P. capsici, P. citrophthora and P. cinnamomi. Their
results showed that cacao isolates of P. capsici and P. citrophthora were
closely related, that P. palmivora and P. megakarya shared a common
142 S. Takamatsu
lineage, and that P. cinnamomi was only distantly related to the other species.
Crawford et al. (1996) used rDNA sequences in an evolutionary analysis of
15 Phytophthora species. Analysis of papillate, semi-papillate and non-
papillate species showed that sporangium papillation had phylogenetic
significance, with the three morphological groups each forming separate
clusters. Within the P. megasperma species complex, separate evolutionary
lines were identified for P. medicaginis, P. trifolii and P. sojae, species
formerly regarded as a formae speciales of P. megasperma. This finding
confirmed their recent reclassification as biological species. P. macro-
chlamydospora from soybean, which has only been observed in Australia,
was found to be closely related to P. sojae, indicating a possible common
ancestry. Cooke et al. (1996) used the RAPD analysis and rDNA sequences
in a phylogenetic study of group I species of Phytophthora. The RAPD
banding patterns separated P. iranica and P. clandestina from the other
Phytophthora species, P. idaei, P. pseudotsugae and P. cactorum. Collar rot
isolates from apple placed in P. cactorum clustered separately from straw-
berry crown rot isolates, while isolates from raspberry appeared to have
affinities with both clusters.
7.5 Conclusions
Our knowledge of fungal phylogeny is rapidly being increased by PCR-

mediated studies. As described above, most of these studies have been based on
nuclear or mitochondrial rRNA genes, because conserved rRNA coding
regions and variable spacer regions are present within a rDNA repeat, which
enables the design of universal primers suitable for a wide range of fungi.
However, recently, the use of sequences obtained from protein genes has
increased. Sequence data obtained from different DNA regions will be
required in future to construct more precise phylogenetic trees. While most
studies described in this chapter have focused on fungal systematics, molecular
phylogenetic study is also useful to infer morphological, ecological and
physiological evolution (Berbee and Taylor, 1995). Furthermore, if the genes
directly related to morphological, ecological and physiological phenotypes
were identified and sequenced, then comparative analyses of these genes would
make it possible to investigate how these phenotypes have evolved.
References
Anderson, J.B. and Stasovski, E. (1992) Molecular phylogeny of northern hemisphere

Appel, D.J. and Gordon, T.R. (1995) Intraspecific variation within populations of
Fusarium oxysporum based on RFLP analysis of the intergenic spacer region of
the rDNA. Experimental Mycology 19, 120–128.
Appel, D.J. and Gordon, T.R. (1996) Relationships among pathogenic and non-
pathogenic isolates of Fusarium oxysporum based on the partial sequence of the
intergenic spacer region of the ribosomal DNA. Molecular Plant–Microbe
Interactions 9, 125–138.
Baldauf, S.L. and Palmer, J.D. (1993) Animals and fungi are each other’s closest
relatives: Congruent evidence from multiple proteins. Proceedings of the
National Academy of Sciences USA 90, 11558–11562.
Baura, G., Szaro, T.M. and Bruns, T.D. (1992) Gastrosuillus laricinus is a recent
derivative of Suillus grevillei: molecular evidence. Mycologia 84, 592–597.
Berbee, M.L. (1996) Loculoascomycete origins and evolution of filamentous ascomy-
cete morphology based on 18S rRNA gene sequence data. Molecular Biology and
Evolution 13, 462–470.
Berbee, M.L. and Taylor, J.W. (1993) Dating the evolutionary radiations of the true
fungi. Canadian Journal of Botany 71, 1114–1127.
Berbee, M.L. and Taylor, J.W. (1995) From 18S ribosomal sequence data to evolution
of morphology among the fungi. Canadian Journal of Botany 73 (suppl. 1),
S677–S683.
Berbee, M.L., Yoshimura, A., Sugiyama, J. and Taylor, J.W. (1995) Is Penicillium
monophyletic? An evaluation of phylogeny in the family Trichocomaceae from
18S, 5.8S and ITS ribosomal DNA sequence data. Mycologia 87, 210–222.
Bernier, L., Hamelin, R.C. and Ouellette, G.B. (1994) Comparison of ribosomal
DNA length and restriction site polymorphisms in Gremmeniella and Ascocalyx
isolates. Applied and Environmental Microbiology 60, 1279–1286.
Biel, S.W. and Parrish, F.W. (1986) Isolation of DNA from fungal mycelia and
sclerotia without use of density gradient ultracentrifugation. Analytical Bio-
chemistry 154, 21–25.
Bowman, B.H., Taylor, J.W. and White, T.J. (1992) Molecular evolution of the fungi:
human pathogens. Molecular Biology and Evolution 9, 893–904.
Bowman, B.H., White, T.J. and Taylor, J.W. (1996) Human pathogenic fungi and their
close nonpathogenic relatives. Molecular Phylogenetics and Evolution 6, 89–96.
Boyd, M.L. and Carris, L.M. (1997) Molecular relationships among varieties of the
Tilletia fusca (T. bromi) complex and related species. Mycological Research 101,
269–277.
Briard, M., Dutertre, M., Rouxel, F. and Brygoo, Y. (1995) Ribosomal RNA sequence
divergence within the Pythiaceae. Mycological Research 99, 1119–1127.
Bruns, T.D. and Szaro, T.M. (1992) Rate and mode differences between nuclear and
mitochondrial small-subunit rRNA genes in mushrooms. Molecular Biology and
from fungal herbarium specimens. Mycologia 82, 175–184.
Bruns, T.D., White, T.J. and Taylor, J.W. (1991) Fungal molecular systematics. Annual
Review of Ecology and Systematics 22, 525–564.
Bruns, T.D., Vilgalys, R., Barns, S.M., Gonzalez, D., Hibbett, D.S., Lane, D.J., Simon,
L., Stickel, S., Szaro, T.M., Weisburg, W.G. and Sogin, M.L. (1992) Evolutionary
relationships within the fungi: analysis of nuclear small subunit rRNA sequen-
ces. Molecular Phylogenetics and Evolution 1, 231–241.
Bryan, G.T., Daniels, M.J. and Osbourn, A.E. (1995) Comparison of fungi within the
Gaeumannomyces–Phialophora complex by analysis of ribosomal DNA sequen-
ces. Applied and Environmental Microbiology 61, 681–689.
144 S. Takamatsu
Bunyard, B.A., Nicholson, M.S. and Royse, D.J. (1994) A systematic assessment of
Morchella using RFLP analysis of the 28S ribosomal RNA gene. Mycologia 86,
762–772.
Bunyard, B.A., Nicholson, M.S. and Royse, D.J. (1996) Phylogeny of the genus
Agaricus inferred from restriction analysis of enzymatically amplified ribosomal
DNA. Fungal Genetics and Biology 20, 243–253.
Buscot, F., Wipf, D., Battista, C.D., Munch, J.-C., Botton, B. and Martin, F. (1996)
DNA polymorphism in morels: PCR–RFLP analysis of the ribosomal DNA
spacers and microsatellite-primed PCR. Mycological Research 100, 63–71.
Carbone I. and Kohn, L.M. (1993) Ribosomal DNA sequence divergence within
internal transcribed spacer 1 of the Sclerotiniaceae. Mycologia 85, 415–427.
Chen, W. (1992) Restriction fragment length polymorphisms in enzymatically
ogy 82, 1467–1472.
Chen, X.M., Line, R.F. and Leung, H. (1993) Relationship between virulence
variation and DNA polymorphism in Puccinia striiformis. Phytopathology 83,
1489–1497.
Chiu, S.-W., Ma, A.-M., Lin, F.-C. and Moore, D. (1996) Genetic homogeneity of
cultivated strains of shiitake (Lentinula edodes) used in China as revealed by the
polymerase chain reaction. Mycological Research 100, 1393–1399.
Cooke, D.E.L., Kennedy, D. M., Guy, D.C., Russell, J., Unkles, S.E. and Duncan,
J.M. (1996) Relatedness of group I species of Phytophthora as assessed by
randomly amplified polymorphic DNA (RAPDs) and sequences of ribosomal
DNA. Mycological Research 100, 297–303.
Cox, G.M., Rude, T.H., Dykstra, C.C. and Perfect, J.R. (1995) The actin gene from
Cryptococcus neoformans: structure and phylogenetic analysis. Journal of
Medical and Veterinary Mycology 33, 261–266.
Crawford, A.R., Bassam, B.J., Drenth, A., Maclean, D.J. and Irwin, J.A.G. (1996)
Evolutionary relationships among Phytophthora species deduced from rDNA
sequence analysis. Mycological Research 100, 437–443.
Donaldson, G.C., Ball, L.A., Axelrood, P.E. and Glass, N.L. (1995) Primer sets
developed to amplify conserved genes from filamentous ascomycetes are useful
in differentiating Fusarium species associated with conifers. Applied and Envi-
ronmental Microbiology 61, 1331–1340.
Edel, V., Steinberg, C., Gautheron, N. and Alabouvette, C. (1996) Evaluation of
restriction analysis of polymerase chain reaction (PCR)-amplified ribosomal
DNA for the identification of Fusarium species. Mycological Research 101,
179–187.
Edlind, T.D., Li, J., Visvesvara, G.S., Vodkin, M.H., McLaughlin, G.L. and Katiyar,
S.K. (1996) Phylogenetic analysis of β-tubulin sequences from amitochondrial
protozoa. Molecular Phylogenetics and Evolution 5, 359–367.
Erland, S. (1995) Abundance of Tylospora fibrillosa ectomycorrhizas in a South
Swedish spruce forest measured by RFLP analysis of the PCR-amplified rDNA
ITS region. Mycological Research 99, 1425–1428.
Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 39, 783–791.
Felsenstein, J. (1989) PHYLIP-phylogeny inference package (version 3.2). Cladistics 5,
164–166.
Fletcher, L.D., McDowell, J.M., Tidwell, R.R., Meagher, R.B. and Dykstra, C.C.
(1994) Structure, expression and phylogenetic analysis of the gene encoding actin
I in Pneumocystis carinii. Genetics 137, 743–750.
Gardes, M., White, T.J., Fortin, J.A., Bruns, T.D. and Taylor, J.W. (1991) Identifica-
tion of indigenous and introduced symbiotic fungi in ectomycorrhizae by
amplification of nuclear and mitochondrial ribosomal DNA. Canadian Journal
of Botany 69, 180–190.
Gargas, A. and Taylor, J.W. (1992) Polymerase chain reaction (PCR) primers for
amplifying and sequencing nuclear 18S rDNA from lichenized fungi. Mycologia
84, 589–592.
Gargas, A. and Taylor, J.W. (1995) Phylogeny of Discomycetes and early radiations
of the apothecial Ascomycotina inferred from SSU rDNA sequence data.
Experimental Mycology 19, 7–15.
Gargas, A., DePriest, P.T. and Taylor, J.W. (1995) Positions of multiple insertions in
208–218.
Gehrig, H., Schüssler, A. and Kluge, M. (1996) Geosiphon pyriforme, a fungus
forming endocytobiosis with Nostoc (Cyanobacteria), is an ancestral member of
the Glomales: evidence by SSU rRNA analysis. Journal of Molecular Evolution
43, 71–81.
Geiser, D.M., Timberlake, W.E. and Arnold, M.L. (1996) Loss of meiosis in
Aspergillus. Molecular Biology and Evolution 13, 809–817.
Gelfand, D.H. and White, T.J. (1990) Thermostable DNA polymerases. In: Innis,
M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols: a Guide
to Methods and Applications. Academic Press, New York, pp. 129–141.
Gerbi, S.A. (1985) Evolution of ribosomal DNA. In: MacIntyre, R.J. (ed.) Molecular
Evolutionary Genetics. Plenum, New York, pp. 419–517.
Glenn, A.E., Bacon, C.W., Price, R. and Hanlin, R.T. (1996) Molecular phylogeny of
Acremonium and its taxonomic implications. Mycologia 88, 369–383.
Goodwin, P.H. and Annis, S.L. (1991) Rapid identification of genetic variation and
pathotype of Leptosphaeria maculans by random amplified polymorphic DNA
assay. Applied and Environmental Microbiology 57, 2482–2486.
Guadet, J., Julien, J., Lafay, J.F. and Brygoo, Y. (1989) Phylogeny of some Fusarium
species, as determined by large-subunit rRNA sequence comparison. Molecular
Guillemaud, T., Raymond, M., Callot, G., Cleyet-Marel, J.-C. and Fernandez, D.
(1996) Variability of nuclear and mitochondrial ribosomal DNA of a truffle
species (Tuber aestivum). Mycological Research 100, 547–550.
Harmsen, D., Schwinn, A., Weig, M., Bröker, E.-B. and Heesemann, J. (1995) Phylo-
geny and dating of some pathogenic keratinophilic fungi using small subunit ribo-
somal RNA. Journal of Medical and Veterinary Mycology 33, 299–303.
Harrington, F.A. and Potter, D. (1997) Phylogenetic relationships within Sarcoscypha
based upon nucleotide sequences of the internal transcribed spacer of nuclear
ribosomal DNA. Mycologia 89, 258–267.
Harrington, T.C. and Wingfield, B.D. (1995) A PCR-based identification method for
Hasegawa, M., Hashimoto, T., Adachi, J., Iwabe, N. and Miyata, T. (1993) Early
branchings in the evolution of eukaryotes: ancient divergence of entamoeba that
lacks mitochondria revealed by protein sequence data. Journal of Molecular
146 S. Takamatsu
Hausner, G., Reid, J. and Klassen, G.R. (1993) On the phylogeny of Ophiostoma,
Ceratocystis s.s., and Microascus, and relationships within Ophiostoma based
on partial ribosomal DNA sequences. Canadian Journal of Botany 71,
1249–1265.
Hibbett, D.S. and Vilgalys, R. (1993) Phylogenetic relationships of Lentinus
(Basidiomycotina) inferred from molecular and morphological characters. Sys-
tematic Botany 18, 409–433.
Hibbett, D.S., Fukumasa-Nakai, Y., Tsuneda, A. and Donoghue, M.J. (1995)
Phylogenetic diversity in shiitake inferred from nuclear ribosomal DNA
sequences. Mycologia 87, 618–638.
Hillis, D.M. and Davis, S.K. (1987) Evolution of the 28S ribosomal RNA gene in
anurans: regions of variability and their phylogenetic implications. Molecular
Hillis, D.M. and Dixon, M.T. (1991) Ribosomal DNA: molecular evolution and
phylogenetic inference. The Quarterly Review of Biology 66, 411–453.
Hinkle, G., Wetterer, J.K., Schultz, T.R. and Sogin, M.L. (1994) Phylogeny of the
attine ant fungi based on analysis of small subunit ribosomal RNA gene
sequences. Science 266, 1695–1697.
Hirata, T. and Takamatsu, S. (1996) Nucleotide sequence diversity of rDNA internal
transcribed spacers extracted from conidia and cleistothecia of several powdery
mildew fungi. Mycoscience 37, 283–288.
Hopple, J.S., Jr. and Vilgalys, R. (1994) Phylogenetic relationships among coprinoid
taxa and allies based on data from restriction site mapping of nuclear rDNA.
Hseu, R.-S., Wang, H.-H., Wang, H.-F. and Moncalvo, J.-M. (1996) Differentiation
and grouping of isolates of the Ganoderma lucidum complex by random
amplified polymorphic DNA-PCR compared with grouping on the basis of
internal transcribed spacer sequences. Applied and Environmental Microbiology
62, 1354–1363.
Hsiao, C., Chatterton, N.J., Asay, K.H. and Jensen, K.B. (1994) Phylogenetic
relationships of 10 grass species: an assessment of phylogenetic utility of the
internal transcribed spacer region in nuclear ribosomal DNA in monocots.
Genome 37, 112–120.
Hsiao, C., Chatterton, N.J., Asay, K.H. and Jensen, K.B. (1995) Phylogenetic
relationships of the monogenomic species of the wheat tribe, Triticeae (Poaceae),
inferred from nuclear rDNA (internal transcribed spacer) sequences. Genome
38, 211–223.
Illingworth, C.A., Andrews, J.H., Bibeau, C. and Sogin, M.L. (1991) Phylogenetic
placement of Athelia bombacina, Aureobasidium pullulans, and Colletotrichum
gloeosporioides inferred from sequence comparisons of small-subunit ribosomal
RNAs. Experimental Mycology 15, 65–75.
Jasalavich, C.A., Morales, V.M., Pelcher, L.E. and Séguin-Swartz, G. (1995) Compar-
ison of nuclear ribosomal DNA sequences from Alternaria species pathogenic to
crucifers. Mycological Research 99, 604–614.
Jeng, R.S., Dumas, M., Liu, F.H., Wang, C.L. and Hubbes, M. (1997) DNA analysis
of Cylindrocladium floridanum isolates from selected forest nurseries. Myco-
logical Research 101, 285–291.
Jorgensen, R.A. and Cluster, P.D. (1988) Modes and tempos in the evolution of
nuclear ribosomal DNA: new characters for evolutionary studies and new
markers for genetic and population studies. Annals of the Missouri Botanical
Garden 75, 1238–1247.
Jungehülsing, U. and Tudzynski, P. (1997) Analysis of genetic diversity in Claviceps
purpurea by RAPD markers. Mycological Research 101, 1–6.
Karuppayil, S.M., Peng, M., Mendoza, L., Levins, T.A. and Szaniszlo, P.J. (1996)
Identification of the conserved coding sequences of three chitin synthase genes
in Fonsecaea pedrosoi. Journal of Medical and Veterinary Mycology 34,
117–125.
Khashnobish, A.K. and Shearer, C.A. (1996) Phylogenetic relationships in some
Leptosphaeria and Phaeosphaeria species. Mycological Research 100, 1355–1363.
Koch, E., Badawy, H.M.A. and Hoppe, H.H. (1989) Differences between aggressive
and nonaggressive single spore lines of Leptosphaeria maculans in cultural
characteristics and phytotoxin production. Journal of Phytopathology 124,
52–62.
Koch, E., Song, K., Osborn, T.C. and Williams, P.H. (1991) Relationship between
pathogenicity and phylogeny based on restriction fragment length polymor-
phism in Leptosphaeria maculans. Molecular Plant–Microbe Interactions 4,
341–349.
Kretzer, A., Li, Y., Szaro, T. and Bruns, T.D. (1996) Internal transcribed spacer
sequences from 38 recognized species of Suillus sensu lato: phylogenetic and
taxonomic implications. Mycologia 88, 776–785.
Kumar, S., Tamura, K. and Nei, M. (1993) MEGA : Molecular Evolutionary Genetics
Analysis, ver. 1.01. Pennsylvania State University, University Park, Pennsylvania.
Kusaba, M. and Tsuge, T. (1994) Nuclear ribosomal DNA variation and pathogenic
pecialization in Alternaria fungi known to produce host-specific toxins. Applied
Kusaba, M. and Tsuge, T. (1995) Phylogeny of Alternaria fungi known to produce
host-specific toxins on the basis of variation in internal transcribed spacers of
ribosomal DNA. Current Genetics 28, 491–498.
Leal, S.C.M., Bertioli, D.J., Butt, T.M., Carder, J.H., Burrows, P.R. and Peberdy, J.F.
(1997) Amplification and restriction endonuclease digestion of the Pr1 gene for
the detection and characterization of Metarhizium strains. Mycological Research
101, 257–265.
Protocols: A Guide to Methods and Applications. Academic Press, New York,
pp. 282–287.
Lee, S.B., Milgroom, M.G. and Taylor, J.W. (1988) A rapid, high yield mini-prep
method for isolation of total genomic DNA from fungi. Fungal Genetics
Newsletter 35, 23–24.
Li, J. and Edlind, T. (1994) Phylogeny of Pneumocystis carinii based on β-tubulin
sequence. The Journal of Eukaryotic Microbiology 41, S97.
Liu, Z.L. and Sinclair. J.B. (1992) Genetic diversity of Rhizoctonia solani anastomosis
group 2. Phytopathology 82, 778–787.
Liu, Z.L. and Sinclair, J.B. (1993) Differentiation of intraspecific groups within
anastomosis group 1 of Rhizoctonia solani using ribosomal DNA internal
148 S. Takamatsu
transcribed spacer and isozyme comparisons. Canadian Journal of Plant

Liu, Z.L., Domier, L.L. and Sinclair, J.B. (1993) ISG-specific ribosomal DNA polymor-
phism of the Rhizoctonia solani species complex. Mycologia 85, 795–800.
Liu, Z.L., Domier, L.L. and Sinclair, J.B. (1995) Polymorphism of genes coding for
nuclear 18S rRNA indicates genetic distinctiveness of anastomosis group 10
from other groups in the Rhizoctonia solani species complex. Applied and
LoBuglio, K.F., Pitt, J.I. and Taylor, J.W. (1993) Phylogenetic analysis of two
LoBuglio, K.F., Pitt, J.I. and Taylor, J.W. (1994) Independent origins of the
synnematous Penicillium species, P. duclauxii, P. clavigerum, and P. vulpinum,
as assessed by two ribosomal DNA regions. Mycological Research 98, 250–256.
LoBuglio, K.F., Berbee, M.L. and Taylor, J.W. (1996) Phylogenetic origins of the
asexual mycorrhizal symbiont Cenococcum geophilum Fr. and other mycorrhizal
fungi among the ascomycetes. Molecular Phylogenetic and Evolution 6, 287–294.
Lott, T.J., Kuykendall, R.J. and Reiss, E. (1993) Nucleotide sequence analysis of the
5.8S rDNA and adjacent ITS2 region of Candida albicans and related species.
Yeast 9, 1199–1206.
Maddison, W.P. and Maddison, D.R. (1992) MacClade: Analysis of Phylogeny and
Character Evolution, ver. 3. Sinauer Associates, Sunderland, Massachusetts.
Martin, W., Brinkmann, H., Savonna, C. and Cerff, R. (1993) Evidence for a chimeric
nature of nuclear genomes: Eubacterial origin of eukaryotic glyceraldehyde-
3-phosphate dehydrogenase genes. Proceedings of the National Academy of
diversity of Beauveria bassiana and relatedness to host insect range. Mycological
Research 101, 159–164.
McGee, D.C. and Petrie, G.A. (1978) Variability of Leptosphaeria maculans in
relation to blackleg of oilseed rape. Phytopathology 68, 625–630.
Mehmann, B., Brunner, I. and Braus, G.H. (1994) Nucleotide sequence variation of
chitin synthase genes among ectomycorrhizal fungi and its potential use in
taxonomy. Applied and Environmental Microbiology 60, 3105–3111.
Michelmore, R.W. and Hulbert, S.H. (1987) Molecular markers for genetic analysis
of phytopathogenic fungi. Annual Review of Phytopathology 25, 383–404.
Michot, B. and Bachellerie, J.-P. (1987) Comparisons of large subunit rRNAs reveal
some eukaryote-specific elements of secondary structure. Biochimie 69, 11–23.
Michot, B., Hassouna, N. and Bachellerie, J.-P. (1984) Secondary structure of mouse
28S rRNA and general model for the folding of the large rRNA in eukaryotes.
Möller, E.M., Bahnweg, G., Sandermann, H. and Geiger, H.H. (1992) A simple and
efficient protocol for isolation of high molecular weight DNA from filamentous
fungi, fruit bodies, and infected plant tissues. Nucleic Acids Research 20,
6115–6116.
Moncalvo, J.-M., Wang, H.-H. and Hseu, R.-S. (1995a) Phylogenetic relationships in
Ganoderma inferred from the internal transcribed spacers and 25S ribosomal
DNA sequences. Mycologia 87, 223–238.
Moncalvo, J.-M., Wang, H.-F. and Hseu, R.-S. (1995b) Gene phylogeny of the
Ganoderma lucidum complex based on ribosomal DNA sequences. Comparison
with traditional taxonomic characters. Mycological Research 99, 1489–1499.
Morales, V.M., Pelcher, L.E. and Taylor, J.L. (1993) Comparison of the 5.8S rDNA
and internal transcribed spacer sequences of isolates of Leptosphaeria maculans
from different pathogenicity groups. Current Genetics 23, 490–495.
Morales, V.M., Jasalavich, C.A., Pelcher, L.E., Petrie, G.A. and Taylor, J.L. (1995)
Phylogenetic relationships among several Leptosphaeria species based on their
ribosomal DNA sequences. Mycological Research 99, 593–603.
Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G. and Erlich, H. (1986) Specific
enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold
Spring Harbor Symposia on Quantitative Biology 51, 263–273.
Nagahama, T., Sato, H., Shimazu, M. and Sugiyama, J. (1995) Phylogenetic divergence
of the entomophthoralean fungi: evidence from nuclear 18S ribosomal RNA
gene sequences. Mycologia 87, 203–209.
Nishida, H. and Sugiyama, J. (1993) Phylogenetic relationships among Taphrina,
Saitoella, and other higher fungi. Molecular Biology and Evolution 10, 431–436.
Nishida, H. and Sugiyama, J. (1994) Archiascomycetes: detection of a major new
lineage within the Ascomycota. Mycoscience 53, 361–366.
Nishida, H., Blanz, P.A. and Sugiyama, J. (1993) The higher fungus Protomyces
inouyei has two group I introns in the 18S rRNA gene. Journal of Molecular
Norman, J.E. and Egger, K.N. (1996) Phylogeny of the genus Plicaria and its
relationship to Peziza inferred from ribosomal DNA sequence analysis. Myco-
logia 88, 986–995.
Nordnes, S., Krauss, S. and Johansen, T. (1994) cDNA sequence of zebrafish
(Brachydanio rerio) translation elongation factor-1a: molecular phylogeny of
eukaryotes based on elongation factor-1a protein sequences. Biochimica et
Biophysica Acta 1219, 529–532.
O’Donnell, K. (1992) Ribosomal DNA internal transcribed spacers are highly
divergent in the phytopathogenic ascomycete Fusarium sambucinum (Gibberella
pulicaris). Current Genetics 22, 213–220.
O’Donnell, K. (1993) Fusarium and its near relatives. In: Reynolds, D.R. and Taylor,
J.W. (eds) The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciation
in Fungal Systematics. CAB International, Wallingford, pp. 225–233.
O’Donnell, K. and Cigelnik, E. (1997) Two divergent intragenomic rDNA ITS2 types
within a monophyletic lineage of the fungus Fusarium are nonorthologous.
Molecular Phylogenetics and Evolution 7, 103–116.
O’Donnell, K., Cigelnik, E., Weber, N.S. and Trappe, J.M. (1997) Phylogenetic
relationships among ascomycetous truffles and the true and false morels inferred
from 18S and 28S ribosomal DNA sequence analysis. Mycologia 89, 48–65.
Pei, M.H., Whelan, M.J., Halford, N.G. and Royle, D.J. (1997) Distinction between
stem- and leaf-infecting forms of Melampsora rust on Salix viminalis using
RAPD markers. Mycological Research 101, 7–10.
Peterson, S.W. (1991) Phylogenetic analysis of Fusarium species using ribosomal
RNA sequence comparisons. Phytopathology 81, 1051–1054.
Peterson, S.W. (1993) Molecular genetic assessment of relatedness of Penicillium
150 S. Takamatsu
subgenus Penicillium. In: Reynolds, D.R. and Taylor, J.W. (eds) The Fungal
Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics.
CAB International, Wallingford, pp. 121–128.
Pitt, J.I. (1993) Speciation and evolution in Penicillium and related genera. In:
Reynolds, D.R. and Taylor, J.W. (eds) The Fungal Holomorph: Mitotic, Meiotic
and Pleomorphic Speciation in Fungal Systematics. CAB International, Wall-
ingford, pp. 107–113.
Radford, A. (1993) A fungal phylogeny based upon orotidine 5′-monophosphate
decarboxylase. Journal of Molecular Evolution 36, 389–395.
Rakotonirainy, M.S., Cariou, M.L., Brygoo, Y. and Riba, G. (1994) Phylogenetic
relationships within the genus Metarhizium based on 28S rRNA sequences and
isozyme comparison. Mycological Research 98, 225–230.
Rehner, S.A. and Samuels, G.J. (1994) Taxonomy and phylogeny of Gliocladium
analysed from nuclear large subunit ribosomal DNA sequences. Mycological
Research 98, 625–634.
Ritland, C.E., Ritland, K. and Straus, N.A. (1993) Variation in the ribosomal internal
transcribed spacers (ITS1 and ITS2) among eight taxa of the Mimulus guttatus
species complex. Molecular Biology and Evolution 10, 1273–1288.
Rusk, S.A., Spiegel, F.W. and Lee, S.B. (1995) Design of polymerase chain reaction
primers for amplifying nuclear ribosomal DNA from slime molds. Mycologia 87,
140–143.
Saenz, G.S., Taylor, J.W. and Gargas, A. (1994) 18S rRNA gene sequences and
supraordinal classification of the Erysiphales. Mycologia 86, 212–216.
Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and
Arnheim, N. (1985) Enzymatic amplification of β-globin genomic sequences and
restriction site analysis for diagnosis of sickle cell anemia. Science 230,
1350–1354.
K.B. and Erlich, H.A. (1988) Primer-directed enzymatic amplification of DNA
Saitou, N. and Nei, M. (1987) The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406–425.
Sappal, N.P., Jeng, R.S., Hubbes, M. and Liu, F. (1995) Restriction fragment length
polymorphisms in polymerase chain reaction amplified ribosomal DNAs of
three Trichogramma (Hymenoptera: Trichogrammatidae) species. Genome 38,
419–425.
Schäfer, C. and Wöstemeyer, J. (1992) Random primer dependent PCR differentiates
aggressive from non-aggressive isolates of the oilseed rape pathogen Phoma
lingam (Leptosphaeria maculans). Journal of Phytopathology 136, 124–136.
Schardl, C.L., Liu, J.-S., White, J.F. Jr., Finkel, R.A., An, Z. and Siegel, M.R. (1991)
Molecular phylogenetic relationships of nonpathogenic grass mycosymbionts
and clavicipitaceous plant pathogens. Plant Systematics and Evolution 178,
27–41.
Schlötterer, C., Hauser, M.-T., von Haeseler, A. and Tautz, D. (1994) Comparative
evolutionary analysis of rDNA ITS regions in Drosophila. Molecular Biology
and Evolution 11, 513–522.
Seifert, K.A., Louis-Seize, G. and Savard, M.E. (1997) The phylogenetic relationships
of two trichothecene-producing hyphomycetes, Spicellum roseum and Tricho-
thecium roseum. Mycologia 89, 250–257.
Shearer, Jr., G. (1995) Cloning and analysis of cDNA encoding an elongation factor
1a from the dimorphic fungus Histoplasma capsulatum. Gene 161, 119–123.
Sherriff, C., Whelan, M.J., Arnold, G.M., Lafay, J.-F., Brygoo, Y. and Bailey, J.A.
(1994) Ribosomal DNA sequence analysis reveals new species groupings in the
genus Colletotrichum. Experimental Mycology 18, 121–138.
Sherriff, C., Whelan, M.J., Arnold, G.M. and Bailey, J.A. (1995) rDNA sequence
analysis confirms the distinction between Colletotrichum graminicola and C.
sublineolum. Mycological Research 99, 475–478.
Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. and Flook, P. (1994)
Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences
and a compilation of conserved polymerase chain reaction primers. Annals of the
Entomological Society of America 87, 651–701.
Simon, L., Bousquet, J., Lévesque, R.C. and Lalonde, M. (1993) Origin and
diversification of endomycorrhizal fungi and coincidence with vascular land
plants. Nature 363, 67–69.
Spatafora, J.W. and Blackwell, M. (1993) Molecular systematics of unitunicate
perithecial ascomycetes: the Clavicipitales–Hypocreales connection. Mycologia
85, 912–922.
Strimmer, K. and von Haeseler, A. (1996) Quartet puzzling: a quartet maximum-
likelihood method for reconstructing tree topologies. Molecular Biology and
Suh, S.-O. and Sugiyama, J. (1994) Phylogenetic placement of the basidiomycetous
yeasts Kondoa malvinella and Phodosporidium dacryoidum, and the anamorphic
yeast Sympodiomycopsis paphiopedili by means of 18S rRNA gene sequence
analysis. Mycoscience 35, 367–375.
Swann, E.C. and Taylor, J.W. (1993) Higher taxa of basidiomycetes: an 18S rRNA
gene perspective. Mycologia 85, 923–936.
Swofford, D.L. (1993) Phylogenetic Analysis Using Parsimony (PAUP version 3.1.1).
Illinois Natural History Survey, Champaign, Illinois.
Taylor, J.L., Borgmann, I. and Séguin-Swartz, G. (1991) Electrophoretic karyotyping
of Leptosphaeria maculans differentiates highly virulent from weakly virulent
isolates. Current Genetics 19, 273–277.
Taylor, J.W. and Natvig, D. (1987) Isolation of fungal DNA. In: Fuller, M.S. and
Jaworski, A. (eds) Zoosporic Fungi in Teaching and Research. South-eastern
Publishing Corporation, Athens, Georgia, pp. 252–258.
Taylor, J.W., Bowman, B.H., Berbee, M.L. and White, T.J. (1993) Fungal model
organisms: phylogenetics of Saccharomyces, Aspergillus, and Neurospora. Sys-
tematic Biology 42, 440–457.
Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence weight-
ing, positions-specific gap penalties and weight matrix choice. Nucleic Acids
Research 22, 4673–4680.
Van der Auwera, G., Chapelle, S. and De Wachter, R. (1994) Structure of the large
ribosomal subunit RNA of Phytophthora megasperma, and phylogeny of the
oomycetes. FEBS Letters 338, 133–136.
Van der Auwera, G., De Baere, R., Van de Peer, Y., De Rijk, P., Van den Broeck, I.
and DeWachter, R. (1995) The phylogeny of the Hyphochytriomycota as deduced
from ribosomal RNA sequences of Hyphochytrium catenoides. Molecular
152 S. Takamatsu
Van der Auwera, G. and De Wachter, R. (1996) Large-subunit rRNA sequence of the
chytridiomycete Blastocladiella emersonii, and implications for the evolution of
zoosporic fungi. Journal of Molecular Evolution 43, 476–483.
Verweij, P.E., Meis, J.F.G.M., Van den Hurk, P., Zoll, J., Samson, R.A. and Melchers,
W.J.G. (1995) Phylogenetic relationships of five species of Aspergillus and related
taxa as deduced by comparison of sequences of small subunit ribosomal RNA.
Journal of Medical and Veterinary Mycology 33, 185–190.
Waalwijk, C., de Koning, J.R.A., Baayen, R.P. and Gams, W. (1996a) Discordant
Waalwijk, C., Baayen, R.P., de Koning, J.R.A. and Gams, W. (1996b) Ribosomal
DNA analyses challenge the status of Fusarium sections Liseola and Elegans.
Sydowia 48, 90–104.
Walsh, P.S., Metzger, D.A. and Higuchi, R. (1991) Chelex 100 as a medium for simple
extraction of DNA for PCR-based typing from forensic material. BioTechniques
10, 506–513.
Wery, J., Dalderup, M.J.M., Linde, J.T., Boekhout, T. and van Ooyen, A.J.J. (1996)
Structural and phylogenetic analysis of the actin gene from the yeast Phaffia
rhodozyma. Yeast 12, 641–651.
Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols: a Guide to
Methods and Applications. Academic Press, New York, pp. 315–322.
Xue, B. and Goodwin, P.H. (1994) Insertions and G-C rich DNA sequences in the
mitochondrial large ribosomal subunit of Leptosphaeria maculans. Mycological
Research 98, 445–452.
Xue, B., Goodwin, P.H. and Annis, S.L. (1992) Pathotype identification of Lep-
tosphaeria maculans with PCR and oligonucleotide primers from ribosomal
internal transcribed spacer sequences. Physiological and Molecular Plant Pathol-
ogy 41, 179–188.
Yan, Z.H., Rogers, S.O. and Wang, C.J.K. (1995) Assessment of Phialophora species
based on ribosomal DNA internal transcribed spacers and morphology. Mycolo-
gia 87, 72–83.
Zambino, P.J. and Szabo, L.J. (1993) Phylogenetic relationships of selected cereal and
grass rusts based on rDNA sequence analysis. Mycologia 85, 401–414.
Zhou, J. and Kleinhofs, A. (1996) Molecular evolution of nitrate reductase genes.
Journal of Molecular Evolution 42, 432–442.
Zolan, M.E. and Pukkila, P.J. (1986) Inheritance of DNA methylation in Coprinus
cinereus. Molecular and Cellular Biology 6, 195–200.
PCR Applications to the 8
Taxonomy of
Entomopathogenic Fungi
F. Driver and R.J. Milner
CSIRO, Division of Entomology, GPO Box 1700, Canberra, ACT
2601, Australia
8.1 Introduction
The extent of biodiversity within fungi is often underestimated: there are

over 72,000 described species and the total number of species in the world
may be as many as 1.5 million (Hawksworth, 1995). It is more widely known
that insects are a highly diverse component of the animal kingdom with large
numbers of undescribed species and it is estimated that a total of 10 million
species of insect exist. Given that 5% of these insects are attacked by a
specific fungus then it might be expected that there are 500,000 species of
fungi as symbionts, commensals or pathogens of insects (Hawksworth,
1991). The diversity of association between insects and fungi has recently
been reviewed by Lawrence and Milner (1996) and Murrin (1996). While
over 750 species of fungi have been described as being pathogens of insects,
only a small proportion of these have been intensively studied, mainly
because they attack pest insects and are, therefore, of interest as biological
control agents. The different types of fungi which are pathogenic on insects
and the detailed ecology of some of these have been reviewed by Glare and
Milner (1991).
There are two basic approaches to the use of pathogens for biological
control of insects. A pathogen can be introduced into an area where it does
not naturally occur in the hope of achieving long-term classical biological
control. The other strategy is to mass-produce the pathogen for repeated use
in an area as a biological insecticide. In both cases, it is important to know
the genetic make-up of the isolate of the fungus being released into the field.
Increasingly scientists are finding that PCR methodologies are useful in these
applied programmes. This increased knowledge of the genetic make-up of
154 F. Driver and R.J. Milner
isolates is being applied to track the distribution of artificially released

isolates in the field, to understand the host specificity profile of an isolate and
for protection of intellectual property. The obvious implications for a greater
understanding of the taxonomy of the pathogens involved is often a side-
benefit, and not a prime objective of the research.
In this chapter, we review the use of PCR for study of the taxonomy of
entomopathogenic fungi and use as a case study our own research on
Metarhizium. Finally we offer some conclusions and outline some of the
future directions for this research. For a more general treatment of the
applications of molecular biology to entomopathogenic fungi the reader is
referred to Khachatourians (1996), and the application of biotechnology to
the development of mycoinsecticides has been covered by Hegedus and
Khachatourians (1995).
8.2 Recent Studies on PCR of Entomophthorales
The largest and most successful group of insect pathogenic fungi is the 150
or so species within the order Entomophthorales of the subdivision Zygomy-
cetina. Most of these fungi were once placed in a single large genus,
Entomophthora, but now some nine genera are generally recognized:
Conidiobolus, Entomophaga, Entomophthora, Eryniopsis, Neozygites, Ery-
nia, Zoophthora, Strongwellsea and Massospora. Some species can be grown
on simple media and have been investigated as biological insecticides but
most are too fastidious for this application. Unfortunately the species most
effective as biological control agents are very widely distributed (along with
their hosts) and so opportunities for introductions are rare.
Nagahama et al. (1995) examined the phylogenetic relationships between
the entomophthoran genera, Zoophthora, Entomophthora and Conidiobolus
and other zygomycetes such as Mucor, Glomus, Smittium and Basidiobolus by
comparing sequences of the 18S RNA gene. Phylogenetic trees were developed
using neighbour-joining (Saitou and Nei, 1987) or parsimony (Swofford, 1993)
and the robustness of the branches was assessed using bootstrap analysis
(Felsenstein, 1985). The two trees both showed that the three insect pathogenic
genera were distinct but closely related; Mucor was the most closely related
free-living genus. More studies of this type are needed to cover a wider range of
genera and isolates. The results may help to clarify, for example, the
controversial distinction between Erynia and Zoophthora.
Three species which have been introduced into other countries either
accidentally or deliberately are Entomophaga maimaiga into the USA
(Andreadis and Weseloh, 1990), Zoophthora radicans into Australia (Milner
et al., 1982), and Entomophaga grylli into both Australia (Milner, 1985) and
the USA (Carruthers and Onsager, 1993). PCR studies of all these species
have been published in addition to those on the ubiquitous aphid pathogen
Erynia neoaphidis (syn. Pandora neoaphidis).
Taxonomy of Entomopathogenic Fungi 155
The gypsy moth, Lymantria dispar, is an important pest of forests in the

USA. In 1989, extensive mortality of caterpillars occurred in the north-east
USA and the causative organism was provisionally identified as a member of
the Entomophaga aulicae complex, an entomophthoran pathogen of a variety
of species of Lepidoptera in North America. Hajek et al. (1990) used
allozymes and RFLP to compare 20 isolates of E. aulicae from a variety of
hosts in the USA and Canada, with six isolates of E. maimaimga, a
morphologically similar fungus from the L. dispar in Japan, and three isolates
of the new fungus from gypsy moth caterpillars infected in the north-east
USA. Hajek et al. (1996b) have extended these studies using PCR products
from two primers as well as RFLP used previously. rDNA primers for the
18S and 25S genes were used to amplify 200 bp of the 3′ end of the 18S gene
and 1100 bp of the 5′ end of the 25S gene. The results supported the splitting
of E. aulicae into three groups based on RFLP analysis (Walsh et al., 1990)
and showed that a new isolate obtained from Orygia vetusta, a lymantriid
closely related to the gypsy moth, belonged to group 2 E. aulicae and was
distinct from E. maimaiga from the gypsy moth in the USA and Japan.
Unfortunately the original host of the group 2 E. aulicae reference strain is
not known for certain but is thought to be a Heliothis sp. These data provide
strong evidence that there are four cryptic species within the E. aulicae
complex in the USA which are ecologically separated by attacking different
hosts. Only one of these species, E. maimaiga, has been characterized and
named.
Recent PCR studies on two other apparently broad host-range entomo-
phthoran fungi, Zoophthora radicans and Erynia neoaphidis, have also
demonstrated that these are species complexes. Hodge et al. (1995) used
RAPDs to compare 38 isolates from a variety of hosts around the world. The
aim of the study was to determine whether or not seven isolates of this
fungus, originally from Serbia and field-released near Ithaca, New York (for
biological control of the potato leafhopper, Empoasca fabae) had become
established. The results gave a high level of correlation between isolates from
Serbia and those subsequently isolated from field-release sites at Ithaca. More
interesting was the finding that aphid-derived isolates were distinct from
both the ciccadelid isolates and from isolates derived from Lepidoptera. In
all some ten groups could be distinguished on the basis of RAPD patterns.
Further work is needed to determine the taxonomic implications of these
results. They support previous studies which proposed host-specific groups
within Z. radicans (Milner and Mahon, 1985; Glare et al., 1987). The
successful introduction of a strain of Z. radicans into Australia from Israel for
the control of the spotted alfalfa aphid, Therioaphis trifollii f. maculata, was
undertaken on the understanding that isolates already present in Australia on
Lepidoptera, Diptera and Hymenoptera, were unable to attack aphids
(Milner et al., 1982).
The relationships within Zoophthora spp. were further investigated by
Hajek et al. (1996a) who investigated the origin of an outbreak of Zoophthora
phytonomi in North American alfalfa weevils, Hypera punctata. Similar

methods, using RAPDs, were used to those of Hodge et al. (1995). The
results clearly delineated two distinct groups within Z. phytonomi, both of
which were distinct from two isolates of Z. radicans from a lepidopteran and
a homopteran which gave identical patterns. The authors postulated that one
of the two genotypes may be ‘new’ to North America, either because of
importation from Europe or through genomic change (e.g. by mutation).
They found that spore size, traditionally a key taxonomic character, was too
variable to be of any taxonomic value.
In a similar study, Rohel et al. (1997) compared RAPD patterns for 31
isolates of the Erynia neoaphidis complex. As with the E. aulicae complex,
only a single species Er. kondoiensis had been formally recognized and
described as a distinct species. Er. kondoiensis was distinguished from Er.
neoaphidis on the basis of allozymes, spore size and ecological factors
(Milner et al., 1983). Rohel et al. (1997) showed that the Er. neoaphidis
complex clearly displays size polymorphism in the internally transcribed
spacer (ITS) region. RAPD data showed that there were four major groups
within the 31 isolates studied. The majority of isolates, which were from
aphid hosts in France and other countries, were placed in group 1100, two
isolates from non-aphid hosts in Mexico were group 575, the Er. kondoiensis
isolate from Acyrthosiphon kondoi in Australia plus two other isolates from
Aphis sp. in Mexico and Acyrthosiphon pisum in Brazil constituted group
1000, and seven isolates all from aphids in France constituted group 1450.
Both groups 1000 and 1450 had smaller conidia than the (probably ‘typical’)
Er. neoaphidis group 1100, and they grew more rapidly on artificial media.
Further ecological and molecular studies are needed to determine the
differences between these groups, especially groups 1100 and 1450, both of
which occur on a range of aphid species in France. The two isolates from
non-aphid hosts are likely to constitute a distinct species.
8.3 Recent Studies on PCR of Ascomycota
A large number of species of fungi from the Ascomycota have been described
as pathogens of insects including the genera Cordyceps, Torrubiella and
Nectria. Recent molecular research has focused on the Ascosphaera spp.
which cause the disease known as chalkbrood in bees (Bissett et al., 1996). Lu
et al. (1996) found that RAPD patterns could be used to detect the infection
in leafcutter bees and to distinguish between bees infected with A. aggregata
and those infected with A. larvis. They reported that a quick ‘vortexing’
method for extracting DNA was effective for use in RAPD analysis. All the
primers except one gave clear banding patterns and these were consistent
between infected cadavers and those from pure cultures; while uninfected
insects gave quite different patterns. There were obvious differences in
banding patterns between insects infected with either species of Ascosphaera
and non-sporulating cadavers gave banding patterns similar to those from

sporulating cadavers. Lu et al. (1996) concluded that this method provides a
rapid and accurate identification of the infection in leafcutter bees and that
species-specific ITS primers would provide a more reliable way of recogniz-
ing species.
Recently five new species of Ascosphaera have been described from bee
material in Australia, using traditional taxonomic methods (Anderson and
Gibson, 1997), taking the total of known species to 25. They also compared
20 of these species using sequence analysis of the ITS1 and ITS2 regions
(Anderson et al., 1997). The methodology used was essentially that adopted
for Metarhizium by Curran et al. (1994). Sequences were found to be
remarkably uniform within species and small differences between species
were therefore considered important and diagnostic. The ITS1 region was
found to be more variable than the ITS2 region. Four distinct groups were
detected which correlate with morphological data. For example, the eight
species clustered with A. apis all have large, blackish spore cysts, with
ellipsoidal to subcylindrical ascospores that are small or of average size.
Because of the limited differences in morphology, the molecular data were
used as the primary character for separating some species, e.g. A. sub-
cuticulata from A. aggregata. Interestingly these clusters did not correlate
with the host taxonomy, though there was some evidence that the
saprophytic/parasitic life cycle correlated with these clusters. The results of
Anderson et al. (1997) also support the conclusions of Berbee and Taylor
(1992, 1995) who found, using sequence data from the nuclear 18S rDNA
gene, that Ascosphaera and Eremascus are closely related genera.
8.4 Recent Studies on PCR of Mitosporic Fungi
8.4.1 Verticillium spp.

One of the first fungi to be commercialized as a mycoinsecticide was
Verticillium lecanii for control of aphids (trade-named Vertalec) and for
whiteflies (trade-named Mycotal). Various species of insect pathogenic fungi
were synomized under the name V. lecanii by Gams (1971). Jun et al. (1991)
tested the validity of this revision using a range of morphological, physio-
logical and biochemical characters to establish the taxonomic relationships
between 64 isolates of Verticillium spp. They found that isolates of V. lecanii
clustered according to their source and suggested that further work using
enzyme patterns and DNA composition might support the case for
separating entomopathogenic, fungicolous and plant-pathogenic isolates into
distinct taxa. Typas et al. (1992) used RFLPs and found that three isolates of
V. lecanii from aphids (two species) and whitefly (one species) clustered
together and were distinct from six plant pathogenic species. Roberts et al.
(1995) used RAPDs to compare V. lecanii with plant pathogenic species V.
albo-atrum and V. dahliae and concluded that V. lecanii was highly variable
and quite distinct from the other two Verticillium species. Other workers
such as Nazir et al. (1991) have used sequence data of the ITS region to
differentiate between species and strains within plant-pathogenic members of
the genus. These data suggest that V. lecanii could be incorrectly named and
that it could be separated into a number of varieties/species which were
ecologically distinct.
Mor et al. (1996) analysed 36 isolates, mostly from insects and identified
as V. lecanii, using RAPDs. Unlike Jun et al. (1991) the isolates did not
cluster according to source, nor was there any correlation with geographical
location or virulence for the whitefly, Bemisia tabaci. They conclude ‘it
appears that virulence determinants of V. lecanii are also unrelated to
polymorphic DNA pattern as expressed by RAPDs’.
8.4.2 Paecilomyces spp.

Two species of Paecilomyces, P. farinosus and P. fumosoroseus, are important
as natural control agents of insects and are being evaluated as potential
mycoinsecticides. A third species, P. lilacinus, is used as a biological control
agent for plant parasitic nematodes in the Philippines.
Tigano-Milani et al. (1995b, 1995c) have been investigating variation
within these species using RAPDs. The first of these studies (Tigano-Milani
et al., 1995a) was concerned with P. lilacinus and compared the banding
patterns of 28 isolates identified as P. lilacinus, mainly from soil and
nematode material in Brazil, with the banding patterns of P. fumosoroseus
(two isolates), P. farinosus (three isolates) and P. amoenoroseus (one isolate).
The polyacrylamide gels showed considerable variation within P. lilacinus
and enabled a large number of bands to be scored resulting in 293 scorable
characters. Cluster analysis with P. fumosoroeus as the outgroup gave a large
number of clusters with two isolates, code-named CG301 and CG190, being
particularly divergent. The tRNA phylogenic tree gave a smaller number of
clusters based on the 112 scorable characters. Interestingly, one isolate of P.
farinosus clustered in the middle of the P. lilacinus isolates while CG190 was
clustered with an isolate of P. amoenoroseus and one of P. farinosus. It was
concluded that P. farinosus was not monophyletic. However apparently no
attempt was made to determine whether or not CG190, isolated from the
soil, was pathogenic for insects. While these results clearly indicate a high
degree of variability within P. lilacinus and suggest that polyacrylamide gels
are potentially useful for genetic fingerprinting of strains, the phylogenetic
conclusions are open to question. Do the tRNA genes have adequate
information content to allow the drawing of phylogenetic conclusions? Were
the closely related strains of P. fumoroseus suitable as outgroups?
Identical methods were applied by Tigano-Milani et al. (1995b) to study
27 P. fumosoroeus isolates, of which 15 came from B. tabaci, in comparison
with one strain of P. lilacinus and nine strains of Paecilomyces not assigned
to species. As with P. lilacinus, the RAPD patterns revealed a high degree of

genetic divergence between strains. Cluster analysis placed the P. fumosor-
oseus isolates into three groups. Group 1 isolates were morphologically
similar and resembled the typical P. fumosoroeus, and group 2 isolates were
more polymorphic and this group contained most of the B. tabaci isolates.
Group 1 included isolate CG170 derived from the PFR-97 pilot product
being produced by ECO-tek in the USA. The group 3 isolates were highly
divergent from what can be regarded as normal. This is similar to the
situation in Metarhzium where it is also a species aggregate (see case study
below). The phylogenetic analysis based on the tRNA primers did not clarify
the situation because group 1 and group 2 isolates often clustered together,
again suggesting that the data may be unsuitable for this type of analysis.
8.4.3 Beauveria spp.

Agostino Bassi is credited with being the first scientist to demonstrate that
a disease was caused by a microorganism, when in 1835 he infected
silkworms with Beauveria bassiana. Since that time, members of the genus
Beauveria have been intensively studied all over the world. A diverse range
of isolates sharing the essential features of Beauveria have been described and
some six species are generally recognized at present: B. bassiana, B.
brongniartii, B. amorpha, B. vermiconia, B. velata and B. caledonica (Glare
and Inwood, 1997). Distinguishing features of Beauveria include con-
idiophores which produce one-celled conidia in whorls or dense clusters of
sympodial, short or globose or flask-shaped conidial cells with apical
denticulate rachi. Generally, isolates are insect pathogens which produce
cadavers covered in white mycelium and conidia sometimes forming
pronounced coremia. B. calendonica, described from moorland soil in
Scotland (Bissett and Widden, 1988), is the only species not known to be
pathogenic to insects and may be entirely saprophytic.
Prior to the development of PCR, Rakotonirainy et al. (1991) sequenced
a 500 bp segment of the 28S RNA gene of nine isolates of B. bassiana and
compared them with Fusarium and Tolypocladium. The data confirmed that
these Tolypocladia should not be synomized with Beauveria. Kosir et al.
(1991) used RFLP banding patterns to differentiate two isolates of B.
bassiana, one a virulent isolate and the other a derived mutant of much lower
virulence. Pfeifer et al. (1993) analysed a mitochondrial gene of B. bassiana
isolate GK2016 using restriction enzymes, gene probe hybridization and
DNA sequence comparisons. They found the mtDNA to be circular and
28.5 kbp in length. By using probes from other organisms, they were able to
produce a restriction enzyme map. They were unable to find any introns and
concluded that the sequence was more similar to that of Aspergillus nidulans
than to two other species, Podospora anserina and Neurospora crassa.
The first application of PCR was by Bidochka et al. (1993) who
compared RAPD patterns of 24 isolates of Metarhizium and Beauveria from
grasshoppers. Using three primers and analysing the data by means of the
method of Nei and Li (1979), they found considerable variability within M.
anisopliae but 12 ‘acridid’ isolates clustered together and showed much less
variability. These were referred to as M. flavoviride because they included
ARSEF 2023, an isolate described as M. flavoviride var. minus by Rombach
et al. (1986) (see below). Isolates of the two Metarhizium species were found
to be more similar to each other than to B. bassiana. This study clearly
showed the potential of RAPDs for identifying species and strains of
entomopathogenic fungi.
Contrasting approaches to using RAPDs for studying variation within
Beauveria are shown in recent papers: Maurer et al. (1997) have confirmed
the existence of host-dependent clusters while Glare and Inwood (1997) have
found evidence of a distinct New Zealand group of B. bassiana isolates. The
36 isolates studied by Maurer et al. (1997) were all classified as B. bassiana
on the basis of conidial morphology and were derived from pyralids (mostly
the European corn borer, Ostrinia nubilalis), curculionids (mostly Sitona
spp.) and four isolates from chrysomelids. Isolates were from Europe, Latin
America, South America and Africa. RAPD and RFLP analyses were used
and the isolates were bioassayed against European corn borer and the weevil
S. lineatus. The results for the European corn borer isolates were particularly
convincing. Twelve of the 13 most virulent isolates originated from this
insect, and when analysed they clustered together with the one exception:
isolate Bb231 from Sitona, which clustered closer to the corn borer isolates
and was only slightly pathogenic for S. lineatus. The curculionid isolates
were more variable but also tended to cluster together. This study shows that
genetic fingerprinting, using RAPDs or a similar method, can be a powerful
tool for screening isolates to detect those highly virulent for a particular pest.
Maurer et al. (1997) also compare two dendograms produced for the RAPD
and RFLP data using an unweighted pair-group algorithm and found that
these dendograms showed a remarkable degree of congruity. However, the
authors correctly point out problems of using a hierarchical method for
placing isolates in groups with implied relatedness.
The difficulties posed by identifying isolates of Beauveria based on
morphological characters led Glare and Inwood (1997) to use molecular tools
to compare isolates from New Zealand with those from other countries.
They compared 26 isolates, most of which were classified as B. bassiana or
B. brongniartii, on the basis of conidial morphology. Other isolates studied
were single isolates of B. amorpha, B. caledonica and B. velata of the ARSEF
collection, one isolate with curved conidia from Chile referred to as B.
vermiconia and an isolate of Akanthomyces sp. from Australia which was
used as an outgroup in the analysis. DNA was extracted and analysed by
RAPDs and by RFLPs of the ITS region. Neither RAPD patterns nor RFLP
banding from the ITS region separated out B. bassiana and B. brongniartii.
The RAPD analysis provided many more differences in scorable bands and
using these data three clusters were apparent: B. bassiana from New Zealand
and other countries plus two overseas B. brongniartii, a second cluster

containing only New Zealand isolates of B. bassiana, and a final cluster
containing only B. brongniartii from New Zealand and other countries. The
other four species clustered together with the Akanthomyces sp. outgroup.
However, as discussed by Maurer et al. (1997), it is difficult to draw
phylogenetic conclusions from this type of analysis. The RFLP patterns gave
less variation but supported the conclusion that there was a ‘New Zealand’
genotype of B. bassiana which clustered with B. amorpha, B. caledonica and
B. vermiconia. The second major cluster contained all the other B. bassiana
plus B. brongniartii isolates. An interesting speculation in this paper is that
the two genetically distinct groups of B. bassiana found in New Zealand
represent an indigenous (‘New Zealand’) form and a post-European settle-
ment group. It is also interesting that B. brongniartii might have been
successfully introduced from France in the 1890s.
Hegedus and Khachatourians (1993) used the restriction enzyme Sau 3A
to generate a number of small randomized DNA fragments and then used
dot-blots to test the specificity of these fragments for B. bassiana. Several
fragments, ranging in size from 1180 to 2700 bp were found to hybridize to
DNA from B. bassiana but not B. brongniatii, B. caledonica, B. densa, M.
anisopliae, and several other species of entomopathogenic and non-
entomopathogenic fungi. These results were extended in a later paper
(Hegedus and Khachatourians, 1996) in which the use of combinations of
three primers (P1, P3 and P5) as species-specific probes was described. The
PCR products derived from the P1–P3 primer set were then studied using
single-strand conformation analysis. This enabled identification of a specific
strain of B. bassiana.
Polymorphism of the ITS region as detected using RFLPs was also used
by Neuvéglise et al. (1994) to compare isolates of B. brongniartii from
Haplochelus marginalis. This study, while confirming the high degreee of
variability within the ITS region of B. brongniartii, found a remarkable
degree of congruence with isolates from H. marginalis having similar RFLP
patterns and being the only isolates to be virulent for this scarab host. An
unrooted tree computed by the PAUP program (Swofford, 1993) shows that
this group of B. brongniartii from H. marginalis forms a distinct cluster,
closely related to other B. brongniartii, but more distantly related from
clusters containing isolates of B. brongniartii from Melolontha melolontha
and isolates of B. bassiana. A complete sequence for the ITS and 5.8S RNA
coding gene for two isolates of B. bassiana has recently been published by
Shih et al. (1995).
The first report of a group 1 intron in an entomopathogenic fungus was
by Neuvéglise and Brygoo (1994) when they found three insertion elements
each 350–450 bp in the 28S ribosomal RNA gene of B. brongniartii. In a
further study of 37 isolates of B. brongniartii, two isolates of B. bassiana and
one isolate of Metarhizium anisopliae, Neuvéglise et al. (1997) reported 14
variant forms of introns in four different positions. Isolates from H.
marginalis all showed one of three patterns, another pattern was unique to
isolates from M. melolontha and eight further patterns were from isolates
from other hosts including the M. anisopliae isolate and the two B. bassiana
isolates. Interestingly with plant parasitic fungi, similar introns have been
found in the host and the fungus (Nishida and Sugiyama, 1995) suggesting
that there may have been intron transfer during evolution from host to
pathogen in the Haplochelus–B. brongniartii model.
Another promising method for genetic fingerprinting of strains is the use
of teleomeric polymorphisms (Viaud et al., 1996). The teleometric sequence
was cloned from another fungus, Botrytis cinerea and used to analyse nine
isolates of B. bassiana. RFLP banding patterns of the amplified DNA
showed that most French isolates from the European corn borer were similar,
and those from other insects gave distinct fingerprints. Glare has confirmed
that teleomeric fingerprinting is a useful tool for comparing isolates of
Beauveria spp (T.R. Glare, Christchurch, 1997, personal communication).
Viaud et al. (1996) found that chromosome number varied between seven and
eight among these isolates and that there were significant chromosomal
length polymorphisms within B. bassiana.
In conclusion, recent PCR studies have shown:
1. That there is considerable genetic diversity within the two main species,
B. bassiana and B. brongniartii and that various methods such as RAPD
(Bidochka et al., 1993; Glare and Inwood, 1997; Maurer et al., 1997),
teleomeric fingerprinting (Viande et al., 1996) and RFLPs (Neuvéglise et al.,
1994; Glare and Inwood, 1997) are useful for distinguishing between
isolates;
2. That the morphological characters are unreliable (St Leger et al., 1992a)
and in particular the distinction between B. bassiana and B. brongniartii is
not supported. However, it could be that a distinction should be made
between ‘true’ B. brongniatii from strains of B. bassiana which tended to
form more cylindrical conidia (T.R. Glare, Christchurch, 1997, personal
communication);
3. That phylogenetic relationships are most reliably determined by RFLP
studies using the ITS region (Neuvéglise et al., 1994; Glare and Inwood,
1997). However, this work now needs to be extended to sequence data from
this region. Limited results to date suggest that B. bassiana and B.
brongniartii are closely related and that four other species are distinct but
correctly placed within the Beauveria genus. B. bassiana-specific gene
probes have been developed (Hegedus and Khatchatourians, 1996) but have
not yet been tested by other workers. Another species, Microhilum onco-
perae is very closely related to B. bassiana and its taxonomic position needs
to be reassessed (Riba et al., 1994);
4. That there is no geographical clustering within the B. bassiana–B.
brongniartii complex other than suggestion of a distinct genotype of B.
bassiana found only in New Zealand (Glare and Inwood, 1997);
5. That there is evidence of co-evolved host-associated genotypes, shown

previously for isolates from coffee berry borer (Bridge et al., 1990), with the
scarabs Haplochelus marginalis (Neuvéglise et al., 1994), and Melolontha
melolontha, the Sitona weevils and the pyralid, Ostrinia nubilalis (Maurer et
al., 1997);
6. That isolates of Beauveria may contain group 1 introns which can be used
to distinguish between isolates (Neuvéglise et al., 1994, 1997).
8.5 A Case Study: Variation in Metarhizium spp.
8.5.1 Introduction
‘Green muscardine disease’ is one of the most frequently found fungal diseases
of insects and occurs worldwide. The causative agent is a Hyphomycete fungus
which produces uninuclear, haploid, phialidic conidia in chains. These conidia
are usually green and cover the cadaver, hence the ‘green muscardine’
appearance. In nature, the fungus is found only on infected insects or as
dormant conidia in the soil but, in the laboratory, it is easily grown on a wide
range of media. No sexual stage is known, however some genetic exchange is
possible by means of a parasexual cycle (Al Aidroos, 1980).
The genus Metarhizium was erected to cover all isolates of green
muscardine fungus and the first species was M. anisopliae from Russia.
It was named after its scarab host – Anisoplia austriaca (Zimmermann,
1993). Since then various new names have been erected for other strains
which differed from M. anisopliae often in minor ways such as colour
of the conidia. The currently accepted taxonomy owes much to papers
by Tulloch (1976) and Rombach et al. (1987). Three species are recognized,
distinguished by the morphology of the conidia, the conidiophores and
the growth characteristics. M. anisopliae has green, elongate and often
slightly waisted conidia produced on parallel-sided conidiophores. There
are two varieties, var. anisopliae with smaller conidia 5–7 × 2–3 µm, and
var. majus with conidia approximately twice that size (it has been suggested
that these conidia are diploids; Samuels et al., 1989). M. flavoviride is
slower-growing, lighter green in colour and has swollen conidia borne on
swollen conidiophores. Again two varieties are recognized, var. flavoviride
with larger conidia 7–9 × 4.5–5.5 µm, and var. minus with conidia 4.5–7.0
× 2–3 µm. The third species, M. album, has almost white conidia and
grows on plates on a subhymenial zone of inflated hyphal bodies. The
conidia are swollen and measure 3–6 × 1.5–2.5 µm.
Besides these three species, isolates of which are available from many
culture collections, four additional species of Metarhizium have been
described from China: M. pingshaeme Chen and Guo, M. cylindrosporae
Chen and Guo, M. guizhousense Chen and Guo (Guo et al., 1986), and M.
taii Liang and Liu, and its teleomorph Cordeyceps taii (Liang et al., 1991).
Since the publication of the Rombach et al. (1987) key, our knowledge
of diversity within Metarhizium has increased greatly due to new strains
being found and the use of biochemical and molecular techniques to provide
new taxonomic characters. Morphological studies have shown that the
distinction between M. anisopliae with cylindrical phialides and conidia and
M. flavoviride with its swollen phialides and ovoid conidia is difficult to
apply, and some isolates can display both forms depending on factors such
as cultural conditions and age of culture (Glare et al., 1996). In addition,
detailed measurements of conidia have failed to show a distinction between
these two species (T.R. Glare, Christchurch, 1997, personal communication).
Various authors have used RAPDs to establish differences between strains
from sugar cane insects (Fegan et al., 1993) from cercopids and the soil in
Brazil (Tigano-Milani et al., 1995c; Fungaro et al., 1996), from different
countries (Leal et al., 1994a), from acridid compared with other hosts (Cobb
and Clarkson, 1993; Bridge et al., 1993; Bidochka et al., 1993), and from
New Zealand (Glare et al., 1997). Similar studies by RFLPs on rDNA have
also shown high levels of diversity between isolates (Pipe et al., 1995). Using
allozymes combined with a number of other characters, St Leger et al.
(1992b) detected ‘cryptic’ species within M. anisopliae. Rath et al. (1995)
using germination temperature profiles (McCammon and Rath, 1994) and
carbohydrate utilization patterns described a new cold-temperature variety,
M. anisopliae var. frigidum. A powerful method for identifying strains,
useful for direct determination in infected insects, is the use of primers
which detect polymorphisms in the Pr1 gene and RFLP to produce scorable
bands (Leal et al., 1996). Recently Bailey et al. (1996) have described
introns in the large subunit of nuclear ribosomal RNA genes from
M. anisopliae.
The present case study aims to extend that of Curran et al. (1994) to help
resolve some of the problems with the current taxonomy of Metarhizium.
These problems include:
1. Should the three specific names, M. anisopliae, M. flavoviride and M.

album be retained and if so, how are they to be defined given that the
morphological basis has been shown to be invalid? A radical solution,
already proposed, is that M. flavoviride and M. album should be synomized
with M. anisopliae which would then be subdivided into a number of
varieties (Milner et al., 1994);
2. What is the correct name for the genetically distinct group of isolates from
acridid hosts now known as M. flavoviride group 3 (Bridge et al., 1997)? The
first of these isolates (ARSEF 2023) was isolated from an acridid in the
Galapagos Islands and described primarily on the basis of conidial morphol-
ogy as M. flavoviride var. minus (Rombach et al., 1986). Another isolate
(ARSEF 324) was isolated from Austracris guttulosa from Australia and
named M. anisopliae (St Leger et al., 1992b), again on the basis of conidial
morphology. It has since been shown to be almost identical genetically to
ARSEF 2023 and a number of other so-called acridid isolates from many
countries in Africa, as well as Madagascar, Brazil and Australia (Bidochka et
al., 1994). Bidochka et al. (1994) revised their opinion of ARSEF 324, and on
the basis of PCR-amplified banding patterns described it as M. flavoviride.
These isolates are all very similar when studied using RAPDs, isozymes and
protease production, yet are quite distinct from isolates of M. flavoviride
from the soil or from leafhoppers in the Philippines and the Solomon Islands
(Bridge et al., 1997);
3. What is the taxonomic validity of M. anisopliae var. frigidum (Rath et al.,
1995)?
4. Another group of isolates, like the acridid group, which are genetically
distinct from all others studied have been identified from New Zealand
(Curran et al., 1994; Rakotonirany et al., 1994; Glare et al., 1997). What is the
correct taxonomic placement for these isolates?
Therefore in this study, we attempt to redefine the phylogenetic, and by
inference, the taxonomic relationships of the major morphological species
clusters in Metarhizium. We correlated RAPD banding patterns with
sequence data from the ITS and 5.8S rDNA. Here we report on phylogenetic
estimates made by parsimony and distance using the ITS and the 5.8S region
of the rDNA. The following is a summary of this work which is published
in detail elsewhere (Driver et al., 1998).
8.5.2 Methods
Isolates
The 26 representative isolates used in this study are given in Table 8.1.
Another 95 isolates have also been sequenced but did not provide significant
additional data. The isolates were chosen either because they are the subject
of on-going CSIRO research to develop a range of mycoinsecticides based on
Metarhizium spp. (Milner and Jenkins, 1996), or because they are important
(such as isolates derived from type material) for a comprehensive under-
standing of genetic diversity within Metarhizium spp.
ITS amplification and sequencing

PCR (Saiki et al., 1988) was used to amplify the region of the ribosomal
repeat from the 3′ end of the 16S rDNA to the 5′ end of the 28S rDNA,
spanning the ITS1, the 5.8S rDNA and the ITS2. Primer sequences and
reaction conditions were those described by Curran et al. (1994). Sequencing
reactions were done using the Prism Ready Reaction DyeDeoxy Terminator
Cycle Sequencing mix from Applied Biosystems Inc. (ABI) Australia.
RAPD amplifications and analysis

The presence or absence of RAPD band patterns was scored visually in
order to correlate any relationships with ITS sequence data without any
attempt to produce an hierarchic arrangement of clusters. RAPD groups
Table 8.1. List of representative isolates used for case study on Metarhizium.
Other Geographical
Clade Morphological species FI number designation Host origin Reference
1 M. album FI-MaF ARSEF 1941 Nephotetti viresens (Homoptera) Philippines Rombach et al. (1997)
M. album FI-1165 ARSEF 1942 Nephotetti viresens (Homoptera) Philippines Rombach et al. (1997)
2 M. flavoviride var. minus FI-1173 ARSEF 2948 Unknown (Homoptera) Brazil Humber (1992)
M. anisopliae var. anisopliae FI-152 Lepidiota consobrina (Coleoptera) Australia
3 M. anisopliae var. anisopliae FI-698 F10 Unknown (Lepidoptera) New Zealand Glare et al. (in press)
M. anisopliae ‘var. frigidum’ FI-1124 DAT-F220 Soil Australia Rath et al. (1995)
M. anisopliae ‘var. frigidum’ FI-1125 DAT-F368 Soil Australia Rath et al. (1995)
4 M. anisopliae var. anisopliae FI-72 IMI 177416 Pemphigus treherni (Homoptera) Britain IMI (1982)
5 M. flavoviride var. minus FI-1172 ARSEF 1764 Nilaparvata lugens (Homoptera) Philippines Rombach et al. (1986)
M. flavoviride var. minus FI-403 ARSEF 2037 Nilaparvata lugens (Homoptera) Philippines Rombach et al. (1986)
6 M. flavoviride var. flavoviride FI-1170 ARSEF 2025 Soil Germany Gams and Roszypal
(1973)
M. flavoviride var. flavoviride FI-405 ARSEF 1184 Otiorrhynchus sulcatus (Coleoptera) France Rombach et al. (1986)
M. flavoviride var. flavoviride FI-402 ARSEF 2024 Otiorrhynchus sulcatus (Coleoptera) France Rombach et al. (1986)
M. anisopliae ‘var. frigidum’ FI-38 DAT-F001 Adoryphorus couloni (Coleoptera) Australia Yip et al. (1992)
7 M. flavoviride var. minus FI-1216 ARSEF 2023 Acridid (Orthoptera) Galapagos Islands Rombach et al. (1986)
M. anisopliae var. anisopliae FI-985 ARSEF 324 Austracris guttulosa (Orthoptera) Australia St Leger et al. (1992)
M. flavoviride FI-987 IMI 330189 Ornithacris cavoisi (Orthoptera) Niger Bridge et al. (1993)
M. flavoviride FI-1028 IMI 324673 Zonocerus variegatus (Orthoptera) Tanzania Bridge et al. (1993)
8 M. anisopliae var. anisopliae FI-1042 Dermolepida albohirtum (Coleoptera) Australia
M. anisopliae var. anisopliae FI-147 Lepidiota consobrina (Coleoptera) Australia
9 M. anisopliae var. anisopliae FI-1029 IMI 168777ii Schistocerca gregaria (Orthoptera) Eritrea Tulloch (1976)
M. anisopliae var. anisopliae FI-1034 IIBC I91-614 Patanga succincta (Orthoptera) Thailand Bidochka et al. (1994)
M. anisopliae var. anisopliae FI-1099 ARSEF 445 Teleogryllus commodus (Orthoptera) Australia Bridge et al. (1̀993)
10 M. anisopliae var. majus FI-388 ARSEF 1914 Oryctes rhinoceros (Coleoptera) Philippines Humber (1992)
M. anisopliae var. majus FI-389 ARSEF 2151 Oryctes rhinoceros (Coleoptera) Indonesia Humber (1992)
* Beauveria bassiana FI-297 Soil Australia
* Paecilomyces sp. FI-360 Inopus rubriceps (Diptera) Australia
* Paecilomyces sp. FI-442 Inopus rubriceps (Diptera) Australia
*Outgroups.
were assigned on the basis of perfectly identical, or nearly identical, banding

patterns (Fig. 8.1).
Analysis of rDNA sequences

Sequences for complementary strands were checked and the resulting
sequences aligned using CLUSTAL W (T. Gibson, D. Higgins, J. Thompson,
EMBL, Heidelberg, Germany, May 1994) at default settings. The alignment
was checked visually and minor adjustments made manually. The alignment
Fig. 8.1. RAPD–PCR banding patterns using two primers, OP-H01 and OP-F06. Panels A
and B, lanes 1–17: 100 bp ladder; FI-1216 (ARSEF 2023, clade 7); FI-152, 1173 (clade 2);
FI-403, 1172 (clade 5); FI-405, 402, 1170, 38 (clade 4); Fi-72, 1101 (clade 6); FI-698,
699, 702, 1125, 1126 (clade 2); and panel B only FI-1165 (M. album, clade 1). Panels B
and C illustrate the genetic homogeneity of acridid strains (clade 7), lanes 1–15: 100 bp
ladder; FI-1216 (Galapagos Islands); FI-1189, 1190, 1191, 1192, 1193 (Brazil); FI-1067,
983, 984, 986 (Benin); FI-987 (Niger); FI-1028 (Tanzania); and FI-985 (ARSEF 324), 1155
(Australia).
was translated into #NEXUS format for analysis using PAUP4d52-53 (beta
test version of PAUP; Swofford, 1997).
The partition homogeneity test (Farris et al., 1995) as implemented in
PAUP indicated no incongruence amongst the ITS1, 5.8S and ITS2 regions of
the molecule. Subsequently the regions were analysed separately and
together, but final phylogenetic results are based on the combined data. The
ITS1 region (positions 14–219 in the file) contained 71 parsimony informa-
tive positions, the 5.8S region (positions 220–377) contained seven, and the
ITS2 region (positions 378–604) contained 80. With alignment gaps treated
as missing data and with no differential weighting of transversions against
transitions, parsimony analysis of either the whole data set or the ITS1 region
identified in excess of 40,000 most parsimonious (mp) trees, apparently on a
single TBR-branch-swapper defined island. Separate analysis of the ITS2
region produced a lesser number of mp trees, the strict consensus of which
was consistent with the strict consensus of the ITS1 or whole data set trees
(Fig. 8.2). Some branches are supported by several synapomorphic changes.
The large number of trees results from the lack of informative character state
changes within certain clades (primarily single point deletions in a number of
M. anisopliae isolates).
8.5.3 Results
The RAPD–PCR banding patterns showed a high level of diversity even within
some clades, for example clade 9 which contains a very large number of isolates
normally classified as M. anisopliae var. anisopliae. Small changes in ITS
sequence, e.g. single point mutations or deletions with respect to the type-
strain of M. anisopliae var. anisopliae, are often accompanied by dramatically
different RAPD patterns with most primers. Low levels of sequence diver-
gence in most other clades of isolates, including var. majus and the acridid
isolates, were mirrored by much smaller levels of polymorphism in their
RAPD banding patterns (Fig. 8.1, panels A, B, C and D).
The size of the ITS1, 5.8S and ITS2 PCR product (excluding primer
sequences) varied from 506 bp for FI-1029, the type material of M. anisopliae
var. anisopliae, to 573–4 bp for the two isolates of M. album. The size of this
region is comparable to that reported for other entomopathogenic fungi
(Neuvéglise et al., 1994; Anderson et al., 1997). Size polymorphisms for this
region which could be detected on agarose gels, were most evident between
isolates from var. anisopliae, var. majus and B-type strains of Metarhizium,
clades 8, 9 and 10 which ranged from 505 to 510 bp, compared with all other
material examined, including the acridid isolates. These larger ITS fragments,
542–544 bp in acridid isolates, 530–551 bp for all varieties of M. flavoviride,
545–546 bp for New Zealand isolates and 552–558 bp for the two isolates
from clade 2 in the phylogenetic tree, generally arose from longer, more
variable sequences in the ITS1. Interisolate variation was very low in all
recognized varieties of Metarhizium, and newly identified clusters with most
FI-297 Beauveria bassiana

100 FI-360
Paecilomyces sp.
FI-442
CLADE 1
FI-1165 M. album
100 CLADE 2 FI-152
FI-1173 M. flavoviride var. nov.
FI-1025
99
CLADE 3 M. flavoviride var. nov.
FI-1026
FI-698
CLADE 4
FI-72
***
90
CLADE 5 FI-1172 M. flavoviride var. minus
55 100 FI-403
FI-38
82 FI-402
CLADE 6 95 M. flavoviride var. flavoviride
FI-405
FI-1170
FI-1216
CLADE 7 100
FI-985 M. anisopliae var. nov.
FI-1028
***
98
CLADE 8 95
FI-147
FI-1042 M. anisopliae var. nov.
FI-379
98
FI-1029
FI-550
FI-330
80 FI-1027
CLADE 9 FI-163
FI-203 M. anisopliae var. anisopliae
FI-23
60 FI-328
FI-358
65 FI-114
FI-208
80 FI-1034
FI-1114
FI-700
65 FI-1031
FI-1056
90
FI-388
FI-389 M. anisopliae var. majus
CLADE 10
Fig. 8.2. Phylogeny of Metarhizium spp.: strict consensus of a maximum parsimony

analysis. The numbers at branches are the bootstrap values (100 replicates), and ***
indicates a T-PTP value of 0.01. Isolate designations are given in Table 8.1.
isolates exhibiting only single point mutations, or small insertions or

deletions, which were generally confined to ‘hot spots’ of variation.
The strict consensus tree of length 394 steps from the whole data set,
original alignment, with uncorrected distances, is shown as Fig. 8.2.
Bootstrap tests (Felsenstein, 1985) were used to quantify the support for
nodes in the consensus of mp trees. Taxon groups distinguished only by
parsimony-uninformative state changes (i.e. isolates differing by only single
point deletions) were combined into single nodes. Bootstrap analysis was
based on 100 bootstrap replicates each with ten random-addition-sequence
starting trees and keeping no more than 50 trees at each replicate, to sample
the range of parsimonious trees for each resampling of the data matrix.
Bootstrap proportions > 50% are shown in Fig. 8.2 where the monopoly of
clades 7–10 (M. anisopliae) is supported.
Topologically constrained permutation tail probability (T-PTP) tests
(Faith, 1991) under both equal-weighting and 2:1 transversion:transition
weighting confirmed the apparent monopoly of the M. anisopliae clades and
clades 4 and 5 (M. flavoviride). These clusters are not due to chance alone
(PTP = 0.01). The acridoid isolates, FI-985, FI-986 and FI-1028, appear as a
clade 7 closely related to clades 9 and 10 which are typical M. anisopliae at
bootstrap support > 95%, rendering M. flavoviride paraphyletic. T-PTP was
used to test this clustering against a conflicting hypothesis that the acridid
isolates should cluster within a monophyletic clade of M. flavoviride. For
this test, the M. anisopliae clades were reduced to their basal node and the
group M. anisopliae + clade 7 isolates subjected to T-PTP tests both for
monophyly and non-monophyly. A prior hypothesis of monophyly could
not be falsified (PTP = 0.01). A prior hypothesis of non-monophyly could
be falsified (PTP = 1.00). The data are sufficient to accept the former
hypothesis and reject the latter.
Clade 6 includes isolate FI-38 which is now a commercial product
in Australia (BioGreen) under the name M. anisopliae, clusters within
M. flavoviride var. flavoviride on all mp trees. That placement is supported
by bootstrap values > 80% on the intervening branches. To confirm the
prior hypothesis, a placement within the M. anisopliae clade could be
falsified on these data, and T-PTPs for monophyly of clade 4 + M.
anisopliae isolates were conducted. A prior hypothesis of monophyly could
be falsified (PTP = 1.00). A prior hypothesis of non-monophyly could
not be falsified (PTP = 0.01). These tests confirm placement of FI-38 within
clade 6 (M. flavoviride).
The ITS region has been used extensively for fungal taxonomy (reviewed
by Seifert et al., 1995), and it is very useful for identifying species clusters,
as well as differentiating strains that are ecologically distinct (Nazir et al.,
1991). Sequence data from this region (Driver et al., 1998), have provided a
sound framework for a taxonomic revision of the three accepted species of
Metarhizium, despite the lack of resolution in the base of the tree. Processes
such as gene conversion may result in the loss of clear patterns of descent in
distant relationships, and reticulation and not synapomorphies arise in the

comparisons of sequences (Brower and DeSalle, 1994). The results show that
the worldwide genetic diversity, as presently known, can be circumscribed
by ten clades. In most cases these clades correspond to either morpho-
logically recognized varieties, or clusters of isolates which have been
identified by other molecular or biochemical markers. It is likely that most
new isolates found in the future will be unequivocally placed in one of these
clades. However the taxonomy is flexible and new clades may be added if the
sequence data justify creation of additional clades. A key question is what
level of nucleotide divergence should be attributed to define taxonomic rank
at species and varietal levels? Nucleotide divergence for the ITS region
between morphologically defined species in Metarhizium ranges between 14
and 18%, whilst divergence between recognized varieties within species does
not exceed 5%. Levels of nucleotide divergence for clusters of isolates from
acridoid hosts in New Zealand blur the margins between species and varietal
limits. Paired clusters of isolates of clade 7/anisopliae, clade 7/flavoviride and
clade 7/album show levels of nucleotide divergence of 9.4%, 17.2% and
16.5% respectively, whilst paired clusters of isolates from clade 3/anisopliae,
clade 3/flavoviride, and clade 3/album are in the range 11.3%, 6.9% and
9.1% respectively. Cladistics requires that species represent monophyletic
groups (Wiley et al., 1991) but there are no guidelines on taxonomic ranking
(Seifert et al., 1995).
As far as possible, it is proposed that existing species names be retained
and any new names proposed will be at the variety level. Therefore the name
M. album is retained and is now defined as applying only to isolates which
fit into clade 1. At present we consider clades 2–6 to contain varieties of M.
flavoviride while clades 7–10 contain varieties of M. anisopliae. Where
appropriate, new varietal names have been proposed for some of these clades
(Driver et al., 1998). However for some clades, we have too few isolates and
therefore too little data, on genetic diversity within the clade, to justify a
varietal name at this time. It is likely that as our knowledge of these clades
increases, especially with regard to ecological factors such as host special-
ization, the taxonomy will become clearer, leading to some clades being
elevated to new species.
8.6 Descriptions of the Clades
Most taxonomic decisions are implicitly based on the biological species

concept of actually or potentially interbreeding populations that are repro-
ductively isolated, a view that has been widely accepted by mycologists
(Seifert et al., 1995). It has been suggested that anamorphic species not be
considered as species at all, and that the term be reserved for organisms that
undergo meiosis (Perkins, 1991). In practice, morphologically defined
species infer the potential to interbreed (Volger and Desalle, 1994). Such
biological species concepts of actual or inferred breeding populations to

delimit taxa are not directly applicable to Metarhizium. The molecular data
give qualified support for the existing morphological-based taxonomy, if we
accept that species represent monophyletic groups. The combination of
molecular, biochemical and morphological markers make a case for phyloge-
netically defined species or ‘evolutionary significant’ groups (Volger and
Desalle, 1994).
Clade 1 – Metarhizium album

The only isolates identified as belonging to this clade were isolates ARSEF
1941 and ARSEF 1942, both of which were described by Rombach et al.
(1987) from infected leafhoppers in the Philippines. Besides the apparent host
specificity of this clade, other characters are the small ovoid to ellipsoid
conidia measuring 4–6 × 1.5–2.5 µm, the growth of a bulging mass of hyphal
bodies rather than mycelium prior to sporulation and the lack of laterally
adhering conidia forming prismatic columns. The pale brown colour of the
spores is also characteristic although this is of doubtful taxonomic sig-
nificance.
Clade 2 – Metarhizium flavoviride

This is an unusual clade containing just two rather diverse isolates. The first,
FI-1173 (ARSEF 2948) on an homopteran from Brazil was identified as M.
flavoviride var. minus by Humber (1992), however all the other isolates of
this variety from leafhoppers and related insects in the Philippines and
Solomon Islands (Rombach et al., 1986) are clustered in clade 5.
Morphologically these isolates are all very similar and come from similar
hosts, thus it is surprising that one of the isolates should be genetically so
distinct. Even more surprising is that FI-152, isolated from a scarab in
Australia, and morphologically resembling M. anisopliae var. anisopliae,
should also cluster into this clade. FI-152 and FI-1173 show RAPD–PCR
patterns which clearly distinguish them from other isolates of M. flavoviride
var. minus. More work is needed to clarify this clade and to determine if
there are ecological and/or morphological characteristics which are shared
by these isolates, and to collect other isolates from nature which might fit
into this clade.

This clade contains quite a large number of isolates, many from New
Zealand, which have been recognized as distinct by several workers (Riba et
al., 1990; Curran et al., 1994; Glare et al., 1997). Our study has shown that
isolates from this clade also occur in Australia (described as Strain 2 by Yip
et al., 1992) and that they have been included as part of a group of low-
temperature isolates called M. anisopliae var. frigidum by Rath et al. (1995).
These authors recognized that some isolates were as distinct from M.
anisopliae var. anisopliae as they were from M. flavoviride and that they may
represent a new species. Morphologically, isolates from this clade have

cylindrical conidia and correspond to the short-spored form of M. anisopliae
described from New Zealand (Glare et al., 1997). All isolates in this clade
grow well at low temperatures (10°C and below), infect soil insects or have
been isolated from the soil and attack soil insects (both scarab larvae and
lepidopterous caterpillars).

This is another small clade containing just two isolates with identical
collection data except the date. Both isolates were from infected root aphids
in Norfolk, UK (Foster, 1975), and they have cylindrical green conidia
morphologically resembling M. anisopliae var. anisopliae. However they
grow well at low temperatures and cluster with M. flavoviride; consequently,
we regard that as the correct specific name. More isolates representing this
clade are needed before it can be formally given a varietal name and it is
possible that a search for Metarhizium infection on other root aphids may
reveal additional isolates.
Clade 5 – Metarhizium flavoviride var. minus

In our study only two isolates FI-403 and FI-1172 (ARSEF 2037 and ARSEF
1764), both morphologically identified as Metarhizium flavoviride var.
minus and obtained from infected leafhoppers, were included within this
clade. One of these, FI-403 (ARSEF 2037) was identified by Rombach et al.
(1985) as the type-isolate of this variety. These isolates fit the description
given by Rombach and were collected in the Philippines and the Solomon
Islands suggesting a narrow host range and geographical distribution.
Clade 6 – Metarhizium flavoviride var. flavoviride

This clade contains FI-405 (ARSEF 2025) which was derived from the
material used by Gams and Roszypal (1973) for their original description of
M. flavoviride. It also contains other isolates described by Rombach et al.
(1986) as M. flavoviride var. flavoviride. These isolates have large, somewhat
swollen conidia which form a pale green conidial mat in culture and come
from the soil or from soil-inhabiting beetles. All these isolates grow well at
low temperatures. Rath et al. (1995) included FI-38 in M. anisopliae var.
frigidum and this isolate, along with a number of other soil-derived isolates,
has an ITS sequence similar to FI-405 (ARSEF 2025), unequivocally
identifying these isolates as M. flavoviride var. flavoviride. RAPD–PCR
banding patterns show a high degree of homogeneity and conservation with
the northern European isolates suggesting that this clade probably has a very
wide geographical distribution. Rath et al. (1995) provide a nearest-
neighbour dendogram based on their carbohydrate data which showed that
FI-38 (DAT F001) clustered nearer to M. flavoviride than to M. anisopliae.
Our data support this finding and it is therefore proposed that the correct
identity of this isolate is M. flavoviride var. flavoviride.
Clade 7 – Metarhizium anisopliae

This clade contains all of the acridoid isolates described as ‘M. flavoviride
group 3’ (Bridge et al., 1997). Our data supports and extends that of Bridge
et al. (1993), Cobb and Clarkson (1993), Bidochka et al. (1993) and Bridge
et al. (1997), in showing that these isolates are genetically quite uniform and
are quite distinct from the type material of both accepted varieties of M.
flavoviride. Bootstrapping and T-PTP tests give strong support for the
phylogenetic signal that unites these isolates to the major evolutionary line
that gives rise to M. anisopliae rather than M. flavoviride. Therefore, we
propose that the correct identity is as a new variety of M. anisopliae which
will be described elsewhere (F. Driver, unpublished work).
The isolates in this clade have all been isolated from acridid grass-
hoppers. Interestingly other orthopteran hosts such as crickets are not
susceptible and in nature are attacked (exclusively) by isolates from clade 9.
In our experience, grasshoppers are more often infected in nature by isolates
from clade 9 but these isolates are less virulent than the rarer clade 7 isolates
(Bateman et al., 1996).
Most isolates from clade 7 produce small ovoid conidia which would
identify them as M. flavoviride var. minus. For example, FI-1216 (ARSEF
2023) from the Galapagos Islands described under that name by Rombach et
al. (1985). Other isolates, though, have larger spores which can be almost
cylindrical (FI-985, ARSEF 324). All isolates share some unusual character-
istics such as the ability to sporulate internally and to grow well at
temperatures up to 40°C (Welling et al., 1994).
Clade 8 – Metarhizium anisopliae

This is another clade with only a small number of known isolates. All known
isolates have cylindrical spores and produce a profuse layer of green conidia
in culture, and have been isolated from scarab larvae in Queensland,
Australia. Using allozyme data St Leger et al. (1992b) were able to show
considerable inter-isolate variation and the existence of cryptic ‘species’ or,
probably more correctly, cryptic varieties within M. anisopliae. This cluster
of isolates has previously been described as B-type isolates of M. anisopliae
(Curran et al., 1994), and probably correspond to those of pathogenicity
group 1 for Lepidiota spp; or RAPD group A, described by Fegan et al.
(1993). More needs to be known about this clade; however, the sequence data
clearly separates it from clades 7 and 9.
Clade 9 – Metarhizium anisopliae var. anisopliae

The type material of Metarhizium anisopliae var. anisopliae as described
by Tulloch (1976) is FI-1029 (IMI168777ii) and this isolate therefore forms
the basis for this clade. This clade includes the vast majority of isolates
found in nature and is genetically highly diverse. St Leger et al. (1992b)
demonstrated the existence of clonal population structures in M. anisopliae.
Distinct groups can be identified within the clade: for example, a number
of isolates from the black field cricket, Teleogryllus commodus, in Australia,

share identical ITS sequence data and have very similar RAPD patterns
(Milner et al., 1996). Isolates generally have cylindrical conidia, 5–7 µm
long which form green conidia in columns of chains. They normally grow
poorly outside the range 15–32°C, although recently two cold temperature
active isolates have been found in soil samples taken at MacQuarie Island
(Roddam and Rath, 1997), confirming that cold activity is a homoplasious
character.
Clade 10 – Metarhizium anisopliae var. majus

A typical isolate from this clade is FI-401 (ARSEF 1946) which conforms to
the description by Tulloch (1976). Isolates are readily identified on the basis
of the very large conidia, usually over 10 µm long, and rapidly growing
colonies producing dark green conidia; they are most frequently found
attacking dynastine beetles in tropical countries. Our results support those
of other workers (St Leger et al., 1992b; Leal et al., 1994b) showing that
genetically this clade differs less from M. anisopliae var. anisopliae isolates in
clade 9 than do other isolates such as those in clade 8 (B-type), which are also
currently described as var. anisopliae.
8.7 Discussion
Morphological characters are generally complex and may involve the

expression of many genes. Traditional fungal systematics assesses the
phenotype for reliable characters that should result in the recognition of
homologous features with alternate character states that may be evaluated
cladistically (Brower and Desalle, 1994; Seifert et al., 1995). The skill of the
researcher resides in the ability to ‘assign characters successfully to the
appropriate level of analysis’ (Brower and Desalle, 1994). The reproducibility
and impartiality of sequence-based systematics has made an important
contribution to fungal taxonomy. Although species concepts based solely on
a single gene region have been considered insufficient and too trivial to be
representative of all characters (Seifert et al., 1995), gene regions such as the
ITS are being heavily relied upon to discriminate and define new species in
such genera as Ascosphera (Anderson and Gibson, 1997), and the edible
shiitake mushroom Lentinula (Hibbert et al., 1995), as well as phytopatho-
genic fungi such as Colletotrichum (Sherriff et al., 1994). 18S ribosomal DNA
sequence data have been used to estimate ascomycete relationships, and
phylogenetic trees from such data sets are highly resolved, and generally
consistent with morphological evolutionary events like forcible spore
discharge (Berbee and Taylor, 1995). Lutzoni and Vilgalys (1995) integrated
molecular and morphological data sets to estimate fungal phylogenies in
lichenized and non-lichenized Omphalina species. Homogeneity testing of
the 28S large subunit ribosomal DNA sequences and the morphological
characters showed that the two data sets were sampling the same phyloge-
netic history and could be combined.
Such studies go to the heart of the matter, that is, the conflict of gene trees
and the evolution of a segment of DNA and the ‘true’ course of evolution of
the organism. Brower and Desalle (1994) consider such concerns about gene
tree versus species tree problems to be overstated, and except for recently
diverged or hybridizing taxa, ancestral polymorphism and lineage sorting
cannot result in strong support for an incongruent topology. Congruence
between cladograms derived from different gene regions or other available
characters into a total evidence approach such as described above provides
strong statistical support and circumvents the problem. The gene region of
choice is critically important in maximizing the phylogenetic signal-to-noise
ratio. Reviews by Simon et al. (1994) on the utility of mitochondrial gene
sequences, and Brower and DeSalle (1994) on using nuclear gene regions,
raise important issues about the taxonomic rank at which particular genes are
useful.
8.7.1 How can the taxonomy be made more user friendly?

A major problem with a taxonomic scheme which is dependent to a large
extent on molecular data is that it is difficult to provide easily applied
diagnostic characters for identification. While some clades will be easy to
identify others, such as clade 2, are impossible at the present time except by
molecular methods. Published molecular methods for species recognition
such as the probes devised by Bidochka et al. (1994) and Leal et al. (1994b)
cannot be applied since they did not include all available type material,
consequently there is uncertainty about the true identity of the isolates which
they used as, for example, M. flavoviride var. flavoviride. Only the Gams and
Roszypal (1973) strain, ARSEF 2025, can be regarded as M. flavoviride var.
flavoviride sensu stricto. Consequently these methods need to be reassessed
in the light of the results of our study.
While our work suggests that the most rigorous way to identify clades
is by sequence determination of the ITS regions, it has also been shown that
these correlate strongly with RAPD patterns, in the same manner that ITS-
RFLP patterns have been shown to correlate with RAPD patterns in
Beauveria (Maurer et al., 1997). It is therefore suggested that clades be
identified by using either RFLP analysis of the ITS region, or RAPD–PCR
patterns established by primers such as OP-H01 or OP-A03 which give rise
to fewer polymorphic fragments against a set of ‘standard’ isolates. It is
suggested that the first isolate listed under each clade in Table 8.1 be used as
the standards or type material. These are mostly ARSEF isolates and it is
hoped that the other isolates will be deposited prior to publication of the
taxonomic revision (Driver et al., 1998).
8.8 Conclusions and Future Work
Molecular methods involving PCR techniques are now accepted as being a

key element in research on entomogenous fungi and some information, as
summarized in this chapter, is available about most groups. However, it is
still an infant technology which means that there are still substantial gaps in
our knowledge: for example, clarification of strain variation in the Entomo-
phthora muscae complex, a common worldwide pathogen of flies, is needed
and may shed light on differences between countries in the ecology of these
pathogens. In addition, there are new techniques, and improvements to
existing techniques, which have yet to be applied to entomogenous fungi.
Taxonomic problems, such as those highlighted in the case study on
Metarhizium spp., could be further resolved by an analysis of mitochondrial
genes (as initiated by Junior and Martinez-Rossi, 1995) or nuclear protein
coding genes such as the Pr1 protease gene used by Leal et al. (1996) for strain
identification. Other techniques which have either not been applied or only
used to a limited extent include random amplified microsatellites (RAMS;
Hantula and Muller, 1997) and amplified fragment length polymorphisms
(AFLP; Majer et al., 1996). The presence of double-stranded RNA and
isometric virus-like particles in M. anisopliae was first announced by Leal et
al. (1994a) and has recently been confirmed by Bogo et al. (1996). Similar
viruses may be present also in Beauveria bassiana (Osborne and Rhodes,
1994). However, their possible significance in terms of virulence is unknown.
In fact, very little is known of virulence genes in entomogenous fungi,
though the Pr1 gene is involved in M. anisopliae (St Leger et al., 1996) and
probably similar genes occur in some other entomogenous fungi (Leal et al.,
1996). With the increased use of these fungi in pest control there will be more
attention given to virulence factors and the development of genetically
improved, hypervirulent, isolates as reported recently by St Leger et al.
(1995).
Acknowledgements
The authors would like to thank the numerous colleagues who supplied
isolates of Metarhizium spp. for their taxonomic study and especially Dr
Richard Humber (USDA, Ithaca, New York), Dr Paul Bridge (CABI
BIOSCIENCE UK Centre, Egham, UK), Dr Tigano-Milani (EMBRAPA,
Brazil), Dr Andrew Rath (BioCare Pty Ltd, Sydney, Australia), Dr Dave
Holdom (CTPM, Brisbane, Australia), and Dr Travis Glare (AgResearch,
Christchurch, New Zealand). Our work on Metarhizium has been greatly
assisted by discussions with many colleagues including Dr Chris Prior
(Royal Horticultural Society, London, UK), Drs Paul Bridge and John
Curran (CSIRO, Canberra, Australia), Dr Travis Glare (AgResearch,
Christchurch, New Zealand) and Dr Gisbert Zimmermann (Institute for
Biological Control, Darmstadt, Germany). Finally Dr John Truemann has

been invaluable in generously devoting his time and skill to analysing our
sequence data on Metarhizium spp. The research on Metarhizium has been
funded, in part, by the Rural Industries Research and Development
Corporation (RIRDC).
References
Al Aidroos, K. (1980) Demonstration of parasexual cycle in the entomopathogenic

fungus Metarhizium anisopliae. Canadian Journal of Genetics and Cytology 22,
309–314.
Anderson, D.L. and Gibson, N. (1997) New species and isolates of spore-cyst fungi
(Plectomycetes: Ascosphaerales) from Australia. Australian Systematic Botany
(in press).
Anderson, D.L., Gibbs, A.J. and Gibson, N.L. (1997) Identification and phylogeny
of spore-cyst fungi (Plectomycetes: Ascospaerales) using ribosomal DNA
sequences. Mycological Research (in press).
Andreadis, T.G. and Weseloh, R.M. (1990) Discovery of Entomophaga maimaga in
North American gypsy moth, Lymantria dispar. Proceedings of the National
Academy of Sciences, USA 87, 2461–2465.
Bailey, A.M., Kershaw, M.J., Hunt, B.A., Paterson, I.C., Charnely, A.K., Reynolds,
S.E. and Clarkson, J.M. (1996) Cloning and sequence analysis of an intron-
containing domain from a peptide synthetase-encloding gene of the entomo-
pathogenic fungus Metarhizium anisopliae. Gene 173, 195–197.
Bateman, R., Carey, M., Batt, D., Prior, C., Abraham, Y., Moore, D., Jenkins, N. and
Fenlon, J. (1996) Screening for virulent isolates of entomopathogenic fungi
against desert locust, Schistocerca gregaria (Forskal). Biocontrol Science and
Technology 6, 549–560.
Berbee, M.L. and Taylor, J.W. (1992) Two Ascomycete classes based on fruiting body
characters and ribosomal DNA sequence. Molecular Biology and Evolution 9,
278–284.
Berbee, M.L. and Taylor, J.W. (1995) From 18S ribosomal sequence data to evolution
of morphology among the fungi. Canadian Journal of Botany 73 (suppl. 1),
S677–S683.
Bidochka, M.J., McDonald, M.A., St Leger, R.A. and Roberts, D.W. (1993) Differ-
entiation of species and strains of entomopathogenic fungi by random amplified
polymorphic DNA (RAPD). Current Genetics 21, 107–113.
Bissett, J. and Widden, P. (1988) A new species of Beauveria isolated from Scottish
moorland soil. Canadian Journal of Botany 66, 361–362.
Bissett, J., Duke, G. and Goettel, M. (1996) Ascosphaera acerosa sp. nov. isolated from
alfalfa leafcutting bee, with a key to species of Ascosphaera. Mycologia 88,
797–803.
Bogo, M.R., Queiroz, M.V., Silva, D.M., Gimenez, M.P., Azevedo, J.L. and Schrank,
A. (1996) Double-stranded RNA and isometric virus-like particles in the
entomopathogenic fungus Metarhizium anisopliae. Mycological Reseach 100,
1468–1472.
Bridge, P.D., Abraham, Y.J., Cornish, M.C., Prior, C. and Moore, D. (1990) The
chemotaxonomy of Beauveria bassiana (Deuteromycetina: Hyphomycetes)

isolates from coffee berry borer Hypothenemus hampei (Coleoptera: Scolytidae).
Mycopathologia 111, 85–90.
Bridge, P.D., Williams, M.A.J., Prior, C. and Patterson, R.R.M. (1993) Morphological,
biochemical and molecular characteristics of Metarhizium anisopliae and M.
flavoviride. Journal of General Microbiology 139, 1163–1169.
Bridge, P.D., Prior, C., Sogbohan, J., Lomer, C.M., Carey, M. and Buddie, A. (1997)
Molecular characterization of isolates of Metarhizium from locusts and grass-
hoppers. Biodiversity and Conservation 5, 177–189.
Brower, A.V.Z. and DeSalle, R. (1994) Practical and theoretical considerations for the
choice of a DNA sequence region in insect systematics, with a short review of
published studies using nuclear gene regions. Annals of the Entomological Society
of America 87 (6), 702–716.
Carruthers, R.I. and Onsager, J.A. (1993) Perspectives on the use of exotic natural
enemies for biological control of pest grasshoppers (Orthoptera: Acrididae).
Environmental Entomology 22, 885–903.
Cobb, B.D. and Clarkson, J.M. (1993) Detection of molecular variation in the insect
pathogenic fungus Metarhizium using RAPD–PCR. FEMS Microbiology Letters
112, 319–324.
Curran, J., Driver, F., Ballard, J.W.O. and Milner, R.J. (1994) Phylogeny of
Metarhizium: sequence analysis of the internally transcribed and 5.8S region of
the ribosomal DNA repeat. Mycological Research 98, 547–552.
Driver, F., Milner, R.J. and Trueman, J.W.H. (1998) A taxonomic revision of
Metarhizium based on a phylogenetic analysis of ribosomal DNA sequence data.
Mycological Research (in press).
Faith, D.P. (1991) Cladistic permutation tests for monophyly and non-monophyly.
Systematic Zoology 40, 366–375.
Fegan, M., Manners, J.M., MacLean, D.J., Irwin, J.A.G., Samuels, K.D.Z., Holdom,
D.G. and Li, D.P. (1993) Random amplified polymorphic DNA markers reveal
a high degree of genetic diversity in the entomopathogenic fungus Metarhizium
anisopliae var. anisopliae. Journal of General Microbiology 139, 2075–2081.
Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using bootstrap.
Foster, W.A. (1975) Life history and population biology of an intertidal aphid,
Pemphigus trehernei Foster. Transactions of the Royal Entomological Society 127,
192–207.
Fungaro, F.H.P., Vieira, M.L.C., Pizzirani-Kleiner, A.A. and Azevedo, de J.L. (1996)
Diversity among soil and insect isolates of Metarhizium anisopliae var. anisopliae
detected by RAPD. Letters in Applied Microbiology 22, 389–392.
Gams, W. (1971) Cephalosporium-artige Schimmelpilze (Hyphomycetes). G. Fisher,
Stuttgart.
Gams, W. and Roszypal, J. (1973) Metarhizium flavoviride n. sp. isolated from insects
and the soil. Acta Botanica Neerlandica 22, 518–521.
Glare, T.R. and Inwood, A.J. (1997) Morphological and genetic characteristics of
Beauveria spp. from New Zealand. Mycological Research (in press).
Glare, T.R. and Milner, R.J. (1991) Ecology of entomopathogenic fungi. In: Arora,
D.K., Ajello, L. and Mukerji, K.G. (eds) Handbook of Applied Mycology, Vol. 2,
Humans, Animals and Insects. Marcel Dekker, New York, pp. 547–612.
Glare, T.R., Milner, R.J., Chilvers, G.A., Mahon, R.J. and Brown, V.W. (1987)
Taxonomic implications of intraspecific variation amongst isolates of the aphid

pathogenic fungi, Zoophthora radicans Brefeld and Z. phalloides Batko (Zygo-
mycetes: Entomophthoraceae). Australian Journal of Botany 37, 49–67.
Glare, T.R., Milner, R.J. and Beaton, C.D. (1996) Variation in Metarhizium, a genus
of fungal pathogens attacking Orthoptera: is phialide morphology a useful
taxonomic criterion? Journal of Orthopteran Research 5, 19–27.
Glare, T.R., Inwood, A., van der Wielen, P. and Nelson, T. (1997) Indentification of
novel strains of Beauveria and Metarhizium in New Zealand. In: Jackson, T.A.
and Glare, T.R. (eds) Proceedings 3rd International Workshop on Microbial
Control of Soil Dwelling Pests. AgResearch, Lincoln, pp. 39–49.
Guo, H.-L., Ye, B.-L., Yue, Y.-Y., Chen, Q.-T. and Fu, C.-S. (1986) Three new species
of Metarhizium. Acta Mycologica Sinica 5, 177–184 (in Chinese).
Hajek, A.E., Humber, R.A., Elkinton, J.S., May, B., Walsh, S.R.A. and Silver, J.C.
(1990) Allozyme and restriction fragment length polymorphisms confirm
Entomophaga maimaga responsible for 1989 epizootics in North American
gypsy moth populations. Proceedings of the National Academy of Sciences USA
87, 6979–6982.
Hajek, A.E., Hodge, K.T., Liebherr, J.K., Day, W.H. and Vandenberg, J.D. (1996a)
Use of RAPD analysis to trace the origin of the weevil pathogen Zoophthora
phytonomi in North America. Mycological Research 100, 349–355.
Hajek, A.E., Walsh, S.R.A., Strong, D.R. and Silver, J.C. (1996b) A disjunct
Californian strain of Entomophaga aulicae infecting Orgyia vetusta. Journal of
Invertebrate Pathology 68, 260–268.
Hantula, J. and Muller, M.M. (1997) Variation within Gremmeniella abietina in
Finland and other countries as determined by Random Amplified Microsatellites
(RAMS). Mycological Research 101(2), 169–175.
Hawksworth, D.L. (1991) The fungal dimension of biodiversity: magnitude, sig-
nificance, and conservation. Mycological Research 95, 641–655.
Bisby’s Dictionary of the Fungi, 8th edn. CAB International, Wallingford.
Hegedus, D.D. and Khachatourians, G.G. (1993) Construction of cloned DNA
probes for specific detection of the entomopathogenic fungus Beauveria
bassiana in grasshoppers. Journal of Invertebrate Pathology 62, 233–240.
Hegedus, D.D. and Khachatourians, G.G. (1995) The impact of biotechnology on
hyphomycetous fungi as insect control agents. Biotechnology Advances 13,
455–490.
Hegedus, D.D. and Khatchatourians, G.G. (1996) Identification and differentiation
of the entomopathogenic fungus Beauveria bassiana using polymerase chain
reaction and single-strand conformation polymorphism analysis. Journal of
Hibbert, D.S., Nakai, Y.F., Tsuneda, A. and Donoghue, M.J. (1995) Phylogenic
diversity in shiitake inferred from nuclear DNA sequences. Mycologia 87,
618–638.
Hodge, K.T., Sawyer, A.J. and Humber, R.A. (1995) RAPD–PCR for identification
of Zoophthora radicans isolates in biological control of the potato leafhopper.
Journal of Invertebrate Pathology 65, 1–9.
Humber, R.A. (1992) Collection of Entomopathogenic Fungal Cultures: Catalogue of
Strains, 1992. US Department of Agriculture, Agriculture Research Service,
ARS-110.
Jun, Y., Bridge, P.D. and Evans, H.C. (1991) An integrated approach to the taxonomy
of the genus Verticillium. Journal of General Microbiology 137, 1437–1444.
Junior, H.A.P. and Martinez-Rossi, N.M. (1995) Restriction endonuclease analysis of
mitochondrial DNA of Metarhizium anisopliae strains. Brazilian Journal of
Genetics 18, 369–372.
Khachatourians, G.G. (1996) Biochemistry and molecular biology of entomopatho-
genic fungi. In: Howard, D.H. and Miller, J.D. (eds) The Mycota, Vol. 6, Animal
and Human Relationships. Springer-Verlag, Berlin, pp. 3331–3363.
Kosir, J.M., MacPherson, J.M. and Khachatourians, G.G. (1991) Genomic analysis of
a virulent and less virulent strain of the entomopathogenic fungus, Beauveria
bassiana, using restriction fragment length polymorphisms. Canadian Journal of
Lawrence, J. and Milner, R.J. (1996) Associations between arthropods and fungi. In:
Fungi of Australia, Vol. 1B, Introduction – Fungi in the Environment. Australian
Biological Resources Study, Canberra, pp. 137–202.
Leal, S.C.M., Bertioli, D.J., Butt, T.M. and Peberdy, J.F. (1994a) Characterisation of
isolates of the entomopathogenic fungus Metarhizium anisopliae by RAPD–
PCR. Mycological Research 98, 1077–1081.
Leal, S.C.M., Bertioli, D.J., Ball, B.V. and Butt, T.M. (1994b) Presence of double-
stranded RNAs and virus-like particles in the entomopathogenic fungus
Metarhizium anisopliae. Biocontrol Science and Technology 4, 89–94.
Leal, S.A.C.M., Bertioli, D.J., Butt, T.M., Cardner, J.H., Burrows, P.R. and Peberdy,
J.F. (1997) Amplification and restriction endonuclease digestion of the Pr1 gene
for the detection and characterization of Metarhizium strains. Mycological
Research 101, 257–265.
Liang, Z.-Q., Liu, A.-Y. and Liu, J.-L. (1991) A new species of the genus Cordyceps
and its Metarhizium anamorph. Acta Sinica 10, 257–262 (in Chinese).
Lu, R., Goerzen, D.W. and Rank, G. (1996) Use of RAPD analysis for in situ
identification of Ascosphaera aggregata and Ascosphaera larvis in larval cadavers
of the alfalfa leafcutting bee, Megachile rotundata. Journal of Invertebrate
Lutzoni, F. and Vilgalys, R. (1995) Integration of morphological and molecular data
sets in estimating fungal phylogenies. Canadian Journal of Botany 73 (suppl. 1),
S649–S659.
Research 100, 1107–1111.
diversity of Beauveria bassiana and relatedness to insect host range. Mycological
Research 101, 159–164.
McCammon, S.A. and Rath, A.C. (1994) Separation of Metarhizium anisopliae strains
by temperature dependent germination rates. Mycological Research 98,
1253–1257.
Milner, R.J. (1985) Field tests of a strain of Entomophaga grylli from the USA for
biocontrol of the Australian wingless grasshopper, Phaulacridium vittatum. In:
Proceedings of the 4th Australasian Conference on Grassland Invertebrate
Pathology, Canterbury, New Zealand, 13–15 May 1985, pp. 255–261.
Milner, R.J. and Jenkins, K. (1996) Metarhizium: a versatile mycoinsecticide of the
future. Professional Pest Manager 1, 32–36.
Milner, R.J. and Mahon, R.J. (1985) Strain variation in Zoophthora radicans, a
pathogen on a variety of insect hosts in Australia. Journal of the Australian
Entomological Society 24, 195–198.
Milner, R.J., Soper, R.S. and Lutton, G.G. (1982) Field release of an Israeli strain of
Entomophthora sphaerosperma Fresenius for biological control of Therioaphis
trifolii f. maculata Monell. Journal of Invertebrate Pathology 21, 113–118.
Milner, R.J., Mahon, R.J. and Brown, W.V. (1983) A taxonomic study of the Erynia
neoaphidis Remaudiere & Keller (Zygomycetes: Entomophthoraceae) group of
pathogenic fungi, together with a description of the new species, Erynia
kondoiensis. Australian Journal of Botany 31, 173–188.
Milner, R.J., Driver, F., Curran, J., Glare, T.R., Prior, C., Bridge, P.D. and
Zimmermann, G. (1994) Recent problems with the taxonomy of the genus
Metarhizium, and a possible solution. Proceedings of the VIth International
Colloquium of Invertebrate Pathology and Microbial Control, Montpellier, 28
August–2 September, 1994, pp. 109–110.
Milner, R.J., Miller, L., Lutton, G.G. and Driver, F. (1996) Biological control of the
black field cricket, Teleogryllus commodus Walker (Orthoptera: Gryllidae), using
the fungal pathogen Metarhizium anisopliae (Metsch.) Sorokin (Deuteromy-
cotina: Hyphomycetes). Plant Protection Quarterly 11, 9–13.
Mor, H., Gindin, G., Ben Ze’ev, I.S., Raccah, B., Geschtovt, N.U. and Ajtkhozhina,
N. (1996) Diversity among isolates of Verticillium lecanii as expressed by DNA
polymorphism and virulence towards Bemisia tabaci. Phytoparastica 24,
111–118.
Murrin, F. (1996) Fungi and insects. In: Howard, D.H. and Miller J.D. (eds) The
Mycota, Vol. 6, Human and Animal Relationships. Springer-Verlag, Berlin,
pp. 365–388.
Nagahama, T., Sato, H., Shimazu, M. and Sugiyama, J. (1995) Phylogenetic divergence
of the entomophthoralean fungi: Evidence from nuclear 18S ribosomal RNA
gene sequences. Mycologia 87, 203–209.
Nazir, R.N., Hu, X., Schidt, J., Culham, D. and Robb, J. (1991) Potential use of PCR-
amplified ribosomal intergenic sequences in the detection and differentiation of
Verticillium wilt pathogens. Physiological and Molecular Plant Pathology 39,
1–11.
Nei, M. and Li, W.H. (1979) Mathematical model for studying genetic variation in
terms of restriction endonucleases. Proceedings of the National Academy of
Neuvéglise, C. and Brygoo, Y. (1994) Identification of group-I introns in the 28S
rDNA of the entomopathogenic fungus Beauveria brongniartii isolated from
insects. Current Genetics 27, 38–45.
Neuvéglise, C., Brygoo, Y., Vercambre, B. and Riba, G. (1994) Comparative analysis
of molecular and biological characteristics of strains of Beauveria brongniartii
isolated from insects. Mycological Research 98, 322–328.
Neuvéglise, C., Brygoo, Y. and Riba, G. (1997) 28S rDNA group I introns: a powerful
tool for identification of Beauveria brongniartii strains. Molecular Ecology 6,
373–381.
Nishida, H. and Sugiyama, J. (1995) A common group I intron between a plant
parasitic fungus and its host. Molecular Biology and Evolution 12, 883–886.
Osborne, D. and Rhodes, D. (1994) Presence of double stranded RNA elements
in Beauveria bassiana. Proceedings of the Vth International Colloquium of
Invertebrate Pathology and Microbial Control, Montpellier, 28 August–2

September 1994, p. 113.
Perkins, D.D. (1991) In: Bennet, J.W. and Lasure, L.L. (eds) More Gene Manipula-
tions in Fungi. Academic Press, New York, pp. 3–26.
Pfeifer, T.A., Hegedus, D.D. and Khachatourians, G.G. (1993) The mitochondrial
genome of the entomopathogenic fungus Beauveria bassiana: analysis of the
ribosomal RNA region. Canadian Journal of Microbiology 39, 25–31.
Pipe, N.D., Chandler, D., Bainbridge, B.W. and Heale, J.B. (1995) Restriction
fragment length polymorphisms in the ribosomal RNA gene complex of isolates
of the entomopathogenic fungus Metarhizium anisopliae. Mycological Research
99, 485–491.
Rakotonirainy, M.S., Dutertre, M., Brygoo, Y. and Riba, G. (1991) rRNA sequence
comparison of Beauveria bassiana, Tolypocladium cylindrosporum and Tolypo-
cladium extinguens. Journal of Invertebrate Pathology 57, 17–22.
Rakotonirainy, M.S., Dutertre, M. Brygoo, Y. and Riba, G. (1994) Phylogenic
relationships within the genus Metarhizium based on 28S rRNA sequences and
isozyme comparisons. Mycological Research 98, 225–230.
Rath, A.C., Carr, C.J. and Graham, B.R. (1995) Characterisation of Metarhizium
anisopliae strains by carbohydrate utilization (AP150CH). Journal of Inverte-
brate Pathology 65, 152–161.
Riba, G., Rakotonirainy, M. and Brygoo, Y. (1990) Phylogenetic relationships within
the genus Metarhizium. In: Pinnock, D.E. (ed.) Proceedings and Abstracts of the
Vth International Colloquium on Invertebrate Pathology and Microbial Con-
trol. Society for Invertebrate Pathology, Adelaide, pp. 125–131.
Riba, G., Couteaudier, Y., Maurer, P. and Neuvéglise, C. (1994) Molecular methods
offer new challenge for fungal bioinsecticides. In: Proceedings of the 27th Annual
Meeting of the Society for Invertebrate Pathology. Montpellier, 28 August–2
September, pp. 16–22.
Roberts, D.M., Bainbridge, B.W., Evans, H.C. and Heale, J.B. (1995) Genome
analysis in isolates of Verticillium, V. albo-atrum, V. dahliae and V. lecanii.
Phytoparasitica 23, 40.
Roddam, L.F. and Rath, A.C. (1997) Isolation and characterization of Metarhizium
anisopliae and Beauveria bassiana from Subantarctic Macquarie Island. Journal
of Invertebrate Pathology 69, 285–288.
Rohel, E., Couteaudier, Y., Paperiok, B., Cavelier, N. and Dedryver, C.A. (1997)
Ribosomal internal transcribed spacer size variation correlated with RAPD–
PCR pattern polymorphisms in the entomopathogenic fungus Erynia neoaphidis
and some closely related species. Mycological Research 101, 573–579.
Rombach, M.C., Humber, R.A. and Roberts, D.W. (1986) Metarhizium flavoviride
var. minus var. nov., a pathogen of plant- and leafhoppers on rice in Philippines
and Solomon Islands. Mycotaxon 27, 87–92.
Rombach, M.C., Humber, R.A. and Evans, H.C. (1987) Metarhizium album a fungal
pathogen of leaf- and planthoppers of rice. Transactions of the British Myco-
logical Society 37, 37–45.
Saitou, N. and Nei, M. (1987) The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406–425.
Samuels, K.D.Z., Heale, J.B. and Llewellyn, M. (1989) Characteristics relating to the
pathogenicity of Metarhizium anisopliae towards Niliparvata lugens. Journal of
Seifert, K.A., Wingfield, B.D. and Wingfield, M.J. (1995) A critique of DNA sequence
analysis in the taxonomy of filamentous Ascomycetes and ascomycetous
anamorphs. Canadian Journal of Botany 73 (suppl. 1), S760–S767.
Sherriff, C., Whelan, M.J., Arnold, G.M., Lafay, J.F., Brygoo, Y. and Bailey, J.A.
(1994) Ribosomal DNA sequence analysis reveals new species groupings in the
genus Colletotrichum. Experimental Mycology 18, 121–138.
Shih, H.L., Lin, C.P., Liou, R.F. and Tzean, S.S. (1995) Complete nucleotide sequence
of Beauveria bassiana 5.8S RNA coding gene and flanking internal transcribed
spacers. DNA Sequence – The Journal of Sequencing and Mapping 5, 381–383.
Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. and Flook, P. (1994)
Evolution weighting and phylogenetic utility of mitochondrial gene sequences
and a compilation of conserved polymerase chain reactions primers. Annals of
the Entomological Society of America 87, 651–701.
St Leger, R.J., Allee, L.L., May, B., Staples, R.C. and Roberts, D.W. (1992a)
Worldwide distribution of genetic variation among isolates of Beauveria spp.
Mycological Research 96, 1007–1015.
St Leger, R.J., May, B., Allee, L.L., Frank, D.C., Staples, R.C. and Roberts, D.W.
(1992b) Genetic differences in allozymes and in formation of infection structures
among isolates of the entomopathogenic fungus Metarhizium anisopliae. Journal
of Invertebrate Pathology 60, 89–101.
St Leger, R.J., Joshi, L., Bidochka, N.J. and Roberts, D.W. (1995) Construction of an
improved mycoinsecticide overexpressing a toxic protease. Proceedings of the
National Academy of Sciences, USA 93, 6349–6345.
Swofford, D.L. (1993) PAUP, Phylogenetic analysis using parsimony, version 3.1.1.
paign, Illinois.
Swofford, D.L. (1997) PAUP, phylogenetic analysis using parsimony, beta version 4.
paign, Illinois.
Tigano-Milani, M.S., Samson, R.A., Martins, I. and Sobral, B.W.S. (1995a) DNA
markers for differentiating isolates of Paecilomyces lilacinus. Microbiology 141,
239–245.
Tigano-Milani, M.S., Honeycutt, R.J., Lacey, L.A., Assis, R., McClelland, M. and
Sobral, B.W.S. (1995b) Genetic variability of Paecilomyces fumosoroseus isolates as
revealed by molecular markers. Journal of Invertebrate Pathology 65, 274–282.
Tigano-Milani, M.S., Gomes, A.C.M.M. and Sobral, B.W.S. (1995c) Genetic variabil-
ity among Brazilian isolates of the entomopathogenic fungus Metarhizium
anisopliae. Journal of Invertebrate Pathology 65, 206–210.
Tulloch, M. (1976) The genus Metarhizium. Transactions of the British Mycological
Society 66, 407–411.
Typas, M.A., Griffen, A.M., Bainbridge, B.W. and Heale, J.B. (1992) Restriction
fragment length polymorphisms in mitochondrial DNA and ribosomal RNA
gene complexes as an aid to the characterization of species and sub-species
populations in the genus Verticillium. FEMS Microbiological Letters 95,
157–162.
Viaud, M., Couteaudier, Y., Levis, C. and Riba, G. (1996) Genome organisation in
Beauveria bassiana: electrophoretic karyotype, gene mapping, and teleomeric

fingerprinting. Fungal Genetics and Biology 20, 175–183.
Volger, A.P. and Desalle, R. (1994) Diagnosing units of conservation management.
Conservation Biology 8(2), 354–363.
Walsh, S.R.A., Tyrrell, D., Humber, R.A. and Silver, J.C. (1990) DNA restriction
length polymorphisms in the rDNA repeat unit of Entomophaga. Experimental
Mycology 14, 381–392.
Welling, M., Nachtigall, G. and Zimmermann, G. (1994) Metarhizium spp. isolates
from Madagascar: morphology and effect of high temperature on growth and
infectivity to the migratory locust, Locusta migratoria. Entomophaga 39,
351–361.
Wiley, E.O., Siegel-Causey, D., Brooks, D.R. and Funk, V.A. (1991) The complete
cladist. A primer of phylogenetic procedures. University of Kansas Museum of
Natural History Special Publication 19, 1–158.
Yip, H., Rath, A.C. and Koen, T.B. (1992) Characterization of Metarhizium
anisopliae isolates from Tasmanian pasture soils and their pathogenicity to
redheaded cockchafer (Coleoptera: Scarabaeidae: Adoryphorus couloni). Myco-
logical Research 96(2), 92–96.
Zimmermann, G. (1993) The entomopathogenic fungus Metarhizium anisopliae and
its potential as a biological control agent. Pesticide Science 37, 375–379.
Application of PCR in Fungal 9
Biotechnology
W.V. Burnett, S.-J.D. Chiang, J.D. Basch and
R.P. Elander
Biotechnology Development, Bristol-Myers Squibb Company,
Syracuse, NY 13221-4755, USA
9.1 Introduction
Filamentous fungi have been utilized for decades in the commercial

production of enzymes, antibiotics, and speciality chemicals. Fungi are
unparalleled as producers of secreted proteins; Aspergillus niger, for example,
produces glucoamylase at 20 g l–1. Since the development of transformation
methods for filamentous fungi, genetic engineering technology has been
applied to fungal systems for the production of heterologous proteins.
Members of the genus Aspergillus, Fusarium and Neurospora in particular,
have been employed as hosts for the high level secretion of recombinant
proteins (Peberdy, 1994; Van den Hombergh et al., 1996). In this chapter, we
will discuss the application of various PCR techniques for the character-
ization, cloning and expression of heterologous genes in industrially impor-
tant filamentous fungi. Characterization of fungal strains and transformants,
as well as the development of suitable fungal hosts for the expression of
therapeutic human proteins, will also be discussed.
9.2 Cloning of Conserved Genes by PCR
Several approaches have been used to isolate genes from filamentous fungi
(Goosen et al., 1992). A number of fungal genes were cloned by
complementation of auxotrophic mutants of Escherichia coli or Sacchar-
omyces cerevisiae. This approach is limited because fungal expression
signals may not be recognized by the host transcriptional or translational
machinery, and many fungal genes have introns which cannot be processed
188 W.V. Burnett et al.
properly to make a functional mRNA in E. coli or yeast. Isolation of

fungal genes by complementation of auxotrophic fungal mutants is limited
by the low DNA transformation efficiency in filamentous fungal species
with the exception of Aspergillus nidulans and Neurospora crassa. A
‘reverse genetics’ approach has been used successfully in the cloning of
many fungal β-lactam biosynthetic genes (Skatrud, 1992). This approach
begins with the purification of the desired enzyme, determination of a
partial amino acid sequence, and synthesis of oligonucleotide probes based
on the amino acid sequence. A genomic DNA library of this fungal species
is then constructed in E. coli and screened for clones that hybridize to
the DNA probes. Sequencing of the cloned DNA is used to confirm that
the DNA sequence matches the known amino acid sequence. For genes
which are sufficiently conserved, gene isolation can be achieved in a short
period of time by heterologous hybridization with a probe generated from
its counterpart gene from another organism. Alternatively, degenerate
oligonucleotide primers synthesized from the conserved regions of the
available genes, are used to amplify a genomic or a cDNA fragment that
can be used as a probe for cloning of the entire gene. This approach has
been used successfully for the cloning of the cDNA of the NADPH-
cytochrome P450 reductase gene (cpr) from Schizosaccharomyces pombe
(Miles, 1992) as well as the genomic cpr gene from A. niger (Van den
Brink et al., 1995), and the cDNA clone of the protein disulphide
isomerase gene from A. niger (Malpricht et al., 1996).
9.2.1 Cloning of a gene from genomic DNA

The NADPH-cytochrome P450 reductase (CPR) serves as an electron donor
for the activity of all eukaryotic non-mitochondrial cytochrome P450 mono-
oxygenase enzymes. These enzymes catalyse the oxidation of lipophilic
chemicals by the addition of one atom of molecular oxygen to the substrate
molecule, such as the conversion of benzoic acid to p-hydroxy-benzoic acid.
Genomic and cDNA clones of the cpr gene have been isolated from yeast, rat,
rabbit and human genomes. The amino acid sequence of trout and pig CPR
have also been determined from the purified protein. Comparison of the
deduced amino acid sequences of these proteins shows two highly conserved
regions. Miles (1992) used degenerate oligonucleotide primers, based on
these conserved sequences, to amplify a 309 bp fragment of the cpr gene from
Sc. pombe and used it as a probe to identify a cDNA clone of the cpr gene.
Van den Brink et al. (1995) used a similar approach to generate a 1.4 kbp
PCR-amplified DNA probe and cloned a genomic fragment containing the
entire coding region with the 5′ promoter and 3′ untranslated regions of the
cpr gene from A. niger. This method should be generally applicable to the
cloning of cpr genes from diverse sources when hybridization with heterolo-
gous probes fails.
PCR in Fungal Biotechnology 189
9.2.2 Cloning of a gene from mRNA

Protein disulphide isomerase (PDI) catalyses the formation, reduction, and
isomerization of disulphide bonds in the process of maturation and folding
of nascent polypeptide chains in the cell. Comparison of amino acid
sequences of PDI proteins from a number of organisms indicates that the
PDI enzyme has two highly conserved active sites. Malpricht et al. (1996)
cloned the PDI cDNA sequences from total RNA isolated from mycelia of
A. niger NRRL3 in three steps. First, they used two degenerate primers
derived from the conserved regions of the two active sites to amplify a 158 bp
PCR fragment from single-stranded cDNA which had been transcribed from
A. niger total RNA. This PCR fragment was cloned and sequenced to verify
its identity with the published PDI protein sequences. From the sequence
information, a specific 27-mer primer was used as a 5′ primer in a 3′-rapid
amplification of cDNA ends (RACE) PCR with single-stranded cDNA and
oligo-dT primer to yield a longer cDNA fragment. This fragment consists of
the above 158 bp fragment sequence and all of the 3′ sequences extending to
the poly(A)-tail (Frohman et al., 1988). The 5′ end of the gene, upstream of
the sequenced region, was subsequently cloned by inverse PCR (IPCR)
(Huang et al., 1990). Double-stranded cDNA was prepared from full-length
mRNA and self-ligated to generate circular templates for PCR. Primers were
prepared which were complementary to the 5′ and 3′ ends of the previously
amplified cDNA fragment, but oriented outward so that they would amplify
the uncharacterized portion of the template. After 25 cycles of PCR, a DNA
fragment containing sequences from the 5′ end of the mRNA was synthe-
sized and characterized. By using IPCR, it was possible to determine the
sequence of the 5′ region of a specific mRNA molecule without knowing the
sequence of the 5′ end in advance. An alternative approach is to use
5′-RACE. Single-stranded cDNA is synthesized from mRNA and C-tailed
using terminal deoxynucleotidyl transferase and dCTP. This serves as a
template for PCR using oligo-dG and a gene-specific primer. Either method
allows full-length cDNA fragments to be generated even with limited
nucleotide sequence information (Frohman et al., 1988; Zilberberg and
Gurevitz, 1993).
9.3 Expression Vector Construction
Interest in the use of filamentous fungi for the production of both industrial
enzymes and therapeutic proteins has increased significantly in recent years.
Because fungi can produce large quantities of secreted proteins and many
fungal strains are now generally recognized as safe, they can potentially serve
as ideal hosts for the expression of heterologous genes. To accomplish this,
a transformation protocol must be developed which allows foreign DNA to
be introduced into the host in either an integrated or autonomous form.
Then, an expression vector must be constructed which provides the gene of

interest with additional DNA sequences to allow its expression in the fungal
host. These sequences typically include:
• a strong transcriptional promoter (preferably regulated);
• suitable restriction sites near the promoter to insert heterologous genes;
• a transcriptional terminator;
• a selectable marker.
Optionally, the vector may contain a secretion signal sequence or part of
a highly expressed endogenous protein (generally from the gene which is
naturally associated with the strong promoter), allowing a foreign gene to be
either secreted or expressed as a fusion protein.
PCR is particularly useful in the construction of new expression vectors
since most of the components can be derived from existing vectors, but
require several changes in the flanking restriction sites. The following
example from our laboratory demonstrates how we have easily constructed
a rather complex expression system for Fusarium oxysporum by PCR.
In the course of developing an enzymatic method to convert penicillin
V to 6-aminopenicillanic acid, research scientists at Bristol-Myers Squibb
discovered a strain of F. oxysporum which produces substantial quantities
(1–2 g l–1) of a penicillin V amidase (PVA) enzyme (Fig. 9.1). Expression of
the PVA gene is induced by the presence of phenoxyacetic acid (POAc), and
the protein is secreted into the medium. To increase production of the
enzyme, we cloned the PVA gene and approximately 2 kb of flanking
sequences into a vector that contained a phleomycin resistance gene for the
selection of fungal transformants. When the transforming plasmid was
inserted into the chromosome of a different F. oxysporum strain (f. sp.
lycopersici, ATCC 16322) which has very little endogenous PVA activity and
no DNA sequences homologous to the PVA gene, the transformants
produced over 1 g l–1 of active enzyme. When the host was transformed with
a vector containing a tandem repeat (two copies) of the PVA gene, the
expression increased to 10 g l–1 (Chiang et al., 1996). The protein was
secreted and its expression remained POAc-inducible. These characteristics
have led us to believe that the PVA promoter and gene can be converted into
a component of a valuable expression system in Fusarium.
Because the two-copy PVA gene vector produces much higher levels of
expression, we decided to create a Fusarium expression system with two
component plasmids for the easy construction of two-gene expression vectors.
One component, pWB20 (the ‘cassette’ vector, Fig. 9.2), allows a heterologous
gene to be inserted into the PVA gene at a variety of locations. Depending upon
the insertion site, the gene can be expressed directly, or fused to the PVA
secretion signal sequence, or expressed as a fusion protein. After the gene is
inserted, an expression cassette containing the gene plus the PVA promoter and
transcriptional terminator can be cut out with either of two restriction
enzymes (EcoRI or XbaI). A second component, pSJC62 (the ‘resistance’
Fig. 9.1. Enzymatic conversion of penicillin V to 6-aminopenicillanic acid (6-APA).
vector, Fig. 9.2), contains the gene coding for phleomycin resistance and unique
EcoRI and XbaI restriction sites on opposite sides of the gene. Two copies of
the expression cassette can be inserted into these sites on pSJC62 to generate
four different combinations. These copies are not true tandem repeats since
they are separated by the phleomycin resistance gene. In order to generate
tandem repeats we engineered an overlapping dam-methylation site (GATC)
at one of the XbaI sites of the pWB20 cassette vector. The vector is initially
grown in a dam– E. coli host so that the cassette can be cut out with XbaI. After
the first copy of the cassette is inserted into the pSJC62 resistance vector, it is
grown in a dam+ E. coli host which prevents cleavage of one of the XbaI sites.
A second copy of the expression cassette is now easily inserted into the one
remaining XbaI site to produce a true tandem repeat.
The cassette vector, pWB20 was created from the vector pFO20, which
contains the PVA gene plus 1.2 kb of upstream (promoter region) and 0.8 kb of
downstream (transcriptional terminator region) DNA sequences inserted into
the popular cloning vector pUC19. To convert pFO20 to pWB20, it was
necessary to remove six restriction sites, add four new restriction sites (one
with an overlapping dammethylation site), and to modify the translation start
Fig. 9.2. Plasmid maps of pWB20 and pSJC62.

site. Although introducing this number of changes appears daunting, it was

easily accomplished by PCR with carefully designed primers. The strategy is
outlined in Fig. 9.3. Firstly, an NcoI site was removed from the transcriptional
terminator by digestion, filling-in, and religation. Next, PCR primers were
made to amplify either the promoter region or the coding and terminator
regions. The primers were 29–33 bp long and their 3′ ends provided 14–19 bases
of homology to the PVA gene. The 5′ sequences of the primers were designed to
create all of the new restriction sites needed for pWB20. For the annealing step
of the PCR, the T m is about 50°C when the template is the pFO20 vector (since
only the 3′ end of the primer hybridizes). After the initial rounds of PCR,
however, the newly synthesized template will be complementary to the entire
primer and the T m will increase to 80–90°C. To optimize the specificity of the
PCR, it was carried out in two stages. Firstly, a PCR with an annealing
temperature of 48°C was run for six cycles to generate a small amount of newly
synthesized template. This was followed by a two-step PCR (94° and 70°C) for
35 cycles to amplify the fragments. The PCR-generated fragments were then
digested with restriction enzymes to produce ‘sticky’ ends and ligated into a
modified pUC19 vector (pUC19EB) which had most of the polylinker region
removed. The resulting pWB20 vector is now being developed to express
heterologous genes in its Fusarium host.
9.4 Site-directed Mutagenesis by PCR
After an expression vector (usually a plasmid) has been constructed, it is often

desirable to introduce mutations into the vector either to alter the properties of
an expressed gene product or to increase its level of expression. In some cases,
the desired mutation will be very specific (for example, the introduction of new
restriction sites or changing a single amino acid at the active site of an enzyme).
In other cases, it may be preferable to introduce random mutations into a small
region of the vector (for example, when trying to increase the strength of a
promoter). In either case, the most convenient way to mutagenize specific sites
or regions of the vector is by PCR. Several of the most commonly used
procedures will be described below.
9.4.1 Introduction of specific mutations

All of the procedures to create non-random mutations begin with the
synthesis of PCR primers which contain the desired mutation. Either a
region of the plasmid or the entire plasmid is amplified, and the vector
containing the mutation is reconstructed.
Inverse PCR (IPCR) and enzymatic inverse PCR (EIPCR)

An easy way to mutagenize a circular plasmid, inverse PCR procedures
require only two primers to the complementary strands of the plasmid.
Fig. 9.3. pWB20 Construction strategy.

1. Cut pFO20 with NcoI, fill in, and religate (= pFO20∆Nco). [Removes unwanted NcoI
site from the PVA terminator region.]
2. Cut pUC19 with EcoRI + HindIII, add a linker, and ligate (= pUC19EB). Cut the plasmid
with EcoRI and remove 5′-phosphates. [Removes all of the polylinker region, keeping
only the EcoRI site and adding a BglII site.]
3. PCR the promoter region of pFO20∆Nco and cut the product with EcoRI + NcoI.
[Adds an EcoRI and XbaI (with overlapping dam methylation) site to the 5′ end and
an NcoI site at the translation start site.]
4. PCR the coding and terminator region of pFO20∆Nco and cut the product with
EcoRI + NcoI. [Adds an EcoRI and XbaI site to the 3′ end, an NcoI site at the
translation start site, and adds one amino acid to the N terminus of PVA.]
5. Ligate the three fragments from steps 2–4. [If the correct fragments come together,
pWB20 is produced. The correct construct is identified by restriction analysis.]
Their 5′ ends are adjacent to each other, and one of the primers contains
the desired mutation (Helmsley et al., 1989). PCR with these primers will
amplify the entire plasmid as a linear molecule, and this can then be
recircularized with T4 DNA ligase and transformed into an E. coli host.
Because the ends of the molecule are not always precisely blunt, it is often
necessary to sequence the junction to confirm that no additional mutations
have been introduced. A better way to accurately recircularize the plasmid
is to use overlapping complementary primers containing a unique restriction
site and digest the ends with the restriction enzyme before ligation (EIPCR).
If a unique restriction site is located close enough to the mutation site,
complementary primers containing both the restriction site and the
mutation can be used for the PCR. Even if there are no restriction sites
close to the mutation site, a unique class 2s restriction site whose recognition
site is 5′ to the cutting site can be added as a 5′ extension to both primers
(Stemmer and Morris, 1992). Digestion of the amplified DNA with the class
2s restriction enzyme removes the recognition site and leaves com-
plementary overhangs which are part of the original plasmid sequence.
When ligated into a circle, the new plasmid is identical to the old one except
for the introduced mutations.
Recombination PCR (RPCR)

Similar to IPCR, an entire plasmid is amplified with complementary primers
which contain the desired mutation. Instead of recircularizing the plasmid in
vitro, the linear DNA is transfected directly into competent E. coli cells
(Jones and Howard, 1991). The host cells (including recA – strains) contain
recombinational repair enzymes which can recircularize the plasmid in vivo.
Although initially simpler than IPCR or EIPCR, some errors can be
introduced during this recombination, so further characterization of the
plasmid is often advisable.
Overlap PCR
Introducing a mutation into the middle of a linear fragment of DNA requires
four PCR primers. Two primers are complementary to the ends of the
fragment, and two are complementary to each other and contain the desired
mutation. Initially, two separate PCRs are carried out which amplify the two
halves of the fragment. If the overlapping region containing the mutation also
contains a unique restriction site, the two fragments can simply be digested
with the enzyme and ligated together. If not, one alternative is to add a class
2s restriction site to the 5′ ends of the primers containing the mutation
(Tomic et al., 1990). When digested with the enzyme, the recognition sites are
removed and the complementary overhangs contain only sequences from the
original DNA fragment plus the mutation. A second alternative is to allow
the overlapping region of the two fragments to prime each other in a third
PCR reaction (Ho et al., 1989). The two halves of the fragment are combined
with the two primers which are complementary to the ends of the original
DNA fragment and the PCR is repeated to regenerate the original fragment
with the desired mutation. This approach can also be used to fuse together
two unrelated gene fragments.
9.4.2 Introduction of random mutations (mutagenic PCR)

Depending upon the application, it may be preferable to introduce random
mutations over a small region of an expression vector rather than create a
larger number of plasmids with specific mutations. Mutagenic PCR takes
advantage of the fact that native Taq DNA polymerase has an unusually high
error rate (approximately 10–4 per nucleotide incorporated). This rate can be
further increased by manipulating the concentration of MgCl2, MnCl2, and
dNTP in the PCR reaction mix (Cadwell and Joyce, 1995). By carrying out
a mutagenic PCR on a small region of an expression vector and subsequently
subcloning the fragment back into the vector, a large number of random
mutations in a small region of the plasmid can easily be generated.
9.5 Characterization of High-producing Industrial Strains
Fungi have been employed in the fermentation industry for over 100 years.
Traditional strain improvement methods such as random mutagenesis and
selection have led to tremendous increases in the productivity of these
organisms. The genetic changes that have resulted in these improvements,
however, remain largely uncharacterized. PCR applications such as reverse
transcription PCR (RT–PCR) and differential display RT–PCR (DDRT–
PCR) enable us to identify genes which have altered expression levels in
higher-producing organisms. Identifying these mutations enables the devel-
opment of rational strategies for the genetic engineering of these strains for
further improvements in productivity. Furthermore, knowledge gained
regarding the genetic changes in one strain improvement programme may
also help to speed productivity improvements of other related products.
PCR can then be used for the identification and characterization of these
genetically engineered fungi.
9.5.1 Characterization and quantitation of mRNA

RT–PCR is a technique for analysing gene expression by specific amplifica-
tion of cDNA which has been synthesized from mRNA (reverse transcrip-
tion). It can be used simply to detect the presence of a specific RNA
transcript, or when a competitive template of a known quantity is added to
the reaction, RT–PCR can be used to quantitate expression levels in RNA
samples. The competitive template should be as similar to the cDNA target
as possible. A cloned genomic fragment provides a good competitor if the
PCR primers are chosen so that they span an intron. The amplified products
can then be distinguished by the difference in size between the genomic and
cDNA sequences. The advantage of RT–PCR over Northern blotting is that
a smaller amount of total RNA of a lesser quality is required and further
purification of poly(A)-tailed mRNA is not necessary. This is particularly
helpful when dealing with fungal organisms from which RNA is difficult to
extract.
In the case of the β-lactam antibiotics produced by Penicillium chrysoge-
num and Acremonium chrysogenum, most of the genes involved specifically
in the biosynthetic pathway have been cloned (Martin et al., 1994). In the
higher producing strains, accumulation of beneficial mutations has increased
the expression of these genes dramatically. Mutations in promoter regions
can increase expression levels and alter the pattern of regulation that these
genes display. Mutations in the coding region can affect the activity of the
β-lactam biosynthetic enzymes, resulting in increased productivity of the
organism. One approach for analysing the mutations accumulated through

the course of strain improvement uses PCR to amplify a defined region of
genomic DNA from a number of different strains followed by a non-isotopic
RNase cleavage assay to locate mutations (Myers et al., 1985). This technique
locates the position of mutations so that sequencing can be limited to regions
where mutations have been previously been identified. PCR primers
designed to amplify a genomic region of 100–1000 bp in length are used to
amplify a specific promoter or coding region from a wild-type or early
development ‘reference strain’ and from higher-producing strains. These
amplified products can be cloned into a vector between two different
bacteriophage promoters. Separate sense and antisense transcripts can be
generated by adding one of two different bacteriophage RNA polymerases.
The sense strand amplified from the reference strain is annealed to the
antisense transcripts generated from the high-producing strains. Mismatches
in the complementary RNA templates will result in positions susceptible to
RNase cleavage. By sizing the products on an agarose gel, the positions of
these mismatches can be mapped, indicating the location of mutations
incurred during strain improvement.
9.5.2 Differential display of fungal mRNA

The comparison of gene expression in fungal cells at various stages of
differentiation has traditionally been performed by subtractive hybridization
(Zimmerman et al., 1980). This technique is time consuming and requires the
isolation of high quality mRNA. DDRT–PCR was developed to analyse a
broad spectrum of expressed genes and to detect differences in expression
levels between cell types (Appleyard et al., 1995). DDRT–PCR relies on the use
of short random primers that non-specifically amplify fragments (<1000 bp) of
cDNA. Differences in the expression of various genes can be determined by
comparison of the DNA banding pattern observed upon amplification of
different RNA samples. For example, antibiotics are produced by fungal
organisms as secondary metabolites; specific conditions such as environmental
stress are required for antibiotic production. DDRT–PCR of RNA isolated
from cultures grown at either logarithmic phase (trophophase) or producing
phase (idiophase) can be used to identify the genes that are expressed during the
synthesis of antibiotics. These genes, related to antibiotic synthesis, are good
targets for cloning and overexpression (Usher et al., 1992). For a company with
a long history of strain improvement, analysis of high- and low-producing
strains by this method can determine the genetic changes resulting in higher
productivity. The DDRT–PCR and RT–PCR techniques are described in
detail in other chapters of this book.
9.5.3 Characterization of transformants and integration sites

PCR is useful for identifying and characterizing fungal transformants.
Because many selection systems for fungal transformation are not 100%
selective, abortive transformants due to the transitory uptake of transforming

DNA can outgrow the selection. Fungal transformation in industrial
applications is almost exclusively integrative. Therefore, to identify true
transformants, genomic DNA is first isolated from putative transformants
and a dot-blot or PCR amplification of the integrated DNA is performed.
Nowak et al. (1995) used PCR to confirm that a linear DNA fragment which
contains a mutant tubulin gene and lacks any bacterial sequences can confer
resistance to benomyl and is sufficient for transformation of Acremonium
chrysogenum.
The expression level of a heterologous gene which has been integrated
into a fungal chromosome is often determined by the site of integration as
well as by any regulatory sequences on the expression vector. A gene
integrated into a transcriptional ‘hot spot’ can express at higher levels than
the same gene inserted elsewhere on the chromosome. If a putative hot spot
is identified after the random insertion of a vector, it may be desirable to
isolate the flanking sequences from the host chromosome. These sequences
could then be added to future expression vectors to direct integration to the
hot spot by homologous recombination. Inverse PCR can be used to amplify
the host DNA sequences flanking integrated transforming DNA. A South-
ern blot of the genomic DNA is first performed to identify restriction
fragments which contain the integrated DNA and flanking genomic DNA.
Sometimes a single fragment will contain both the upstream and downstream
sequences, otherwise two separate fragments may be used for amplification
of each flanking region. Once the restriction enzyme is chosen, genomic
DNA is digested, diluted, and ligated so that the restriction fragments
circularize. This material will serve as the template for the amplification.
Unlike standard PCR where the primers are designed so that they amplify
the sequences between them, primers for inverse PCR are designed to extend
their template in outward directions. When annealed to the circular template,
these primers will amplify a fragment that contains the sequences flanking
the primers until they join at the restriction site used for cleavage of the
genomic DNA. This amplified product can then be cloned and sequenced.
9.6 Future Applications
9.6.1 Efficient secretion of heterologous proteins

The efficiency of protein secretion is protein-specific and recombinant
proteins are often difficult to secrete at high levels in fungal hosts. The effort
at Genencor to produce bovine chymosin in A. nidulans and A. awamori
demonstrated that transcription was not a limiting factor in chymosin
production but that secretion may have been inefficient (Ward et al., 1990).
The productivity and secretion of the chymosin protein was significantly
improved by engineering a fusion protein product which links the cDNA
encoding bovine prochymosin in frame to the last codon of the A. awamori

glycoamylase gene. The produced chymosin is autocatalytically released at
pH 2 from the fusion protein after secretion (Ward et al., 1990). This work
demonstrated that secretion of the fusion protein is more efficient than for
heterologous protein alone. If autocatalytic release does not occur in the
fungal system, a cleavable linker peptide can be engineered between the
proteins to allow separation of the products for purification. Site-specific
mutagenesis by PCR or overlap PCR (Pont-Kingdon, 1994) can be used in
the construction of fusion vectors and the generation of a cleavable linker.
9.6.2 Host improvement for heterologous gene expression

The ability of filamentous fungi to secrete large quantities of protein has
made them an attractive host for the production of recombinant proteins. For
the proper expression of therapeutic human proteins in filamentous fungi,
several aspects need to be considered in addition to the efficient expression
of heterologous genes:
• stability of the secreted preteins in the fermentation media;
• glycosylation pattern/ biological activity of the secreted proteins;
• ‘generally regarded as safe’ (GRAS) strain development.
Proteinase-deficient mutants
A recombinant protein secreted into the fermentation medium may be
degraded by extracellular fungal proteinases. The aspartic proteinase of A.
awamori had been shown to degrade secreted bovine chymosin and the gene
encoding this enzyme was cloned (Berka et al., 1990). Deletion of the native
aspartic proteinase gene in A. awamori resulted in a significant reduction in
overall extracellular proteinase activity. The production of chymosin was
improved seven-fold by combining expression in the proteinase-deficient
mutant with a classical strain improvement programme (Dunn-Coleman et
al., 1991). Based on the deduced amino acid sequence, A. awamori aspartic
proteinase shares homology with other fungal aspartic proteinases (Berka et
al., 1990). Cloning of conserved protease genes in other fungal hosts by PCR
could be performed as discussed earlier. Aspartic proteinase-deficient
mutants could then be constructed by gene disruption or deletion. A number
of genes encoding other fungal proteinases have been isolated (Van den
Hombergh et al., 1996), and some of these genes are highly conserved in
fungi. Cloning of these genes can be facilitated by PCR and used to construct
proteinase-deficient mutants.
Glycosylation engineering
The correct carbohydrate composition of many human therapeutic proteins
is essential in vivo for their solubility, stability, and biological activity, as well
as to avoid recognition by the human immune system. The recombinant
mammalian proteins produced in yeast usually have a large number of
mannose residues (hyperglycosylation) which alter their serum half-life and

antigenicity in mammals (MacKays, 1987). The glycosylated recombinant
mammalian proteins produced in filamentous fungi usually co-migrate with
the natural protein in SDS–PAGE gels, indicating no excess glycosylation.
Upshall et al. (1987) have shown that human tissue plasminogen activator
(tPA) produced in A. nidulans is correctly processed at the amino terminus
and is not over-glycosylated. Ward et al. (1992) have also demonstrated that
recombinant human lactoferrin expressed in A. oryzae has the same level of
glycosylation as the authentic lactoferrin present in human milk. However,
the nature and chemical composition of the carbohydrates added to these
recombinant proteins derived from different fungal expression systems have
never been characterized. When the cDNA encoding tPA was expressed by
a strong fungal promoter in A. nidulans, the recombinant tPA protein was
overglycosylated (Upshall et al., 1991). The authors suggested that in the
high-yielding transformants, the translation of mRNA proceeds faster than
the ability of the host cell to process and to translocate the protein
extracellularly. The intracellular accumulation of this protein in the Golgi
apparatus results in the continued addition of excess carbohydrate side-
chains. A similar observation of over-glycosylation of recombinant proteins
has been observed in the high-level expression of an aspartic proteinase
derived from Rhizomucor miehei in A. oryzae, although the biological
activity was not affected (Christensen et al., 1988). Therefore, in order to
achieve the correct level of glycosylation, high-level expression of mamma-
lian glycoproteins is not always desirable.
There is an increasing understanding of the biosynthetic pathways of
protein glycosylation and the relationship between glycosylation and the
biological activity of various proteins (Stanley, 1992; Jenkins and Curling,
1994). With this basic knowledge, a filamentous fungal host can be
engineered by removing the fungal glycosyltransferases and adding the
desired mammalian glycosyltransferases. Cloning, inactivation, and replace-
ment of these genes can be achieved by applying PCR technology. Recently,
Borsig et al. (1995) have demonstrated the expression of a functional human
α-2,6(N)-sialyltransferase enzyme in S. cerevisiae. Theoretically, the same
gene could be expressed in filamentous fungal cells.
GRAS strain development

For the production of recombinant proteins or metabolites by fungal
organisms, it is important to use a fungal host which has a GRAS status. One
of the most important factors that is required to recognize a fungal strain as
safe is the absence of mycotoxins which are toxic to humans, animals, or
plants. A number of fungal strains used for antibiotic and food industries are
considered GRAS strains by the Food and Drug Administration (FDA) in
the United States. These include A. awamori, A. oryzae, A. chrysogenum, P.
chrysogenum and Fusarium graminerarum A3/5. If a mycotoxin-producing
fungus must be used to produce a desirable product, the cloning and
subsequent inactivation of genes encoding for one or more key enzymes in

the mycotoxin biosynthetic pathway could be used to generate new GRAS
strains. PCR will undoubtedly serve as a key technology for cloning and
characterizing these genes.
9.7 Summary
This chapter details the many uses of PCR technology in the genetic
engineering of industrial fungi for the commercial production of antibiotics,
enzymes, secreted proteins and speciality chemicals. One of the major
activities of industrial biotechnology process improvement laboratories is to
overexpress the desired antibiotic, enzyme, or therapeutic protein using
modern genetic engineering strategies through the construction of efficient
expression vectors. PCR technology appears to be particularly useful in the
development of improved vectors since most of the essential expression
components are derived from existing vectors but require changes in flanking
restriction sites. One of the highlights of this chapter is a detailed description
of how PCR technology was used to overproduce penicillin V amidase
(PVA) in engineered strains of F. oxysporum. When this host was trans-
formed with a vector containing a tandem repeat representing two copies of
the PVA gene, a nearly ten-fold improvement in enzyme production was
noted.
PCR has also been shown to be a convenient procedure to mutagenize
specific regions of an expression vector. Examples are described for the
introduction of specific mutations using IPCR and EIPCR. The utility of
RPCR, overlap PCR, and the use of PCR for the introduction of random
mutations have also been highlighted in this chapter.
Another important application of PCR in fungal biotechnology is its use in
characterizing high-producing industrial strains. Traditional strain improve-
ment methodologies, including random mutagenesis and directed selection,
have resulted in significant over-production of commercial metabolites.
However, the genetic basis for these improvements remains largely uncharac-
terized. PCR strategies, including RT–PCR and differential DDRT–PCR,
enable biotechnologists to identify discrete genes that may be tied to increased
expression in higher-producing strains. These altered genes now provide for
rational strategies for further improvements in strain productivity.
PCR applications will play even more important roles in future fungal
biotechnology research and development programmes. Strategies have been
described in this chapter on the efficient secretion of bovine chymosin
through the fusion of the chymosin gene to the last codon of the Aspergillus
awamori glucoamylase gene. Site-directed mutagenesis by PCR can be
utilized for the generation of fusion vectors and cleavable linker protein
products. Lastly, future uses of PCR and site-directed mutagenesis include
the development of potential commercial, non-toxin-producing GRAS
fungal strains for the development of proteinase-deficient fungal isolates and

for the development of fungal strains producing proteins with desirable
changes in their protein glycosylation process.
References
Appleyard, V.C.L., Unkles, S.E., Legg, M. and Kinghorn, J.R. (1995) Secondary
metabolite production in filamentous fungi displayed. Molecular and General
Genetics 247, 338–342.
Berka, R.M., Ward, M., Wilson, L.J., Hayenga, K.J., Kodama, K.H., Carlomagno, L.P.
and Thompson, S.A. (1990) Molecular cloning and deletion of the gene encoding
aspergillopepsin A from Aspergillus awamori. Gene 86, 153–162.
Borsig, L., Ivanov, S.X., Herrmann, G.F., Kragl, U., Wandrey, C. and Berger, E.G.
(1995). Scaled-up expression of human α2,6(N)sialyltransferase in Sacchar-
omyces cerevisiae. Biochemical and Biophysical Research Communications 210,
14–20.
Cadwell, R.C. and Joyce, G.F. (1995) Mutagenic PCR. In: Dieffenbach, C.W. and
Dvesker, G.S. (eds) PCR Primer – a Laboratory Manual. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York, pp. 583–589.
Chiang, S-J., Burnett, W.V. and Tonzi, S.M. (1996) Penicillin V amidohydrolase gene
from Fusarium oxysporum. U.S. Patent 5,516,679.
Christensen, T., Woeldike, H., Boel, E., Mortensen, S.B., Hjortshoej, K., Thim, L. and
Hansen, M.T. (1988) High level expression of recombinant genes in Aspergillus
oryzae. Bio/Technology 6, 1419–1422.
Dunn-Coleman, N.S., Bloebaum, P., Berka, R.M., Bodie, E.A., Robinson, N.,
Armstrong, G., Ward, M., Przetak, M., Carter, G.L., LaCost, R., Wilson, L.J.,
Kodama, K.H., Baliu, E.F., Bower, B., Lasma, M. and Heinsohn, H. (1991)
Commercially viable levels of chymosin production by Aspergillus. Bio/
Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production of full-length
cDNAs from rare transcripts: amplification using a single gene-specific oligo-
nucleotide primer. Proceedings of the National Academy of Sciences USA 85,
8998–9002.
Goosen, T., Bos, C.J. and van den Broek, H. (1992) Transformation and gene
manipulation in filamentous fungi: An overview. In: Arora, D.K., Elander, R.P.
and Mukerji, K.G. (eds) Handbook of Applied Mycology Volume 4: Fungal
Biotechnology. Marcel Dekker, New York, pp. 151–195.
Helmsley, A., Arnheim, N., Toney, M.D., Cortopassi, G. and Galas, D.J. (1989) A
simple method for site-directed mutagenesis using the polymerase chain reac-
Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K. and Pease, L.R. (1989) Site-directed
mutagenesis by overlap extension using the polymerase chain reaction. Gene 77,
51–59.
Huang, S.H., Hu, Y., Wu, C. and Holcenberg, J. (1990) A simple method for direct
cloning cDNA sequence that flanks a region of known sequence from total RNA
by applying the inverse polymerase chain reaction. Nucleic Acids Research 18,
1922.
Jenkins, N. and Curling, E.M.A. (1994) Glycosylation of recombinant proteins:

problems and prospects. Enzyme and Microbial Technology 16, 354–364.
Jones, D.H. and Howard, B.H. (1991) A rapid method for recombination and site-
specific mutagenesis by placing homologous ends on DNA using polymerase
chain reaction. BioTechniques 10, 62–66.
MacKay, V.L. (1987) Secretion of heterologous proteins in yeast. In: Stewart, G.G.,
Russell, I., Klein, R.D. and Hiebach, R.R. (eds) Biochemistry and Molecular
Biology of Industrial Yeasts. CRC Press, Boca Raton, Florida, pp. 27–36.
Malpricht, S., Thamm, A. and Khanh, N.Q. (1996) Cloning of cDNA for the protein
disulfide isomerase from Aspergillus niger strain NRRL3 using PCR. Bio-
technology Letters 18, 445–450.
Martin, J.F., Guitierrez, S., Fernandez, F.J., Velasco, J., Fierro, F., Marcos, A.T. and
Kosalkova, K. (1994) Expression of genes and processing of enzymes for the
biosynthesis of penicillins and cephalosporins. Antonie van Leeuwenhoek 65,
227–243.
Myers, R.M., Larin, Z. and Maniatis, T. (1985) Detection of single base susbstitutions
by ribonuclease cleavage of mimatches in RNA:DNA duplexes. Science 230,
1242–1246.
Miles, J.S. (1992) Structurally and functionally conserved regions of cytochrome
P-450 reductase as targets for DNA amplification by the polymerase chain
reaction: cloning and nucleotide sequence of the Schizosaccharomyces pombe
cDNA. Biochemical Journal 287, 195–200.
Nowak, C., Radzio, R. and Kuck, U. (1995) DNA-mediated transformation of a
fungus employing a vector devoid of bacterial DNA sequences. Applied
Microbiology and Biotechnology 43, 1077–1081.
Peberdy, J.F. (1994) Protein secretion in filamentous fungi – trying to understand a
highly productive black box. Trends in Biotechnology 12, 50–57.
Pont-Kingdon, G. (1994) Construction of chimeric molecules by a two step
recombinant PCR method. BioTechniques 16, 1010–1011.
Skatrud, P.L. (1992) Genetic engineering of β-lactam antibiotic biosynthetic pathways
in filamentous fungi. Trends in Biotechnology 10, 324–329.
Stanley, P. (1992) Glycosylation engineering. Glycobiology 2, 99–107.
Stemmer, W.P.C. and Morris, S.K. (1992) Enzymatic inverse PCR: a restriction site
independent, single-fragment method for high-efficiency, site-directed mutage-
nesis. BioTechniques 13, 214–220.
Tomic, M., Sunjevaric, I., Savtchenko, E.S. and Blumenberg, M. (1990) A rapid and
simple method for introducing specific mutations into any position of DNA
leaving all other positions unaltered. Nucleic Acids Research 18, 1656.
Upshall, A., Kumar, A.A., Bailey, M.C., Parker, M.D., Favreau, M.A., Lewison, K.P.,
Joseph, M.L., Maraganore, J.M. and McKnight, G.L. (1987) Secretion of active
human tissue plasminogen activator from the filamentous fungus Aspergillus
nidulans. Bio/Technology 5, 1301–1304.
Upshall, A., Kumar, A.A., Kaushansky, K. and McKnight, G.L. (1991) Molecular
manipulation of and heterologous protein secretion from filamentous fungi. In:
Leong, S.A. and Berka, R.M. (eds) Molecular Industrial Mycology: Systems and
Application for Filamentous Fungi. Marcel Dekker, New York, pp. 31–44.
Usher, J., Hughes, D.W., Lewis, M.A. and Chiang, S-J. D. (1992) Determination of
rate-limiting step(s) in the biosynthetic pathways leading to penicillin and
cephalosporin. Journal of Industrial Microbiology 10, 157–163.
Van den Brink, H.M., van Zeijl, C.M.J., Brons, J.F., van den Hondel, C.A.M.J.J. and
van Gorcom, R.F.M. (1995) Cloning and characterization of the NADPH
cytochrome P450 oxidoreductase gene from the filamentous fungus Aspergillus
niger. DNA and Cell Biology 14, 719–729.
Van den Hombergh, J.P.T.W., ven de Vondervoort, P.J.I. and Visser, J. (1996) Improve
the efficiency of protein expression by fungi. Chemtech 26, 30–36.
Ward, M., Wilson, L.J., Kodama, K.H., Rey, M.W. and Berka, R.M. (1990) Improved
production of chymosin in Aspergillus by expression as a glucoamylase-
chymosin fusion. Bio/Technology 8, 435–440.
Ward, P.P., Lo, J-Y., Duke, M., May, G.S., Headon, D.R. and Conneely, O.M. (1992)
Production of biologically active recombinant human lactoferrin in Aspergillus
oryzae. Bio/Technology 10, 784–789.
Zilberberg, N. and Gurevitz, M. (1993) Rapid isolation of full length cDNA clones
by ‘inverse PCR’: purification of a scorpion cDNA family encoding
α-neurotoxins. Analytical Biochemistry 209, 203–205.
Zimmerman, C.R., Orr, W.C., Leclerc, R.F., Barnard, E.C. and Timberlake, W.E.
(1980) Molecular cloning and selection of genes regulated in Aspergillus
development. Cell 21, 709–715.
Application of PCR in Studying 10
Lignocellulose Degradation by
Basidiomycetes
C.A. Reddy and T.M. D’Souza
Department of Microbiology and NSF Center for Microbial Ecology,
Michigan State University, East Lansing, MI 48824-1101, USA
10.1 Introduction
Lignin, cellulose and hemicellulose are the major structural polymers of plant
biomass comprising, respectively, 45%, 20–30% and 20–30% of the dry
weight of woody plants (Kirk and Farrell, 1987; Boominathan and Reddy,
1992). Because of the importance of lignocellulose as a renewable resource
for the production of paper products, feeds, chemicals and fuels, there has
been a considerable amount of research in recent years on the fungal
degradation of lignocellulose (Kirk and Farrell, 1987; Boominathan and
Reddy, 1992). Among the fungi, wood-rot basidiomycetes are considered the
most efficient degraders of lignocellulose. White-rot fungi completely
mineralize the three major lignocellulose polymers to CO2, whereas the
brown-rot fungi efficiently decompose cellulose and hemicellulose compo-
nents of wood but mineralize lignin only to a limited extent (Kirk and
Farrell, 1987; Reddy, 1993; Reddy and D’Souza, 1994). Earlier research
focused extensively on lignocellulose degradation by the white-rot basidio-
mycete Phanerochaete chrysosporium (Kirk and Farrell, 1987; Boominathan
and Reddy, 1992; Cullen and Kersten, 1992; Gold and Alic, 1993). However,
there has been a growing interest recently in studying lignocellulose
degrading systems of other wood-rot basidiomycetes (Higuchi, 1993; de
Jong et al., 1994; Hatakka, 1994; Tuor et al., 1995).
An increasing number of researchers are currently utilizing molecular
biological approaches to study fungal lignocellulose degradation (Cullen and
Kersten, 1992; Reddy, 1993; Gold and Alic, 1993; Reddy and D’Souza, 1994).
With the advent of the polymerase chain reaction (PCR) and its associated
methodologies (Saiki et al., 1985; Mullis and Faloona, 1987; Innis et al., 1990;
206 C.A. Reddy and T.M. D’Souza
Steffan and Atlas, 1991; Bej and Mahbubani, 1992; Dieffenbach and Dveksler,
1995), many researchers are using PCR-based strategies to better understand
the physiology and molecular biology of fungal lignocellulose degradation
and this is the focus of this review. A broad overview of the PCR techniques
is presented first and is followed by a review of the applications of PCR
methodology. The latter includes the detection, isolation and character-
ization of genes involved in lignocellulose degradation as well as studies on
the expression of these genes under varying environmental conditions.
10.2 Extraction of Nucleic Acids for PCR Amplification
10.2.1 From fungal mycelia

Most methods for DNA isolation from mycelia involve an initial lysis step
using freeze–thaw cycles (Garber and Yoder, 1983), or by grinding the
mycelia. Grinding is done with dry ice (Wahleithner et al., 1996), liquid
nitrogen (Raeder and Broda, 1988; Lee and Taylor, 1990; Graham et al.,
1994), liquid nitrogen and glass beads (Rao and Reddy, 1984), or glass beads
only (van Vaerenbergh et al., 1995). This is followed by the use of phenol/
chloroform/isoamyl alcohol extraction of the DNA and precipitation at a
high salt concentration with isopropanol or ethanol (Sambrook et al., 1989).
Gentle lysis of the mycelial cells by enzymatic hydrolysis (Black et al., 1989;
Li and Ljungdahl, 1994) results in more intact DNA, but the yield is lower
(van Vaerenbergh et al., 1995). Moreover, for use in PCR, mechanical
shearing of the genomic DNA during isolation is not a major concern
provided that the resulting DNA is ~10–20 kbp in size (Sogin, 1990; van
Vaerenbergh et al., 1995). However, in cases where the same DNA
preparations are used for both PCR and library construction, the DNA
needs to be relatively pure. This is accomplished by extraction with phenol
(Ashktorab and Cohen, 1992), cetyltrimethylammonium bromide (Kim et
al., 1990; Graham et al., 1994), or by using affinity chromatography (e.g.
Qiagen tip-500 mini-columns from Qiagen Inc., Los Angeles) (Wahleithner
et al., 1996). In a recent study comparing various methods for extraction of
DNA for PCR, it was reported that relatively pure DNA was needed even
for PCR applications in order to remove inhibitors of Taq polymerase,
especially from DNA samples of certain pigmented fungi (van Vaerenbergh
et al., 1995). These researchers also found that the use of glass beads for DNA
isolation reduced the amount of contaminating polysaccharides and inhibi-
tors, and suggested that the freeze–thaw-based method for DNA isolation
was superior to the other methods tested.
Fungal RNA isolation for use in PCR is based on standard protocols
using a guanidinium isothiocyanate step (Lucas et al., 1977; Chirgwin et al.,
1979; Timberlake and Barnard, 1981; Sims et al., 1988; Sambrook et al., 1989),
followed by ethanol precipitation in the presence of high concentration of
Study of Lignocellulose Degradation 207
salt (Sambrook et al., 1989; James et al., 1992), or isolation using affinity-
based systems (Li and Ljungdahl, 1994; Wahleithner et al., 1996). Poly(A)-
RNA is isolated from total RNA preparations using affinity column systems
containing oligo-dT-cellulose (de Boer et al., 1987; Sambrook et al., 1989;
Johnston and Aust, 1994a; Tempelaars et al., 1994), or magnetic beads
(Brooks et al., 1993; Broda et al., 1995; Lamar et al., 1995).
10.2.2 From soil

Approaches used for the isolation of total DNA from soil, for PCR
amplification of the fungal DNA component, are similar to those used
for isolation and PCR amplification of soil bacterial DNA described
previously (reviewed in Bej and Mahbubani, 1992; Picard et al., 1992;
Tebbe and Vahjen, 1993; Moré et al., 1994; Selenska-Pobell, 1995; Van Elsas
and Smalla, 1995). Johnston and Aust (1994b) used DNA extraction
followed by PCR amplification for detecting fungal DNA in soils spiked
with basidiomycetes. However, detection limits were low when compared
to the use of template DNA isolated from pure cultures; this could be
due to interference with the PCR amplification of the fungal DNA by
the contaminating humic acids and DNA from other soil organisms
(Tebbe and Vahjen, 1993; Tsai and Olson, 1993). In addition, clay in the
soil can bind DNA and reduce the yield (Ogram et al., 1987). Another
approach used is first to extract fungal cells from the soil and then extract
the DNA; however, this approach is found to be less efficient (Hilger and
Myrold, 1991). Recently, Thorn et al. (1996) described a procedure in
which they used a selective medium for isolating diverse groups of soil
basidiomycetes. However, it is not known what proportion of the total
basidiomycetes in soil were isolated by this method. DNA isolated from
selected pure cultures of soil basidiomycetes, utilizing the procedure of
Thorn et al. (1996), is currently being used in PCR for the isolation of
laccase and lip gene sequences (C.A. Reddy and T.M. D’Souza, unpub-
lished work).
10.3 PCR Amplification Methods used in Studies on

Lignocellulose Degradation
A number of papers have been published recently on the use of PCR
methodology for a variety of studies on lignocellulose degradation by
basidiomycetes. These studies include the detection, isolation and character-
ization of partial or complete lignocellulose degradative genes, the analysis of
allele segregation, and gene expression under varying environmental condi-
tions. PCR procedures used in these studies include DNA-PCR, RT–PCR,
competitive RT–PCR, and inverse PCR. In this section, we provide a brief
description of these procedures.
10.3.1 DNA-PCR
Replication of both strands of a target DNA sequence using a reaction
mixture consisting of a thermostable DNA polymerase, forward and reverse
oligonucleotide primers, the four deoxynucleotide triphosphates (dNTPs),
magnesium ions and an appropriate template DNA is the standard procedure
used for DNA-PCR (Saiki et al., 1985). The outcome is an exponential
amplification of the specific target fragment, depending on the number of
cycles of amplification performed (Saiki et al., 1985; Mullis and Faloona,
1987; Saiki et al., 1988; Vahey et al., 1995). Recent technologies have refined
this basic PCR procedure to make it simpler and more efficient, resulting in
enhanced amplification fidelity, higher specificity and minimizing DNA
contamination problems.
In studies on lignocellulose degradation by fungi, conventional DNA-
PCR procedures have been used to isolate and characterize lignin peroxidase
(Johnston and Aust, 1994b; Collins and Dobson, 1995; Rajakumar et al.,
1996; Schneider et al., 1996), manganese peroxidase (Asada et al., 1995),
laccase (Giardina et al., 1995; Wahleithner et al., 1996; Yaver et al., 1996;
D’Souza et al., 1996), cellobiohydrolase (Covert et al., 1992; Tempelaars et
al., 1994), cellulase (Chow et al., 1994) and xylanase (Li and Ljungdahl, 1994)
genes, as well as to analyse the allelic segregation patterns of some of these
genes (Gaskell et al., 1992, 1994, 1995). The procedure has also been used to
investigate the expression of lignocellulose degradative genes under varying
environmental conditions (Covert et al., 1992; Brooks et al., 1993; Reiser et
al., 1993; Broda et al., 1995; Gaskell et al., 1995; Rajakumar et al., 1996) as
described in later sections in this chapter.
10.3.2 RT–PCR
RNA can also serve as a template for PCR amplification after conversion to
cDNA (Todd et al., 1987; Veres et al., 1987). RNA-PCR, or RT–PCR
(reverse transcriptase–PCR) as it is more popularly known, is a modified
PCR procedure designed for analysing RNA transcripts. RT–PCR is more
sensitive than other methods used for RNA analysis, such as Northern
hybridization, S-1 nuclease analysis, RNase A protection assay and in situ
hybridization (Kawasaki, 1990). The first step in this procedure is the
synthesis of cDNA from RNA using reverse transcriptase. First strand
cDNA is synthesized using either total RNA or mRNA as template.
Random hexamers, the downstream primer, or oligo-dT can be used as
primers, although the use of random hexamers consistently gives better
amplification than the other two primers (Kawasaki, 1990). Since single RNA
molecules can be amplified efficiently, even relatively crude RNA prepara-
tions can be used as the starting template for RT–PCR. The newly
synthesized first strand cDNA is then used as a template for PCR, and the
target fragment is amplified. In cases where the downstream primer is used
for first-strand cDNA synthesis, it is necessary to add only the upstream
primer to the reaction mixture. However, both primers should be used for
PCR in cases where random hexamers or oligo-dT primers were used in the
first-strand cDNA synthesis (Ausubel et al., 1995). Contaminating DNA
serving as the template is a common problem encountered in RT–PCR.
Solutions to this problem include the use of primers positioned in separate
exons (Kawasaki, 1990), or RNase-free DNase I digestion to remove the
contaminating DNA (Ausubel et al., 1995).
In studies on lignocellulose degradation by basidiomycetes, the
RT–PCR technique has been used in the isolation of lignin peroxidase
(Rajakumar et al., 1996), manganese peroxidase (Matsubara et al., 1996),
laccase (Giardina et al., 1995) and cellobiohydrolase (Covert et al., 1992)
genes. The RT–PCR procedure has also been used in allele segregation
studies (Gaskell et al., 1995), and to investigate the expression of ligno-
cellulose genes under different environmental conditions (Covert et al., 1992;
Brooks et al., 1993; Johnston and Aust, 1994a; Broda et al., 1995; Gaskell et
al., 1995; Lamar et al., 1995; Bogan et al., 1996b).
10.3.3 Competitive RT–PCR

Competitive RT–PCR is a technique that is commonly used for quantification
of specific mRNA species (Gilliland et al., 1990). This procedure involves
co-amplification of a competing template that uses the same primers as those
for the target cDNA, but the amplified products can be distinguished from
each other as described below. Competitive templates can be either cDNA with
a new restriction site, or genomic DNA containing an intron in the region to be
amplified; the amplified product of the competitive template can then be
differentiated from the amplified product of the target DNA based on size.
PCR amplification with genomic DNA as the competitive template may not be
as efficient as that using cDNA because of the size increase and changes in
duplex melting temperature (Gilliland et al., 1990). Target cDNA should be
co-amplified with serial dilutions of competitor DNA of known concentra-
tion. Since a change in any of the variables (such as polymerase, dNTPs, Mg2+,
template DNA and primers) will affect the yield of target cDNA and the
competitive template equally, relative ratios of the two should be preserved
during amplification. The target cDNA concentration can then be estimated
by direct scanning of ethidium bromide-stained gels or by measuring the
radioactivity from incorporated radiolabelled dNTPs. Since the starting
concentration of the competitive template is known, the initial concentration
of the target cDNA can be determined fairly accurately. For example, it has
been claimed that less than 1 pg of target cDNA from 1 ng of total mRNA can
be accurately quantified using this procedure (Gilliland et al., 1990).
The competitive RT–PCR procedure has been employed in studying the
expression of lignin peroxidase (Stewart et al., 1992; Lamar et al., 1995),
manganese peroxidase (Bogan et al., 1996a) and cellobiohydrolase (Lamar et
al., 1995) genes.
10.3.4 Inverse PCR

DNA sequences that are outside of the target DNA sequence flanked by the
PCR primers can also be amplified by a modification of the basic PCR
procedure designated ‘inverse PCR’. In this approach, the template is
digested with a restriction enzyme that cuts outside the region to be
amplified; the restricted template is then circularized by ligation, and the
region outside the target sequence is amplified using primer sequences in the
opposite orientation to those used for the initial PCR (Ochman et al., 1988;
Triglia et al., 1988; Silver and Keerikatte, 1989). The inverse PCR method has
been extremely useful in studying upstream and downstream regions of a
target DNA segment, without the need to use conventional cloning
techniques. It can also be used to prepare hybridization probes to identify
and orient adjacent/overlapping clones isolated from a DNA library (Och-
man et al., 1990). The inverse PCR technique has been used in isolating the
cellobiohydrolase gene (Tempelaars et al., 1994).
10.4 Applications of PCR in Studies on Lignocellulose

Degradation by Basidiomycetes
10.4.1 Detection, isolation, and characterization of genes involved in
lignocellulose degradation
Wood-rot basidiomycetes are efficient degraders of the lignocellulose com-
plex. The key enzymes involved are lignin peroxidases (LIP), manganese-
dependent peroxidases (MNP), laccases, cellulases and xylanases. Several LIP
(H1, H2, H6, H7, H8, and H10), and MNP (H3, H4, H5, and H9) isozymes
produced by Phanerochaete chrysosporium, the prototype organism for
studies on lignin degradation, have been described (Kirk and Farrell, 1987;
Boominathan and Reddy, 1992; Cullen and Kersten, 1992; Gold and Alic,
1993). Recent studies have used PCR techniques to obtain a better under-
standing of the genes involved in lignocellulose degradation by P. chrysospo-
rium, as well as a number of other wood-rot basidiomycetes.
Lignin peroxidase genes

Johnston and Aust (1994a) designed oligonucleotide primers H8I (forward)
and H8II (reverse), corresponding to positions starting at 252 and 868 in the
LIP H8 gene (Smith et al., 1988) of P. chrysosporium BKM-F 1767, for the
detection of LIP H8 mRNA by RT–PCR (Table 10.1). Sequencing of a 402
bp PCR product verified the presence of H8 mRNA under N-limited or
N-sufficient culture conditions. In another study, Johnston and Aust (1994b)
used the same primers to detect P. chrysosporium in soil by PCR amplifica-
tion using total DNA isolated from soil as the template. This resulted in the
amplification of a 616 bp PCR fragment. However, they report that the
method for detecting P. chrysosporium BKM-F 1767 using the H8 gene
primers was not as sensitive as that using the internal transcribed spacer (ITS)
region of fungal ribosomal DNA (see Table 10.6).
Collins and Dobson (1995) described a method for PCR amplification
and cloning of lip gene sequences from four different white-rot fungi,
including P. chrysosporium ATCC 32629, Chrysosporium lignosum PM1,
Coriolus versicolor 290, and Bjerkandera adusta DSM 3375. Genomic DNA
was used as the template, with oligonucleotide primers corresponding to the
conserved amino acid motifs present in the distal and proximal histidine
regions of several P. chrysosporium LIP isozymes (Table 10.1). PCR-
amplified products, ranging between 600 and 700 bp, were sequenced and
found to have a nucleotide similarity of 70–80%. One of the PCR products
was also found to have a 90% similarity with GLG5, which encodes the LIP
isozyme H10 (Gaskell et al., 1991).
PCR-amplification procedures were also used to determine the possible
presence of lip gene sequences in genomic DNA of two white-rot basidiomy-
cetes Ceriporiopsis subvermispora and Phanerochaete sordida, which were
not known to produce LIPs (Rajakumar et al., 1996). Degenerate oligo-
nucleotide primers were prepared corresponding to amino acid motifs
surrounding an essential histidine residue highly conserved in LIPs but not
in MNPs (Table 10.1). Three genomic clones, two from C. subvermispora,
and one from P. sordida, were obtained after cloning of the PCR-amplified
products. These clones showed 92.6–95.6% amino acid similarity to lip A,
which encodes the LIP isozyme H8 in P. chrysosporium (Gaskell et al.,
1994).
Schneider et al. (1996) used oligonucleotide primers specific for the
H8-encoding LPOA gene of P. chrysosporium BKM-F 1767 (Holzbaur and
Tien, 1988) to PCR-amplify a 1590 bp fragment, designated HG3, from the
genomic DNA of this organism. Cloning and sequencing of HG3 showed
that it is related to, but distinct from, LPOA (Holzbaur and Tien, 1988) and
GLG3 (Naidu and Reddy, 1990), both of which are known to encode LIP H8
in P. chrysosporium, and that HG3 is possibly a non-allelic variant of the P.
chrysosporium BKM-F 1767 LIP H8 gene.
Manganese-dependent peroxidase genes

Asada et al. (1995) amplified mnp gene-specific sequences from genomic
DNA and cDNA of Pleurotus ostreatus using PCR. Synthetic 30- to 32-mer
primers (sequences not shown) that match the exon sequences around the
proximal and distal His residues of the MNP of P. chrysosporium were used
to obtain PCR products pcr1 using genomic DNA as the template, and pcr2
using cDNA as the template. Both pcr1 and pcr2 were cloned and sequenced.
A subsequent PCR, using cDNA as the template, and a 32-mer upstream
primer (sequence not shown) corresponding to the N-terminal amino acid
sequence of the purified MNP, and a 30-mer downstream primer (sequence
not shown) corresponding to a region near the 3′-end of pcr2, yielded a third
PCR product, designated pcr3. Comparison of the deduced amino acid
Table 10.1. Primers used for PCR amplification of lignin peroxidase-encoding genomic DNA and cDNA sequences.
Amplified
PCRb product
Genea Organism procedure 5′ Primer 3′ Primer (bp)b Referenceb
LPOA Phanerochaete chrysosporium DNA-PCR1 TGAGGCGCACGAGTCGATTCGTCT GACAAGCTCGAGCTCCTCGAACTC 6161, 4022 Johnston and
(LIP H8) BKM-F 1767 RT–PCR2 (H8I) (H8II) Aust (1994a1,
b2)
lip P. chrysosporium ATCC DNA-PCR T T 500–700 Collins and
32699, Chrysosporium TTCCACGATGCCATCGC GCAGCAATAGAATGGGC Dobson (1995)
lignorum PM1, Coriolus CT G T C G CG G C
versicolor 290, Bjerkandera
adusta DSM 3375
lip P. sordida HHB-8922, DNA-PCR C A A T 208–312 Rajakumar et al.
Ceriporiopsis subvermispora GCCTCGTGCCCGAGCCCTTCC AGCTGCGTCTCGATGAAGAACTG (1996)
L14807 T T T G G A A C
HG3 P. chrysosporium DNA-PCR ACTAAGCTTGAGCGGACATGGCCTT- CGCTGGATCCTATGGCATCATTTAAGCACC 1590 Schneider et al.
(LIP H8) BKM-F 1767 CAAGCA (1996)
lipA P. chrysosporium RT–PCR GCAGCTATCTCTCTCGCTCT TCCCAGTTCTTCGTCGAG 683, 1012 Stewart et al.
(LIP H8) BKM-F 1767 (1992); Lamar
et al. (1995)
lipB P. chrysosporium RT–PCR GCAGCGATTTCCCTCGCACT TCCCAGTTCTTCGTCGAG 683, 1006 Stewart et al.
(LIP H8) BKM-F 1767 (1992)
GLG5, lipC P. chrysosporium RT–PCR GCTGTTCTTACCGCCGCTCT TCCCAGTTCTTCGTCGAG 677, 999 Stewart et al.
(LIP H10) BKM-F 1767 (1992); Lamar
et al. (1995)
GLG4, P. chrysosporium RT–PCR CAGCCCTCTCCGTCGCCCTG TCCCAGTTCTTCGTCGAG 685, 1000 Stewart et al.
lipD BKM-F 1767 (1992); Lamar
(LIP H2) et al. (1995)
lipE P. chrysosporium RT–PCR TCGCCGCGATCACCGTCGCC TCCCAGTTCTTCGTCGAG 685, 1006 Lamar et al.
(LIP H8) BKM-F 1767 (1995)
0282 P. chrysosporium RT–PCR GCGGCTATCTCTCTTGCGCT TCCCAGTTCTTCGTCGAG 683, 1020 Stewart et al.
(LIP H2) BKM-F 1767 (1992)
V4 P. chrysosporium RT–PCR GCCATCGCGATCTCTCCC GACAAAGAATTGCGTATC 479, 694 Stewart et al.
(LIP H2) BKM-F 1767 (1992)
LIG1 P. chrysosporium RT–PCR GCCGCAATTTCTCTTGCTCTTTCCA TACATCGAACCACGCGCACGATGATT 1233, 1264, Brooks et al.
(LIP H8) ME446 (ATCC 34541) [UMG#90019] [UMG#90020] 1783, 1794 (1993)3; Broda
et al. (1995)4
LIG2 P. chrysosporium RT–PCR CATCGCAATTTCGCCCGCCATG- ACCTTCTGAACGAATGGCTTCTGGAGC 179, 222 Broda et al.
(LIP H8) ME446 (ATCC 34541) GAGGCA (1992)
LIG3 P. chrysosporium RT–PCR TATTGCCATCTCTCCTGCTATGGAGGCC ATGTTAGGGTGGAAGTTGGGCTCGATG 126, 179 Broda et al.
(LIP H8) ME446 (ATCC 34541) (1995)
LIG4 P. chrysosporium RT–PCR GTGCGCCTGGTTCCCCATTCTGCAG AATTGGTCTCGATAGTATCGAAGAC 222, 350 Broda et al.
(LIP H8) ME446 (ATCC 34541) (1995)
LIG5 c P. chrysosporium RT–PCR TTGCCCCGACGGCGTGCACAC GGTCTCGATCGAGGAGAAGGTAATGATC 2353, 3553, Brooks et al.
(LIP H2) ME446 (ATCC 34541) [UMG#90084] [UMG#90081] 2224, 3504 (1993)3; Broda
et al. (1995)4
LIG6 P. chrysosporium RT–PCR GACCTGCTCGAACGGCAAGGTCGTCC CATGATAGAACCATCGGCGCCTCGC 222, 350 Broda et al.
(LIP ?) ME446 (ATCC 34541) (1995)
lip P. chrysosporium DNA-PCR GGAATTCCACGATGCNATCGC T G CG G C Not given Reiser et al.
BKM-F 1767 (ATCC 24725) CT T AACTGCAGCAGCAATAGAATGTGC (1995)
[Oligo D] C G
[Oligo P]
lipI P. chrysosporium RT–PCR TATATGCCTCTGAGCTCCTG ACGTCTGTCTAGAAGTATGC 683, 1020 Gaskell et al.
(LIP H2) ME446 (1995)
lip P. sordida RT–PCR C A A CGACTCAGAGCTACTTCTTGA ~200, ~310 Rajakumar et al.
HHB-8922 GCCTCGTGCCCGAGCCCTTCC (1996)
T T T G G
lip C. subvermispora RT–PCR TTGTGCCGGAGCCGTTCC GAAGAACTGGGAGTCGAA No product Rajakumar et al.
L14807 (1996)
lipA P. chrysosporium RT–PCR TCCATCGCAATTTCGCCC ACACGGTTGATGATTTGG 301, Bogan et al.
(LIP H8) BKM-F 1767 not given (1996b)
lipB P. chrysosporium RT–PCR GCTATTGCCATCTCTCCT ACACGAGCGATGATCTGG 301, Bogan et al.
lipC P. chrysosporium RT–PCR GCCATCGCTATCTCTCCC ACACGGTCGATGATTTGG 298, Bogan et al.
continued overleaf
Table 10.1 continued.
Amplified
PCRb product
Genea Organism procedure 5′ Primer 3′ Primer (bp)b Referenceb
lipD P. chrysosporium RT–PCR TCCATCGCTATCTCGCCC ATGCGAGCGAGAACCTGA 301, Bogan et al.

lipE P. chrysosporium RT–PCR TCCATCGCCATCTCGCCC ACGCGGGCGATGATCTGG 301, Bogan et al.
lipF P. chrysosporium RT–PCR TGCCCTTGAGTCTCAAGG ACGCGAGAGATGATGTGG 301, Bogan et al.
(LIP ?) BKM-F 1767 not given (1996b)
lipG P. chrysosporium RT–PCR TCGATCGCCATCTCGCCC ACACGCTCGATGAGCTGG 301, Bogan et al.
lipH P. chrysosporium RT–PCR GCAATTGCCATCTCGCCC ACACGGTTAATGAGCTGG 301, Bogan et al.
lipI P. chrysosporium RT–PCR TCTATCGCTATCTCTCCC ACACGGCTGATGATTTGA 301, Bogan et al.
lipJ P. chrysosporium RT–PCR GCCATCGCGATCTCTCCC ACCCGAGCCAGGATTTGA 298, Bogan et al.
a
Lignin peroxidase isozymes encoded by the given lip genes (Kirk and Farrell, 1987; Boominathan and Reddy, 1992; Cullen and Kersten, 1992; Gold and
Alic, 1993) are given in parentheses.
b
Superscripts in the ‘PCR procedure’ and ‘Amplified product’ columns refer to the corresponding superscripts in the ‘Reference’ column.
c
The upstream and downstream sequences of the primers for LIG5 were erroneously switched in Table 1 of Broda et al (1995). These sequences are shown
correctly in this Table and in Brooks et al (1993).
sequence of pcr3 to the N-terminal amino acid sequences of MNPs revealed

that it was part of an MNP gene. Using the cassette–primer PCR technique
and a high fidelity Takara EX Taq polymerase, full-length sequences of
genomic DNA and cDNA of the mnp gene were then obtained, cloned,
sequenced and analysed. Their results showed that the P. ostreatus mnp gene
is more closely related to the P. chrysosporium lip genes, with respect to
sequence similarity and intron/exon organization, than to the mnp genes of
this organism.
Full-length mnp genes were also obtained using PCR with primers
(Table 10.2) corresponding to the region of the translational start and stop
codons of mnp genes of P. chrysosporium BKM-F 1767 (Bogan et al., 1996a).
These PCR-amplified MNP gene products served as templates in com-
petitive RT–PCR experiments to analyse mnp transcripts of P. chrysosporium
BKM-F 1767 during bioremediation of soils contaminated with poly-
aromatic hydrocarbons (PAH) (described in section 10.4.3).
Matsubara et al. (1996) performed RT–PCR of poly(A)-RNA from the
lignin-degrading deuteromycete IZU-154. DNA primers were synthesized
corresponding to amino acid sequences around distal and proximal histidine
residues in mnp genes of P. chrysosporium (Table 10.2). The resulting PCR
fragments, approximately 400 bp in size, were isolated and labelled with
digoxigenin using the DIG DNA labelling kit (Boehringer Mannheim), and
were used to screen the cDNA library of IZU-154. Eight positive clones
were obtained and separated into two groups based on restriction enzyme
mapping and partial nucleotide sequences. Two cDNAs (IZ-MnP1 and
IZ-MnP2), representative of the two groups, were further analysed. The
coding sequences of IZ-MnP1 and IZ-MnP2 were 1152 bp (384 amino acids)
and 1155 bp (385 amino acids), respectively, and showed 96.2% nucleotide
and 95.1% amino acid similarities to each other. Also, IZ-MnP1 showed
72.5% nucleotide and 79% amino acid similarity to P. chrysosporium mnp1
cDNA (Pribnow et al., 1989).
Laccase genes
Laccase, in addition to its role in lignin biodegradation (Bourbonnais and
Paice, 1990; Hatakka, 1994), also has important applications in the bleaching
of wood pulp (Bourbonnais and Paice, 1992) and the degradation of phenolic
compounds (Bollag et al., 1988; Roy-Arcand and Archibald, 1991). The
structure and function of fungal laccases were reviewed by Thurston (1994).
A number of researchers have used PCR as a tool in their studies on the
laccase genes of wood-rotting basidiomycetes (Giardina et al., 1995, 1996;
Yaver et al., 1996; Wahleithner et al., 1996; D’Souza et al., 1996) and these
studies are reviewed in this section.
Giardina et al. (1995) used RT–PCR and the rapid amplification of
cDNA ends (RACE) technique (Frohman et al., 1988) to amplify partial
cDNA fragments encoding the laccase pox1 gene from the white-rot
basidiomycete Pleurotus ostreatus. After first-strand cDNA synthesis using
Table 10.2. Primers used for PCR amplification of manganese peroxidase-encoding genomic DNA and cDNA sequences.
Amplified
PCR product
Genea Organism procedure 5′ Primer 3′ Primer (bp) Reference
mnp-1 Pleurotus ostreatus IFO 30160 DNA-PCR Not given Not given Not given Asada et al.
(MNP H4) (1995)
mnp-1 P. chrysosporium DNA-PCR GCAATGGCCTTCGGTTCTCT TTAGGCAGGGCCATCGAACT Not given Bogan et al.
(MNP H4) BKM-F 1767 (ATCC 24725) (1996a)
mnp-2 P. chrysosporium DNA-PCR CAGATGGCCTTCAAGTCCCT TTATGCGGGACCGTTGAACT Not given Bogan et al.
(MNP ?) BKM-F 1767 (ATCC 24725) (1996a)
mnp-3 P. chrysosporium DNA-PCR GCACTCAAGCCAGCGCAATG TGTCCGGCGCGTCAGACTTA Not given Bogan et al.
(MNP H3) BKM-F 1767 (ATCC 24725) (1996a)
MNP Fungus IZU-154, RT–PCR ATCCGCCTCACCTTCCACGA GCGACGGAGTGGGAGGCGAG ~400 Matsubara et al.
P. chrysosporium ME446 (1996)
mnp1 P. chrysosporium RT–PCR TCCGGTCAACGGCTTGGTATTCCAG GCGATCGTCTTGTTCGGGCGGCCAG 517, 676 Broda et al.
(=mnp-2) ME446 (ATCC 34541) (1996)
(MNP ?)
mnp-1 P. chrysosporium RT–PCR CAGACGGTACCCGCGTCACC AGTGGGAGCGGCGACATCAC Not given Bogan et al.
(MNP H4) BKM-F 1767 (ATCC 24725) (1996a)
mnp-2 P. chrysosporium RT–PCR CCGACGGCACCCGCGTCAGC CGAGCGGGAGCGGCGACGCC Not given Bogan et al.
(MNP ?) BKM-F 1767 (ATCC 24725) (1996a)
mnp-3 P. chrysosporium RT–PCR CCGACGGTACCAAGGTCAAC AGCGGCAGCGGCGACGCGAC Not given Bogan et al.
(MNP H3) BKM-F 1767 (ATCC 24725) (1996a)
a
Manganese peroxidase isozymes encoded by the given mnp genes (Kirk and Farrell, 1987; Boominathan and Reddy, 1992; Cullen and Kersten, 1992; Gold
and Alic, 1993) are shown in parentheses.
reverse transcriptase (RT) and the RT primer, another primer was used to
amplify a 750 bp cDNA fragment corresponding to the 3′-end of the pox1
gene (Table 10.3). A second PCR was carried out using two new primers and
the first-strand cDNA as template to amplify a 900 bp cDNA fragment
corresponding to the 5′-end of the pox1 gene. Except the RT primer, the
primers were derived from the genomic DNA sequence determined earlier
for the pox1 gene (Table 10.3). Together the two PCR fragments obtained
accounted for the entire pox1 cDNA. The deduced amino acid sequence of
pox1 showed 45–63% similarity with the laccase genes of Coriolus hirsutus,
basidiomycete PM1 (CECT 2971), Phlebia radiata and Agaricus bisporus,
but only 20–27% similarity with the laccase genes of Neurospora crassa,
Aspergillus nidulans and Cryphonectria parasitica (Giardina et al., 1995). In
order to determine whether pox1 and pox2 (another P. ostreatus laccase gene)
were allelic or not, two separate PCR amplification experiments were
performed using the genomic DNA from six monokaryotic isolates as the
templates. The two primer sets were located at identical positions on both
pox1 and pox2 sequences, thus resulting in the amplification of 570 bp
fragments (Table 10.3). However, the two products were distinguishable
because of the presence of a unique HindIII site in pox1, and a unique
BamHI in pox2. The results showed that the two genes segregated together
into monokaryons and hence were non-alleles (Giardina et al., 1995).
In a subsequent study, Giardina et al. (1996) used RT–PCR to synthesize
the entire laccase pox2 cDNA sequence, as well as the genomic equivalent of
the pox2 gene. RT–PCR was done using mRNA and the oligonucleotide
primer dT-NotI (Table 10.3). This was followed by PCR with the high
fidelity Pfu polymerase, using the primer pairs O1/O2, LAC1/LAC2, and
LAC3/dTNotI (Table 10.3), at annealing temperatures of 50°C, 60°C and
53°C, respectively. To amplify the 3′-end of the pox2 gene, primer pairs
LAC3/LAC4 (Table 10.3) were used with Pfu polymerase, genomic DNA as
template, and an annealing temperature of 60°C. The pox2 cDNA had 84%
nucleotide and 90% amino acid similarity with the pox1 cDNA (Giardina et
al., 1996).
Yaver et al. (1996) used RT–PCR and two degenerate oligonucleotide
primers (Table 10.3), one based on the N-terminal sequence of laccase and the
other based on the C-terminal sequence of the C. hirsutus gene, to amplify a
laccase gene-specific PCR product from Trametes villosa using first-strand
cDNA synthesized from poly(A)-RNA of xylidine-induced cells. The first-
strand cDNA was synthesized using reverse transcriptase and a commercial
cDNA synthesis kit (Gibco BRL). The PCR product was then used as a probe
to screen a cDNA library of T. villosa and obtain more than 100 positive clones.
Out of these, the longest clone (LCC cDNA) was sequenced and found to have
an identity of 90% with the sequence of the C. hirsutus laccase.
A 220 bp PCR-amplified fragment, isolated from genomic DNA of the
phytopathogenic fungus Rhizoctonia solani with oligonucleotide degenerate
primers, was used to isolate laccase gene sequences from a R. solani genomic
Table 10.3. Primers used for PCR amplification of laccase-encoding genomic DNA and cDNA sequences.
Amplified
PCR product
Genea Organism procedure 5′ Primer 3′ Primer (bp) Referencea
Laccase Pleurotus ostreatus RT–PCR CGCAGATCCCAACTTGGGATCGACTGGCTT AATTCGCGGCCGCTTTTTTTTTTTTTTT 750 Giardina et al.

(3′-pox1) (str. Florida) [03] [04] (1995)
Laccase Pleurotus ostreatus RT–PCR ATGTTTCCAGGCGCACGG CCAGTCGATCCCAAGTTGGG 900 Giardina et al.
(5′-pox1 1, (str. Florida) [01] [02] (19951, 19962)
5′-pox2 2)
Laccase Pleurotus ostreatus DNA-PCR GCTGGCACGTTCTGTAAG TCTGCCTCGATGACCTGC 570 Giardina et al.
(pox1) (str. Florida) [05] [06] (1995)
Laccase Pleurotus ostreatus DNA-PCR GCTGGAACGTTTTGTAAG TCTGCTTCAATGACGAGC 570 Giardina et al.
(pox2) (str. Florida) [07] [09] (1995)
Laccase Pleurotus ostreatus RT–PCR CGCTCTAGACTCGTCATTGAAGCAGATG GCGCTGCAGCTAAGCTATGCCACCTTTGTC 842 Giardina et al.
(3′-pox2) (str. Florida) [LAC1] [LAC2] (1996)
Laccase Pleurotus ostreatus RT–PCR CATCCATTCCATCTTCACGGC AATTCGCGGCCGCTTTTTTTTTTTTTTT 434 Giardina et al.
(3′-pox2) (str. Florida) [LAC3] [dt-NotI] [=04, see above] (1996)
Laccase Pleurotus ostreatus DNA-PCR CATCCATTCCATCTTCACGGC CGTCGGAGATGAGGTTC Not given Giardina et al.
(3′-pox2) (str. Florida) [LAC3] [LAC4] (1996)
Laccase Trametes villosa RT–PCR ACCAGNCTAGACACGGGNTGAGATACT- CGCGGCCGCTAGGATCCTCACAATGGCCAA- Not given Yaver et al.
GACGNGAAGCGGACTTGCTGGTCACT- GTCTCTGCCTCGACCTTC (1996)
ATCTTCGAAGATCTCG
Laccase Rhizoctonia solani DNA-PCR T 220 Wahleithner et
ATCCATTGGCATGGNTTTTTTCAA GTGNCAATGATACCAGAANGT al. (1996)
A C C C C G A GTG G A
Laccase Fomes fomentarius DNA-PCR CATTGGCATGGNTTTTTTCA GTGGCTATGATACCAGAANGT 144–217 D’Souza et al.
TVJ-93-7-T, Ganoderma C C C C A A G G A (1996)
lucidum (strains 58537
and 103561), Gloeophyl-
lum trabeum Madison-
617-R, Grifola frondosa,
Lentinula edodes RA-
3-2-E, Lentinus tigrinus,
Phlebia brevispora HHB-
7099-Sp, Phlebia tremel-
losa FP-101416, Pleuro-
tus ostreatus NRRL 2366,
Trametes (Coriolus) versi-
color ATCC 12679
a
Superscripts in the ‘Gene’ column refer to the corresponding superscripts in the ‘Reference’ column.
DNA library (Wahleithner et al., 1996). The primers corresponded to two

amino acid sequences conserved among laccases (IHWHGFFQ and
TFWYHSH; Table 10.3). The sequence of the cloned PCR fragment had
60% similarity to the corresponding region of a C. hirsutus laccase gene
(Kojima et al., 1990). Sequencing of 15 other PCR clones established the
presence of three distinct laccase genes, designated lcc1, lcc2, and lcc3. Using
the cloned PCR fragment as the probe, nine genomic clones were isolated
from the R. solani genomic library.
D’Souza et al. (1996) used primers (Table 10.3), based on the conserved
sequences around the two pairs of histidines in the N-terminal copper-
binding regions of known basidiomycete laccases, to rapidly isolate laccase
gene-specific sequences from different wood-rot basidiomycetes. Genomic
DNA was isolated from each of the wood-rot fungi and used as the template
in PCR. Of the 11 white-rot and brown-rot fungi (belonging to nine genera)
used for the amplification of the laccase gene-specific PCR products, eight
gave amplification products of approximately 200 bp. One strain, Gloeo-
phyllum trabeum Mad-617-R, a brown-rot fungus, gave a 144 bp PCR
product. No PCR products were obtained for Fomes fomentarius and
Pleurotus ostreatus, two white-rot fungi which are known to produce
laccases (Hatakka, 1994). However, Southern hybridization of restriction
enzyme-digested genomic DNA of F. fomentarius and P. ostreatus, using the
G. trabeum 144 bp PCR product as the probe, showed hybridization bands
indicating that laccase genes are present in these two strains. Several of the
white-rot fungi tested gave two PCR products, one of 144 bp, and the other
of the expected 200 bp. Sequencing of the larger PCR product revealed a size
range of 197–217 bp; the smaller PCR products all were 144 bp in size
(D’Souza et al., 1996). All the PCR products sequenced had a high degree of
similarity to corresponding regions of previously published laccase gene
sequences. Alignment of the predicted amino acid sequences of the PCR-
amplified products showed high similarities between the laccase gene
segments of the wood-rotting fungi and lower similarities to those of
Aspergillus nidulans and Neurospora crassa, two laccase producing non-
wood rotters (Fig. 10.1). Following up on the demonstration of a laccase
gene-specific PCR product from the genomic DNA of the brown-rot fungus
G. trabeum, D’Souza et al. (1996) demonstrated for the first time the
presence of laccase activity in cultures of this and other brown-rot fungi.
Using the approach described above, a laccase gene-specific 199 bp PCR
product was recently isolated and sequenced from a soil basidiomycete,
AX-1 (Srinivasan et al., 1996). The laccase gene fragment of AX-1 showed a
high degree of nucleotide similarity (62–94%) to the corresponding portions
of laccase genes from wood-rotting basidiomycetes.
Cellulase genes
A large number of microorganisms degrade cellulose in nature; of these,
fungi are perhaps the most studied. Cellulolytic enzymes include the
Fig. 10.1. Alignment of the predicted amino acid sequences of the PCR-amplified
laccase gene products (D’Souza et al., 1996). The abbreviations for the fungal strains are:
Tv, Trametes versicolor; Pb, Phlebia brevispora; Gl 103561 and Gl 58537, Ganoderma
lucidum strains 103561 and 58537; Le1 and Le2, Lentinula edodes PCR products 1 and
2; Lt, Lentinus tigrinus; Gt, Gloeophyllum trabeum; Tvi, Trametes villosa; Po, Pleurotus
ostreatus; PM1, unidentified basidiomycete; Ch, Coriolus hirsutus; Cv, Coriolus versicolor;
Pr, Phlebia radiata; Ab, Agaricus bisporus; An, Aspergillus nidulans; Nc, Neurospora
crassa. Sequences from the latter nine organisms were taken from published literature (see
D’Souza et al., 1996). Alignment was done using the GENEPRO program (Riverside
Scientific Enterprises). The program introduces gaps where necessary to optimize the
alignments. Amino acid positions with a ≥ 50% match are highlighted. Invariant amino acid
positions are shown in bold.
hydrolytic cellulases and oxidative cellulases. Hydrolytic cellulases consist

of three classes: endoglucanases (EG), cellobiohydrolases (CBH) and
β-glucosidases. Oxidative cellulases consist of two classes: cellobiose qui-
none oxidoreductase (cellobiose dehydrogenase) and cellobiose oxidase
(Eriksson et al., 1990; Béguin and Aubert, 1995). Fungal and bacterial
cellulases share similar functional characteristics, including a catalytic core, a
conserved cellulose-binding terminal region, and an intervening, highly
glycosylated hinge region (Knowles et al., 1987; Gilkes et al., 1991; Bayer et
al., 1996). A brief review of the use of PCR methodology for studying the
cellulases of ligninolytic fungi is presented here.
Covert et al. (1992) characterized three structurally related CBH genes
(cbh1-1, cbh1-2 and cbh1-3) from P. chrysosporium which were closely
related to the Trichoderma reesei cbh-1 gene (Shoemaker et al., 1983). Full-
length cDNA species encoding P. chrysosporium cbh1-1, cbh1-2 and cbh1-3
were amplified by PCR, cloned, and sequenced. RT–PCR was carried out
using total RNA isolated from P. chrysosporium BKM-F 1767 cellulolytic
cultures using downstream primers (Table 10.4) to synthesize first-strand

cDNA of cbh1-1 and cbh1-3. Then, upstream primers were used to amplify
the cDNA for these two genes. The cDNA cbh1-2 was amplified by DNA-
PCR employing double-stranded cDNA (synthesized using an oligo-dT
primer) as the template and two specific primers (Table 10.4) (Covert et al.,
1992). A highly conserved region, assumed to be the catalytic site, within the
P. chrysosporium cDNAs cbh1-1, cbh1-2 and cbh1-3 was 80%, 69% and 80%
similar, respectively, to the corresponding region within the T. reesei cbh-1
gene. However, analysis of the P. chrysosporium cbh1-1 gene revealed that it
was different from other fungal cellulase genes because it did not contain the
hinge or tail regions. Transcription studies on these three genes were also
carried out using competitive RT–PCR (described in Section 10.4.3).
Two allelic variants of the P. chrysosporium ME-446 cbhII gene were
isolated from a cDNA library after screening with a T. reesei cbhII gene
probe (Tempelaars et al., 1994). Characterization of these cDNAs by
restriction enzyme analysis, Southern hybridization analysis, and partial
sequencing using the dideoxy chain-termination method, revealed that they
were very similar, and in the cellulose-binding domain had a 65% amino acid
similarity to the corresponding region of the T. reesei cbhII gene. The results
also revealed that the entire cbhII gene is present on a PstI genomic fragment.
Therefore, inverse PCR (Ochman et al., 1990) was used to amplify a 1.1 kbp
fragment from PstI-digested and religated genomic DNA, using two primers
(Table 10.4) deduced from the cbhII cDNA sequence, and the high fidelity
Pfu polymerase. The inverse PCR was followed by conventional DNA-PCR
using the 1.1 kbp PCR-amplified DNA fragment as the template and two
primers, based on the DNA sequence adjacent to the PstI restriction site. The
resulting 2.3 kbp PCR-amplified genomic cbhII fragment was cloned,
sequenced, and analysed. Sequence comparison showed that both the
genomic and cDNA clones represent two distinct classes (type 1 and type 2),
which were later shown to be allelic variants (Tempelaars et al., 1994).
Chow et al. (1994) isolated two allelic forms of a cellulase (endogluca-
nase) CEL3-encoding cDNA from a cDNA library of A. bisporus, an
important commercial mushroom. The cDNA library was constructed in
lambda ZAP-PII (Raguz et al., 1992) from cDNA synthesized from a
cellulose-grown mycelial culture. A sample of this cDNA library was excised
in vivo as pBluescript plasmids with R408 helper phage (Short et al., 1988),
and total plasmid DNA was isolated from the bacterial culture harbouring
these plasmids. PCR amplification was performed on the total plasmid DNA
using a 20-mer degenerate oligonucleotide (OL60B1, Table 10.4), which is
complementary to a region from a 19 kDa CNBr CEL3-cleaved peptide, as
the reverse primer, and the T7 primer (Table 10.4) which corresponds to a
region 5′ of the insertion site in the pBluescript plasmid, as the forward
primer. Three PCR amplified products, 400 bp, 600 bp and 1.1 kbp in size,
were obtained. Northern hybridization studies showed that the 400 bp PCR
Table 10.4. Primers used for PCR amplification of cellulase-encoding genomic DNA and cDNA sequences.
Amplified
PCR product
Gene Organism procedure 5′ Primer 3′ Primer (bp)a Referencea
cbh1-1 P. chrysosporium RT–PCR GAGAATTCTGAAACCGCTACACATT TGAATTCCACCAATATTCACGCAGG Not given Covert et al.

BKM-F 1767 (ATCC 24725) (1992)
cbh1-2 P. chrysosporium DNA-PCR GAGAATTCGAGGTTGAGACGCGATA TTGTGACCCCAGCATTAGATACA Not given Covert et al.
BKM-F 1767 (ATCC 24725) (1992)
cbh1-3 P. chrysosporium RT–PCR GAGAATTCTACCGTCTGCTCACACT GAGAATTCCTTAGTAGCACTGGGA Not given Covert et al.
BKM-F 1767 (ATCC 24725) (1992)
cbh1-1 P. chrysosporium Competitive CACAGTGTGTCCAAGGGATGTC CAAAAGCCCGTGTTGGAGGT 221, 274 Covert et al.
BKM-F 1767 (ATCC 24725) RT–PCR [pr6] [pr7] (1992)
cbh1-2 P. chrysosporium Competitive GCCGATGGTGGACTTGC CGTGGTACCAAGCCAGCCTT 132, 197 Covert et al.
BKM-F 1767 (ATCC 24725) RT–PCR [Ps1] [pr5] (1992)
cbh1-3 P. chrysosporium Competitive GCTAAGTACGGTACCGGCTA GCAGTCGCTTCCGGAGCAGC 226, 286 Covert et al.
BKM-F 1767 (ATCC 24725) RT–PCR [pr3] [pr2] (1992)
cbhII P. chrysosporium Inverse GACGTCTAGAGGCTGGTGATAACGG ATCAAGCTTGCCGGCTTCGGTACCC 1100 Tempelaars et
ME446 (ATCC 34541) PCR al. (1994)
cbhII P. chrysosporium DNA-PCR GCGAATTCCACATTCCAGCATTTCAT- CGCTGCAGAGATGCTAACCGAATTT- 2300 Tempelaars et
ME446 (ATCC 34541) CCGTTG CAACCGG al. (1994)
cbh1.1 P. chrysosporium DNA-PCR ACAATGTTCCGCACTGCTACTT AGGGTGCCCGCGGAGGTGCC Not given1, Tempelaars et
ME446 (ATCC 34541) [G36] [G32] 8402, 9502 al. (1994)1,
Broda et al.
(1995)2
Table 10.4 continued
Amplified
PCR product
Gene Organism procedure 5′ Primer 3′ Primer (bp)a Referencea
cbh1.2 P. chrysosporium DNA-PCR CACTCCTCGCATTCACTTGTCT CTGCCGGTCTCGGTCCAGTTGC Not given1, Tempelaars et

ME446 (ATCC 34541) [G34] [G35] 5602, 8402 al. (1994)1,
Broda et al.
(1995)2
cbhII P. chrysosporium DNA-PCR CCTCAGCCCTTACTACGC CCAATCTACCTCTACAGC Not given1, Tempelaars et
ME446 (ATCC 34541) [#29] [#32] 9502, 13302 al. (1994)1,
Broda et al.
(1995)2
cel3 Agaricus bisporus DNA-PCR T 400, 500, Chow et al.
D649 CCTTGATCNACGATAAAATG GTAATACGACTCACTATAGGGC 1100 (1994)
C G A G G [T7]
[OL60B1]
cbh1-4 P. chrysosporium RT–PCR GATCGAATTCATGTTCCGCGCCGCCGCACT GATCGAATTCTTAGTAGCACTGCGAGTAGT 1537 van Rensburg et
BKM-F 1767 (ATCC 24725) [CBH-5′] [CBH-3′] al. (1996)
cbh1-1 P. chrysosporium RT–PCR TCCTTTTGTTGGGCGTCGTC ACCTCCAACACGGGCTTTG 766, 8176 Lamar et al.
BKM-F 1767 (1995)
cbh1-4 P. chrysosporium RT–PCR AAGGTCGTCCTCGACTCGAA CTCCAAGCCCTTCACCGTCG 741, 7795 Lamar et al.
BKM-F 1767 (1995)
a
Superscripts in the ‘Amplified product’ column refer to the corresponding superscripts in the ‘Reference’ column.
product hybridized to a 1.4 kbp cel mRNA; the 600 bp product to a 1.4 kbp
mRNA as well as to a small mRNA thought to be non-cel mRNA. The
1.1 kbp PCR-amplified product was assumed to be an almost full-length
copy of the cel3 cDNA. The 400 bp PCR product was digested with EcoRI
to remove a small terminal vector sequence, labelled with 32P-dCTP, and
used as a probe to screen the cDNA library (Chow et al., 1994) to obtain 14
cDNA clones which were then analysed. The nucleotide sequence of the
clones showed that two types of cDNAs were isolated. Using genomic DNA
from four monokaryotic mycelia, the segregation pattern of the cel3 gene was
studied. Since two differing patterns of hybridization were obtained in
Southern hybridization analysis, it was concluded that the two genes were
allelic (Chow et al., 1994). These alleles had 98.8% sequence identity to each
other.
A cDNA fragment encoding the P. chrysosporium cellobiohydrolase
(cbh1-4) was amplified using RT–PCR and cloned (van Rensburg et al.,
1996). First-strand cDNA was synthesized from P. chrysosporium BKM-F
1767 poly(A)-RNA using a commercial kit and commercial primers
(Boehringer Mannheim). The DNA was then amplified using two primers
(Table 10.4), CBH-5′ (forward primer), and CBH-3′ (reverse primer) based
on a previously published cbh1-4 gene sequence (Vanden Wymelenberg et
al., 1993). The 1537 bp PCR-amplified product was determined to be
identical to the published nucleotide sequence of cbh1-4, minus the two
introns (Vanden Wymelenberg et al., 1993). It was subcloned into the yeast
multicopy episomal plasmid pJC1 by inserting it between the yeast
phosphoglycerate kinase-I gene promoter (PGK1P) and terminator
(PGK1T) sequences. The recombinant plasmid (pCBH) contained the
PGK1P-cbh1-4-PGK1T construct, designated CBH1. A 3477 bp PvuII
DNA fragment containing this CBH1 construct was excised from pCBH
and subcloned into a unique SmaI site of another plasmid, pEND. This
plasmid consisted of the yeast multicopy episomal, expression/secretion
vector (pDLG4) and the gene end1, which encodes the endo-β-1,4-glucanase
of Butyrivibrio fibrisolvens, a cellulolytic rumen bacterium. The resulting
12 kbp plasmid, designated pENCB, was transformed into the yeast
Saccharomyces cerevisiae, and the coexpression of cbh1-4 and end1 was
analysed. The maximum cellulolytic activity of the transformed S. cerevisiae
Y294 [pENCB], containing both the genes, was 1380 U as compared to S.
cerevisiae with cbh1-4 (which had a maximum cellobiohydrolase activity of
12.03 U) and end1 (which had a maximum endo-β-1,4-glucanase activity of
1100 U). These studies indicated that coexpression of both the genes results
in enhanced cellulose degradation (van Rensburg et al., 1996).
Cellobiose dehydrogenase (CDH) is a haemoflavoenzyme, secreted
under cellulolytic conditions, that oxidizes cellodextrins, lactose and man-
nodextrins (Eriksson et al., 1990). The role of CDH in wood degradation,
and catabolism of cellobiose has been suggested (Bao et al., 1993; Eriksson
et al., 1993; Ander, 1994). In a recent study, Raices et al. (1995) isolated more
than 50 putative positive clones, using either immuno- or gene-probe

screening for the CDH gene. Out of these clones, five were sequenced and
found to overlap with identical sequences, but lacking the 5′-end of the
mRNA. This 5′-end was obtained by RACE (Frohman et al., 1988), using
poly(A)-RNA as the template and two nested primers (sequences not shown)
based on the 5′-end of the longest cDNA isolated. A single PCR product,
Ra-12, corresponding to the missing 5′-end, was obtained. By determining
the sequences of the 5′ (Ra-12) and 3′ (CP3) sections of the CDH gene, the
complete cDNA sequence was determined (Raices et al., 1995). The full-
length cDNA was assembled by combining Ra-12 and CP3 in a recombina-
tion PCR using the Ra-12 forward and the CP3 reverse primers (sequences
not shown). The complete cDNA contains 2310 translated bases excluding
the 3′ poly(A)-tail. Analysis of the CDH amino acid sequence showed the
presence of haem and flavin adenine dinucleotide (FAD) domains, as well as
the nucleotide-binding motif. The FAD domain appears to be distantly
related to the glucose/methanol/choline (GMC) oxidoreductase family
(Raices et al., 1995).
Xylanase genes
Graham et al. (1993) used a novel PCR-based procedure to synthesize an
artificial xylanase gene from the white-rot fungus Schizophyllum commune.
The sequence of the synthetic gene was designed so that restriction enzyme
recognition sequences could be introduced into the gene without alteration
of the amino acid sequence of the final translation product. Additionally, the
design also incorporated a selection of codon bias suited for expression in E.
coli. Overlapping PCR primers Xyl1 (189-mer) and Xyl2 (208-mer) were
mixed with different dilutions of two other primers, Xyl3 (42-mer) and Xyl4
(36-mer), in a PCR-amplification procedure to yield a 426 bp double-
stranded product XylA, representing two-thirds of the 5′-end of the xylanase
gene. An aliquot of XylA was mixed with a 217-mer oligonucleotide primer
and flanking primers Xyl3 (5′-end) and Xyl6″ (3′-end) and subjected to a
second PCR to yield a 629 bp double-stranded XylB DNA representing the
full-length xylanase-encoding xynA gene (Graham et al., 1993). The XylB
fragment was subcloned into a plasmid vector; after sequencing three
subclones, it was found that errors were introduced in the sequences of each
of the subclones because of the low fidelity of Taq polymerase. The error was
corrected by selecting one of the subclones and excising the segment
containing the error using flanking restriction sites and replacing it with a
correct segment from another subclone; the result was an authentic xynA
gene. The synthesized xynA gene was subcloned into the NheI–HindIII site
of the protein expression vector, pTUG. To accomplish this, the 5′ PstI site
of xynA was changed to a NheI site by PCR amplification using a new 5′
primer Xyl3″ (with a NheI recognition site) and the original 3′ primer Xyl6″.
The PCR product was then subcloned into pTUG and, after verification that
the sequence was correct, was transformed into E. coli JM101. Xylanase-
secreting clones produced clearing zones when grown on Luria broth agar
plates containing remazol brilliant blue xylan substrate.
Using the data obtained from the N-terminal sequence of purified
xylanase APX-II from the xylanolytic fungus Aureobasidium pullulans
Y-2311-1, Li and Ljungdahl (1996) designed two degenerate biotinylated
oligonucleotide primers, P0813 and P3035 (Table 10.5) to amplify a xylanase
gene from genomic DNA. The resulting 83 bp biotinylated PCR fragments
were used as probes to screen a cDNA library, as well as in the character-
ization of genomic DNA (Southern blot), and in the study of regulation of
the xylanase gene (Northern blot). Five positive clones were obtained after
screening the cDNA library of which two were sequenced. The sequence
data revealed that none of these clones contained the 5′-end of the gene.
Using PCR, the 5′-end of the cDNA was amplified from the cDNA library,
using two oligonucleotide primers. The forward primer (T3 promoter
sequence; P200) was located at the 5′ of the insert while the reverse primer
(P3338) was 152 bp from the 5′-end of the positive cDNA clones (Table 10.5).
The PCR product was cloned and sequenced and using the sequence data,
two oligonucleotide primers PFW and PRW (Table 10.5) were synthesized.
PFW and PRW corresponded to the 5′- and 3′-ends of the full-length cDNA
for the A. pullulans xylanase, and were used to amplify the whole gene.
Comparison between the genomic and cDNA sequences revealed that one
intron of 59 bp was present in the coding region. The result of the Southern
blot showing the presence of only a single copy in the genome, and that of
the Northern blot showing that only a single transcript was present,
indicated that the two xylanases present in the culture were encoded by the
same gene (Li and Ljungdahl, 1996).
10.4.2 Allele-specific oligonucleotides

The PCR approach was also used to differentiate lip alleles of P. chrysospo-
rium (Gaskell et al., 1992, 1994, 1995). Two primers, A and B (Table 10.1),
were used to amplify lip H8 sequences from the genomic DNA of
basidiospores (homokaryotic) and dikaryote isolates of P. chrysosporium.
Amplified products of 251 bp and 260 bp were obtained. These PCR
products were Southern blotted and probed with gene-specific oligonucleo-
tide probes to identify rapidly the H8 gene and its alleles (Gaskell et al.,
1992).
In another study, Gaskell et al. (1994) developed a strategy for genetic
mapping by segregation analysis. They monitored allelic segregation by PCR
of genomic DNA from single basidiospore-derived cultures followed by
probing with allele-specific oligonucleotides. Gene-specific PCR primers
were used for 12 P. chrysosporium genes coding for LIP (Table 10.1), glyoxal
oxidase (GLOX) and CBH (Table 10.4). Based on the sequences of the
amplified products, allele-differentiating probes were prepared. Genetic
linkage was determined by monitoring the segregation of specific alleles
Table 10.5. Primers used for PCR amplification of xylanese-encoding genomic and cDNA sequences.
Amplified
PCR product
Gene Organism procedure 5′ Primer 3′ Primer (bp) Reference
Xylanese Schizophyllum DNA-PCR ACCCCGTCTTCTACCGGTACCGACGGTGGTTA- GACGGAGCGTTGTAACGCCAGGTAGACAGGA- 426 Graham et al.

[xylA = commune CTACTACAGCTGGTGGACCGACGGTGCTGGTG- TGTCGTAGGTGGCGCCGTTGCAGGTAACGGA- (1993)
5′-end of ACGCTACCTACCAGAACAACGGTGGTGGTTCT- TCCTTTGTGAGAAGCAGCAGAAGACGGGTCG-
xynA] TACACGTTAACCTGGTCTGGTAACAACGGTAA- TAAGAACCGTAAGATTCAACGATGTAGTATT-
CTTAGTTGGTGGTAAAGGTTGGAACCCGGGTG- CGATCAGACTCGAGCGGGTCCAACCGTAAAC-
CTGCTTCTAGATCTATCTCTTACTCTGGT AGACAGGTAAGAGTTACCGTTCGGCTGGTAG-
[Xyl1] (189-mer) GTACCAGAGTAAGAGATAGATC
[Xyl2] (208-mer)
ACCGCCTCTGCAGCTTCTGGTACCCCGTCTTC-
TACCGGTAC CTGGGTACCATCGATAGACGGAGCGTTGTAA-
[Xyl3] (42-mer) CGCCA
[Xyl4] (36-mer)
Xylanase Schizophyllum DNA-PCR ACCGCCTCTGCAGCTTCTGGTACCCCGTCTTC- CTAGACGGTGATGGTAGCGGTACCAGAAGAC- 629 Graham et al.
[xylB = commune TACCGGTAC TGGTAACCTTCGGTCGCGACGATCTGGTAGT- (1993)
xynA] [Xyl3] (42-mer) TGTGTTCAGAACCCAGGTTCATACCCAGGCC-
TTTCCAAGCGTCGAAGTGGCACTGAACGTCG-
ACGGTACCAGAGATAGAACCACCCGGAGCTT-
TTTTCGGGTTACGTACAGACCAGAACTGTTC-
GAAGGTCTGGGTACCATCGATAGACGGAGCG-
TTGTA
[Xyl5] (222-mer)
CGTATAAGCTTCTATTAGCTAGCGGTGACGG-
TGATGGTAGCCG
[Xyl6″] (43-mer)
Xylanese Schizophyllum DNA-PCR GCCTCTGCTAGCGGTACCCCGTCTTCTACCGG- CGTATAAGCTTCTATTAGCTAGCGGTGACGG- Not Graham et al.
[xynA] commune TAC TGATGGTAGCCG given (1993)
[Xyl3″] (35-mer) [Xyl6″] (43-mer)
Xylanese Aureobasidium DNA-PCR TATGTNCAAAATTATAA CCATTATTCCAATACAT 83 Li and Ljungdahl
[3′-end of pullulans C G C C G G G (1994)
xynA] Y-2311-1 [P0813] [P3035]
Xylanese Aureobasidium DNA-PCR GTCGCCATTGACACCGT GAAGTCGCCATTGACACCGTTGTT Not Li and Ljungdahl
[5′-end of pullulans [P200] [P3338] given (1994)
xynA] Y-2311-1
Xylanese Aureobasidium DNA-PCR CGGCACGAGCTCGTGCCGG GTAGCAAGGTGTCTGACAT 895 Li and Ljungdahl
[xynA] pullulans [PFW] [PRW] (1994)
Y-2311-1
among homokaryotic segregants. Homokaryotic single-basidiospore

cultures were first isolated and identified, followed by the extraction of
genomic DNA, amplification of genes, and differentiation of alleles using
radiolabelled oligonucleotides as probes. The linkage was computed from
allelic co-segregation frequencies. Five linkage groups were identified, one
of which contained eight closely linked lip genes. One unlinked lip gene,
was determined to co-segregate with a cbh1 gene cluster (Gaskell et al.,
1994).
Recently, Gaskell et al. (1995) investigated the copy number, inheritance,
genomic location, and distribution of Pce1, an insertional element within P.
chrysosporium gene lipI, discovered after analysis of the sequences of the ten
known lip genes. PCR was used to amplify a 1767 bp Pce1 insertional
element from genomic DNA of P. chrysosporium BKM-F 1767, using
primers at the junction of the insertion point of Pce1 in lipI2. The Pce1
element was localized to the 3.7 Mb chromosomal band by experiments
using the amplified product to probe Southern blots of clamped homoge-
neous field electrophoresis gels of size-fractionated chromosomes of a
dikaryotic strain of P. chrysosporium BKM-F 1767. The copy number and
distribution of Pce1 were assessed by Southern blot analysis of restriction
enzyme-digested genomic DNA. An additional Pce1-like sequence was
found on a 4.6 kbp BamHI–XbaI genomic DNA fragment. Southern blot
analysis of genomic DNA from 17 strains of P. chrysosporium using Pce1 as
a probe showed that only three isolates hybridized under moderate strin-
gencies. One widely used laboratory strain, ME-446, did not show hybrid-
ization with Pce1. Allelic segregation patterns were determined for lipA and
lipI using PCR with gene-specific primers and 69 single-basidiospore
isolates. PCR products of 2236 bp and 479 bp allowed easy differentiation of
lipI alleles. For lipA, allele-specific probes were used to differentiate PCR
products, since all the lipA gene-specific PCR products were identical in
length. The results showed that lipA and lipI alleles co-segregate. RT–PCR
followed by probing with allele-specific oligonucleotides, was also done in
order to detect lipI1 and lipI2 transcripts in N-limited and C-limited cultures
(discussed in section 10.4.3).
10.4.3 Gene expression under varying environmental conditions

Stewart et al. (1992) used competitive RT–PCR and gene-specific oligonu-
cleotide probes to study the pattern of LIP gene expression in P. chrysospo-
rium BKM-F 1767. First-strand cDNA of four closely related LIP genes
(lipA, lipB, GLG5 and 0282) was prepared by reverse transcription using a
conserved downstream primer (Table 10.1). Gene-specific upstream primers
were used to amplify the double-stranded cDNA. Each PCR contained
genomic DNA as a competitive template. The cDNA levels of the four genes
were quantified in N-limiting and C-limiting culture conditions. The
transcript levels for the LIP H8-encoding lipA and lipB genes, and for the
LIP H2-encoding 0282 gene, were similar in C- and N-limited cultures.

However, for the LIP H10-encoding GLG5 the N-limited cDNA levels were
between 25 and 100 pg, but no cDNA product was amplified in the C-limited
cultures. Competitive PCR was also used to quantify the LIP H2-encoding
GLG4 and V4 transcript levels, using gene-specific primers (Table 10.1). The
GLG4 transcript was more abundant (1000-fold) in C-limited than in
N-limited cultures. The V4 gene transcript could only be detected using a
second set of primers (Table 10.1) and when reverse transcription reactions
included 0.5 µg of RNA and were extended to 45 min. Under these
conditions, the V4 gene transcripts were found to be more abundant in
N-limited than in C-limited cultures.
Brooks et al. (1993) determined the expression profiles of LIP
H8-encoding LIG1 and LIP H2-encoding LIG5 in P. chrysosporium
ME-446 cultures under conditions of nitrogen limitation (LN) or non-
limitation (HN) using gene-specific primer pairs (Table 10.1). No LIG1
expression was seen in either LN or HN cultures, but LIG5 expression was
seen in both LN and HN cultures. In carbon non-limiting cultures, however,
no LIG5 transcripts were seen, leading to the conclusion that LIG5
expression in strain ME-446 is dependent on low C concentration.
The expression of LIP genes from C-limited cultures of P. chrysosporium
BKM-F 1767 was analysed by PCR. For this, cDNA prepared from 6-day-old
C-limited cultures was used as the template with degenerate oligonucleotide
primers corresponding to the regions surrounding the proximal and distal His
residues in LIP from BKM-F 1767 (Reiser et al., 1993). Twenty-four PCR
clones were analysed and found to be ordered into two sets, based on digestion
with the restriction enzymes SalI and RsaI. One set showed a high degree of
similarity to the LIP H2-encoding CLG4 cDNA sequence of de Boer et al.
(1987), while the other was similar to the LIP H8-encoding L18 cDNA
sequence (Ritch et al., 1991). These represented the major transcripts in
C-limited cultures.
Broda et al. (1995) applied the RT–PCR technique to monitor the
expression of 11 genes from low-N cultures of P. chrysosporium ME-446
during growth with one of four different carbon sources: low glucose (0.2%),
high glucose (2.0%), Avicel (0.2%) and ball-milled straw (BMS; 0.2%).
Different primers were used for amplification of LIP H8-encoding genes
LIG1, LIG2, LIG3, and LIG4, the LIP H2-encoding gene LIG5, the
unknown LIP-encoding gene LIG6 (Table 10.1), the MNP-encoding gene
mnp1 (Table 10.2), and the CBH-encoding genes cbh1.1, cbh1.2, and cbhII
(Table 10.4). Amplification of the constitutively expressed trpC gene was
used as a positive control for gene expression in all cultures (primers for trpC
are shown in Table 10.6). Cultures grown in low glucose expressed only
LIG5 (on days 3–8), and cbh1.1 (on days 7 and 8). High glucose cultures
expressed none of the genes studied, except low levels of mnp1 on day 3.
Avicel cultures expressed cbh1.1 and cbh1.2 on days 3–6; LIG1 and LIG2 on
day 6, LIG3 on days 4–8, LIG6 on day 3, and cbhII, LIG5 and mnp1 on days
Table 10.6. Primers used for PCR amplification of genomic DNA and cDNA of house-keeping and other genes isolated from ligninolytic fungi.
Amplified
PCR product
Gene Organism procedure 5′ Primer 3′ Primer (bp) Reference
ITSa P. chrysosporium BKM-F 1767, DNA-PCR GGAAGTAAAAGTCGTAACAAGG TCCTCCGCTTATTGATATGC 700 Johnston and
P. chrysosporium HHB-6251-sp, [ITS 5] [ITS 4] Aust (1994b)
P. chrysosporium FP-104297-sp,
P. sordida HHB-7423-sp,
P. sordida HHB-8922-sp,
F. fomentarius, Penicillium sp., Pythium
sp., P. radiata, R. solani
β-tubulin P. chrysosporium RT–PCR AGGTCGTCTCAGACGAACAC GGCATGGGTACTCTCCTGATC 495, 640 Lamar et al.
BKM-F 1767 (ATCC 24725) (1995)
trpC P. chrysosporium RT–PCR CACGGGCATCGTGACGGATAC TGGGTCTTGAGTGTGTAGTGG 126, 179 Broda et al.
ME446 (ATCC 34541) (1995)
Pcel P. chrysosporium DNA-PCR GGGACCGTAGCTACATCAGCAAT CTGGCTGGGTACATCAG 1747 Gaskell et al.
BKM-F 1767 (ATCC 24725) (1995)
a
Presented here as an example of similar papers published using the internal transcribed spacer (ITS) region or other regions of fungal ribosomal DNA for
phylogenetic studies of lignocellulosic fungi.
3–8. BMS cultures expressed cbh1.1 and cbh1.2 on days 3–6, LIG1 on day 8
and cbhII, LIG5 and mnp1 on days 3–8.
RT–PCR and allele-specific oligonucleotide probes were used to detect
the LIP H2-encoding lipI transcripts in N-limited and C-limited cultures of
P. chrysosporium BKM-F 1767 (Gaskell et al., 1995) using gene-specific
primers (Table 10.1). The fungus expressed lipI1 transcripts in both culture
media, but lipI2 transcripts were not detected; the lipI2 contains a 1747 bp
insertional element Pce1 (described in Section 10.4.2). The results indicated
that Pce1 inactivated the lipI2 gene.
Rajakumar et al. (1996) used RT–PCR to determine whether LIP-like
genes were transcribed in P. sordida and C. subvermispora cultures grown
under ligninolytic (N-limited medium) conditions. The primers used are
shown in Table 10.1. The results showed that one LIP-like sequence, with a
88.4% nucleotide similarity to the corresponding region of a T. versicolor lip
gene, was transcribed in P. sordida cultures. However, no LIP-like tran-
scripts were detected in C. subvermispora cultures.
Quantitative RT–PCR analysis was done on mRNA isolated from
anthracene-transforming soil cultures of P. chrysosporium BKM-F 1767 to
assess the temporal regulation of the H2O2-producing glyoxal oxidase
(GLOX) gene expression (Bogan et al., 1996b). Anthracene, a known LIP
substrate, needs the presence of H2O2 for its transformation by LIP. The
primers used for PCR amplification of the lip gene sequences are shown in
Table 10. 1; no primer sequences for glx were given. The results showed that
during the initial period of incubation (<10 days), the LIP H8-encoding lipA
and the LIP H2-encoding lipD transcripts were at the highest levels. The
highest transcript level for any of the genes studied was that of the LIP
H2-encoding lipJ (days 15–20). The lipA transcript level, however, main-
tained high levels for a majority of the 25 days. No lipF (unknown LIP-
encoding) transcripts were seen on any of the days studied. The transcript
levels of lipA and glx genes correlated with the levels of the enzymes they
coded for (H8 and GLOX, respectively). The oxidation of anthracene was
also seen to take place throughout the course of the study (Bogan et al.,
1996b).
In a separate study, Bogan et al. (1996a) used competitive RT–PCR to
examine the temporal expression of three MNP genes (mnp-1, mnp-2 and
mnp-3) of P. chrysosporium BKM-F 1767 during the bioremediation of
PAH-contaminated soil. All three transcripts were seen on day 1 or 2, with
peak levels on day 6. The β-tubulin gene (tub) and glyceraldehyde-
3-phosphate dehydrogenase gene (gpd) transcripts were also determined by
competitive RT–PCR as controls for mRNA loading. The results showed
that mnp mRNA levels correlated with MNP enzyme levels and with the
disappearance of PAHs from the soil, supporting the hypothesis that MNP
are involved in the oxidation of PAHs in soil (Bogan et al., 1996a).
Competitive RT–PCR was used to determine the relative transcript
levels of P. chrysosporium BKM-F 1767 cbh1-1, cbh1-2 and cbh1-3 genes in
glucose-grown, sucrose-grown and cellulose–cellobiose-grown cultures

(Covert et al., 1992). First-strand cDNAs were prepared by reverse tran-
scription with downstream primers (see Table 10.4). This was followed by
PCR-amplification using upstream primers (Table 10.4) in the presence of
serial dilutions of genomic DNA as competitive templates. The primers
flanked an intron common to all three genes, so that the PCR-amplified
products obtained from cDNA and genomic DNA could be identified on
agarose gels. Gene-specific oligonucleotide probes were used to further
establish the identity between the three genes. The results showed that
cbh1-3 transcripts were about 1000-fold more abundant than those of cbh1-1
and cbh1-2 in cellulose–cellobiose-grown cultures. The cbh1-1 and
cbh1-2 transcript levels were low in all four cultures, but were higher than
cbh1-3 transcript levels in 3-day-old glucose-grown cultures. Thus, unlike
cbh1-3, cbh1-1 and cbh1-2 appear not to be subjected to glucose repression.
10.5 Future Perspectives
An increasing number of researchers have been using PCR methodology in

recent years for studies on fungal lignocellulose degradation. The techniques
applied to date have been limited to DNA-PCR, RT–PCR, competitive
RT–PCR and inverse PCR. These techniques have been used for the
detection, isolation and characterization of genes involved in lignocellulose
degradation. The latter included genes encoding LIP, MNP, laccase, cellulase
and xylanase. PCR approaches have also played a major role in the study of
regulation of expression of genes encoding lignocellulose-degrading
enzymes under a variety of environmental conditions. Furthermore, PCR
techniques were also useful for mapping and segregation analysis of genes
involved in lignin and cellulose breakdown as well as for studying the
molecular genetics of an insertional element Pce1 in P. chrysosporium.
The PCR approaches described above have been useful in enhancing our
understanding of fungal lignocellulose degradation but these studies repre-
sent only the beginning of what we believe will be an expanding field in
future research. Several new and improved PCR-based techniques show
promise for future applications in this research area. For example, DDRT–
PCR (Liang and Pardee, 1992; see Chapter 3) is a sensitive technique that
could be used for detailed studies on environmental control of gene
expression. Another area where PCR could be used effectively would be in
phylogenetic studies of lignocellulose-degrading wood-rot basidiomycetes
(Hibbett and Vilgalys, 1991; Kwan et al., 1992; Boysen et al., 1996; Bunyard
et al., 1996; Chiu et al., 1996). More recently, in the Center for Microbial
Ecology at Michigan State University, we have initiated studies using
denaturing gradient gel electrophoresis PCR (DDGE–PCR) to characterize
the phylogenetic affiliation of the various lignin-degrading soil basidiomy-
cetes. Thus it appears quite likely that a greater variety of PCR approaches
will be used by researchers in the future for increasing the knowledge of

fungal lignocellulose degradation systems.
Acknowledgements
The research in the authors’ laboratory reported in this review was supported
in part by DOE grant DE-FG02-85ER-13369 to C.A. Reddy, and NSF grant
BIR-9120006 to the Center for Microbial Ecology at Michigan State
University.
References
Ander, P. (1994) The cellobiose-oxidizing enzymes CBQ and CbO as related to
lignin and cellulose degradation – a review. FEMS Microbiology Reviews 13,
297–312.
Asada, Y., Watanabe, A., Irie, T., Nakayama, T. and Kuwahara, M. (1995) Structures
of genomic and complementary DNAs coding for Pleurotus ostreatus manganese
(II) peroxidase. Biochimica et Biophysica Acta 1251, 205–209.
Ashktorab, H. and Cohen, R.J. (1992) Facile isolation of genomic DNA from
filamentous fungi. BioTechniques 13, 198–200.
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and
Struhl, K. (1995) Current Protocols in Molecular Biology. John Wiley & Sons,
New York.
Bao, W., Usha, S.N. and Renganathan, V. (1993) Purification and characterization of
cellobiose dehydrogenase, a novel extracellular hemoflavoenzyme from the
white-rot fungus Phanerochaete chrysosporium. Archives of Biochemistry and
Biophysics 300, 705–713.
Bayer, E.A., Morag, E., Shoham, Y., Tormo, J. and Lamed, R. (1996) The cellulosome:
A cell surface organelle for the adhesion to and degradation of cellulose. In:
Fletcher, M. (ed.) Bacterial Adhesion: Molecular and Ecological Diversity. Wiley-
Liss, New York, pp. 155–182.
Béguin, P. and Aubert, J.-P. (1995) The biological degradation of cellulose. FEMS
Microbiology Letters 13, 25–58.
Bej, A.K. and Mahbubani, M.H. (1992) Applications of the polymerase chain reaction
in environmental microbiology. PCR Methods and Applications 1, 151–159.
Black, M.T., Gunn, F.J., Chapman, S.K. and Reid, G.A. (1989) Structural basis for the
kinetic differences between flavocytochromes b2 from the yeasts Hansenula
anomula and Saccharomyces cerevisiae. Biochemical Journal 263, 973–976.
Bogan, B.W., Schoenike, B., Lamar, R.T. and Cullen, D. (1996a) Manganese
peroxidase mRNA and enzyme activity levels during bioremediation of poly-
aromatic hydrocarbon-contaminated soil with Phanerochaete chrysosporium.
Bogan, B.W., Schoenike, B., Lamar, R.T. and Cullen, D. (1996b) Expression of lip
genes during growth in soil and oxidation of anthracene by Phanerochaete
chrysosporium. Applied and Environmental Microbiology 62, 2381–2386.
Bollag, J.-M., Shuttleworth, K.L. and Anderson, D.H. (1988) Laccase-mediated

detoxification of phenolic compounds. Applied and Environmental Micro-
biology 54, 3086–3091.
Boominathan, K. and Reddy, C.A. (1992) Fungal degradation of lignin: biotechno-
logical applications. In: Arora, D.K., Elander, R.P. and Mukerji, K.G. (eds)
Handbook of Applied Mycology, Volume 4: Fungal Biotechnology. Marcel
Dekker, New York, pp. 763–822.
Bourbonnais, R. and Paice, M.G. (1990) Oxidation of non-phenolic substrates. An
expanded role for laccase in lignin biodegradation. FEBS Letters 267, 99–102.
Bourbonnais, R. and Paice, M.G. (1992) Demethylation and delignification of kraft
pulp by Trametes versicolor laccase in the presence of 2,2′-azinobis(3-
ethylbenzthiazoline-6-sulphonate). Applied Microbiology and Biotechnology 36,
823–827.
Boysen, M., Borja, M., Del Moral, C., Salazar, O. and Rubio, V. (1996) Identification
at strain level of Rhizoctonia solani AG4 isolates by direct sequence of
asymmetric PCR products of the ITS regions. Current Genetics 29, 174–181.
Broda, P., Birch, P.R.J., Brooks, P.R. and Sims, P.F.G. (1995) PCR-mediated analysis
of lignocellulolytic gene transcription by Phanerochaete chrysosporium:
substrate-dependent differential expression within gene families. Applied and
Brooks, P.R., Sims, P.F.G. and Broda, P. (1993) Isozyme specific polymerase chain
reaction analysis of differential gene expression: a general method applied to
lignin peroxidase genes of Phanerochaete chrysosporium. Bio/Technology 11,
830–834.
Bunyard, B.A., Chaichuchote, S., Nicholson, M.S. and Royse, D.J. (1996) Ribosomal
DNA analysis for resolution of genotypic classes of Pleurotus. Mycological
Research 100, 143–150.
Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J. (1979) Isolation of
biologically active ribonucleic acid from sources enriched in ribonuclease.
Biochemistry 18, 5294–5299.
Chiu, S.W., Ma, A.M., Lin, F.C. and Moore, D. (1996) Genetic homogeneity of
cultivated strains of shiitake (Lentinula edodes) used in China as revealed by the
polymerase chain reaction. Mycological Research 100, 1393–1399.
Chow, C.-K., Yagüe, E., Raguz, S., Wood, D.A. and Thurston, C.F. (1994) The cel3
gene of Agaricus bisporus codes for a modular cellulase and is transcriptionally
regulated by the carbon source. Applied and Environmental Microbiology 60,
2779–2785.
Collins, P.J. and Dobson, A.D.W. (1995) PCR amplification of lignin peroxidase
genes in white rot fungi. Biotechnology Techniques 9, 917–920.
Covert, S., Vanden Wymelenberg, A. and Cullen, D. (1992) Structure, organization
and transcription of a cellobiohydrolase gene cluster from Phanerochaete
Cullen, D. and Kersten, P. (1992) Fungal enzymes for lignocellulose degradation. In:
Kinghorn, J.R. and Turner, G. (eds) Applied Molecular Genetics of Filamentous
Fungi. Chapman and Hall, London, pp. 100–131.
de Boer, H.A., Zhang, Y.Z., Collins, C. and Reddy, C.A. (1987) Analysis of nucleotide
sequences of two ligninase cDNAs from a white-rot filamentous fungus,
Phanerochaete chrysosporium. Gene 60, 93–102; Corrigendum (1988) Gene 69,
369.
de Jong, E., Field, J.A. and de Bont, J.A.M. (1994) Aryl alcohols in the physiology
of ligninolytic fungi. FEMS Microbiology Reviews 13, 153–188.
Dieffenbach, C.W. and Dveksler, G.S. (1995) PCR Primer: a Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, pp. 714.
D’Souza, T.M., Boominathan, K. and Reddy, C.A. (1996) Isolation of laccase gene-
specific sequences from white rot and brown rot fungi by PCR. Applied and
Eriksson, K.-E.L., Blanchette, R.A. and Ander, P. (1990) Microbial and Enzymatic
Degradation of Wood and Wood Components. Springer Verlag, Berlin.
Eriksson, K.-E.L., Habu, N. and Samejima, N. (1993) Recent advances in fungal
cellobiose oxidoreductases. Enzyme and Microbial Technology 15, 1002–1008.
Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production of full-length
cDNAs from rare transcripts: amplification using a single gene-specific oligonu-
cleotide primer. Proceedings of the National Academy of Sciences USA 87,
2725–2730.
Garber, R.C. and Yoder, O.C. (1983) Isolation of DNA from filamentous fungi and
separation into nuclear, mitochondrial, ribosomal, and plasmid components.
Gaskell, J., Dieperink, E. and Cullen, D. (1991) Genomic organization of lignin
peroxidase genes of Phanerochaete chrysosporium. Nucleic Acids Research. 19,
599–603.
Gaskell, J., Vanden Wymelenberg, A., Stewart, P. and Cullen, D. (1992) Method to
identify specific alleles of a Phanerochaete chrysosporium gene encoding lignin
peroxidase. Applied and Environmental Microbiology 58, 1379–1381.
Gaskell, J., Stewart, P., Kersten, P.J., Covert, S.F., Reiser, J. and Cullen, D. (1994)
Establishment of genetic linkage by allele-specific polymerase chain reaction:
application to the lignin peroxidase gene family of Phanerochaete chrysosporium.
Bio/Technology 12, 1372–1375.
Gaskell, J., Vanden Wymelenberg, A. and Cullen, D. (1995) Structure, inheritance,
and transcriptional effects of Pce1, an insertional element within Phanerochaete
chrysosporium lignin peroxidase gene lipI. Proceedings of the National Academy
Giardina, P., Cannio, R., Martirani, L., Marzullo, L., Palmieri, G. and Sannia, G.
(1995) Cloning and sequencing of a laccase gene from the lignin-degrading
basidiomycete Pleurotus ostreatus. Applied and Environmental Microbiology 61,
2408–2413.
Giardina, P., Aurilia, V., Cannio, R., Marzullo, L., Amoresano, A., Siciliano, R., Pucci,
P. and Sannia, G. (1996) The gene, protein and glycan structures of laccase from
Pleurotus ostreatus. European Journal of Biochemistry 235, 508–515.
Gilkes, H.R., Henrissat, B., Kilburn, D.G., Miller, R.C., Jr and Warren, R.A.J. (1991)
Domains in microbial β-1,4-glycanases: sequence conservation, function, and
enzyme families. Microbiological Reviews 55, 303–315.
Gilliland, G., Perrin, S. and Bunn, H.F. (1990) Competitive PCR for quantitation of
mRNA. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR
Protocols: a Guide to Methods and Applications. Academic Press, New York,
pp. 282–287.
Gold, M.H. and Alic, M. (1993) Molecular biology of the lignin-degrading
basidiomycete Phanerochaete chrysosporium. Microbiological Reviews 57,
605–622.
Graham, R.W., Atkinson, T., Kilburn, D.G., Miller, R.C. Jr and Warren, R.A.J. (1993)
Rational design and PCR-based synthesis of an artificial Schizophyllum com-
mune xylanase gene. Nucleic Acids Research 21, 4923–4928.
Graham, G.C., Mayers, P., and Henry, R.T. (1994) A simplified method for the
preparation of fungal genomic DNA for PCR and RAPD analysis. Bio-
Hatakka, A. (1994) Lignin-modifying enzymes from selected white-rot fungi:
production and role in lignin degradation. FEMS Microbiology Reviews 13,
125–135.
Hibbett, D.S. and Vilgalys, R. (1991) Evolutionary relationships of Lentinus to the
Polyporaceae: evidence from restriction analysis of enzymatically amplified
ribosomal DNA. Mycologia 83, 425–439.
Higuchi, T. (1993) Biodegradation mechanism of lignin by white-rot basidiomycetes.
Journal of Biotechnology 30, 1–8.
Hilger, A.B. and Myrold, D.D. (1991) Method for extraction of Frankia DNA from
soil. Agriculture, Ecosystems and Environment 34, 107–113.
Holzbaur, E.L.F. and Tien, M. (1988) Structure and regulation of a lignin peroxidase
gene from Phanerochaete chrysosporium. Biochemical and Biophysical Research
Communications 155, 626–633.
Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (1990) PCR Protocols: a
Guide to Methods and Applications. Academic Press, New York.
James, C.M., Felipe, M.S.S., Sims, P.F.G. and Broda, P. (1992) Expression of a single
lignin peroxidase-encoding gene in Phanerochaete chrysosporium strain ME446.
Gene 114, 217–222.
Johnston, C.G. and Aust, S.D. (1994a) Transcription of ligninase H8 by Phanero-
chaete chrysosporium under nutrient nitrogen sufficient conditions. Biochemical
and Biophysical Research Communications 200, 108–112.
Johnston, C.G. and Aust, S.D. (1994b) Detection of Phanerochaete chrysosporium in
soil by PCR and restriction enzyme analysis. Applied and Environmental
Kawasaki, E.S. (1990) Sample preparation from blood, cells, and other fluids. In:
Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols: a
Guide to Methods and Applications. Academic Press, New York, pp. 146–152.
Kim, W.K., Mauthe, W., Hausner, G., and Klassen, G.R. (1990) Isolation of high
molecular weight DNA and double-stranded RNAs from fungi. Canadian
Journal of Botany 68, 1898–1902.
Kirk, T.K. and Farrell, R.L. (1987) Enzymatic ‘combustion’: the microbial degrada-
tion of lignin. Annual Reviews of Microbiology 41, 465–505.
Knowles, J., Lehtovaara, P. and Teeri, T. (1987) Cellulase families and their genes.
Trends in Biotechnology 5, 255–261.
Kojima, Y., Tsukuda, Y., Kawai, Y., Tsukamoto, A., Sugiura, J., Sakaino, M. and Kita,
Y. (1990) Cloning, sequences analysis, and expression of ligninolytic phenolox-
idase genes of the white-rot basidiomycete Coriolus hirsutus. Journal of
Biological Chemistry 265, 15224–15230.
Kwan, H.S., Chiu, S.W., Pang, K.M. and Cheng, S.C. (1992) Strain typing in
Lentinula edodes by polymerase chain reaction. Experimental Mycology 16,
163–166.
Lamar, R.T., Schoenike, B., Vanden Wymelenberg, A., Stewart, P., Dietrich, D.M. and
Cullen, D. (1995) Quantitation of fungal mRNAs in complex substrates by
reverse transcription PCR and its application to Phanerochaete chrysosporium-

colonized soil. Applied and Environmental Microbiology 61, 2122–2126.
pp. 282–287.
Li, X.L. and Ljungdahl, L.G. (1994) Cloning, sequencing, and regulation of a xylanase
gene from the fungus Aureobasidium pullulans Y-2311-1. Applied and Environ-
mental Microbiology 60, 3160–3166; Erratum (1994) Applied and Environmental
Microbiology 60, 4647.
Lucas, M.C., Jacobson, J.W. and Giles, N.H. (1977) Characterization and in vitro
translation of polyadenylated messenger ribonucleic acid from Neurospora
crassa. Journal of Bacteriology 130, 1192–1198.
Matsubara, M., Suzuki, J., Deguchi, T., Miura, M. and Kitaoka, Y. (1996) Character-
ization of manganese peroxidases from the hyperlignolytic fungus IZU-154.
Moré, M.I., Herrick, J.B., Silva, M.C., Ghiorse, W.C. and Madsen, E.L. (1994)
Quantitative cell lysis of indigenous microorganisms and rapid extraction of
microbial DNA from sediment. Applied and Environmental Microbiology 60,
1572–1580.
Naidu, P.S. and Reddy, C.A. (1990) Nucleotide sequence of a new lignin peroxidase
gene GLG3 from the white-rot fungus Phanerochaete chrysosporium. Nucleic
Acids Research 18, 7173; Corrigendum (1992) Nucleic Acids Research 20, 4124.
Ochman, H., Gerber, A.S. and Hartl, D.L. (1988) Genetic applications of an inverse
polymerase chain reaction. Genetics 120, 621–623.
Ochman, H., Ajioka, J.W., Garza, D. and Hartl, D.L. (1990) Inverse polymerase chain
reaction. Bio/Technology 8, 759–764.
Ogram, A.V., Sayler, G.S., Gustin, D. and Lewis, R.J. (1987) DNA adsorption to soils
and sediments. Environmental Science and Technology 22, 982–984.
Picard, C., Ponsonnet, C., Paget, E., Nesme, X. and Simonet, P. (1992) Detection and
enumeration of bacteria in soil by direct DNA extraction and polymerase chain
reaction. Applied and Environmental Microbiology 58, 2717–2722.
Pribnow, D., Mayfield, M.B., Nipper, V.J., Brown, J.A. and Gold, M.H. (1989)
Characterization of a cDNA encoding a manganese peroxidase from the lignin-
degrading basidiomycete Phanerochaete chrysosporium. Journal of Biological
Chemistry 264, 5036–5040.
Raeder, U. and Broda, P. (1988) Preparation and characterization of DNA from
lignin-degrading fungi. Methods in Enzymology 161B, 211–220.
Raguz, S., Yagüe, E., Wood, D.A. and Thurston, C.F. (1992) Isolation and character-
ization of a cellulose-growth-specific gene from Agaricus bisporus. Gene 19,
183–190.
Raices, M., Paifer, E., Cremata, J., Montesino, R., Ståhhlberg, J., Divne, C., Szabó, I.J.,
Henriksson, G., Johansson, G. and Pettersson, G. (1995) Cloning and character-
ization of a cDNA encoding a cellobiose dehydrogenase from the white rot
fungus Phanerochaete chrysosporium. FEBS Letters 369, 233–238.
Rajakumar, S., Gaskell, J., Cullen, D., Lobos, S., Karahanian, E. and Vicuña, R. (1996)
lip-Like genes in Phanerochaete sordida and Ceriporiopsis subvermispora, white
rot fungi with no detectable lignin peroxidase activity. Applied and Environmen-
Rao, T.R. and Reddy, C.A. (1984) DNA sequences from a ligninolytic filamentous
fungus Phanerochaete chrysosporium capable of autonomous replication in yeast.
Biochemical and Biophysical Research Communications 118, 821–827.
Reddy, C.A. (1993) An overview of the recent advances on the physiology and
molecular biology of lignin peroxidases of Phanerochaete chrysosporium. Journal
of Biotechnology 30, 91–107.
Reddy, C.A. and D’Souza, T.M. (1994) Physiology and molecular biology of the
lignin peroxidases of Phanerochaete chrysosporium. FEMS Microbiology
Reviews 13, 137–152.
Reiser, J., Walther, I., Fraefel, C. and Fiechter, A. (1993) Methods to investigate the
expression of lignin peroxidase genes by the white-rot fungus Phanerochaete
Ritch, T.G., Nipper, N.V., Akileswaran, L., Smith, A.J., Pribnow, D.G. and Gold,
M.H. (1991) Lignin peroxidase from the basidiomycete Phanerochaete chryso-
sporium is synthesized as a preproenzyme. Gene 107, 119–126.
Roy-Arcand, L. and Archibald, F.S. (1991) Direct dechlorination of chlorophenolic
compounds by laccases from Trametes versicolor. Enzyme and Microbial
Saiki, R., Sharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Arnheim,
N. (1985) Enzymatic amplification of β-globin genomic sequences and restric-
tion site analysis for diagnosis of sickle cell anemia. Science 230, 1350–1354.
with thermostable DNA polymerase. Science 239, 487–491.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: a Laboratory
Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
New York.
Schneider, H., Barth, W. and Böhme, H.-J. (1996) Cloning and characterization of
another lignin peroxidase gene from the white-rot fungus Phanerochaete
chrysosporium. Biological Chemistry Hoppe-Seyler 377, 399–402.
Selenska-Pobell, S. (1995) Direct and simultaneous extraction of DNA and RNA
from soil. In: Akkermans, A.D.L., van Elsas, J.D. and De Bruijn, F.J. (eds)
Molecular Microbial Ecology Manual. Kluwer Academic Publishers, Dor-
drecht.
Shoemaker, S., Schweickart, V., Ladner, M., Gelfand, D., Kwok, S., Myambo, K. and
Innis, M. (1983) Molecular cloning of exocellobiohydrolase I derived from
Trichoderma reesei strain L27. Bio/Technology 1, 691–696.
Short, J.M., Fernandez, J.M., Sorge, J.A. and Huse, W.D. (1988) Lambda ZAP: a
bacteriophage lambda expression vector with in vivo excision properties. Nucleic
Silver, J. and Keerikatte, V. (1989) Novel use of polymerase chain reaction to amplify
cellular DNA adjacent to an integrated provirus. Journal of Virology 63,
1924–1928.
Sims, P., James, C. and Broda, P. (1988) The identification, molecular cloning and
characterization of a gene from Phanerochaete chrysosporium that shows strong
homology to the exo-cellobiohydrolase I gene from Trichoderma reesei. Gene

74, 411–422.
Smith, T.L., Schalch, H., Gaskell, J., Covert, S. and Cullen, D. (1988) Nucleotide
sequence of a ligninase gene from Phanerochaete chrysosporium. Nucleic Acids
Research 16, 1219.
Sogin, M.L. (1990) Amplification of ribosomal RNA genes for molecular evolution
studies. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR
pp. 307–314.
Srinivasan, C., D’Souza, T.M. and Reddy, C.A. (1996) American Society for
Microbiology 96th General Meeting. New Orleans. Abstract May 19–23. Q266.
Steffan, R.J. and Atlas, R.M. (1991) DNA amplification to enhance detection of
genetically engineered bacteria in environmental samples. Applied and Environ-
mental Microbiology 54, 2185–2191.
Stewart, P., Kersten, P., Vanden Wymelenberg, A., Gaskell, J. and Cullen, D. (1992)
Lignin peroxidase gene family of Phanerochaete chrysosporium: complex regula-
tion by carbon and nitrogen limitation, and the identification of a second
dimorphic chromosome. Journal of Bacteriology 174, 5036–5042.
Tebbe, C.C. and Vahjen, W. (1993) Interference of humic acid and DNA extracted
directly from soil in detection and transformation of recombinant DNA from
bacteria and a yeast. Applied and Environmental Microbiology 59, 2657–2665.
Tempelaars, C.A.M., Birch, P.R.J., Sims, P.F.G., and Broda, P. (1994) Isolation,
characterization, and analysis of the expression of the cbhII gene of
Phanerochaete chrysosporium. Applied and Environmental Microbiology 60,
4387–4393.
Thorn, R.G., Reddy, C.A., Harris, D. and Paul, E.A. (1996) Isolation of saprophytic
basidiomycetes from soil. Applied and Environmental Microbiology 62,
4288–4292.
Thurston, C.F. (1994) The structure and function of fungal laccases. Microbiology
140, 19–26.
Timberlake, W.E. and Barnard, E.C. (1981) Organization of the gene cluster
expressed specifically in the asexual spores of Aspergillus nidulans. Cell 26,
29–37.
Todd, J.A., Bell, J.I. and McDevitt, H.O. (1987) HLA-DQβ gene contributes to
susceptibility and resistance to insulin-dependent diabetes mellitus. Nature 329,
599–604.
Triglia, T., Peterson, M.G. and Kemp, D.J. (1988) A procedure for in vitro
amplification of DNA segments that lie outside the boundaries of known
sequences. Nucleic Acids Research 16, 8186.
Tsai, Y.-L. and Olson, B.H. (1993) Rapid method for separation of bacterial DNA
from humic substances in sediments for polymerase chain reaction. Applied and
Tuor, U., Winterhalter, K. and Fiechter, A. (1995) Enzymes of white-rot fungi
involved in lignin degradation and ecological determinants for wood decay.
Journal of Biotechnology 41, 1–17.
Vahey, M.T., Wong, M.T. and Michael, N.L. (1995) A standard PCR protocol: Rapid
isolation of DNA and PCR assay for β-globin. In: Dieffenbach, C.W. and
Dveksler, G.S. (eds) PCR Primer: a Laboratory Manual. Cold Spring Harbor
Laboratory Press, Cold Spring Harbour, New York, pp. 17–21.
van Elsas, J.D. and Smalla, K. (1995) Extraction of microbial community DNA from
soils. In: Akkermans, A.D.L., van Elsas, J.D. and De Bruijn, F.J. (eds) Molecular
Microbial Ecology Manual, Kluwer Academic Publishers, Dordrecht
pp. 1.3.3/1–1.3.3.11.
van Rensburg, P., van Zyl, W.H. and Pretorius, I.S. (1996) Co-expression of a
Phanerochaete chrysosporium cellobiohydrolase gene and a Butyrivibrio fibri-
solvens endo-β-1,4-glucanase gene in Saccharomyces cerevisiae. Current Genetics
30, 246–250.
van Vaerenbergh, B., Grootaert, B. and Moens, W. (1995) Validation of a method for
the preparation of fungal genomic DNA for polymerase chain reaction (PCR)
and random amplification of polymorphic DNA (RAPD). Journal of Mycology
and Medicine 5, 133–139.
Vanden Wymelenberg, A., Covert, S. and Cullen, D. (1993) Identification of the gene
encoding the major cellobiohydrolase of the white rot fungus Phanerochaete
chrysosporium. Journal of Bacteriology 174, 2131–2137.
Veres, G., Gibbs, R.A., Scherer, S.E. and Caskey, C.T. (1987) The molecular basis of
the sparse fur mouse mutation. Science 237, 415–417.
Wahleithner, J.A., Xu, F., Brown, K.M., Brown, S.H., Golightly, E.J., Halkier, T.,
Kauppinen, S., Pederson, A. and Schneider, P. (1996) The identification and
characterization of four laccases from the plant pathogenic fungus Rhizoctonia
solani. Current Genetics 29, 395–403.
Yaver, D.S., Xu, F., Golightly, E.J., Brown, K.M., Brown, S.H., Rey, M.W., Schneider,
P., Halkier, T., Mondorf, K. and Dalbøge, H. (1996) Purification, character-
ization, molecular cloning, and expression of two laccase genes from the white
rot basidiomycete Trametes villosa. Applied and Environmental Microbiology
62, 834–841.
PCR Methods for the 11
Detection of Mycotoxin-
producing Fungi
R. Geisen
Bandesforschungsanstalt für Ernährung, Institut für Hygiene und
Toxikologie, Engesserstr. 20, 76131 Karlsruhe, Germany
11.1 Introduction
Nearly every food or feed commodity can be contaminated by fungal

organisms. It is estimated that approximately 25% of the yearly production
of plant-derived foods are spoiled by fungi. Many of the food-borne
filamentous fungi are capable of producing mycotoxins, which are toxic
metabolites of concern to both the health of humans and the health of
animals. Mycotoxins, like antibiotics, are secondary metabolites, which are
primarily produced in the idiostage of fungal growth. Some mycotoxins,
such as patulin, were originally isolated as antibiotics due to their inhibitory
activity towards bacteria, but were later shown to be toxic in animal
experiments (Wilson, 1974). Mycotoxins belong to different chemical classes,
and mainly polyketide, isoprene and amino acid-containing substances are
found (Martin, 1992). Approximately 300 different mycotoxins have been
identified, but only about 20 mycotoxins produced by different species are
relevant to human health (Table 11.1). Due to the different molecular
structures of these mycotoxins, their influences on human and animal health
range from teratogenic, immunosuppressive, tremorgenic, nephrotoxic, hep-
atotoxic to carcinogenic effects (Bullerman, 1979). Some mycotoxicoses are
documented by epidemiological studies. Examples are the ergotism due to
the ingestion of ergot alkaloides produced by Claviceps purpurea (Barger,
1931), the alimentary toxic aleukia which occurred in the Urals and was due
to the infection of cereals with T2 toxin-producing fungi (Bamburg et al.,
1968), the endemic nephropathia in the Balkan region which correlated with
the high occurrence of ochratoxin A-producing filamentous fungi (Krogh,
1987), the high incidence of oesophageal cancer in relation to the high intake
244 R. Geisen
Table 11.1. Mycotoxins of relevance to human health.
Genus Toxins
Aspergillus Aflatoxin
Sterigmatocystin
Cyclopiazonic acid
Penicillium Patulin
Ochratoxin A
Citrinin
Penitrem A
Cyclopiazonic acid
PR toxin
Fusarium T2 Toxin
Deoxynivalenol
Nivalenol
Zearalenon
Diacetoxyscirpenol
Fumonisin
Alternaria Tenuazonic acid
Alternariol
Alternariol monomethylether
Claviceps Ergot alkaloids
of fumonisin-containing maize products (Nelson et al., 1993), and some cases

of epidemiological correlations between the higher incidence of liver cancer
and higher ingestion of aflatoxins (Chu, 1991). Even if these drastic, well-
documented cases are rare, the constant uptake of small amounts of
mycotoxins, especially those with carcinogenic activity, can have profound
effects on human health.
This situation demonstrates the importance of using appropriate
methods to control the mycological status of food and feed commodities.
Conventional methods for the detection of mycotoxinogenic fungi are
culture methods, which are time-consuming and require expertise in fungal
taxonomy. Taxonomic classification can be simplified by the use of selective
media, but the time required is not reduced (Davies et al., 1987). These
problems can be overcome by the use of the PCR which can reduce the
detection time from several days to several hours. The diagnostic PCR
approach for the detection of mycotoxinogenic fungi is an indirect method.
DNA or DNA fragments of the target organism can be amplified and
detected by gel electrophoresis. However, the method does not distinguish
between dead and living cells. This fact, which is a disadvantage for the
detection of pathogenic bacteria in foods, is advantageous in the case of
Detection of Mycotoxin-producing Fungi 245
mycotoxinogenic fungi, as mycotoxins are usually very stable. A positive

PCR can, therefore, be taken as an indication that the sample potentially
contains mycotoxins and should be analysed further. The PCR approach,
however, has the disadvantage that the quantification of fungal biomass is not
easy and although some PCR-based quantification methods have been
described (Hu et al., 1993), they are too laborious for routine analysis.
A prerequisite for the development of a diagnostic PCR is the availability
of unique target sequences, which are specific for the mycotoxin-producing
fungus. Ideally, these target sequences should not be present in strains of the
same species that are not able to produce mycotoxins. Possible target
sequences for PCR or gene probe approaches are given in Table 11.2. For
detection of pathogenic or toxinogenic bacteria in foods, respective toxin or
virulence genes are often used as target sequences for amplification (Olsen et
al., 1996). The counterparts for mycotoxinogenic fungi are the genes which
code for the enzymes of the mycotoxin biosynthetic pathway (referred to as
mycotoxin biosynthetic genes). However, to date, only some of the genes of
mycotoxin biosynthetic pathways have been cloned and sequenced. The best
analysed biosynthetic pathways at the genetic level are those from the
aflatoxins (Trail et al., 1995a; Yu et al., 1995), the trichothecens (McCormick
et al., 1996), patulin (Beck et al., 1990; Wang et al., 1991), PR-toxin (Procter
and Hohn, 1993) and for sterigmatocystin (Kelkar et al., 1996). Sterig-
matocystin is a precursor of aflatoxin and the sterigmatocystin biosynthetic
genes are rather homologous to the aflatoxin biosynthetic genes (Brown et
al., 1996). Genes for biosynthetic enzymes of secondary metabolites are
usually clustered (Hohn et al., 1993) and this is true for the aflatoxin (Trail
et al., 1995a; Yu et al., 1995), sterigmatocystin (Brown et al., 1996),
trichothecene (Hohn et al., 1993) and fumonisin biosynthetic genes (Desjar-
dins et al., 1996).
The polyketide synthase gene from Penicillium patulum, which is the
key enzyme in the biosynthetic pathway of the mycotoxin patulin, has been
cloned (Beck et al., 1990). Polyketide synthases are often involved in fungal
secondary metabolism and can be found in various species (Hopwood and
Sherman, 1990). The polyketide synthases are composed of different catalytic
domains, each specific to a certain reaction. These domains, however, often
Table 11.2. Target sequences for PCR/gene probes.
Specificity Target sequences Microorganisms
Gene specific Toxin genes, virulence genes Bacteria

Toxin biosynthetic genes Fungi
Empirical Ribosomal genes, random cloned Bacteria and fungi
fragments, RAPD products
246 R. Geisen
share high sequence homology, even between species, which makes this gene
unsuitable as a specific target gene for diagnostic PCR (Mayorga and
Timberlake, 1992).
11.2 Mycotoxin Biosynthetic Genes as Target Sequences
11.2.1 Aflatoxinogenic fungi

The aflatoxins are the most carcinogenic natural substances known and can
be found in various food commodities (Diener et al., 1987). They are
produced predominately by Aspergillus flavus, A. parasiticus and A. nomius
(Bennett, 1988). Whereas nearly all A. parasiticus isolates are able to produce
aflatoxins B1 , B2 , G1 and G2 , A. flavus is only able to produce aflatoxins B1
and B2 . Only about 40–50% of A. flavus strains isolated are able to produce
these mycotoxins. A. flavus is highly related taxonomically to A. oryzae as
is A. parasiticus to A. sojae (Kurtzman et al., 1986) and they share 90%
nucleotide sequence homology. A. oryzae and A. sojae are used in the food
industry as fermentation organisms and both are generally recognized as safe
(GRAS) organisms. Both species have never been reported to produce
aflatoxin, but they show high morphological similarity to their aflatoxin-
producing relatives (Klich et al., 1995). A method specific to aflatoxin-
producing fungi should be capable of differentiating between these closely
related species and also between aflatoxin-producing and non-producing A.
flavus strains.
The aflatoxin biosynthetic gene cluster is partially elucidated. The
sequences of some of the genes are already known and published (Trail et al.,
1995b). Interestingly, the genes are organized in such a way that the gene
encoding the first enzyme in the pathway is located at one end of the cluster
and the other genes follow in the same order as the enzymatic reactions in
the biosynthetic pathway (Fig. 11.1). Due to this arrangement, the gene for
norsolorinic acid reductase (nor-1) is located at one end of the cluster, the
gene for versicolorin A dehydrogenase (ver-1) lies in the middle, and the
gene for sterigmatocystin-O-methyltransferase is located at the other end of
the cluster. By selecting these genes as target sequences in a multiplex PCR,
the whole aflatoxin biosynthetic gene cluster can be covered, and partial
deletions of the cluster can be detected (Geisen, 1996). Conventional
morphological methods for the detection of aflatoxinogenic fungi cannot
distinguish between aflatoxin producing and non-producing strains. If the
non-producing phenotype is due to a deletion of the biosynthetic gene
cluster or a part thereof, or to nucleotide changes at the primer binding sites,
the PCR approach is able to distinguish between both genetic alterations.
In a multiplex PCR system, several genes can be detected in one reaction
at a time. Several primer sets are added to the reaction mixture and the
reaction is carried out at an optimized temperature. After electrophoresis of
the products, several amplicons become visible. Multiplex PCR with up to 18

primers has been described (Chamberlain et al., 1989). The advantage of this
system is improved specificity. It was observed that some secondary
metabolite biosynthetic genes are more widely distributed in different fungal
species than expected (see later for details). Thus, it might happen that a PCR
product of the same length as the diagnostic PCR product may occur in a
mycotoxin non-producing species. This situation reduces specificity dras-
tically if only a monomeric PCR is used. The occurrence of two or more
Fig. 11.1. Schematic illustration of the aflatoxin biosynthetic pathway. The order of the
genes reflects their relative location in the aflatoxin biosynthetic gene cluster, according to
Yu et al. (1995). The target genes of the multiplex PCR analysis are indicated in boxes.
248 R. Geisen
PCR products of identical length as the diagnostic PCR products with

template DNA of non-producing species, however, is unlikely. In addition,
a multiplex reaction has the advantage that an internal control reaction can
be included which signals the activity of the polymerase.
Due to the complexity of a multiplex PCR system, several requirements
must be met. The reaction kinetics of the different primer sets should be
similar to ensure that comparable amounts of PCR products are produced
during a reaction. The reaction kinetics are strongly dependent on the primer
design: G/C content, melting temperature, secondary structures, 5′3′ overlap.
A G/C content of 40–60% and a length of 23–28 nucleotides are suggested
as general guidelines for specific annealing. The primary structure of
published aflatoxin biosynthetic gene-specific primers are given in Table
11.3.
Another important aspect for the development of a multiplex reaction is
the primer location. They should be chosen in such a way that the resulting
PCR products are easily separated by agarose gel electrophoresis. The primer
binding sites for the detection of aflatoxinogenic fungi with the multiplex
PCR system are shown in Fig. 11.2. The presence of introns in two of the
amplicons does not influence the result. This indicates that the intron
position and length are very conserved in aflatoxin biosynthetic genes. The
Table 11.3. Sequences of published primers specific for aflatoxin biosynthetic genes.
Gene Sequencea Positionb Reference
aflR > TATCTCCCCCCGGGCATCTCCCGG 450 Shapiro et al.

aflR < CCGTCAGACAGCCACTGGACACGG 1482 (1996)
nor1 > ACCGCTACGCCGGCACTCTCGGCAC 501 Geisen (1996)

nor1 < GTTGGCCGCCAGCTTCGACACTCCG 900
ver1 > ATGTCGGATAATCACCGTTTAGATGGC 496 Shapiro et al.

ver1 < CGAAAAGCGCCACCATTCACCCCAATG 1391 (1996)
ver1 > GCCGCAGGCCGCGGAGAAAGTGGT 623 Geisen (1996)

ver1 < GGGGATATACTCCCGCGACACAGCC 1160
omtA > GGCCCGGTTCCTTGGCTCCTAAGC 208 Shapiro et al.

omtA < CGCCCCAGTGAGACCCTTCCTCG 1232 (1996)
omtA > GTGGACGGACCTAGRCCGACATCAC 301 Geisen (1996)

omtA < GTCGGCGCCACGCACTGGGTTGGGG 1098
a
The sequences are given 5′ to 3′.
b
The positions of the first and last nucleotide of the amplified product are given relative
to the first codon of the gene.
results of typical multiplex PCR analyses with DNA from aflatoxinogenic

fungi are shown in Fig. 11.3. All aflatoxin-producing strains show the same
triplet pattern after electrophoretic separation of the PCR products. The
pattern of the aflatoxinogenic A. flavus strains was identical to that of the A.
parasiticus strains, indicating the homology of the aflatoxin biosynthetic
genes in both species, which is also described in the literature (Yu et al., 1995).
Non-aflatoxinogenic A. flavus strains gave variable results. One strain
showed no signal at all, indicating a complete or nearly complete deletion of
the aflatoxin biosynthetic gene cluster. Another strain exhibited a doublet
pattern, the band for the omt-A gene was missing, suggesting a deletion of the
part of the gene cluster containing the genes for the last reactions in the
biosynthetic pathway. A third strain possessed all three PCR DNA product
bands, demonstrating another type of mutation, perhaps in one of the
regulatory genes. Most of the non-aflatoxinogenic strains which were
analysed showed changes in the triplet pattern, suggesting that their
phenotype was due to deletions of the aflatoxin biosynthetic genes.
A. versicolor, which is not an aflatoxin-producing species, showed the
same triplet pattern. This was not unexpected as A. versicolor is a sterig-
matocystin producer, and sterigmatocystin is the precursor of aflatoxin
(Dutton, 1988). It is synthesized as an end-product of a secondary metabolite
pathway in some fungi like A. versicolor, A. nidulans, and in species of
Chaetomium, Monocillium, Farrowia and Bipolaris. Sterigmatocystin by
itself is an important mycotoxin, although with a reduced toxicity compared
with aflatoxin (Feuell, 1969). The sterigmatocystin biosynthetic pathway is
very similar to the one for the aflatoxin biosynthesis. For example, the genes
for the conversion of versicolorin A to sterigmatocystin are very conserved
in both pathways. In addition, aflR, a regulatory gene of the aflatoxin
biosynthetic pathway, is able to induce the genes of the sterigmatocystin
Fig. 11.2. Illustration of the primer binding sites of the three aflatoxin biosynthetic gene-
specific primer pairs used for multiplex PCR. Thick lines represent the aflatoxin
biosynthetic gene coding sequences, cross-hatched boxes indicate intron sequences.
250 R. Geisen
Fig. 11.3. Agarose gel of the multiplex PCR products of different A. flavus, A. parasiticus,
A. versicolor, A. sojae and A. oryzea strains. Chromosomal DNA of these strains was
isolated and subjected to PCR analysis using the aflatoxin biosynthetic gene-specific
primer. Lane 1, A. sojae DSM1147; lane 2, A. oryzea DSM1861; lane 3, A. versicolor
BFE294; lanes 4–6, A. flavus BFE301, BFE310, BFE311; lanes 7–9, A. flavus BFE84,
BFE292, BFE302; lanes 10 and 11, A. parasiticus BFE291, BFE293; lane 12, size standard,
fragment sizes are indicated in bp.
biosynthetic pathway when introduced into a mutant of A. nidulans. A gene

for a polyketide synthase which is required for aflatoxin biosynthesis was
also identified in A. nidulans (Brown et al., 1996).
As mentioned above, the method should differentiate between A. flavus,
A. parasiticus and the related species, A. oryzae and A. sojae. Figure 11.3
shows that this is, indeed, the case. Both fermentation organisms obviously
carry only a part of the aflatoxin biosynthetic gene cluster, as two bands
specific for the ver-1 and omt-A genes appear. But the band for the nor-1
gene is missing, indicating a deletion of the beginning of the gene cluster. The
method clearly differentiates between these two GRAS organisms and the
aflatoxinogenic fungi. These organisms do not have the same habitat and A.
oryzae and A. sojae are only scarcely found in nature. Both strains are
adapted to a fermentative food environment, which is not the typical habitat
for aflatoxinogenic species. They are, however, morphologically very similar

to the aflatoxinogenic species and the ability of the PCR method to
differentiate between these species can be used for the confirmation and
safety control of the GRAS species used for production of human food.
This diagnostic PCR method gave negative results with many of the
food-borne fungal species tested (Table 11.4). These included different
species of the genera Penicillium, Fusarium, Aspergillus, Byssochlamys and
Geotrichum. Two interesting exceptions were several strains of Penicillium
roqueforti and P. italicum. Both species gave a positive signal in the case of
the nor-1 specific band. The PCR product which appeared had the same
migration behaviour as the nor-1-specific amplicon from an aflatoxinogenic
strain. To analyse potential sequence homology, a digoxigenin-labelled nor-1
PCR product was used as a probe for hybridization to the PCR product from
P. roqueforti. A weak signal indicated some homology, suggesting that P.
roqueforti contains sequences with homology to the nor-1 gene of aflatox-
inogenic fungi. The results demonstrate the advantage of multiplex PCR
analyses over monomeric reactions with regard to their specificity.
Shapiro et al. (1996) described a similar diagnostic PCR method for the
detection of aflatoxinogenic fungi. Three target genes, the omt-1 gene, the
ver-1 gene, and the apa-2 gene, from the aflatoxin biosynthetic gene cluster
were used in three separate monomeric PCRs. The apa-2 (now named as
aflR) gene is a regulatory gene, influencing the expression of the other
Table 11.4. Results of PCR analyses specific for aflatoxin biosynthetic genes with food-
borne fungi.
Species BFE straina nor-1 ver-1 omt-A
Penicillium italicum BFE45 + – –

P. digitatum BFE46 – – –
P. nalgiovense BFE66 – – –
P. camemberti BFE135 – – –
P. chrysogenum BFE236 – – –
P. roqueforti BFE278 + +c –
Byssochlamys nivea BFE218 – – –
Geotrichum candidum BFE222 – – –
Fusarium moniliforme BFE322 – – –
F. graminearum DSM1095b – – –
F. poae DSM62376 – – –
F. solani DSM62416 – – –
F. sporotrichoides DSM62423 – – –
a
Strain number according the culture collection of the Bundesforschungsanstalt für
Ernährung.
b
Strain number of the German Culture Collection (DSM).
c
The PCR fragment was slightly larger than that of A. parasiticus.
252 R. Geisen
aflatoxin biosynthetic genes (Chang et al., 1993). In contrast to the results

described by Geisen (1996), no strong positive PCR signals were found with
DNA from aflatoxinogenic A. flavus strains. After 30 cycles a weak signal for
the omt-1 gene appeared, and after 40 cycles, a weak band for the ver-1 gene
became visible with DNA from A. flavus as the template, but a reaction with
the aflR-specific primer pair failed. The sequences for the aflR genes of A.
flavus and A. parasiticus are highly homologous, but show distinct differ-
ences according to Chang et al. (1995). These sequence dissimilarities might
be responsible for the failure to detect the aflR gene in A. flavus by PCR.
Shapiro et al. (1996) could not identify the omt-1 gene in A. nidulans, a
potential sterigmatocystin-producing species, and they argued that no omt-1
gene was present. The PCR approach described by Geisen (1996) however,
demonstrates that at least in A. versicolor, an omt-1-homologous sequence
was present.
Detection of aflatoxinogenic A. flavus strains in a food system

Aflatoxinogenic fungi are found predominantly in certain foods such as
peanuts, almonds, figs and spices (Bullermann, 1979). Figs are often infected
by members of the group of black aspergilli, including A. flavus and A.
parasiticus (Doster et al., 1996). Figs that were infected with an aflatoxino-
genic strain of A. flavus could be identified with the PCR approach. The
expected amplicons were generated with DNA isolated from infected figs,
whereas uninfected figs gave no signal at all (Färber et al., 1997).
The most crucial prerequisite for diagnostic PCR with food samples is
the isolation of sample DNA in a PCR-usable form. It is known that certain
food components like fats and proteins can interfere with the activity of Taq
polymerase (Rossen et al., 1992). An inhibition of the PCR was also observed
for the infected figs, indicating that a high concentration of carbohydrates is
also inhibitory to the PCR system. The sample DNA was prepared by a
phenol extraction method. An estimation of the sensitivity of the reaction
revealed that it was reduced by a factor of ten compared with pure fungal
DNA.
Kreutzinger et al. (1996) described a method for reducing inhibitory
activity in PCR from environmental samples. In an attempt to detect
ectomycorrhizal fungi in their natural habitat by PCR, they observed that the
Taq polymerase was inhibited strongly by compounds in the sample. This
problem was overcome by the use of very dilute template DNA in a first
round of PCR, followed by a second reaction with nested PCR primers.
Lantz et al. (1994) have described another approach for the preparation of
sample DNA. They attempted to detect pathogenic Listeria monocytogenes
cells in soft cheese by PCR. However, with conventional sample DNA
preparation protocols, the reaction failed; foods with a high fat content are
particularly inhibitory to the polymerase reaction. Functional template
DNA can be prepared if an aqueous, two phase sample preparation system
is used. With this system, the sample is homogenized in a mixture of two
non-soluble aqueous solutions, which separate in two phases after homoge-

nization. One phase consists of a polyethylene glycol (PEG) solution and the
other of a dextran solution. This extraction system separates PCR inhibitory
compounds, which partition to the PEG phase. If samples from the dextran
phase are used for PCR, L. monocytogenes cells can be detected.
Shapiro et al. (1996) used their PCR method for the detection of
aflatoxinogenic fungi in corn. They described an enrichment procedure to
amplify the template DNA prior to PCR by suspending the corn sample in
a rich medium; the sensitivity of the method increased with the incubation
time but the detection time increased simultaneously. Only corn inoculated
with aflatoxinogenic A. parasiticus gave positive signals with the PCR and
after 24 h incubation, 1 × 102 spores of A. parasiticus could be detected.
Even with sophisticated DNA preparation protocols, the occurrence of
false negative reactions with food samples remains a problem. The use of an
internal standard can give information about the quality of the reaction. If a
universal primer set is used which gives a PCR product with all food-relevant
fungal species, then a DNA band of a particular length should occur in nearly
all food samples where there is contaminating fungal biomass. Alternatively,
the sample can be spiked with purified fungal DNA of a certain species. The
occurrence of the standard amplicon is then an indication of the efficiency of
the reaction. It is advantageous to use a universal primer set instead of a
specific one, as every available fungal DNA can then be used as an internal
standard. A universal fungus-specific primer system has been described by
Kappe et al. (1996); the target sequences of this system are the 17S ribosomal
RNA genes. Similarly, the conserved nucleotide sequences of the rRNA
genes, which can serve as primer sequences for the amplification of the ITS1
and ITS2 regions, have been described (White et al. 1990).
The primers ITS1 and ITS2 can be added as a fourth primer pair to the
multiplex PCR. They amplify the ITS1 region from different fungal species
and the PCR product is approximately 250 bp long, although the length may
vary depending on the template DNA used. Figure 11.4 shows some typical
results. The aflatoxinogenic strain now shows a quadruplet pattern as
expected. All other strains, including different Penicillium or Aspergillus
species, show only the standard band of the ITS1 region. As a result of this
reaction design, a sample with a quadruplet pattern indicates the presence of
an aflatoxinogenic species, whereas a monomeric band of about 250 bp
indicates that the reaction was not inhibited by food components and that the
sample did not contain potential aflatoxinogenic fungi.
11.2.2 PR toxin producing fungi

Penicillum roqueforti occurs in various natural habitats. It is used as a fungal
starter culture for the production of blue-veined cheese (Marth, 1987), but
can also be found as a spoilage organism in different food and feed
commodities (Frisvad, 1988). P. roqueforti is a heterogeneous species that
254 R. Geisen
Fig. 11.4. Agarose gel of the multiplex PCR products of different food-borne fungi.
Chromosomal DNA of these strains was isolated and subjected to PCR analysis using the
aflatoxin biosynthetic gene-specific primers in addition to a primer pair specific for the
ITS1 region of the rRNA genes. Lane 1, F. moniliforme BFE312; lane 2, F. solani BFE325;
lane 3, P. digitatum BFE350; lane 4, A. flavus BFE312 (aflatoxin negative); lane 5, A. flavus
BFE84 (aflatoxin positive); lane 6, size standard, fragment sizes are indicated in bp.
was recently divided, according to secondary metabolite patterns and

differences in its ITS regions, into three distinct species: P. roqueforti, P.
paneum and P. carneum (Boysen et al., 1996). All three species are able to
produce various secondary metabolites: P. carneum is capable of producing
patulin, penitrem A and mycophenolic acid; P. roqueforti produces PR toxin,
marcfortines and fumigaclavine A; and P. paneum produces patulin, botryo-
diploidin and other secondary metabolites. All three species are morpho-
logically very similar. P. roqueforti is the species which is used exclusively for
the production of blue cheese. All strains isolated from blue cheese are able
to produce PR toxin (Geisen and Holzapfel, 1995). PR toxin is a relatively
toxic substance, which is able to inhibit protein translation in eukaryotic cells
(Moule et al., 1978). However, PR toxin is not stable in the cheese matrix
where it is converted to the much less toxic PR imine (Scott, 1981).
Nevertheless, strains which do not produce PR toxin are preferable over
conventional strains with respect to safety considerations. PR toxin is a

sesquiterpenoid secondary metabolite, with acetyl-CoA as the first pre-
cursor. One of the key enzymes in its biosynthetic pathway is the
aristolochen synthase, a sesquiterpene cyclase. The nucleotide sequence of
this gene is known (Procter and Hohn, 1993) and, by using gene-specific
PCR with the aristolochen synthase gene (ari1) as a target, it is possible to
screen P. roqueforti strains for the presence of aristolochen synthase. Strains
with a deletion in that gene are expected to be unable to produce PR toxin.
This method of screening for PR toxin-free strains is more direct, reliable and
less time-consuming than looking for the ability to produce PR toxin
especially as PR toxin production is dependent on various environmental
conditions (Scott et al., 1977), which makes the identification of PR toxin-
negative strains by conventional methods difficult.
Strains isolated from cheese and infected feeds were subjected to PCR
analysis with ari1-specific primers. A product of the expected length
occurred in nearly all strains, indicating the presence of the ari1 gene. Figure
11.5 shows a typical result obtained with several strains. Subsequent analysis
by thin layer chromatography (TLC) showed that all strains except one
produced PR toxin. The strains which were negative in the PCR, but which
were able to produce PR toxin, were verified by dot-blot hybridization using
an ari1-specific probe. After the analysis all PR toxin-producing strains were
positive either in the dot-blot hybridization or the PCR analysis (Table 11.5).
An exception was one strain which did not produce PR toxin, indicating that
it did not carry the ari1 gene. The other strains which were negative in the
PCR analysis, but positive in the dot-blot hybridization and TLC obviously
carried active genes which may have alterations in their primer binding sites.
These results show that it is not always appropriate to rely solely on one
PCR target site, as small changes in the sequence can have dramatic effects
on the PCR results. The single strain which was negative in the PCR analysis
and did not produce PR toxin, was originally isolated from cheese and is
therefore probably a safe candidate for the production of blue-veined cheese.
As mentioned above, homologues of aflatoxin biosynthetic genes can be
identified unexpectedly in P. roqueforti (Table 11.5). The same phenomenon
is apparent with the ari1 gene and a sequence homologous to that gene can
be found unexpectedly in various species (Table 11.6). The gene-specific PCR
gave positive results with P. camemberti and Byssochlamys nivea, both
species which are not known to produce PR toxin. With the dot-blot analysis
even more species gave positive results, indicating the occurrence of ari1-like
sequences in a variety of species, which are not able to produce PR toxin. The
relevance of the frequent occurrence of a nucleotide sequence homologous to
secondary metabolite biosynthetic genes in various fungi is not known.
Enzymes of secondary metabolite pathways have less specificity than their
counterparts from primary metabolism (Dutton, 1988) and this results in a
somewhat different behaviour from that of biosynthetic enzymes of primary
metabolism. In certain cases, one enzyme can catalyse analogous reactions
256 R. Geisen
with related but different substrates. This can result in a metabolic grid, a
network of enzymatic reactions from different substrates that give rise to
different reaction products (Yabe et al., 1991). This is one of the reasons why
in secondary metabolism a large number of end-products can be produced,
such as the aflatoxins, the fumonisins, the trichothecens or the ochratoxins.
This behaviour may also be an explanation for the positive PCR results for
specific secondary metabolite biosynthetic genes in various species. If these
species possess active genes with homology to mycotoxin biosynthetic genes,
Fig. 11.5. Agarose gel of PCR products of P. roqueforti strains and a P. nalgiovense strain
(as a control) with aristolochen synthase-specific primers. Lane 1, P. roqueforti BFE42;
lane 2, P. roqueforti BFE50; lane 3, P. nalgiovense BFE66; lane 4, P. roqueforti BFE53; lane
5, P. roqueforti BFE54; lane 6, size standard, fragment sizes are indicated in kb.
Table 11.5. Presence of the ari1 gene sequences and ability to produce PR toxin in
various Penicillium roqueforti strains.
BFE straina ari1 b Dot-blotc PR toxind nor1 e Sourcef
BFE42 + + + – C
BFE53 + + + + C
BFE168 + + + ND C
BFE169 + + + – C
BFE170 + + + ND C
BFE171 + + + ND C
BFE172 + + + ND C
BFE50 – + + – C
BFE54 – – – – C
BFE62 – + + + C
BFE63 + + + + C
BFE208 + + + ND S
BFE209 + + + ND S
BFE210 + + + ND S
BFE211 + + + ND S
BFE215 + + + ND S
BFE216 + + + – S
BFE212 – + + – S
BFE213 + + + – S
BFE284 + + + + S
BFE285 + + + + S
a
Strain number according the culture collection of the Bundesforschungsanstalt für
Ernährung.
b
The presence of the ari1 gene sequences was checked with gene-specific PCR.
c
For dot-blot analysis the labelled ari1-specific PCR product was used.
d
Detected by thin layer chromatography.
e
The presence of the nor1 gene was checked by gene-specific PCR.
f
C, isolated from cheese; S, isolated from silage.
ND, not determined.
their gene products may participate in secondary metabolite pathways

leading to different, perhaps as yet unidentified, end-products.
These results taken together suggest that a monomeric PCR reaction,
which targets only one gene, possesses insufficient specificity for the
detection of mycotoxin-producing fungi. Multiplex reactions, as was descri-
bed for aflatoxinogenic fungi, are recommended. If only one gene of the
mycotoxin biosynthetic pathway is known, as in the case of PR toxin,
another known specific sequence can be used as an additional target
sequence, for example the sequences of the rRNA genes of P. roqueforti
(Boysen et al., 1996).
258 R. Geisen
Table 11.6. Presence of aristolochen synthase gene like

nucleotide sequences in various species.
Detection of ari1-like
sequences by
BFE straina PCR Dot-blot
P. roqueforti BFE278 + +
P. camemberti BFE135 + +
B. nivea BFE218 + +
P. italicum BFE45 – +
P. nalgiovense BFE66 – +
A. nidulans BFE125 – +
P. digitatum BFE46 – –
P. chrysogenum BFE236 – –
G. candidum BFE222 – –
A. flavus BFE388 – –
A. parasiticus BFE293 – –
A. versicolor BFE294 – –
a
Strain number according the culture collection of the
Bundesforschungsanstalt für Ernährung.
11.2.3 rDNA and miscellaneous sequences as target sequences

The organization of ribosomal RNA genes is highly conserved within the
fungal kingdom. The small subunit, 5.8S, and large subunit rRNA genes are
organized in a single transcription unit and are separated by two spacer
regions ITS1 and ITS2. The RNA transcript is post-transcriptionally
processed into small subunit, 5.8S, and large subunit rRNA species. The
rRNA sequences have conserved and variable regions and are useful for
studying distantly related organisms at the taxonomic level. The ITS
sequences, however, are more variable in their nucleotide composition and
can be used for differentiation of species or populations. It may be possible
to identify unique sequences within the ITS regions which may serve as
target sequences for diagnostic PCR. Universal primers which can be used
for amplification or cycle sequencing of ITS1 and ITS2 have been described
(White et al., 1990; Fig. 11.6). It is relatively straightforward to sequence
these regions by using primers such as ITS1 and ITS4, and to determine
unique sequences for primer development. A prerequisite for usage of these
sequences for detection of mycotoxinogenic fungi is the requirement that
their presence be linked to the ability of a strain to produce a mycotoxin. This
is one of the drawbacks of this approach as in most cases not all strains of a
species are able to produce the respective mycotoxin. A species-specific
primer pair identified by this approach does not ultimately mean that it is
Fig. 11.6. Illustration of a typical fungal rRNA gene and the position of the universal
primers ITS1 and ITS4.
specific only for the mycotoxinogenic strains of that species. A positive result
from PCR of the rRNA genes is, therefore, not as valid as the results from
a PCR targeted to the mycotoxin biosynthetic genes.
Considerable literature data on ITS sequences of different fungi are
available. Most of the sequences were obtained for taxonomic purposes and
their specificity in PCR analyses has not been determined (Morales et al.,
1993; Bunting, et al., 1996; Waalwijk et al., 1996). F. sambucinum (teleo-
morph, Gibberella pulicaris) is able to produce fusarin C and trichothecenes
(Smith and Solomons, 1994). O’Donnel (1997) has described three different
groups of ITS sequences within the species F. sambucinum. However, the
possible relationship between these ITS groups and the ability to produce a
mycotoxin was not considered. Grimm and Geisen (1996) sequenced the
ITS1 region of fumonisin-producing Fusarium species. They were able to
identify regions which were common to all fumonisin-producing fungi, but
which showed minor polymorphisms in sequence compared with non-
fumonisin-producing species. On the basis of these differences, primer pairs
were derived which gave only the expected products from F. moniliforme, F.
nygamai, F. napiforme and F. proliferatum, i.e. potential fumonisin-
producing fungi.
Schilling et al. (1996) analysed the ITS region of Fusarium culmorum
(teleomorph, unknown), F. graminearum (teleomorph, Gibberella zeae) and
F. avenaceum (teleomorph, G. avenacea) with the aim of developing ITS-
specific PCR primers. All three species are plant pathogens of cereals and
grasses. The three species are able to produce different mycotoxins: F.
avenaceum produces moniliformin and trichothecene A; F. graminearum
produces zearalenone, trichothecene A + B and fusarin C; and F. culmorum
produces zearalenone, trichothecene A + B and culmorin. Schilling et al.
(1996) were not able to identify sufficient sequence polymorphisms within
the ITS region of these three species to identify specific primer target sites.
For this reason, they applied another approach in which preselected random
sequences were chosen as target sequences for the PCR primers. This
preselection was achieved by identifying RAPD–PCR patterns which were
specific for each species. RAPD–PCR is a variation of conventional PCR
(Williams, 1990) in which one primer of arbitrary sequence is used. The
hybridization temperature during RAPD–PCR is considerably reduced
compared with conventional PCR. This enables semi-specific binding of the
260 R. Geisen
primer and results in a specific RAPD pattern. If identical conditions are

used, the same pattern should be generated with each reaction. Depending on
the type of random primer used, the resulting RAPD pattern can be species-
specific (Guthrie et al., 1992), and can differentiate between various
genotypes within a species (Hamelin et al., 1993) or even between strains of
the same species (Bidochka et al., 1994). The probability that certain bands
of the RAPD pattern which occur only in mycotoxin-producing fungi
consists of unique sequences is very high. Schilling et al. (1996) isolated
unique bands of the RAPD pattern of Fusarium species. They derived
specific PCR primer target sites from their sequences which could be used for
differentiation and detection of these species.
The approach described above may be a general method for the
development of a diagnostic PCR method for a particular group of
microorganisms if no genetic data are available. The same approach was used
for the development of gene probes for potential fumonisin-producing fungi
(Geisen, 1997). Two RAPD bands were identified which only occurred with
potential fumonisin-producing fungi, such as F. moniliforme, F. nygamai, F.
napiforme and F. proliferatum. These two DNA fragments were labelled
either with digoxigenin or with biotin and used as probes for various fungal
DNA sequences. Specific hybridization of the probes was visualized by
alkaline phosphatase reactions with either fast blue B (resulting in a blue
colour) or fast red TR (resulting in a red colour). When both colours were
present on the membrane the result was interpreted as the presence of a
potential fumonisin-producing fungus. A survey of the results with the
DNA from various food-borne fungi is given in Table 11.7. From these
results it can be concluded that primer sequences for diagnostic PCR can be
derived from RAPD fragments as also shown by Schilling et al. (1996).
In addition to rRNA genes or random sequences, sequences from cloned
genes of mycotoxin-producing fungi may serve as targets for diagnostic
PCR. Niessen and Vogel (1997) developed a PCR analysis which was specific
for F. graminearum. All other Fusarium species or species of other genera
gave negative results, indicating high specificity for the method. The reaction
was directed against the endogenous galactose oxidase gene (gaoA); however,
the authors did not attempt to correlate mycotoxin production and PCR
results.
11.3 Conclusions
PCR is a valuable tool for the rapid screening of foods and feeds for the
presence of mycotoxin-producing fungi. Results can be obtained from an
infected sample within 24 h as compared with up to several days by
conventional methods. If an appropriate target sequence is chosen, the
method can also differentiate between mycotoxin-producing and non-
producing strains of a species in most cases.
Table 11.7. Dot-blot analysis with the RAPD gene

probes for fumonisin-producing fungi.
BFE straina Probe 1 Probe 2
Penicillium italicum BFE45 – –

P. digitatum BFE46 – –
P. nalgiovense BFE66 – –
Aspergillus flavus BFE84 – +
A. nidulans BFE125 – –
P. camemberti BFE125 – –
Byssochlamys nivea BFE218 – –
Fusarium moniliforme BFE314 + +
F. moniliforme BFE315 + +
F. moniliforme BFE319 ND +
F. proliferatum BFE343 + +
F. proliferatum BFE344 + +
F. nygamai BFE353 + +
F. nygamai BFE355 + +
F. napiforme BFE354 + +
F. graminearum BFE323 – –
F. poae BFE324 – –
F. solani BFE325 – –
F. sporotrichoides BFE326 – –
a
Strain number according the culture collection of the
Bundesforschungsanstalt für Ernährung.
ND, not determined.
Problems with inhibitory substances within food samples can be

overcome by an adapted DNA purification protocol (Lantz et al., 1994), the
use of highly diluted DNA and a subsequent nested second amplification
(Kreutzinger et al., 1996), or controlled by the use of internal standard DNA
giving information about the quality of the reaction.
The most direct procedure for the development of a diagnostic PCR
method for mycotoxin-producing fungi is the targeting of the mycotoxin
biosynthetic genes. If their sequences are not available, other opportunities
for the identification of target sequences exist, such as the determination of
specificities in ITS sequences, or random sequences preselected by RAPDs;
sequences from structural genes may also serve as target sites. These
secondary target sequences are less specific because mycotoxin-producing
and non-producing strains are indistinguishable. Diagnostic PCR methods
262 R. Geisen
are rapid tools for safety control of foods and feeds. They can, however,
only give information about the presence of a potential mycotoxin-
producing fungus in a sample but cannot detect the mycotoxin itself. A
positive result indicates a potential health hazard and the product should
be further checked for the presence of the particular mycotoxin by
analytical methods.
Acknowledgements
P. Thiel and J. P. Rheeder are thanked for providing fumonisin-producing

Fusarium species, and H. Auerbach for the P. roqueforti strains from silage.
References
Bamburg, J.R., Riggs, N.V. and Strong, F.M. (1968) The structures of toxins from two
strains of Fusarium trincinctum. Tetrahedron 24, 3329–3336.
Barger, G. (1931) Ergot and Ergotism. Gurney and Jackson, London.
Beck, J., Ripka, S., Siegner, A., Schiltz, E. and Schweizer, E. (1990) The multi-
functional 6-methylsalicylic acid synthase gene of Penicillium patulum. Euro-
pean Journal of Biochemistry 192, 487–498.
Bennett, J.W. and Papa, K.E. (1988) The aflatoxigenic Aspergillus spp. Advances in
Plant Pathology 6, 263–280.
Bidochka, M.J., McDonald, M.A., St Leger, R.J. and Roberts, D.W. (1994) Differ-
ention of species and strains of entomopathogenic fungi by random amplifica-
tion of polymorphic DNA (RAPD). Current Genetics 25, 107–113.
Boysen, M., Skouboe, P., Frisvad, J. and Rossen, L. (1996) Reclassification of the
Penicillium roqueforti group into three species on the basis of molecular genetic
and biochemical profiles. Microbiology 142, 541–549.
Brown, D.W., Yu, J., Kelkar, H.S., Fernandes, M., Nesbit, T.C., Keller, N.P., Adams,
T.H. and Leonhard, T.J. (1996) Twenty five coregulated transcripts define a
sterigmatocystin gene cluster in Aspergillus nidulans. Proceedings of the National
Bullerman, L.B. (1979) Significance of mycotoxins to food safety and human health.
Journal of Food Protection 42, 65–86.
Bunting, T.E., Plunbley, K.A., Clarke, B.B. and Hillman, B.I. (1996) Identification of
Magnaporthe poae by PCR and examination of its relationship to other fungi by
analysis of their nuclear rDNA ITS1 region. Phytopathology 86, 398–404.
Chamberlain, J.S., Gibbs, R.A., Ranier, J.E., Nguyen, P.N. and Caskey, C.T. (1990)
Multiplex PCR for the diagnosis of Duchenne muscular dystrophy. In: Gelfland,
D.H., Innis, M.A., Sninsky, J.J. and White, T.J. (eds) PCR protocols: a Guide to
Chang, P.K., Cary, J.W., Bhatnagar, D., Cleveland, T., Bennett, J.W., Linz, J.,
Woloshuk, C.P. and Payne, G.A. (1993) Cloning of the Aspergillus parasiticus
apa-2 gene associated with the regulation of aflatoxin biosynthesis. Applied and
Chang, P.K., Bhatnagar, D., Cleveland, T. and Bennett, J.W. (1995) Sequence
variability in homologs of the aflatoxin pathway gene aflR distinguishes species
in Aspergillus section Flavi. Applied and Environmental Microbiology 61, 40–43.
Chu, F.S. (1991) Mycotoxins: food contamination, mechanism, carcinogenic potential
and preventive measures. Mutation Research 259, 291–306.
Davies, N.D., Iyer, S.K. and Diener, U.L. (1987) Improved method of screening for
aflatoxin with a coconut agar medium. Applied and Environmental Microbiology
53,1593–1595.
Desjardins, A.E., Hohn, T.M. and McCormick, S.P. (1993) Trichothecene biosyn-
thesis in Fusarium species: chemistry, genetics and significance. Microbiological
Reviews 57, 595–604.
Diener, U.L., Cole, R.J., Sanders, T.H., Payne, G.A., Lee, L.S. and Klich, M. (1987)
Epidemiology of aflatoxin formation by Aspergillus flavus. Annual Review of
Doster, M.A., Michailides, T.J. and Morgan, D.P. (1996) Aspergillus species and
mycotoxins in figs from California orchards. Plant Disease 80, 484–489.
Dutton, M.F. (1988) Enzymes and aflatoxin biosynthesis. Microbiological Reviews 52,
274–295.
Färber, P., Geisen, R. and Holzapfel, W.H. (1997) Detection of aflatoxinogenic fungi
in figs by a PCR reaction. International Journal of Food Microbiology 36,
215–220.
Feuell, A.J. (1969) Types of mycotoxins in food and feeds. In: Goldblatt, L.A. (ed.)
Aflatoxin. Academic Press, New York, pp. 187–221.
Frisvad, J.C. (1988) Fungal species and their specific production of mycotoxins. In:
Samson, R.A. and van Reenen-Hoekstra, E.S. (eds) Introduction to Food Borne
Fungi. Centraalbureau voor Schimmelcultures, Baarn, pp. 239–249.
Geisen, R. (1996) A multiplex PCR reaction for the detection of potential aflatoxin
and sterigmatocystin producing fungi. Systematic and Applied Microbiology 19,
388–392.
Geisen, R. (1997) Nachweis von potentiell fumonisinbildenden Fusarien mit Hilfe einer
‘Multicolour Dot Blot Reaktion’. In: Gareis, M. and Scheuer, R. (eds) Proceedings
of the 18th Mykotoxin Workshop, Bundesanstalt für Fleischforschung, Kulmbach,
10–12 June 1996. Bundesanstalt für Fleischforschung, pp. 15–20.
Geisen, R. and Holzapfel, W.H. (1995) Molecular charcterization of PR toxin
producing Penicillium roqueforti strains. BIOspectrum 3, 101.
Grimm, C. and Geisen, R. (1996) A PCR reaction specific for potential fumonisin
producing Fusaria based on ITS sequences. VAAM Workshop, Regulation in
Fungi. Jülich. November 21–22.
Guthrie, P.A.I., Magill, C.W., Frederiksen, R.A. and Odvody, G.N. (1992) Random
Hamelin, R.C., Ouellete, G.B. and Bernier, L. (1993) Identification of Gremmeniella
abietina races with random amplified polymorphic DNA markers. Applied and
Hohn, T.M., McCormick, S.P. and Desjardins, A.E. (1993) Evidence for a gene cluster
involving trichothecene-pathway biosynthetic genes in Fusarium sporotri-
choides. Current Genetics 24, 291–295.
Hopwood, D.A. and Sherman, D.H. (1990) Molecular genetics of polyketides and its
comparison to fatty acid biosynthesis. Annual Review of Genetics 24, 37–66.
264 R. Geisen
Hu, X., Nazar, R.N. and Robb, J. (1993) Quantification of Verticillium biomass in
wilt disease development. Molecular Plant Pathology 42, 23–36.
Kappe, R., Fauser, C., Okeke, C.N. and Maiwald, M. (1996) Universal fungus-specific
primer systems and group specific hybridization oligonucleotides for 18S rRNA.
Mycoses 39, 25–30.
Kelkar, H.S., Keller, N.P. and Adams, T.H. (1996) Aspergillus nidulans stc P encodes
an O-methyltransferase that is required for sterigmatocystin biosynthesis.
Klich, M., Yu, J., Chang, P.K., Mullaney, E.J., Bhatnagar, D. and Cleveland, T. (1995)
Hybridization of genes involved in aflatoxin biosynthesis to DNA of aflatoxino-
genic and non-aflatoxinogenic aspergilli. Applied Microbiology and Biotechnol-
ogy 44, 439–443.
Kreutzinger, N., Podeu, R., Gruber, F., Göbl, F. and Kubiceck, C.P. (1996)
Identification of some ectomycorrhizal basidiomycetes by PCR amplification of
their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes. Applied and
Krogh, P. (1987) Ochratoxins in food. In: Krogh, P. (ed.) Mycotoxins in Food.
Academic Press, London, pp. 97–121.
Kurtzman, C.P., Smiley, M.J., Robnett, C.J. and Wicklow, D.T. (1986) DNA
relatedness among wild and domesticated species in the Aspergillus flavus group.
Lantz, P.G., Tjernfeld, F., Borch, E., Hahn-Hägerdahl, B. and Rådström, P. (1994)
Enhanced sensitivity in PCR detection of Listeria monocytogenes in soft cheese
through use of an aqueous two-phase system as a sample preparation method.
Applied and Environmental Microbiology, 60, 3416–3418.
Marth, E. (1987) Dairy products. In: Beuchat, L. (ed.) Food and Beverage Mycology.
Van Nostrand Reinhold, New York, pp. 175–209.
Martin, J.F. (1992) Secondary metabolites. In: Kinghorn, J.R. and Turner, G. (eds)
Applied Molecular Genetics of Filamentous Fungi. Blackie Academic and
Professional, London, pp. 214–252.
Mayorga, M.E. and Timberlake, W.E. (1992) The developmentally regulated Aspergil-
lus nidulans wA gene encodes a polypeptide homologous to polyketide and fatty
acid synthases. Molecular and General Genetics 235, 205–212.
McCormick, S.P., Hohn, T.M. and Desjardins, A.E. (1996) Isolation and
characterization of Tri3, a gene encoding 15-O-acetyltransferase from
Fusarium sporotrichoides. Applied and Environmental Microbiology 62,
353–359.
Morales, V.M., Pelcher, L.E. and Taylor, J.L. (1993) Comparison of the 5.8S rDNA
and internal transcribed spacer sequences of isolates of Leptosphaeria maculans
from different pathogenicity groups. Current Genetics 23, 490–495.
Moule, Y., Jemmali, M. and Darracq, N. (1978) Inhibition of protein synthesis by PR
toxin, a mycotoxin from Penicillium roqueforti. FEBS Letters 8, 341–344.
Nelson, P.E., Desjardins, A.E. and Plattner, R.D. (1993) Fumonisins, mycotoxins
produced by Fusarium species: biology, chemistry and significance. Annual
Reviews of Phytopathology 31, 233–252.
Niessen, L. and Vogel, R.F. (1997) Specific identification of Fusarium graminearum
by PCR with gaoA targeted primers. Systematic and Applied Microbiology 20,
111–113.
O’Donnel, K.L. (1992) Ribosomal DNA internal transcribed spacers are highly
divergent in the phytopathogenic ascomycete Fusarium sambucinum (Gibberella

pulicaris). Current Genetics 22, 213–220.
Olsen, J.E., Aabo, S., Hill, W., Notermans, S., Wernars, K., Granum, P.E., Popovic,
T., Rasmussen, H.N. and Olsvik, Ø. (1995) Probes and polymerase chain
reaction for detection of food-borne bacterial pathogens. International Journal
of Food Microbiology 28, 1–78.
Proctor, R.H. and Hohn, T.M. (1993) Aristolochen synthase: isolation, character-
ization, and bacterial expression of a sesquiterpenoid biosynthetic gene (ARi1)
from Penicillium roqueforti. Journal of Biological Chemistry 268, 4543–4548.
Rossen, L., Nørskov, P., Holmstrøm, K. and Rasmussen, O.F. (1992) Inhibition
of PCR by components of food samples, microbial diagnostic assays and
DNA-extraction solutions. International Journal of Food Microbiology 17,
37–45.
Schilling, A.G., Möller, E.M. and Geiger, H.H. (1996) Polymerase chain reaction-
nearum and F. avenaceum. Phytopathology 86, 515–522.
Scott, P.M. (1981) Toxins of Penicillium species used in cheese manufacture. Journal
of Food Protection 44, 702–710.
Scott, P.M., Kennedy, B.P.C., Harwig, J. and Blanchfield, B.J. (1977) Study of
conditions for production of roquefortin and other metabolites of Penicillium
roqueforti. Applied and Environmental Microbiology 33, 249–253.
Shapiro, R., Paster, N., Eyal, O., Menasherov, M., Mett, A. and Salomon, R. (1996)
Detection of aflatoxinogenic molds in grains by PCR. Applied and Environmen-
Smith, J.E and Solomons, G.L. (1994) Mycotoxins in Human Nutrition and Health.
Directorate General XII, EUR 16048 EN, European Commission, Brussels.
Trail, F., Mahanti, N., Mehigh, R., Liang, S.H., Zhou, R. and Linz, J. (1995a) Physical
and transcriptional map of an aflatoxin gene cluster in Aspergillus parasiticus and
functional disruption of a gene involved early in the aflatoxin pathway. Applied
Trail, F., Mahanti, N. and Linz, J. (1995b) Molecular biology of aflatoxin biosynthesis.
Waalwijk, C., de Koning, J.R.A., Baayen, R.P. and Gams, W. (1996) Discordant
Wang, I.K., Reeves, C. and Gaucher, G.M. (1991) Isolation and sequencing of a
genomic DNA clone containing the 3 terminus of the 6-methysalicylic acid
polyketide synthetase gene of Penicillium urticae. Canadian Journal of Micro-
biology 37, 86–95.
sequencing of fungal ribosomal RNA genes for phylogenetics. In: Gelfland,
D.H., Innis, M.A., Sninsky, J.J. and White, T.J. (eds) PCR protocols: a Guide to
Williams, J.K.G., Kubelik, A.R. Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990)
Wilson, D.M. (1974) Patulin and penicillic acid. In: Rodricks, J.V. (ed.) Mycotoxins
and Other Fungal Related Food Problems. American Chemical Society, Wash-
ington DC, pp. 90–109.
266 R. Geisen
Yabe, K., Ando, Y., and Hamasaki, T. (1991) A metabolic grid among versiconal
hemiacetal acetate, versiconol acetate, versiconol and versiconal during aflatoxin
biosynthesis. Journal of General Microbiology 137, 2469–2475.
Yu, J., Chang, P.K., Cary, J.W., Wright, M., Bhatnagar, D., Cleveland, T., Payne, G.A.
and Linz, J. (1995) Comparative mapping of aflatoxin pathway gene clusters in
Aspergillus parasiticus and Aspergillus flavus. Applied and Environmental
PCR Diagnostics in Medical 12
Mycology
T. Hughes, T.R. Rogers and K. Haynes
Department of Infectious Diseases, Imperial College of Science,
London W12 0NN, UK
12.1 Introduction
Recent advances in the use of immunosuppressive therapies to treat cancer

and enable solid organ or bone marrow transplants, together with advances
in the development of broad spectrum antibiotics, have created an increasing
population of immunocompromised patients. In addition, the HIV pandemic
has created a large increase in the number of immunosuppressed individuals.
These patients are at significant risk from systemic fungal infections. The
incidence of invasive fungal infection in bone marrow transplant patients has
been reported to be as high as 50%, and the subsequent mortality rates are
generally around 80% (Tang and Cohen, 1992). The three major opportu-
nistic fungal pathogens in the UK are Candida albicans, Aspergillus fumiga-
tus and Cryptococcus neoformans but many other fungi have also been
reported as pathogens in these clinical settings. These include non-albicans
Candida spp., especially Candida krusei and Candida glabrata, Aspergillus
flavus, Pneumocystis carinii, Fusarium spp., Trichosporon beigelii, Rhizopus
arrhizus, Histoplasma capsulatum, Paracoccidioides brasiliensis and Cocci-
dioides immitis (Bodey, 1988; Anaissie et al., 1989). With the exception of the
cryptococcal antigen latex agglutination test, established methods for diag-
nosing systemic fungal infections are often time-consuming and insensitive;
e.g. blood cultures are nearly always negative in cases of invasive aspergillosis
(Richardson and Warnock, 1993). If appropriate therapy is to improve the
prognosis of the immunocompromised patient with systemic fungal infec-
tion, early diagnosis is required (Burch et al., 1987).
Antibody responses in immunocompromised hosts are generally too
weak to form the basis of a diagnostic test. However, a large research
268 T. Hughes et al.
investment has been made in the development of antigen detection-based

immunoassays for the diagnosis of various systemic mycoses including both
invasive candidosis and aspergillosis, disseminated histoplasmosis, coccidioi-
domycosis and paracoccidioidomycosis. While these tests have the
advantages of being both quick and relatively straightforward to perform,
they have not gained general acceptance due to low sensitivity and/or lack
of commercial availability (De Repentigny et al., 1994). Extracellular
galactomannan (GM) circulating in patients with invasive aspergillosis can
be detected in serum samples with a commercially available latex
agglutination test (Pastorex Aspergillus, Sanofi Diagnostics Pasteur, Marnes-
La Coquette, France) which uses a monoclonal antibody (raised against A.
fumigatus GM) to detect antigen. However, reports on the utility of this
diagnostic test vary (Van Cutsem et al., 1990; Kappe and Schulze-Berge,
1993; Haynes and Rogers, 1994; Manso et al., 1994; Verweij et al., 1995).
In contrast with other fungal infections, diagnosis of cryptococcosis by the
cryptococcal antigen latex agglutination test is accepted as the standard
method of diagnosis, with a high sensitivity and specificity. Most equivalent
tests are not sensitive enough to exclude diagnosis on the basis of a negative
result.
Commercial biochemical tests are available for identifying clinical yeast
isolates, e.g. Vitek Yeast Biochemical Card (bioMerieux Vitek Inc., Hazel-
wood, Missouri) and the API 20C identification system (bioMerieux Vitek
Inc.); both are reliable for the identification of common yeasts but problems
of non-specificity have been encountered with more unusual species (Fenn
et al., 1994).
Inability or delay in diagnosing fungal infection defers the administra-
tion of appropriate therapy. This has grave implications for the prognosis of
the patient: reliable and rapid diagnostic tests for systemic mycoses are
imperative to improve rates of patient survival (Haynes and Rogers, 1996).
In attempting to overcome low sensitivity, poor specificity and delay,
molecular approaches to the diagnosis of fungal infection have been adopted,
particularly the polymerase chain reaction (PCR). PCR can be very sensitive
and, depending on primer design, very specific. Several species-specific
PCR-based diagnostic methods for detection of various common fungal
pathogens have been described. This discussion will concentrate solely on
the diagnosis of systemic fungal infection; however, many of the principles
described could easily be adapted to the diagnosis of superficial or
subcutaneous mycoses.
12.2 Strategies for Designing PCR-based Diagnostics
When developing a PCR-based diagnostic method various factors can be

adapted to optimize both sensitivity and specificity.
Medical Mycology Diagnostics 269
12.2.1 Target
The specificity of a diagnostic PCR can be engineered to suit the purpose for
which it is being used by selecting an appropriate target sequence for
amplification. The specificity is determined by the degree of homology
shared between the target sequence and DNA sequences of different genera
or species. For example, a highly conserved region from a gene universally
shared by all fungi is a suitable target sequence for a PCR protocol designed
to indicate whether an infection is bacterial or fungal in origin. This strategy
has been adopted by several groups who have selected highly conserved, or
‘universal’, regions within fungal ribosomal RNA (rRNA) genes as target
sequences for amplification. Various amplicon detection methods can be used
to identify the fungal source of DNA to genus or species level. The rRNA
genes are a popular choice for this strategy as they contain highly conserved
regions which can be used to amplify all DNAs, adjacent to highly variable
regions which can be used for subsequent species identification. Another
advantage is that rRNA genes are generally present at a high copy number
which increases the sensitivity of the PCR. Makimura’s group (1994)
developed a PCR based on conserved regions within the fungal 18S rRNA
genes which successfully amplified DNA from 78 strains of 25 medically
important fungi. Haynes et al. (1995) described a PCR in which one pair of
primers corresponded to the V3 region of the S. cerevisiae large subunit
rRNA gene sequences universally conserved within the fungal kingdom.
Species-specific forward primers were then designed which could be used in
tandem with the universal reverse primer to specifically amplify DNA from
A. fumigatus, Cr. neoformans and C. albicans.
Hopfer et al. (1993) used a previously described set of primers based on
an rRNA gene sequence present thoughout the fungal kingdom (White et al.,
1990) to amplify a 306–311 bp target in 42 different fungi. The amplicons
were subjected to restriction enzyme analysis; PCR products were digested
with HaeIII and separated by electrophoresis through agarose gels. The
resulting patterns were used to place the sources of fungal DNA into five
broad groups including Candida spp. and related yeasts, and Aspergillus spp.
plus related septate moulds.
Alternatively, a highly variable region would give greater specificity,
enabling the detection of a particular genus or species. Generally, the more
variable the target region the more discriminatory the PCR (Mitchell et al.,
1994b). Tang et al. (1993) described a PCR to detect the alkaline protease
genes of A. fumigatus and A. flavus; the species were distinguished by the
size of the amplified fragment. This PCR was shown to detect both A.
fumigatus and A. flavus in four bronchoalveolar lavage (BAL) samples of
four patients with either proven or possible invasive pulmonary aspergillosis;
only one of 18 BAL samples from immunosuppressed patients with no
clinical indication of fungal infection was positive by PCR.
12.2.2 Sample choice and preparation

As part of the developmental process for a diagnostic PCR protocol, the
choice of clinical material and the method of DNA extraction from that
material is critical. Ideally, the presence of target DNA in the chosen
specimen will be clinically significant; the detection of Candida must
distinguish pathogen from commensal, the detection of Aspergillus must
distinguish pathogen from colonization or environmental contamination.
Most PCR protocols for the diagnosis of Candida infections involve the
examination of blood samples as detection of the fungus in blood is regarded
as clinically significant. The diagnosis of invasive aspergillosis is more
complicated as the fungus is rarely isolated from blood cultures and a
reproducible PCR method for detecting Aspergillus DNA in blood remains
elusive. This problem is complicated further as the significance of detection
of this ubiquitous organism in respiratory specimens is questionable (see
Section 12.3.2). Often a positive PCR result will need to be interpreted
within the clinical setting to determine its relevance. As so many patients
with systemic or pulmonary fungal infections are immunocompromised, the
invasiveness of the procedure required to obtain the specimen must also be
considered, particularly where sequential samples may be required.
Potentially suitable specimens for the diagnosis of systemic fungal
infection are blood and/or serum, particularly as these may be obtained by
relatively non-invasive procedures. The organism load may be very low or
transient and a 5 ml blood sample is unlikely to be fully representative of the
body’s 4–5 l. Therefore in order to decrease sampling error as much as
possible, consecutive samples may need to be taken over a short period of
time.
The DNA extraction method used must achieve two particular aims: to
efficiently purify fungal DNA with minimal loss, and to remove inhibitors
of PCR from the sample, e.g. haem. Breaking open the fungal cell wall is
difficult but can be achieved either enzymatically or mechanically. Digestion
with lytic enzymes such as Zymolyase (ICN Biomedicals Ltd, Thame) or
NovoZym 234 (Calbiochem-Novabiochem Ltd, Nottingham) can aid DNA
extraction, although mechanical means such as breaking open cells with glass
beads have been successful, particularly for penetrating the thick poly-
saccharide capsule of Cr. neoformans (Tanaka et al., 1996). Yields of extracted
DNA may also be improved by using commercially available kits to purify
DNA from proteins released by cell lysis (e.g. QIAamp Tissue Kit, Qiagen,
Crawley). They are usually quicker to perform than established methods and
avoid the use of phenol and chloroform, but they do add significantly to the
cost of protocols.
12.2.3 Amplicon detection and analysis

The method used to detect or display amplicons resulting from PCR can
increase both sensitivity and specificity. The simplest method is ethidium
bromide staining of PCR products separated by electrophoresis through

agarose gels. This has a detection limit of approximately 20 ng per amplified
band, and in addition yields information on the size of the PCR product. An
increase in sensitivity can be achieved if a nested PCR is performed.
Yamakami et al. (1996) designed a nested PCR to detect Aspergillus species
in serum of patients with invasive aspergillosis; the second (nested) round of
PCR increased the sensitivity of detection by gel staining from 50 pg to 50 fg
target DNA. Southern analysis increased the sensitivity another ten-fold to
5 fg.
Specific oligonucleotide probes have been developed for identification of
PCR products from individual fungal species by Southern hybridization.
Sandhu et al. (1995) used PCR to amplify a conserved region within the 28S
rRNA genes from 50 fungal isolates (including common pathogens and
saprophytes). Variable regions within 21 of these 50 isolates were used to
design species-specific probes. When labelled with 32P each probe hybridized
only to homologous DNA. In order to avoid the use of radioisotopes,
fluorescein can be used to label probes; fluorescein labelling of an internal
probe followed by chemiluminescence (ECL detection system) of Southern
blots allowed the confirmation of products from a PCR that amplified a
region within the 18S rRNA gene universally conserved in all fungi (Polanco
et al., 1995).
Alternatively, probes can be used as part of an enzyme immunoassay
detection system. Species-specific probes are bound to the wells of a
microtitre plate and denatured PCR products labelled with digoxigenin are
hybridized to the probes; the products are visualized using anti-digoxigenin
antibody conjugated to horseradish peroxidase with an appropriate chromo-
gen substrate system, e.g. 3,3′,5,5′-tetramethylbenzidine (Sigma, Poole) and
hydrogen peroxide. A colour reaction indicates the presence of target DNA
identified by the specific probe. Probes are often captured on to the well
surface by biotin-labelling the probe and precoating the wells with streptavi-
din, but dry-adsorption (evaporating a probe solution in the wells overnight
at 37°C and heating for 2 h at 60°C) has been reported to be more efficient
and negates the need for biotinylating probes (Hirayama et al., 1996). Fujita
et al. (1995) described a PCR-immunoassay that generated amplicons with
universal primers based on the internal transcribed spacer (ITS) region of
fungal DNA; species-specific probes derived from this region were used to
identify amplicons from C. albicans, C. tropicalis, C. parapsilosis and C.
krusei. Using the biotin–avidin capture system and the C. albicans-specific
probe, a detection sensitivity of two yeast cells per 0.2 ml blood was
achieved.
Another approach to amplicon analysis is to look at single-strand
conformational polymorphism (SSCP). Minor sequence changes in highly
conserved regions of DNA will cause subtle morphological changes in DNA
tertiary structure resulting in changes in a fragment’s mobility. Differences
of only one base pair can be resolved by separating the DNA products
electrophoretically under non-denaturing conditions on a high-resolution

acrylamide gel, allowing discrimination between species or even strains (Yap
and McGee, 1994). Walsh et al. (1995) developed a universal PCR based
on the 18S rRNA gene combined with SSCP detection to identify a variety
of opportunistic fungal pathogens. The SSCP gel patterns enabled
discrimination between Candida spp., Aspergillus spp., Cr. neoformans,
Pseudallescheria boydii and R. arrhizus.
12.3 Diagnosis of Systemic Fungal Infections by PCR
Much research investment has been made into the development of PCR as a
diagnostic tool in the field of medical mycology. The major developments in
PCR-based diagnosis of invasive candidosis, invasive aspergillosis, P. carinii
pneumonia, cryptococcosis and infections due to dimorphic fungi are
discussed below.
12.3.1 Invasive candidosis

Candida spp., C. albicans in particular, are the most common fungal
pathogens of immunocompromised hosts, causing a variety of infections
from cutaneous disease of skin and nails to deep-seated systemic infection
and candidaemia. Diagnosis is relatively straightforward for superficial
infections but remains a problem for the more invasive forms of disease
(Dupont, 1990). While most attention was initially paid to developing
detection methods for C. albicans, as the primary pathogen of the genus, it
has become apparent that other species of the genus may also cause disease.
In a retrospective study of blood culture isolates from cancer patients
approximately half (28 of 55) of the Candida isolates were C. albicans while
the rest comprised of C. tropicalis (seven), C. glabrata (seven), C. krusei
(five), C. parapsilosis (three), C. guilliermondii (three) and two mixed
infections of C. albicans and C. glabrata (Meunier et al., 1992). Many of the
PCR protocols published therefore describe strategies to detect both C.
albicans and other species.
One of the first PCR methods for diagnosing fungal infection to be
published was that by Buchman et al. (1990); the gene coding for Candida
spp. cytochrome P450 lanosterol-14α-demethylase (L1A1) was chosen as the
target for amplification due to its involvement in the process of ergosterol
biosynthesis. The sensitivity of the PCR was not fully assessed but was
estimated in spiking experiments to be approximately 102–103 c.f.u. ml–1.
Clinical samples including urine, sputum, wound fluid and blood from six
patients that had all undergone surgical trauma were tested by PCR; 15 of
these gave positive results. However, the specificity of this PCR was not
evaluated and the implications of the PCR-positive clinical samples was not
discussed.
A sequence within a duplicated region of C. albicans mitochondrial

DNA (mt DNA), EO3, was chosen by Miyakawa et al. (1992) as the target
for a C. albicans-specific PCR. Primers, designed from partial sequencing of
the region, generated a 1.8 kb fragment from 40 strains of C. albicans (type
A and B) but not from any other of 38 isolates including seven non-albicans
Candida spp., Cr. neoformans, Saccharomyces cerevisiae, three bacterial
isolates and a human cell line. The sensitivity of the PCR was determined by
spiking serial dilutions of yeast cells into both saline and human urine; the
detection limits were two to ten cells and 100 cells in saline and urine
respectively on ethidium bromide-stained gels. This was improved to two to
ten cells for both saline and urine by Southern hybridization analysis. The
authors conceded that such a large amplicon may be impractical when trying
to detect small amounts of DNA present in clinical specimens such as blood,
but suggested that smaller C. albicans-specific fragments (400–500 bp)
within EO3 may amplify more efficiently.
Niesters et al. (1993) used a nested PCR in conjunction with a number
of detection methods to identify various species of Candida. Sequences from
the small subunit (SSU) rRNA genes of C albicans, C. glabrata and S.
cerevisiae were used to design primers which amplified the entire gene.
Products were also obtained from C. guilliermondii, C. krusei, C. para-
psilosis, C. pseudotropicalis, C. stellatoidea and C. tropicalis. Species-specific
fingerprints generated by direct sequencing, Southern hybridization with
species-specific probes, restriction enzyme mapping and interrepeat PCR
(with repeat-oriented primers) were all able to identify these eight Candida
isolates to species level. Restriction mapping provided the most rapid means
of identification (1 day), but none of the methods were used to test clinical
material.
In contrast to the high copy number gene targets described above, a PCR
for diagnosing candidaemia was reported based on amplification of a 158 bp
segment from the C. albicans actin gene (Kan, 1993). Amplicons were
hybridized in the PCR reaction tube with a radiolabelled 30 bp internal
probe before electrophoresis on acrylamide gels which were then exposed to
autoradiography film. The sensitivity was reported as 25 fg of DNA or ten
yeast cells in spiked samples. The specificity testing showed the PCR to be
genus-specific, with the exception of S. cerevisiae. Preliminary evaluation of
the PCR was carried out using immunocompetent mouse models and patient
samples. Blood samples from a murine candidaemia model were cultured and
plasma samples were pooled and tested by PCR. All samples were con-
sistently positive by culture and PCR over a period of 4 days after initiation
of infection. In the second model, localized infection in the thigh was
induced and blood and plasma samples were taken every 3 days up to 15 days
after inoculation; no samples tested positive either by culture or PCR. A
similar pattern was seen in blood cultures from patients. Serum samples were
collected from 14 patients who had previously had Candida isolated from at
least one blood culture; 11 of these were PCR positive while sera from 12
patients with active oral thrush and 17 healthy volunteers were all PCR
negative. This protocol was the first described that could detect and identify
numerous species of Candida and was shown to work with samples from
both mice and patients. More importantly the PCR could detect candidaemia
without false positives generated by the presence of Candida either as a
commensal or in a non-disseminated infection.
Crampin and Matthews (1993) also used a low copy number gene for
PCR amplification, heat shock protein 90 (HSP90). Primers designed from
the C. albicans gene generated amplicons with C. albicans DNA. In addition,
non-specific products were seen in samples ‘spiked’ with C. glabrata, C.
parapsilosis, C. guilliermondii, C. krusei and human DNA, although the
authors stated that these were not seen in PCR performed on any clinical
samples. Southern analysis allowed detection of 100 c.f.u. C. albicans ml–1
broth or 5 pg genomic DNA. An investigation of 100 clinical specimens
(including swabs, urines, peritoneal fluids, pus and blood/serum) tested by
routine culture, extended culture and PCR, gave positive results with 23%,
31% and 37% of samples respectively. The clinical relevance of detecting C.
albicans in these samples was not discussed.
One of the C. albicans chitin synthase genes (CHS1) has also been
exploited as a target for PCR based on the rationale that CHS1 is not present
in any mammalian genome and could therefore help to prevent false-positive
results (Jordan, 1994). The single pair of primers described produced
different sized amplicons from C. albicans (122 bp), C. parapsilosis (311 bp),
C. tropicalis (519 bp) and C. glabrata (535 bp); these four species are
responsible for 90% of cases of neonatal candidaemia. This was the first
published method that was capable of detecting different medically impor-
tant species of Candida in just one step. Species-specific probes were
designed for use in Southern hybridization which gave a detection limit of
10 c.f.u. ml–1 blood. Comparing PCR and blood culture in 27 pairs of blood
samples showed concordance in 26 pairs; blood samples from 29 high-risk
neonates with no signs of Candida infection and five bone marow transplant
recipients with mucosal colonization with Candida were all negative by
PCR. While this protocol was not shown to be more sensitive than blood
culture in this case, it had the advantages of speed and easy species
differentiation.
Meanwhile, the rRNA genes remain a popular target for PCR. Holmes
et al. (1994) described two sets of primers based on the 5S rRNA gene and
the adjacent non-transcribed intergenic spacer (IGS); one pair amplified a
product of 105 bp from C. albicans and five non-albicans species, while the
second set amplified a 684 bp product from C. albicans only, with
a sensitivity comparable to the PCRs already described of approximately 15
c.f.u. ml–1 blood.
Similarly, the V4 region within the SSU rRNA gene was the basis for a
PCR which, in conjunction with Southern blotting and a species-specific
probe, could specifically detect C. albicans candidaemia in neutropenic mice
with a sensitivity of 10–15 c.f.u. ml–1 blood (van Deventer et al., 1995).
Gastrointestinal colonization was established in immunocompetent mice and
blood samples were tested by the same method to demonstrate that the PCR
would only detect invasive fungal cells and not commensals. A comparison
of PCR with blood culture demonstrated a large increase in the number of
positives when PCR was used (89–100% compared with 44–100% for
culture). Only C. albicans was investigated in this report but the authors
indicated the possibilities for adapting this method to other species using
different probes.
Fujita et al. (1995) reported a universal PCR that was capable of
detecting any fungal species with primers based on sequences from the 5S
rRNA gene and adjacent ITS region; specific probes designed from the ITS2
region (found between 5S and 26S) were used in an enzyme immunoassay to
specifically detect PCR products from C. albicans, C. tropicalis, C. para-
psilosis, C. krusei and C. glabrata. Using colorimetric detection instead of
ethidium bromide staining increased the sensitivity ten-fold from 102 to 10
cells ml–1.
Haynes et al. (1995) and Haynes and Westerneng (1996) used a reverse
primer based on a sequence from the large subunit (LSU) rRNA gene,
universally conserved within the fungal kingdom, in tandem with four
different forward primers, each specific for a medically important species of
Candida. The four PCRs used the same temperature cycles and so could run
concurrently, and were shown to correctly identify nine isolates of C.
albicans, 18 of C. glabrata, 13 of C. parapsilosis and 18 of C. krusei in a blind
study. The testing process, including DNA extraction from single colonies,
was estimated to take approximately 3 h, although no testing was performed
on clinical samples.
Recently a PCR based on the C. albicans L1 A1 gene was described which
was capable of amplifying DNA from a variety of yeasts including C.
albicans, ten non-albicans Candida species, S. cerevisiae and Blastoschizo-
myces capitatus (Morace et al., 1997). The PCR had a sensitivity of 200 fg
Candida DNA and seven different species were identified by restriction
enzyme mapping. This method was applied to a small number of blood and
BAL samples from patients considered likely to have fungal infection; 15 of
21 bloods and six of 20 BAL samples gave PCR-positive results and this was
considered to correlate well with culture results. The authors emphasized
that this protocol must be used to analyse a much larger number of patient
specimens before any conclusion can be made. These results were encourag-
ing but a much simpler extraction method would be neccessary for this
protocol to be used on a routine basis.
12.3.2 Invasive aspergillosis

Members of the genus Aspergillus are ubiquitous saprophytes commonly
found in soil and decaying vegetation. Aspergillus conidia account for
0.1–22% of total airborne spores and are found in air and dust within the
hospital environment (Anassie, 1992). There are at least 200 species of
Aspergillus but few are associated with disease in humans; the majority of
invasive disease is due to A. fumigatus and can arise from colonization or de
novo infection (Rinaldi, 1983). The common route of entry into the body is
via the respiratory tract. Conidia are smooth and, in the case of A. fumigatus,
only 2–3 µm in size and can therefore easily reach the alveolar airspace; this
may be directly linked to A. fumigatus being the primary pathogen of the
genus (Kwon-Chung and Bennett, 1992). In predisposed (e.g. neutropenic)
patients the infection rapidly becomes invasive; pulmonary disease dissem-
inates haematogeneously through the body to other major organs and the
associated morbidity and mortality are very high (Cohen, 1990). Early
administration of antifungal therapy is essential for improvement of prog-
nosis in cases of invasive disease (Burch et al., 1987), however, early diagnosis
remains notoriously difficult. Routine microbiological investigation involves
culture and cytological examination of respiratory specimens such as BAL
fluid and induced sputum, procedures that have been evaluated and reviewed
by several groups in a number of retrospective studies. Nalesnik et al. (1980)
suggested that even a single Aspergillus-positive sputum culture must be
treated as potentially significant in patients with haematological malignancy.
Yu et al. (1986) confirmed this, adding that in neutropenic cases positive
respiratory specimens were virtually diagnostic. Cytological examination of
BAL specimens has been considered to be of a higher predictive value than
culture (Levy et al., 1992), although in patients with acute leukaemia, BALs
have been reported to be of more use for diagnosing P. carinii pneumonia
than invasive aspergillosis (Saito et al., 1988). The majority of respiratory
specimens are negative for Aspergillus by cytology and culture, and the
predictive value of immunological diagnosis has yet to be proven. The gold
standard remains cytology and culture of biopsy specimens, but open
surgery is contra-indicated in critically ill patients.
In order to avoid the invasive procedures of obtaining specimens such as
BAL fluid or bronchial washings, Reddy et al. (1993) investigated the
possibility of using PCR to detect A. fumigatus in urine samples. The primers
were based on an A. fumigatus partial protein sequence that shared a high
degree of homology with ribotoxins of A. restrictus and with alpha sarcin of
A. giganteus. The PCR amplified A. fumigatus and A. restrictus DNA only,
with a detection limit of 0.6 pg by Southern analysis. Prospective screening
of 13 urine samples from patients undergoing bone-marrow transplantation
revealed two positives; however only one was from a proven case of IA.
Spreadbury et al. (1993) were able to specifically detect A. fumigatus
DNA in three of three culture-positive respiratory specimens from patients
with clinically diagnosed IA by using a PCR that amplified part of the 26S
intergenic spacer region from the A. fumigatus rRNA gene complex.
However, as Aspergillus conidia are inhaled by the general population on a
day-to-day basis, the significance of finding Aspergillus in the respiratory
tract of an individual is still controversial. To assess the significance of a

positive PCR result, culture-negative samples from immunosuppressed
patients at high risk and from immunocompetent patients with known lung
disease (other than IA) were analysed by PCR: two of ten of the former
patient group and two of seven of the latter patient group gave positive
results. It was suggested that results based on Southern hybridization may be
too sensitive – the two positives from the former patient group were not
detected by electrophoresis alone – but that the high level of correlation
between culture, clinical data and PCR results supported PCR as a valid
method of diagnosis of IA.
These findings were corroborated by further work from the same group;
Tang et al. (1993) used primers based on sequences obtained from the alkaline
protease (Alp) genes of A. fumigatus and A. flavus to detect Aspergillus DNA
in four BAL samples from four patients with proven or probable aspergillo-
sis. One patient with possible aspergillosis was PCR positive, as were one of
18 (6%) immunosuppressed patients with no evidence of fungal infection and
five of 28 (18%) immunocompetent patients, the latter most likely resulting
from colonization.
Verweij et al. (1994) investigated a larger group of low-risk patients and
found a similar level of prevalence of detectable Aspergillus colonization. 72
BAL specimens from 70 non-neutropenic patients were tested by culture and
genus-specific PCR: 11 of the 72 samples (15%) were PCR positive. In a
separate study the validity of the PCR was assessed in a mouse model of IA
and in patient BAL samples. The primers were derived from sequences
obtained from the 18S rRNA genes of A. fumigatus, A. flavus, A. terreus, A.
nidulans and A. niger so that other species that have been reported as
opportunistic pathogens could also be detected (Cohen, 1990). Strong cross-
reactions were observed with Paecilomyces variotii, Penicillium marneffei
and Penicillium chrysogenum but these were differentiated from Aspergillus
by Southern analysis and restriction enzyme digestion. Sensitivity was
increased from 1 pg to 10 fg when rRNA was transcribed into cDNA prior
to amplification, although this was deemed unnecessary as no further
samples were identified as positive using this extra step. Five of six mice with
experimental IA were PCR positive, as were nine of 18 BAL samples from
immunosuppressed patients; none of the control mice or 14 BAL samples
from low-risk patients were positive. In comparison only one BAL sample
from four patients with documented IA grew Aspergillus.
A competitive PCR was described by Bretagne et al. (1995) which used
an internal control to indicate false-negative results due to inhibition of the
PCR. This was achieved by spiking each sample with a fragment of
M13mp18 phage DNA flanked at each end by the A. fumigatus-specific
primers; successful amplification would generate a 135 bp product from A.
fumigatus DNA and a separate smaller amplicon from the control sequence.
False-positive results due to carry-over contamination from previous ampli-
fications was avoided by the substitution of dUTP for dTTP and digestion
with uracil-N-glycosylase. However, it should be noted that this is not

necessarily sufficient to prevent false positives due to contamination. In a
study of PCR protocols used in seven centres for Mycobacterium tuberculosis
detection, this substitution method was employed by the centre that had the
highest rates of false-positive results (Vaneechoutte and van Eldere, 1997). Of
55 BAL samples tested with this PCR, 15 were positive, 37 were negative and
three were negative due to inhibition and discounted. Three patients had
proven IA and another three were high risk, but the remaining nine positive
samples were from two groups of patients, none of whom developed IA. As
the three patients with aspergillosis had already been clinically diagnosed and
given empirical antifungal therapy, the authors concluded that PCR was of
little value in diagnosing cases of IA where clinical symptoms were overt;
routine methods were sufficient and the question of the predictive value of
PCR diagnosis in high-risk patients remained unanswered. Verweij suggested
that optimized techniques and sampling schedules are required if PCR is to
prove useful in the early diagnosis of IA (Verweij et al., 1996).
Recently, Yamakami et al. (1996) reported a genus-specific nested PCR
based on 18S rRNA genes of Aspergillus which was evaluated using serum
from experimentally infected mice and from patients with IA. Southern
analysis increased the sensitivity of the PCR to 5 fg Aspergillus DNA. Serum
samples from animals sacrificed over a period of 4 days post-infection were
tested by PCR and Pastorex Aspergillus latex agglutination; these tests gave
five of eight and three of eight positives respectively and all the controls were
negative. However, mice were inoculated with viable conidia through a
surgical incision over the trachea, possibly allowing direct inoculation of the
bloodstream, in which case this would not be an appropriate model of IA.
Serum samples (100 µl) from 20 patients with documented IA were also
tested, giving 14 positive samples by PCR and 12 positive samples by
Pastorex. Sera from 20 healthy volunteers were all negative. These results are
promising but care would need to be taken when designing sampling
schedules, especially when sample volumes are so small.
A test proven to be sensitive and specific that can be performed on
clinical material obtained without invasive procedures is still needed to
improve the ante-mortem diagnosis of IA.
12.3.3 Pneumocystis carinii pneumonia

Interest in the ubiquitous and, until recently, taxonomically ambiguous P.
carinii (Pixley et al., 1991; Stringer et al., 1992) was re-awakened in the early
1980s when the advent of AIDS caused a significant increase in the incidence
of P. carinii pneumonia (PCP) to such an extent that PCP became a
diagnostic feature of AIDS and was a major cause of morbidity and mortality
in AIDS patients (Cushion et al., 1994). The major obstacle yet to be
overcome in the development of simple, rapid diagnostics for this infection
is the lack of an in vitro culture system, primarily due to the organism’s
fastidious nature (Wakefield et al., 1990). Conventional diagnostic proce-

dures remain: cytochemical staining of BAL or, less frequently, induced
sputum samples, either non-specifically (Giemsa, methenamine silver) or
with a specific immunofluorescent monoclonal antibody stain (Cartwright et
al., 1994). However, small numbers of organisms are difficult to visualize and
a more sensitive method is needed to attempt diagnosis at an earlier stage of
infection. Many research groups have therefore explored the possibilities of
using PCR as a diagnostic method for PCP.
The first PCR reported for detection of P. carinii in clinical samples
amplified a sequence from the large subunit mitochondrial rRNA gene (mt
rDNA) and although sequences were derived from a rat isolate, the PCR also
amplified P. carinii DNA from human isolates (Wakefield et al., 1990). The
products were verified using Southern analysis with a probe specific for
human P. carinii. The PCR appeared to be at least as sensitive as staining
when detecting P. carinii in BAL, but apparently false-positive signals were
observed on blots from three immunosuppressed patients with no evidence
of PCP and from bronchoscope washings from an unspecified source.
While some groups have designed novel PCRs to detect P. carinii, the mt
rDNA primers have since been used by many other investigators. Eisen et al.
(1994) found this PCR to be more sensitive than Toluidine Blue-O staining
and immunofluorescence in sputum samples from 20 HIV-positive patients.
In another study an enzyme immunoassay was developed as a potential
replacement for Southern analysis (Cartwright et al., 1994). This assay
detected P. carinii in all induced sputa from documented PCP cases,
compared with 78% by immunofluorescence, and the entire procedure could
be performed in a single day. This PCR assay was considered sensitive
enough to detect P. carinii in induced sputa from patients with a low
organism burden, possibly saving them from the invasive procedure of
bronchoscopy. However, no advantage over conventional methods for
routine detection of P. carinii in BAL was evident. These findings are similar
to those reported by other groups (Lipschik et al., 1992; Tamburrini et al.,
1993; Roux et al., 1994).
Honda et al. (1994) described a comparison of conventional and capillary
PCR in which both protocols used the mt rDNA primers to detect P. carinii
in sputum and BAL samples from immunosuppressed patients. The volume
of the reaction mix in capillary PCR is only 10 µl (compared with 25–100 µl
in conventional PCR) and thermocycling is performed in sealed glass
capillary tubes; this allows much faster and more efficient temperature
transfer. However, savings made in reaction constituents have to be balanced
against the purchase of a specialized thermocycling machine. The capillary
PCR was 1000-fold more sensitive than conventional PCR (detecting 3 ×
10–2 fg DNA compared with 30 fg) and took only 20 min to complete. The
authors suggested that the high sensitivity of the capillary protocol enabled
detection of P. carinii carriage and subclinical infection and allowed for
earlier initiation of antimicrobial therapy.
In an attempt to monitor organism loading during treatment of P. carinii

infection in immunosuppressed rats, O’Leary et al. (1995) incorporated the
mt rDNA primers into a semi-quantitative PCR (SQPCR). Rat β-globin was
used as the internal standard and assay results were expressed as Pneumocys-
tis mt rDNA/globin signal ratios. The SQPCR results correlated strongly
with cyst counts in BAL and lung homogenates. Furthermore the PCR was
capable of detecting P. carinii DNA during the early phase of infection when
few cysts could be visualized by staining of pulmonary tissue and none were
seen in BAL fluid.
Alternative gene targets for P. carinii PCR include those encoding the 5S
rRNA (Kitada et al., 1991), 18S rRNA (Lipschik et al., 1992), dihydrofolate
reductase (DHFR) (Schluger et al., 1992) and thymidylate synthase (TS)
(Olsson et al., 1993) genes. These were all included in a comparison of the
efficacy of different PCR methods, along with the mt rDNA PCR and a
nested PCR which amplified the ITS of the rRNA genes (Lu et al., 1995).
When used to analyse 50 BAL specimens, the two nested PCRs (ITS and 18S)
achieved 100% sensitivity after the second round (53% and 50% respectively
after the first), the mt rDNA PCR 87%, the 5S rDNA PCR 33%, the TS
PCR 60% and the DHFR PCR 23%. The 18S and TS PCRs demonstrated
false-positive results with S. cerevisiae and C. albicans, plus Cr. neoformans
and C. albicans respectively, leading to the conclusion that the nested ITS
PCR was the most sensitive and specific of the methods tested.
In order to avoid the invasive nature of sampling methods such as
bronchoscopy or open lung biopsy, non-invasive samples such as serum and
blood have been investigated as attractive alternatives for potential routine
specimens when diagnosing P. carinii infection. Preliminary experiments by
Kitada et al. (1991) detected P. carinii DNA in three of five mice with
experimentally induced P. carinii infection; reduced sensitivity compared
with performance of PCR with lung biopsy specimens was attributed to low
organism load in the blood. Schluger et al. (1991) used the DHFR PCR on
serum samples from AIDS patients with PCP; P. carinii DNA was detected
in five of 14 experimental rats and seven of 18 AIDS patients. However, four
patients had documented extrapulmonary PCP, two of which were not
detected by PCR. Tamburrini et al. (1993) successfully detected P. carinii in
spiked samples down to two organisms µl–1 serum or whole blood, but this
could not be reproduced in serum and blood specimens from HIV-positive
patients with documented PCP. The conclusion was that, even allowing for
haematogeneous dissemination, the presence of P. carinii in the bloodstream
is transient and PCR detection is not applicable to serum samples.
12.3.4 Cryptococcosis
Cryptococcal meningitis, caused by Cr. neoformans var. neoformans or Cr.
neoformans var. gattii, is a major cause of morbidity in individuals infected
with HIV (Kwon-Chung et al., 1994). Before the cryptococcal antigen latex
agglutination (LA) test became widely available, cryptococcal meningitis

was diagnosed by India ink preparations of cerebrospinal fluid; this gave
a positive result in approximately 50% of cases. Detection of capsular
polysaccharide by LA has a reported sensitivity and specificity of 99% and
immunological diagnosis appears to be reliable (De Repentigny et al., 1994).
The reliability of the LA test as a method of diagnosing cryptococcosis
has obviated the need for diagnostic PCR. However, a number of protocols
have been described. Mitchell et al. (1994a) designed primers from the 5.8S
rDNA and adjacent ITS region of Filobasidiella neoformans, the teleomorph
of Cr. neoformans. These primers were able specifically to amplify DNA
from 37 strains of Cr. neoformans; amplification from clinical material was
suggested but not attempted. A nested PCR based on the Cr. neoformans
URA5 gene was developed to diagnose non-HIV related pulmonary
cryptococcosis (Tanaka et al., 1996). Sixteen respiratory specimens were
analysed in order to evaluate both the PCR and the glass bead-based
extraction method. Of the five which were positive by culture, four were
PCR positive and no culture-negatives were PCR positive. While this
protocol performed well on this small number of samples, the advantages
over culture were unspecified.
12.3.5 Dimorphic fungal infections

The dimorphic fungi H. capsulatum, B. dermatitidis, Co. immitis and Pa.
brasiliensis are primary human pathogens. However, the incidence of each
has increased as the number of immunosuppressed patients has risen. The
route of infection for these is generally via the respiratory tract; they cause
primary pulmonary disease in competent hosts. H. capsulatum causes
chronic pulmonary disease in those with structural lung defects and
disseminated disease in immunocompromised hosts. Co. immitis is asympto-
matic in 60% of cases and rarely disseminates. Pa. brasiliensis manifests more
as a disseminated infection than a pulmonary one while B. dermatitidis
infection is initially pulmonary but can disseminate and mimic other diseases
such as tuberculosis (TB) (Bradsher, 1996).
While the incidence of these fungi is increasing, particularly in the
Americas where they are endemic, diagnosis using molecular methods is not
well documented and little diagnostic PCR research has been published.
Diagnosis relies mostly on cytological staining of BAL fluids and sputa with
Papanicolaou stain and methenamine silver; TB is excluded by the acid Schiff
test (Lemos et al., 1995). Visualization of the fungus gives a firm diagnosis for
histoplasmosis and blastomycosis as colonization with these organisms does
not occur (Bradsher, 1996).
Molecular methods other than PCR have been successfully used; a
chemiluminescent DNA probe kit (GenProbe, San Diego, California) has
been shown to have sensitivities of 87.8–100% and specificities of 100%
when identifying different isolates of B. dermatitidis, H. capsulatum, Co.
immitis and Cr. neoformans (Stockman et al., 1993). The probes, based on
rDNA sequences, were found to shorten the diagnostic process significantly,
and the preparation required was much less than for exoantigen testing.
These probes were recommended by the author to supplement diagnosis by
in vitro conversion of hyaline mould to yeast forms; false-negative results
that occasionally occurred with the B. dermatitidis probe could thus be
avoided and morphologically similar organisms could be differentiated, such
as the yeast form of H. capsulatum and C. glabrata.
12.4 Future Prospects for PCR Diagnostics in Medical

Mycology
Commercially produced PCR-based protocols are now widely available for

the diagnosis of various infectious diseases, e.g. TB, viral hepatitis. Notwith-
standing the huge research investment that has been made in the development
of diagnostic PCRs in the field of medical mycology, there are no such
protocols available for the diagnosis of fungal infections. The most likely
contender for a successful PCR-based protocol is the detection of P. carinii
for the diagnosis of PCP, but the advantages of PCR over established
diagnostic methods for this disease are debatable. Until simple, rapid and
reproducible methods are developed for the extraction of fungal DNA from
clinical material, the routine diagnosis of systemic fungal infections by PCR
remains unlikely.
References
Anaissie, E. (1992) Opportunistic mycoses in the immunocompromised host:
experience at a cancer centre and review. Clinical Infectious Diseases 14 (Suppl.
1), S43–S53.
Anaissie, E., Bodey, G.P., Kantarjian, H., Ro, J., Vartivarian, S.E., Hopfer, R., Hoy,
J. and Rolston, K. (1989) New spectrum of fungal infections in patients with
cancer. Reviews in Infectious Diseases 11, 369–378.
Bodey, G.P. (1988) The emergence of fungi as major hospital pathogens. Journal of
Hospital Infection 11 (Suppl. A), 411–426.
Bradsher, R.W. (1996) Histoplasmosis and blastomycosis. Clinical Infectious Diseases
22 (Suppl. 2), S102–S111.
Bretagne, S., Costa, J-M., Marmorat-Khuong, A., Poron, F., Cordonnier, C., Vivaud,
M. and Fleury-Feith, J. (1995) Detection of Aspergillus species DNA in
bronchoalveolar lavage samples by competitive PCR. Journal of Clinical
Buchman, T.G., Rossier, M., Merz, W.G. and Charache, P. (1990) Detection of
surgical pathogens by in vitro DNA amplification. Part I. Rapid identification of
Candida albicans by in vitro amplification of a fungus-specific gene. Surgery
108, 338–347.
Burch, P.A., Karp, J.E., Merz W.G., Kuhlman, J.E. and Fishman, E.K. (1987)
Favourable outcome of invasive aspergillosis in patients with acute leukaemia.
Journal of Clinical Oncology 5, 1985–1993.
Cartwright, C.P., Nelson, N.A. and Gill, V.J. (1994) Development and evaluation of
a rapid and simple procedure for detection of Pneumocystis carinii by polymerase
chain reaction. Journal of Clinical Microbiology 32, 1634–1638.
Cohen, J. (1990) Clinical manifestation and management of aspergillosis in the
compromised patient. In: Warnock, D.W. and Richardson M.D. (eds) Fungal
Infection in the Compromised Patient, 2nd edn. John Wiley & Sons, Chichester,
pp. 117–152.
Crampin, A.C. and Matthews, R.C. (1993) Application of the polymerase chain
reaction to the diagnosis of candidosis by amplification of an HSP90 gene
fragment. Journal of Medical Microbiology 39, 233–238.
Cushion, M.T., Harmsen, A., Matsumoto, Y., Stringer, J.R., Wakefield, A.E. and
Yamada, M. (1994) Recent advances in the biology of Pneumocystis carinii.
Journal of Medical and Veterinary Mycology 32 (Suppl. 1), 217–228.
De Repentigny, L., Kaufman, L., Cole, G.T., Kruse, D., Latge, J.-P. and Matthews,
R.C. (1994) Immunodiagnosis of invasive fungal infections. Journal of Medical
and Veterinary Mycology, 32 (Suppl. 1), 239–252.
Dupont, B. (1990) Clinical manifestations and management of candidosis in the
compromised patient. In: Warnock, D.W. and Richardson M.D. (eds) Fungal
Infection in the Compromised Patient, 2nd edn. John Wiley & Sons, Chichester,
pp. 55–84.
Eisen, D., Ross, B.C., Fairburn, J., Warren, R.J., Bard R.W. and Dwyer, B. (1994)
Comparison of Pneumocystis carinii detection by Toluidine Blue-O staining,
direct immunofluorescence and DNA amplification in sputum specimens from
HIV positive patients. Pathology 26, 198–200.
Fenn, J.P., Segal, H., Barland B., Denton, D., Whisenant, J., Chun, H., Christofferson,
K., Hamilton, L. and Carroll, K. (1994) Comparison of the updated Vitek Yeast
Biochemical Card and API 20C yeast identification systems. Journal of Clinical
Fujita, S., Lasker, B.A., Lott, T.J., Reiss, E. and Morrison, C.J. (1995) Microtitration
plate enzyme immunoassay to detect PCR-amplified DNA from Candida
species in blood. Journal of Clinical Microbiology 33, 962–967.
Haynes, K.A. and Rogers, T.R. (1994) Retrospective evaluation of a latex agglutina-
tion test for diagnosis of invasive aspergillosis in immunocompromised patients.
European Journal of Clinical Microbiology and Infectious Diseases 13, 670–674.
Haynes, K.A. and Rogers, T.R. (1996) Clinical perspectives and diagnosis of invasive
aspergillosis. Revista Iberoamericana de Micologia 13, S25–S29.
Haynes, K.A. and Westerneng, T.J. (1996) Rapid identification of Candida albicans,
Candida glabrata, Candida parapsilosis and Candida krusei by species-specific
PCR of large subunit ribosomal RNA. Journal of Medical Microbiology 44,
390–396.
Haynes, K.A., Westerneng, T.J., Fell J.W. and Moens, W. (1995) Rapid detection and
identification of pathogenic fungi by PCR amplification of large subunit
ribosomal RNA. Journal of Medical and Veterinary Mycology 33, 319–325.
Hirayama, H., Tamaoka, J. and Horikoshi, K. (1996) Improved immobilisation of
DNA to microwell plates for DNA–DNA hybridization. Nucleic Acids Research
24, 4098–4099.
Holmes, A.R., Cannon, R.D., Shepherd, M.G. and Jenkinson, H.F. (1994) Detection
of Candida albicans and other yeasts in blood by PCR. Journal of Clinical
Honda, J., Hoshino, T., Natori, H., Tokisawa, S., Akiyoshi, H., Nakahara, S. and
Oizumi, K. (1994) Rapid and sensitive diagnosis of CMV and Pneumocystis
carinii pneumonia in patients with haematological neoplasia by capillary PCR.
Journal of Haematology 86, 138–142.
Hopfer, R.L., Walden, P., Setterquist, S. and Highsmith W.E. (1993) Detection and
differentiation of fungi in clinical specimens using PCR amplification and
restriction enzyme analysis. Journal of Medical and Veterinary Mycology 31,
65–75.
Jordan, J.A. (1994) PCR identification of four medically important Candida species
using a single primer pair. Journal of Clinical Microbiology 32, 2962–2967.
Kan, V.L. (1993) PCR for the diagnosis of candidaemia. Journal of Infectious Diseases
168, 779–783.
Kappe, R. and Schulze-Berge, A. (1993) New cause for false-positive results with the
Pastorex Aspergillus antigen latex agglutination test. Journal of Clinical Micro-
biology 31, 2489–2490.
Kitada, K., Oka, S., Kimura S., Shimada, K., Serikawa, T., Yamada, J., Tsunoo, M.,
Egawa, K. and Nakamura, Y. (1991) Detection of Pneumocystis carinii sequences
by PCR: animal models and clinical application to non-invasive specimens.
Kwon-Chung, K.J. and Bennett, J.E. (1992) Medical Mycology. Lea and Febiger,
London.
Kwon-Chung, K.J., Pfieffer, T., Chang, Y.C., Wickes, B.L., Mitchell, D. and Stern
J.J. (1994) Molecular biology of Cryptococcus neoformans and therapy of
cryptococcosis. Journal of Medical and Veterinary Mycology 32 (Suppl. 1),
S407–S415.
Lemos, L.B., Baliga, M., Taylor, B.D., Cason, Z.J. and Lucia, H.L. (1995) Broncho-
alveolar lavage for diagnosis of fungal disease. Acta Cytologica 39, 1101–1111.
Levy, H., Horak, D.A., Tegtmeier, B.R., Yokota, S.B. and Forman, S.J. (1992) Value
of bronchoalveolar lavage and bronchial washing in the diagnosis of invasive
pulmonary aspergillosis. Respiratory Medicine 86, 243–248.
Lipschik, G.Y., Gill, V.J., Lundgren, J.D., Andrawis V.A., Nelson N.A., Nielson, J.O.,
Ognibene, F.P. and Kovacs, J.A. (1992) Improved diagnosis of Pneumocystis
carinii infection by PCR on induced sputum and blood. Lancet 340, 203–206.
Lu, J-J., Chen, C-H., Bartlett, M.S., Smith, J. and Lee, C.H. (1995) Comparison of
six different PCR methods for detection of Pneumocystis carinii. Journal of
Clinical Microbiology 33, 2785–2788.
Makimura, K., Murayama, S.Y. and Yamaguchi, H. (1994) Detection of a wide range
of medically important fungi by PCR. Journal of Medical Microbiology 40,
358–364.
Manso, E., Montillo, M., De Sio, G., D’Amico, S., Discepoli, G. and Leoni, P. (1994)
Value of antigen and antibody detection in the serological diagnosis of invasive
aspergillosis in patients with haematological malignancies. European Journal of
Clinical Microbiology and Infectious Diseases 13, 756–760.
Meunier, F., Aoun, M. and Bitar, N. (1992) Candidaemia in immunocompromised
patients. Clinical Infectious Diseases 14 (Suppl. 1), S120–S125.
Mitchell, T.G., Freedman, E.Z., White, T.J. and Taylor, J.W. (1994a) Unique
oligonucleotide primers in PCR for identification of Cryptococcus neoformans.

Mitchell, T.G., Sandin, R.L., Bowman, B.H., Meyer, W. and Merz, W.G. (1994b)
Molecular mycology: DNA probes and applications of PCR technology. Journal
of Medical and Veterinary Mycology 32 (Suppl. 1), S351–S366.
Miyakawa, Y., Mabuchi, T., Kagaya, K. and Fukazawa, Y. (1992) Isolation and
characterisation of a species-specific DNA fragment for detection of Candida
albicans by PCR. Journal of Clinical Microbiology 30, 894–900.
Morace, G., Sanguinetti, M., Posteraro, B., Lo Cascio, G. and Fadda G. (1997)
Identification of various medically important Candida species in clinical
specimens by PCR and restriction enzyme analysis. Journal of Clinical Micro-
biology 35, 667–672.
Nalesnik, M.A., Myerowitz, R.L., Jenkins, R., Lenley, J. and Herbert, D. (1980)
Significance of Aspergillus species isolated from respiratory secretions in
diagnosis of invasive pulmonary aspergillosis. Journal of Clinical Microbiology
11, 370–376.
Niesters, H.G., Goessens, W.H., Meis, J.F. and Quint, W.G. (1993) Rapid, PCR-based
identification assays for Candida species. Journal of Clinical Microbiology 31,
904–910.
O’Leary, T.J., Tsai, M.M., Wright, C.F. and Cushion, M.T. (1995) Use of semi-
quantitative PCR to assess onset and treatment of Pneumocystis carinii infection
in a rat model. Journal of Clinical Microbiology 33, 718–724.
Olsson, M., Elvin, K., Lofdahl, S. and Linder, E. (1993) Detection of Pneumocystis
carinii DNA in sputum and BAL samples by PCR. Journal of Clinical
Pixley, F.J., Wakefield, A.E., Banerji, S. and Hopkin J.M. (1991) Mitochondrial gene
sequences show fungal homology for Pneumocystis carinii. Molecular Micro-
biology 5, 1347–1351.
Polanco, A.M., Rodrı́guez-Tudela, J.L. and Martı́nez-Suárez. (1995) Detection of
pathogenic fungi in human blood by the polymerase chain reaction. European
Journal of Clinical Microbiology and Infectious Diseases 14, 618–621.
Reddy, L.V., Kumar, A. and Kurup, V.P. (1993) Specific amplification of Aspergillus
fumigatus DNA by PCR. Molecular and Cellular Probes 7, 121–126.
Richardson, M.D. and Warnock, D.W. (1993) Fungal Infection. Blackwell Scientific
Publications, Oxford.
Rinaldi, M.G. (1983) Invasive aspergillosis. Reviews in Infectious Diseases 5,
1061–1077.
Roux, P., Laurard, I., Poirot, J.L., Chouaid, C., Denis, M., Olivier, J.L., Nigou, M. and
Miltgen, M. (1994) Usefulness of PCR for detection of Pneumocystis carinii
DNA. Journal of Clinical Microbiology 32, 2324–2326.
Saito, H., Anassie, E.J., Morice, R.C., Dekmezian, R. and Bodey, G.P. (1988)
Bronchoalveolar lavage in the diagnosis of pulmonary infiltrates in patients with
acute leukaemia. Chest 94, 745–749.
Sandhu, G.S., Kline, B.C., Stockman, L. and Roberts, G.D. (1995) Molecular probes for
diagnosis of fungal infections. Journal of Clinical Microbiology 33, 2913–2919.
Schluger, N., Sepkowitz, K, Armstrong, D., Bernard, E., Rifkin, M., Cerami, A. and
Bucala, R. (1991) Detection of Pneumocystis carinii in serum of AIDS patients
with PCP by the polymerase chain reaction. Journal of Protozoology 38 (Suppl.),
S240–S242.
Schluger, N., Godwin, T., Sepkowitz, K, Armstrong, D., Bernard, E., Rifkin, M.,
Cerami, A. and Bucala, R. (1992) Application of DNA amplification to
Pneumocystis: presence of serum Pneumocystis carinii DNA during human and
experimentally induced PCP. Journal of Experimental Medicine 176,
1327–1333.
Spreadbury, C., Holden, D., Aufauvre-Brown, A., Bainbridge, B. and Cohen, J.
(1993) Detection of Aspergillus fumigatus by polymerase chain reaction. Journal
of Clinical Microbiology 31, 615–621.
Stockman, L., Clark, K.A., Hunt, J.M. and Roberts, G.D. (1993) Evaluation of
commercially available Acridnium ester-labelled chemiluminescent DNA probes
for culture identification of Blastomyces dermatitidis, Coccidioides immitis,
Cryptococcus neoformans and Histoplasma capsulatum. Journal of Clinical
Stringer, J.R., Edman, J.C., Cushion, M.T., Richards, F.F. and Watanabe, J. (1992) The
fungal nature of Pneumocystis. Journal of Medical and Veterinary Mycology 30
(Suppl. 1), S271–S278.
Tamburrini, E., Mencarini, P., De Luca, A., Maiuro, G., Ventura, G., Antinori, A.,
Ammassari, A., Visconti, E., Ortona, L., Siracuscano, A., Ortona, E. and Vicari,
G. (1993) Diagnosis of Pneumocystis carinii pneumonia: specificity and sensitiv-
ity of PCR in comparison with immunofluorescence in BAL specimens. Journal
of Medical Microbiology 38, 449–453.
Tanaka, K.I., Miyazaki, T., Maesaki, S., Mitsutake, K., Kakeya, H., Yamamoto, Y.,
Yanagihara, K., Hossain, M.A., Tashiro, T. and Kohno, S. (1996) Detection of
Cryptococcus neoformans gene in patients with pulmonary cryptococcosis.
Tang, C.M. and Cohen, J. (1992) Diagnosing fungal infections in immunocompro-
mised hosts. Journal of Clinical Pathology 45, 1–5.
Tang, C.M., Holden, D.W., Aufauvre-Brown, A. and Cohen, J. (1993) Detection of
Aspergillus species by PCR and its evaluation in BAL fluid. American Reviews
in Respiratory Diseases 148, 1313–1317.
Van Cutsem, J., Meulemans, L., van Gerven, F. and Stynen, D. (1990) Detection of
circulating galactomannan by Pastorex Aspergillus in experimental invasive
aspergillosis. Mycoses 33, 61–69.
Van Deventer, A.J., Goessens, W.H., van Belkum, A., van Vliet, H.J., van Etten, E.W.
and Verbrugh, H.A. (1995) Improved detection of Candida albicans by PCR in
blood of neutropenic mice with systemic candidiasis. Journal of Clinical
Vaneechoutte, M. and van Eldere, J. (1997) The possibilities and limitations of nucleic
acid amplification technology in diagnostic microbiology. Journal of Medical
Verweij, P.E., Meis, J.F., van den Hurk, P., de Pauw, B.E., Hoogkamp-Korstanje,
J.A. and Melchers, W.J. (1994) Polymerase chain reaction as a diagnostic tool
for invasive aspergillosis: evaluation in bronchoalveolar lavage fluid from low
risk patients. Serodiagnosis and Immunotherapy in Infectious Disease 6,
203–208.
Verweij, P.E., Rijs, A.J., de Pauw, B.E., Horrevorts, A.M., Hoogkamp- Korstanje, J.A.
and Meis, J.F. (1995) Clinical evaluation and reproduciblity of the Pastorex
Aspergillus antigen latex agglutination test for diagnosing invasive aspergillosis.
Journal of Clinical Pathology 48, 474–476.
Verweij, P.E., Donnelly, J.P., de Pauw, B.E. and Meis, J.F. (1996) Prospects for the
early diagnosis of invasive aspergillosis in the immunocompromised patient.
Reviews in Medical Microbiology 7, 105–113.
Wakefield, A.E., Pixley, F.J., Banersi, S., Sinclair, K., Miller, R.F., Moxon, E.R. and
Hopkin, J.M. (1990) Detection of Pneumocystis carinii with DNA amplification.
Lancet 336, 451–453.
Walsh, T.J., Francesconi, A., Kasai, M. and Chanock, S.J. (1995) PCR and single-
strand conformational polymorphism for the recognition of medically important
opportunistic fungi. Journal of Clinical Microbiology 33, 3216–3220.
White, T.J., Bruns, T.D., Lee, S. and Taylor, J. (1990) Amplification and direct
Gelfand, D.M., Sninsky, J.J. and White, T.J. (eds) PCR Protocols: a Guide to
Yamakami, Y., Hashimoto, A., Tokimatsu, I. and Nasu, M. (1996) PCR detection of
DNA specific for Aspergillus species in serum of patients with invasive
aspergillosis. Journal of Clinical Microbiology 34, 2464–2468.
Yap, E.P. and McGee, J.O’D. (1994) Non-isotopic single-strand conformational
polymorphism analysis of PCR products. In: Griffin, H.G. and Griffin, A.M.
(eds) PCR Technology: Current Innovations. CRC, Boca Raton, Florida,
pp. 165–177.
Yu, V.L., Muder, R.R. and Poorsattar, A. (1986) Significance of isolation of Aspergillus
from the respiratory tract in diagnosis of invasive pulmonary aspergillosis.
American Journal of Medicine 81, 249–254.
Applications of PCR in 13
Fungal–Plant Interactions
E. Ward, A. Tahiri-Alaoui and J.F. Antoniw
Crop and Disease Management Department, Institute for Arable
Crops Research, Rothamsted, Harpenden, Herts AL5 2JQ, UK
13.1 Introduction
This chapter describes the use of PCR-based techniques for studying

plant–fungal interactions. The first section describes the uses of PCR for
detection of fungal pathogens and symbionts within their hosts and the
other three sections cover approaches used to study the genes involved
in plant–fungal interactions. Some genes involved in fungal infection and
plant responses to infection are common to many host–pathogen
combinations and some of these have been characterized at the nucleotide
or amino acid level. Where this is the case, PCR allows similar genes from
other interactions to be isolated and characterized relatively easily. A
second approach, which does not rely on any previous sequence
characterization, is to search for genes whose expression is altered during
fungal interactions and PCR-based methods are available to do this. The
final application discussed is the use of PCR to detect genomic differences
between plants or fungi that differ in one characteristic only, e.g. fungal
pathogenicity or plant resistance to a particular pathogen. Recent reviews
on various aspects of plant–fungal interactions have described: plant
resistance genes (Ellis et al., 1988; Michelmore et al., 1992; Keen, 1992);
fungal pathogenicity and virulence genes (Schäfer, 1994; Van Etten et al.,
1994; Hensel and Holden, 1996); fungal avirulence genes (de Wit, 1992);
genes involved in mycorrhizal interactions (Gianinazzi-Pearson, 1996;
Gianinazzi-Pearson et al., 1996); plant defence genes (Dixon et al., 1994);
and fungal colonization of plants (Takenaka, 1995).

290 E. Ward et al.
13.2 Applications
13.2.1 Detection, localization and quantification of fungi in plant tissues

PCR is now widely used to detect and identify microorganisms, and there are
many examples of its use for fungi, including both plant pathogens and
symbionts. This application has been reviewed by Foster et al. (1993), Ward
(1994) and Bridge and Arora (Chapter 4) and will not be covered here. PCR
assays developed for a fungus in pure culture can usually be adapted for
detection of the fungus within the plant although procedures to overcome
PCR inhibitors in some plant tissues may be necessary (Robb and Nazar,
1996). This then opens the way for using PCR to quantify the extent of
fungal colonization of plant tissue or to localize the fungus within the plant.
One area in which PCR is beginning to be used is the quantification of
fungal biomass in infected tissues. For reviews of quantitative PCR, see Ferre
(1992), Diaco (1995) and Zimmerman and Mannhalter (1996). The use of
PCR for quantification is not straightforward. This is because the PCR
includes an exponential phase, so minute differences in efficiency of reaction
between samples can give rise to dramatically different amounts of final
product. To overcome this problem, internal control DNA, which is
amplified in the same PCR reaction, should be included. The quantity of
control product is then used to adjust the quantity of the test amplicon for
variations in the efficiency of the PCR between tubes. The detection and
quantification of the PCR products can be done by measuring the intensity
of ethidium bromide-stained DNA on gels (e.g. using densitometry), by
scintillation counting of labelled DNA, or by using colorimetric techniques.
Quantitative PCR has several advantages over other methods of deter-
mining fungal biomass, such as tissue maceration and dilution plating which
is a lengthy and labour-intensive procedure. Also, the dilution plating assay
may only indicate the amounts of fungus that can be isolated rather than the
amount actually present, and it cannot be used for obligate pathogens or
symbionts. PCR is a much more rapid technique and it does not require
isolation of pure fungus from the tissue. Another method of biomass
determination is to measure ergosterol or chitin levels, but this method does
not allow discrimination between different fungi infecting the same plant,
which is possible with PCR. Serological methods have also been used for
fungal biomass determination but it is generally difficult to obtain antibodies
with the required specificity for the fungus being studied. PCR has the
potential to measure fungal biomass simply and with great sensitivity and
specificity. Quantitative PCR has been used in the detection of mycorrhizal
fungi (Simon et al., 1992), Verticillium spp. (Hu et al., 1993; Moukhamedov
et al., 1994; Robb and Nazar, 1996), Leptosphaeria maculans (Mahuku et al.,
1995) and Microdochium nivale (Nicholson et al., 1996). The ability to
monitor the amounts of different fungi infecting the same plant at the same
time by quantitative PCR will be of great value in studying disease complexes
Study of Fungal–Plant Interactions 291
(Nicholson et al., 1996) and interactions between fungi, e.g. synergism and
competition.
Localizing fungi within plant tissues can be done simply by separating
the different parts of the plant and testing each for the presence of the fungus;
PCR was used to monitor the spread of Verticillium species through their
hosts at different times after infection (Moukhamedov et al., 1994; Hu et al.,
1993). A much more precise method, capable of localizing the fungus at the
cellular level, is in situ PCR (Nuovo, 1995), in which thin sections of infected
plant tissue are placed on a microscope slide and the PCR is performed
directly on this. This is technically difficult and although there are now many
applications in studying human infections, particularly those involving
viruses, we are not aware of any applications to the study of fungi or plant–
fungal interactions published yet. This could be an area for development in
the future, not just for detection of the fungi themselves but also for the
detection of mRNA from genes expressed in plant–fungal interactions.
13.2.2 Targeted approaches to cloning and analysing plant and fungal

genes
These approaches can be used when physiological, biochemical and/or
molecular data about a gene or gene product suggest that it is involved in a
particular plant–fungal interaction. They are particularly suitable for genes
and gene products that are common to many plants or fungi and/or are
expressed in response to a range of pathogens, hosts or other stimuli. Many
of the plant defence genes fall into this category. Nucleotide or amino acid
sequence data from previously characterized genes or proteins are used to
design primers that can amplify the same or homologous genes or identify
cDNA clones for those genes. Whether designing primers from amino acid
or nucleotide sequences, this approach usually involves the use of degenerate
primers that allow for uncertainties in the nucleotide sequence (see Kwok et
al., 1995 for a review of their design and use). Examples of genes isolated
using targeted approaches are given in Table 13.1.
Where a protein involved in a particular interaction has been charac-
terized, amino acid sequence information can be used to design primers to
amplify part of the corresponding gene from genomic DNA or cDNA.
Because of the redundancy of the genetic code, a given amino acid may be
encoded by different nucleotide triplets. Degenerate primers should be
designed as a pool of all the possible combinations of nucleotides that could
code for the amino acid sequence. Deoxyinosine can be used to reduce the
complexity of the primer pool. In other cases, nucleotide sequence informa-
tion can be used to design primers, e.g. where nucleotide sequence informa-
tion is already known for related genes. This generally involves the use of
degenerate primers because even within conserved regions of genes there is
often some variation, e.g. between different plants or fungi or between
different members of a gene family in the same plant.
Table 13.1. Genes isolated from various plant–fungal interactions using PCR-based targeted approaches.
Gene product Organism Reference
Fungal genes for products involved in Pectin lyase Glomerella cingulata Templeton et al. (1994)
fungal attachment and penetration of Exo-β1,3-glucanase Cochliobolus carbonum Schaeffer et al. (1994)
the host plant Endopolygalacturonase Fusarium moniliforme Caprari et al. (1993)
Extracellular protease (ALP1) Cochliobolus carbonum Murphy and Walton (1996)
Genes for fungal toxins Phytotoxins synthesized by cyclic Cochliobolus victoriae Nikolskaya et al. (1995)
peptide synthetases Diheterospora chlamydosporia Nikolskaya et al. (1995)
Cylindrocladium macrospora Nikolskaya et al. (1995)
Plant defence genes Phenylalanine ammonia lyase Rice Zhu et al. (1995)
Peroxidase Wheat Båga et al. (1995)
Pathogenesis-related gene RH2 Pea root epidermis Mylona et al. (1994)
Chitinases Sugar beet Nielsen et al. (1994)
Pea Vad et al. (1993)
Maize Wu et al. (1994)
Wheat Liao et al. (1994)
Polygalacturonase inhibitor (PGIP) Soybean Favaron et al. (1994)
IWF (non-specific lipid transfer Sugar beet Nielsen et al. (1996)
protein)
Fungal and plant genes involved in Plant sugar transporter Medicago truncatula Harrison (1996)
mycorrhizal interactions Fungal phosphate transporter Glomus versiforme Harrison and van Buuren (1995)
Once a small region of the gene of interest has been amplified using PCR,
full-length clones may be obtained by screening genomic or cDNA libraries
with labelled PCR-amplified DNA, or by using other PCR-based approa-
ches. For cDNA clones the missing parts of the gene sequence can be cloned
by an approach most commonly referred to as RACE (rapid amplification of
cDNA ends; Frohman, 1995). RACE is also known as anchored PCR or one-
sided PCR. RACE involves amplification using one primer derived from a
short stretch of known sequence in the gene/mRNA and another primer that
anneals either to the poly(A)-tail (to obtain the 3′-end) or to an appended
homopolymer tail (for the 5′-end). There are several examples of its use in
cloning genes involved in plant–fungal interactions (Vad et al., 1993; Nielsen
et al., 1994, 1996; Murphy and Walton, 1996).
PCR-based approaches have allowed genes and their mRNA products to
be cloned and analysed much more quickly than was previously possible.
Once sequences are published it is possible for other workers to use the
information to analyse similar genes immediately rather than waiting for the
exchange of clones. There are various uses for the genes once isolated, in
addition to characterizing the gene structure and organization. The spatial
and temporal expression of the gene can be studied during infection by
techniques such as Northern blotting (Vad et al., 1993; Wu et al., 1994; Zhu
et al., 1995; Nielsen et al., 1996), reverse transcriptase (RT) PCR (Båga et al.,
1995; Guo et al., 1995; Meyer et al., 1996) or in situ hybridization. The gene
can be cloned into an expression vector allowing purification and further
characterization of the protein and the production of antisera (Templeton et
al., 1994; Guo et al., 1995). The promoter from the gene can be fused to a
reporter such as β-glucuronidase (GUS), transformed into plants and the
expression studied in various tissues at different times after infection or other
treatments (Zhu et al., 1995).
In fungi, mutants lacking particular genes have been obtained by targeted
gene disruption using cloned genes and this has allowed functional studies to
be carried out. A gene encoding the exo-β-1,3-glucanase of Cochliobolus
carbonum was cloned using degenerate primers based on amino acid
sequence and this was then used to generate mutants that could not produce
the enzyme. The mutant was still pathogenic to maize, indicating that the
exo-β-1,3-glucanase gene was not essential for pathogenicity (Schaeffer et al.,
1994). A similar approach was used to study an extracellular protease ALP1
from Cochliobolus carbonum (Murphy and Walton, 1996). The ALP1
mutants thus generated had the same growth and disease phenotypes as the
wild-type strain, indicating that this gene by itself was not required for
pathogenicity. Although the above studies could have been done without the
PCR, its use enabled the work to be done much more easily and quickly than
was previously possible.
PCR can also be used for in vitro mutagenesis to study the effects of
particular amino acid residues on the biological activity of the gene product.
Altered primers can be used to replace the nucleotides coding for single or
294 E. Ward et al.
multiple amino acid residues in the protein. This approach was used to study
the mode of action of the AVR9 elicitor peptide involved in the Cladospo-
rium fulvum – tomato interaction (Honée et al., 1994).
13.2.3 Studying plant and fungal genes involved in interactions by

comparative genome analysis
The biochemical basis of the effects of most genes involved in plant–fungal
interactions is not known. One approach devised for studying these genes is
based on comparing the DNA of organisms with or without a trait of interest
to find the regions that differ. In particular, this has been used to study plant
resistance genes, but the methods described are applicable to other plant and
fungal genes. The first stage in the analysis is to find a molecular marker that
is closely linked genetically to the required gene. Two types of strategies are
commonly used to ‘home in’ on the region of interest. The first is to use near
isogenic lines, that differ primarily in the gene of interest (Horvath et al.,
1995). The second is a ‘pooling approach’ such as bulked segregant analysis
(Michelmore et al., 1991). Using this technique, markers linked to a trait of
interest are identified using two pooled DNA samples, one from (homo-
zygous) individuals that express the trait and the other from (homozygous)
individuals lacking the trait. Any polymorphism between the two pools
should be linked with the trait. Markers thus identified are then confirmed
by mapping a segregating population.
Until the advent of PCR in the late 1980s most of the markers used
were RFLP (restriction fragment length polymorphisms). Although these
allowed much faster and easier screening than did the previously available
phenotypic markers, the procedure required relatively large quantities of
purified DNA and usually radioactive detection. PCR offered the
opportunity of being able to screen for differences much more easily; the
techniques do not involve radioactivity, are simpler and can be performed
on small amounts of crudely prepared samples. Some of the previously
developed RFLP methods were subsequently converted to PCR-based
protocols by sequencing the clones and then designing primers based on
these sequences (Balint-Kurti et al., 1994; Kilian et al., 1994). These markers
are frequently referred to as SCARs (sequence-characterized amplified
regions).
Additional PCR-based methods were also developed that allow the
identification of useful markers much more quickly. The most widely used
of these involves PCR at low stringency, with arbitrarily chosen primers, and
is known by the acronyms RAPDs (random amplified polymorphic DNAs;
Williams et al., 1990), AP-PCR (arbitrarily primed PCR; Welsh and
McClelland, 1990) and DAF (DNA amplification fingerprinting). The
concept is essentially the same and hereafter RAPDs will be used to refer to
all three techniques. In this technique, the primers are usually much shorter
(10 bases) than those generally used for PCR (~20 bases) and one primer is
sufficient. Also the conditions of the PCR are made relatively non-specific,
e.g. by reducing the annealing temperature and increasing the number of
amplification cycles (e.g. from 25 to 45). Since the primers are so short and
mismatches are allowed by low stringency conditions it is likely that many
primer-binding sites will be present in the target DNA. There is also a high
probability that pairs of sequences complementary to the primer will be
arranged close enough together and in the correct orientation for PCR-
amplification of the intervening sequences. Each RAPD is likely to result in
the amplification of several (usually 3–10) bands that can be detected by
agarose gel electrophoresis and ethidium bromide staining. Alternative
detection methods, that reveal a larger number of bands, are silver staining
of polyacrylamide gels (Caetano-Anollés et al., 1991) radioactive labelling of
products run on acrylamide gels detected by autoradiography (Welsh and
McClelland, 1990) and denaturing gradient gel electrophoresis (DGGE)
(Procunier et al., 1995). Reactions with different RAPD primers can detect
variation at different levels, including species, isolates and near-isogenic lines
differing only in a single trait, e.g. plant resistance to disease or fungal
pathogenicity.
Due to the ease of use and the speed at which markers can be developed
using it, RAPDs have been used extensively in the few years since the method
was first reported. Several reviews have covered various aspects of the
technique and its applications in genetics and plant breeding (Waugh and
Powell, 1992; Bowditch et al., 1993; Rafalski and Tingey, 1993; Williams et
al., 1993; He et al., 1994; McClelland and Welsh, 1995). Using RAPDs,
markers have now been identified that are closely linked to the resistance
genes for barley stem rust (Horvath et al., 1995), barley powdery mildew (Xu
and Kasha, 1992), wheat leaf rust (Schachermayr et al., 1994), lettuce downy
mildew (Michelmore et al., 1991; Paran and Michelmore, 1993; Maisonneuve
et al., 1994), pea powdery mildew (Timmerman et al., 1994), bean rust
(Miklas et al., 1993) and muskmelon Fusarium wilt (Wechter et al., 1995).
RAPDs have also been used as markers in fungi, but the work here has
mainly been used for species and population analysis (McDermott et al.,
1994).
The major problem with the RAPD technique is the lack of reproduci-
bility, although with appropriate precautions the effects of this can be
minimized. Usually RAPD bands behave as dominant markers (only one of
the alleles can be amplified) rather than co-dominant markers (each allele
amplifies a different band) which would be generally more useful. Another
feature of RAPDs is that multiple loci are amplified. Whilst this is useful
initially, in that many loci can be analysed at once, it is a disadvantage in
subsequent analyses because of the complexity of the patterns. Another
potential source of problems is contamination and it is essential to include
negative controls. Because of these problems RAPD markers are often
converted to more reproducible markers (SCARs) after cloning and sequenc-
ing (Markussen et al., 1995; Naqvi and Chattoo, 1996).
296 E. Ward et al.
Another, more recently developed technique for isolating markers linked

to traits of interest is AFLPs (amplified fragment length polymorphisms)
(Vos et al., 1995; Perkin Elmer, 1995). The technique is based on the selective
amplification of restriction fragments generated from the genomic DNA.
First the DNA is digested with restriction enzymes and oligonucleotide
adaptors are ligated to it. Sets of restriction fragments are then amplified
selectively and, finally, the amplified fragments are analysed after gel
electrophoresis. The selectivity is achieved by using primers that contain the
restriction site and variable 3′ extensions. The number of bands produced
depends on the type of gel analysis used but typically 50–100 restriction
fragments are resolved on denaturing polyacrylamide gels. The AFLP
method is more robust and reliable than RAPDs because more stringent
reaction conditions are used, but is more difficult and expensive to do. The
technique has been used to select markers closely linked to the R1 (resistance
to Phytophthora infestans) gene of potato (Meksem et al., 1995) and the
tomato Cf-9 gene (resistance to Cladosporium fulvum; Thomas et al., 1995).
Other PCR-based methods have also been developed that allow rapid
identification of markers for genes of interest (for reviews, see Karp et al.,
1996; Staub et al., 1996), including variable non-translated repeats (VNTRs)
and microsatellite/simple sequence repeats (SSRs). Once developed, these
markers are useful in screening breeding lines to track which progeny
contains the desirable trait (marker-assisted selection). Molecular markers,
and particularly those involving PCR, allow much faster and easier screening
than do the previously available phenotypic markers, and this is important
in these high throughput studies.
The markers can also be used to facilitate cloning of the gene of interest
(for resistance, pathogenicity, etc.) by map-based cloning procedures (Young,
1990, 1995; Michelmore et al., 1991). This is an approach whereby informa-
tion about the gene’s chromosomal location is used as the basis for cloning.
After markers that are closely linked genetically to the gene of interest have
been identified a physical map is constructed in which the distances between
markers are calculated as numbers of nucleotides rather than recombination
frequencies (e.g. using pulsed-field gel electrophoresis). Chromosome walk-
ing is then used to identify overlapping clones in the region of interest. The
last stage is to pinpoint the target gene among the overlapping clones, usually
by complementation of organisms with the recessive phenotype. This
approach is a long-term, labour-intensive undertaking, but it has been used
to isolate the genes conferring resistance to the bacterial pathogen Pseudomo-
nas syringae in tomato (Martin et al., 1993) and Arabidopsis thaliana
(Mindrinos et al., 1994).
It may also be possible to identify genes of interest which, for example,
differ between wild-type and deletion mutants, by genomic subtraction
methods. DNA that is found in one of the pair of organisms under test, but
not the other, is selected and then amplified using PCR (Straus and Ausubel,
1990; Lisitsyn et al., 1993). This approach has been used to clone the
Arabidopsis gibberellin synthesis (GA1) locus (Sun et al., 1992). Subtractive

hybridization is also used on mRNA, to find mRNA species which are
present in colonized plants but absent from the uninfected plant (see section
13.2.4).
13.2.4 Non-targeted approaches to characterizing altered gene

expression during plant–fungal interactions
The use of PCR in combination with standard cloning techniques is now a
widely adopted strategy to identify genes whose expression is altered during
biological interactions and it has resulted in the saving of much time, effort
and cost. Several methods have been developed and optimized in different
laboratories to suit a specific need and a particular biological system. In this
section we discuss three applications of PCR to investigate changes in gene
expression during fungal–plant interaction, without prior knowledge of the
genes or proteins that might be involved: (i) the use of PCR in combination
with differential hybridization methods to screen for differentially expressed
genes; (ii) RNA fingerprinting methods to analyse differential gene expres-
sion; (iii) the use of PCR in conjunction with subtractive hybridization to
generate probes specific to differentially expressed genes.
Differential screening of cDNA libraries

Various papers discuss the use of PCR to construct cDNA libraries (Gurr
and McPherson, 1992; Clackson et al., 1993; Lambert and Williamson,
1993). PCR can also be used during screening to estimate the average cDNA
insert size (Güssow and Clackson, 1989). This allows the presence, size and
orientation of inserts to be determined rapidly by amplification with
flanking primers, and (for orientation) by including a single internal primer.
PCR can be performed directly on single phage plaques, aliquots from phage
libraries, or bacterial colonies, circumventing all DNA preparation. When
the PCR-based assessment is used in combination with the IPTG and X-Gal
colour selection method (Sambrook et al., 1989) to determine the relative
numbers of recombinant (white) versus wild-type (blue) phage, it provides
a simple and accurate assessment of the quality of cDNA library under
investigation.
Differential screening allows the identification of cDNA clones corre-
sponding to differentially expressed genes. Poly(A)+ RNAs extracted from
the two samples under comparison are used as templates to generate labelled
cDNA probes that are hybridized separately to duplicate copies of the same
cDNA library. Clones that hybridize to both probes correspond to genes
that are constitutively expressed in both samples, whereas clones that
hybridize to only one probe correspond to mRNAs that are expressed in
only one sample (Sambrook et al., 1989). To ensure the purification of single
clones, putative positive phage clones are screened through two or three
rounds of differential hybridization. Due to the high number of phages
298 E. Ward et al.
which are analysed during each round of screening, the method can be very
time-consuming and costly. PCR can be used to simplify and speed up this
process. An aliquot is taken from each phage clone as template for a PCR
reaction using, for example, M13 forward and reverse sequencing primers to
amplify the cDNA insert within the polylinker or any specific primers
flanking the cloning site. There are several advantages of using this approach:
(i) it shows whether the phage clone is single or contaminated by other
surrounding phages; (ii) it gives an estimate of the size of the inserted cDNA;
(iii) several phage clones can be screened at once; (iv) when combined with
Southern blot analysis it allows analysis of the induction or repression of the
clones under investigation. This approach has been used to clone symbiosis-
related cDNAs from eucalypt ectomycorrhizae (Tagu et al., 1993) and to
study genes whose expression is altered during the colonization of tomato
roots with the arbuscular mycorrhizal fungus Glomus mosseae (Tahiri-
Alaoui and Antoniw, 1996).
RNA fingerprinting methods

Another approach to detecting and isolating differentially expressed genes is
by comparing cDNA fingerprints generated from mRNA expressed under
different conditions (see Chapter 3; McClelland and Welsh, 1995; McClel-
land et al., 1995, for recent reviews and protocols). These methods are the
RNA equivalents of the DNA fingerprinting methods described in Section
13.2.3. Liang and Pardee (1992) were the first to describe an RNA
fingerprinting protocol, which they termed differential display reverse
transcriptase PCR (DDRT–PCR). They used a primer for reverse transcrip-
tion based on oligo-dT but with an anchor of two bases at the 3′-end. After
reverse transcription and denaturation, PCR was performed on the first
strand cDNA using the anchored oligo-dT primer together with an
arbitrarily chosen 10-mer primer to generate a fingerprint of products
analysed on a polyacrylamide sequencing gel. DDRT–PCT has been used in
the investigation of gene regulation in both animal and plant systems.
Although the principle of the technique is simple and elegant, there are
several problems in practice, including the redundancy and under-
representation of certain mRNA species and a rather high number of false
positives that cannot be confirmed by Northern blot analysis. We have
encountered such problems in our laboratory in investigating the interaction
of barley roots with the take-all fungus, Gaeumannomyces graminis var.
tritici, and potato infected with potato cyst nematode, Globodera ros-
tochiensis. Despite extensive analysis, and although barley and potato
showed dramatic physiological responses to the pathogen attack, no differ-
ences in gene expression were found between uninfected plants and plants
responding to pathogen attack. This led to the design of an experimental
system in which it was demonstrated that differential display showed a
strong bias towards high copy number mRNA species (Bertioli et al., 1995).
There are few reports of the successful use of differential display in analysing
plant–microbe interactions (Martin-Laurent et al., 1995; Martin-Laurent et

al., 1996). Various efforts have been made to optimize and streamline the
method (Liang, et al., 1993, 1994; Li et al., 1994; Mou et al., 1994).
In an alternative protocol, termed RNA arbitrarily primed PCR (RAP-
PCR; Welsh et al., 1992) arbitrary primers are used both for cDNA synthesis
and PCR amplification. A method of RNA fingerprinting based on AFLPs
has also been developed and used to analyse gene expression during potato
tuber development (Bachem et al., 1996).
Subtractive hybridization methods

This approach involves the subtraction (by hybridization) of the mRNAs
expressed in uninfected cells from those expressed in infected cells to leave
only those expressed during infection. PCR has been invaluable in amplify-
ing the minute amounts of material that result from this process. The cDNA
thus produced can be used to make subtractive cDNA libraries or used as a
probe to screen existing cDNA libraries. There are several variations of the
technique depending on the method used to separate the hybridized and
non-hybridized molecules, including hydroxylapatite chromatography
(Sambrook et al., 1989), biotinylation (Wieland et al., 1990) and magnetic
beads (Sharma et al., 1993). Examples of the use of the technique in studying
plant–fungal interactions have been reported (Sharma et al., 1993; Lönneborg
et al., 1995; Roberts and Pryor, 1995; Justesen et al., 1996). Recent
developments in subtractive hybridization techniques include representa-
tional difference analysis (RDA) and PCR-select cDNA subtraction.
RDA is a method originally developed by Lisitsyn et al., (1993) to
isolate differences between two complex genomes. Genomic RDA relies on
the generation, by restriction enzyme digestion and PCR amplification, of
simplified versions of the genomes under investigation known as
‘representations’. If an amplifiable restriction fragment (the target) exists in
one representation (the tester), and is absent from another (the driver), a
kinetic enrichment of the target can be achieved by subtractive hybridization
of the tester in the presence of excess driver. Sequences with homologues
in the driver are rendered unamplifiable, while the target hybridizes only
to itself, and retains the ability to be amplified by PCR. Successive iterations
of the subtraction/PCR process produces bands on ethidium bromide-
stained agarose gels corresponding to enriched target. The RDA method
was adapted for cDNA and successfully used to identify a number of
caffeine-induced cDNA fragments from pre-B cell lines (Hubank and
Schatz, 1994). Although we are not aware of any published work using the
cDNA-RDA method to investigate altered gene expression in plant–fungal
interactions, the approach seems to be fast, sensitive, reproducible, with few
false positives and capable of being applied to a wide range of biological
problems.
PCR-select cDNA subtraction (Clontech, 1996) uses a new method
called suppression PCR (Siebert et al., 1995). The PCR-select cDNA primer
300 E. Ward et al.
adaptors are engineered to prevent undesirable amplification, i.e. amplifica-

tion of common sequences, during PCR. Suppression occurs when
complementary sequences are present on each end of a single-strand cDNA.
During each primer annealing step, the hybridization kinetics strongly
favour the formation of a pan-handle secondary structure that prevents
primer annealing. When occasionally a primer anneals and is extended, the
newly synthesized strand will also have the inverted terminal repeats and
form another pan-handle structure. Thus, during PCR, non-specific
amplification is efficiently suppressed, and specific amplification of cDNA
molecules with different adaptors at both ends can proceed normally. We
have used this technique to generate two specific probes of mRNA that
are specifically expressed in arbuscular mycorrhizal colonized tomato roots
(tester) but not in control uninoculated roots (driver). The two probes were
used to screen a cDNA library prepared from mRNA from arbuscular
mycorrhizal-colonized tomato roots (Tahiri-Alaoui and Antoniw, 1996).
Two different cDNA clones were isolated, which after partial sequencing
showed 94% similarity to an inorganic phosphate transporter from potato
and 86% similarity to the ATP phosphoribosyl transferase from Escherichia
coli and Salmonella typhimurium (A. Tahiri-Alaoui and J.F. Antoniw,
unpublished work).
13.3 Conclusions
PCR techniques have made a large impact on research into plant–fungal

interactions, as they have done in many other areas of biological research.
PCR-based methods have been developed which allow the detection of many
plant pathogens and symbionts on or in their hosts more rapidly and reliably
than before and for a few fungi these methods are quantitative. PCR has also
simplified the isolation of genes involved in plant–fungal interactions. Once
a protein or nucleotide sequence is available for one gene, primers can be
designed to allow related genes to be isolated very quickly. However, PCR
can also be used to isolate genes involved in plant–fungal interactions
without prior knowledge of the proteins involved. These methods detect
differences at the RNA level that correlate with fungal infection or
differences at the DNA level that correlate with a trait such as plant resistance
or fungal pathogenicity.
Acknowledgements
We thank G.L. Bateman and M.J. Adams for critical reading of the
manuscript. IACR receives grant-aided support from the BBSRC. A. Tahiri-
Alaoui is currently supported by a European Union (EU) grant (no. AIR
3-CT94-0809).
References
Bachem, C.W.B., van der Hoeven, R.S., de Bruijn, S.M., Vreugdenhil, D., Zabeau,
M and Visser, R.G.F. (1996) Visualization of differential gene expression
using a novel method of RNA fingerprinting based on AFLP: analysis of
gene expression during potato tuber development. The Plant Journal 9,
745–753.
Båga, M., Chibbar, R.N. and Kartha, K.K.(1995) Molecular cloning and expression
analysis of peroxidase genes from wheat. Plant Molecular Biology 29, 647–662.
Balint-Kurti, P.J., Dixon, M.S., Jones, D.A., Norcott, K.A. and Jones, J.D.G. (1994)
RFLP linkage analysis of the Cf-4 and Cf-9 genes for resistance to Cladosporium
fulvum in tomato. Theoretical and Applied Genetics 88, 691–700.
Bertioli, D.J., Schlichter, U.H.A., Adams, M. J., Burrows, P.R., Steinbiss, H.-H. and
Antoniw, J.F. (1995) An analysis of differential display shows a strong bias
towards high copy number mRNAs. Nucleic Acids Research 23, 4520–4523.
Bowditch, B.M., Albright, D.G., Williams, J.G.K. and Braun, M.J. (1993) Use of
randomly amplified polymorphic DNA markers in comparative genome studies.
Methods in Enzymology 224, 294–309.
Caetano-Anollés, G., Bassam, B.J. and Gresshoff, P.M. (1991) DNA amplification
fingerprints using very short arbitrary oligonucleotide primers. Bio/Technology
9, 553–557.
Caprari, C., Richter, A., Bergmann, C., Lo Cicero, S., Salvi, G., Cervone, F. and De
Lorenzo, G. (1993) Cloning and characterization of a gene encoding the
endopolygalacturonase of Fusarium moniliforme. Mycological Research 97,
497–505.
Clackson, T., Güssow, D. and Jones, P.T. (1993) General application of PCR to gene
cloning and manipulation. In: McPherson, M.J., Quirke, P. and Taylor, G.R. (eds)
PCR: a Practical Approach. IRL Press, Oxford, pp. 187–214.
Clontech laboratories Inc. (1996) Clontech PCR-select cDNA Subtraction Kit User
Manual (PT1117-1).
de Wit, P.J.G.M. (1992) Molecular characterization of gene-for-gene systems in plant–
fungus interactions and the application of avirulence genes in control of plant
pathogens. Annual Review of Phytopathology 30, 391–418.
Diaco, R. (1995) Practical considerations for the design of quantitative PCR assays.
In: Innis, M.A., Gelfand, D.H. and Sninsky, J.J. (eds) PCR Strategies. Academic
Press, San Diego, pp. 84–108.
Dixon, R.A., Harrison, M.J. and Lamb, C.J. (1994) Early events in the activation of
plant defense responses. Annual Review of Phytopathology 32, 479–501.
Ellis, J.G., Lawrence, G.J., Peacock, W.J. and Pryor, A.J. (1988) Approaches to
cloning plant genes conferring resistance to fungal pathogens. Annual Review of
Favaron, F., D’Ovidio, R., Porceddu, E. and Alghisi, P. (1994) Purification and
molecular characterization of a soybean polygalacturonase-inhibiting protein.
Planta 195, 80–87.
Ferre, F. (1992) Quantitative or semi-quantitative PCR: reality versus myth. PCR
Methods and Applications 2, 1–9.
Foster, L.M., Kozak, K.R., Loftus, M.G., Stevens, J.J. and Ross, I.K. (1993) The
Research 97, 769–781.
302 E. Ward et al.
Frohman, M.A. (1995) Rapid amplification of cDNA ends. In: Dieffenbach, C.W and
Dveksler, G.S. (eds) PCR primer. A Laboratory Manual. Cold Spring Harbor
Laboratory Press, Cold Spring Harbour, New York, pp. 381–409.
Gianinazzi-Pearson, V. (1996) Plant cell responses to arbuscular mycorrhizal fungi:
getting to the roots of the symbiosis. The Plant Cell 8, 1871–1883.
Gianinazzi-Pearson, V., Dumas-Gaudot, E., Gollotte, A., Tahiri-Alaoui, A. and
Gianinazzi, S. (1996) Cellular and molecular defence-related root responses to
invasion by arbuscular mycorrhizal fungi. New Phytologist 133, 45–57.
Guo, W., González-Candelas, L. and Kolattukudy, P.E. (1995) Cloning of a novel
constitutively expressed pectate lyase gene pelB from Fusarium solani f.sp. pisi
(Nectria haematococca, mating type VI) and characterization of the gene product
expressed in Pichia pastoris. Journal of Bacteriology 177, 7070–7077.
Gurr, S. J. and McPherson, M. J. (1992) PCR-directed cDNA libraries. In:
McPherson, M.J., Quirke, P. and Taylor, G.R. (eds) PCR: a Practical Approach.
IRL Press, Oxford, pp. 147–170.
Güssow, D. and Clackson, T. (1989) Direct clone characterization from plaques and
colonies by the polymerase chain reaction. Nucleic Acids Research 17, 4000.
Harrison, M. (1996) A sugar transporter from Medicago truncatula: altered expres-
sion pattern in roots during vesicular-arbuscular (VA) mycorrhizal associations.
The Plant Journal 9, 491–503.
Harrison, M. and van Buuren, M. (1995) A phosphate transporter from the
mycorrhizal fungus Glomus versiforme. Nature 378, 626–629.
He, Q.S., Viljanen, M.K. and Mertsola, J. (1994) Effects of thermocyclers and primers
on the reproducibility of banding patterns in random amplified polymorphic
DNA analysis. Molecular and Cellular Probes 8, 155–160.
Hensel, M. and Holden, D.W. (1996) Molecular genetic approaches for the study of
virulence in both pathogenic bacteria and fungi. Microbiology 142, 1049–1058.
Honée, G., van den Ackerveken, G.F.J.M., van den Broek, H.W.J., Cozijnsen, T.J.,
Joosten, M.H.A.J., Laugé, R., Kooman-Gersmann, M., Vervoort, J., Vogelsang,
R., Vossen, P., Wubben, J.P. and de Wit, P.J.G.M. (1994) Molecular character-
ization of the interaction between the fungal pathogen Cladosporium fulvum and
tomato. In: Daniels, M., Downie, J.A. and Osbourn, A.E. (eds) Advances in
Molecular Genetics of Plant–Microbe Interactions, Vol. 3. Kluwer, Dordrecht,
pp. 199–206.
Horvath, D.P., Dahleen, L.S., Stebbing, J.-A. and Penner, G. (1995) A co-dominant
PCR-based marker for assisted selection of durable stem rust resistance in barley.
Crop Science 35, 1445–1450.
Hu, X., Nazar R.N. and Robb, J. (1993) Quantification of Verticillium biomass in wilt
disease development. Physiological and Molecular Plant Pathology 42, 23–36.
Hubank, M. and Schatz, D. G. (1994) Identifying differences in mRNA expression
by representational difference analysis of cDNA. Nucleic Acids Research 22,
5640–5648.
Justesen, A., Somerville, S., Christiansen and Giese, H. (1996) Isolation and
characterization of two novel genes expressed in germinating conidia of the
obligate biotroph Erysiphe graminis f.sp. hordei. Gene 170, 131–135.
Karp, A., Seberg, O. and Buiatti, M. (1996) Molecular techniques in the assessment
of botanical diversity. Annals of Botany 78, 143–149.
Keen, N.T. (1992) The molecular biology of disease resistance. Plant Molecular
Biology 19, 109–122.
Kilian, A., Steffenson, B.J., Maroof, M.A.S. and Kleinhofs, A. (1994) RFLP markers
linked to the durable stem rust resistance gene Rpg1 in barley. Molecular Plant–
Microbe Interactions 7, 298–301.
Kwok, S., Chang, S.-Y., Sninsky, J.J. and Wang, A. (1995) In: Dieffenbach, C.W and
Dveksler, G.S. (eds) PCR Primer. A Laboratory Manual. Cold Spring Harbor
Lambert, K.N. and Williamson, V.M. (1993) cDNA library construction from small
amounts of RNA using paramagnetic beads and PCR. Nucleic Acids Research 21,
775–776.
Li, F., Barnathan, E.S. and Karikó, K. (1994) Rapid method for screening and cloning
cDNAs generated in differential mRNA display: application of Northern blot
for affinity capturing of cDNAs. Nucleic Acids Research 22, 1764–1765.
by means of Polymerase Chain Reaction. Science 257, 967–971.
eukaryotic mRNA by means of differential display: refinements and optimiza-
Liang, P., Zhu, W., Zhang, X., Guo, Z., O’Connell, R.P. Averboukh, L., Wang, F. and
Pardee, A.B. (1994) Differential display using one-base anchored oligo-dT
primers. Nucleic Acids Research 22, 5763–5764.
Liao, Y.C., Kreuzaler, F., Fischer, R., Reisener, H.-J. and Tiburzy, R. (1994)
Characterization of a wheat class Ib chitinase gene differentially induced in
isogenic lines by infection with Puccinia graminis. Plant Science 103, 177–187.
Lisitsyn, N., Lisitsyn, N. and Wigler, M. (1993) Cloning the differences between two
complex genomes. Science 259, 946–951.
Lönneborg, A., Sharma, P. and Stougaard, P. (1995) Construction of a subtractive
cDNA library using magnetic beads and PCR. In: Dieffenbach, C.W and
Dveksler, G.S. (eds) PCR Primer. A Laboratory Manual. Cold Spring Harbor
Mahuku, G.S., Goodwin, P.H. and Hall, R. (1995) A competitive polymerase chain
reaction to quantify DNA of Leptosphaeria maculans during blackleg develop-
ment in oilseed rape. Molecular Plant–Microbe Interactions 8, 761–767.
Maisonneuve, B., Bellec, Y., Anderson, P. and Michelmore, R.W. (1994) Rapid
mapping of two genes for resistance to downy mildew from Lactuca serriola to
existing clusters of resistance genes. Theoretical and Applied Genetics 89,
96–104.
Markussen, T., Krueger, J., Schmidt H. and Dunemann, F. (1995) Identification of
PCR-based markers linked to the powdery-mildew-resistance gene Pl-1 from
Malus robusta in cultivated apple. Plant Breeding 114, 530–534.
Martin, G.B., Brommonschenkel, S.H., Chunwongse, J., Frary, A., Ganal, M.W.,
Spivey, R., Wu, T., Earle, E.D. and Tanksley, S.D. (1993) Map-based cloning of
a protein kinase gene conferring disease resistance in tomato. Science 262,
1432–1436.
Martin-Laurent, F., Franken, P. and Gianinazzi, S. (1995) Screening of cDNA
fragments generated by differential RNA display. Analytical Biochemistry 228,
182–184.
Martin-Laurent, F., Franken, P., van Tuinen, D., Dumas-Gaudot, E. Schlichter, U.
Antoniw, J. F. Gianinazzi-Pearson, V. and Gianinazzi, S. (1996) Differential
display reverse transcription polymerase chain reaction: A new approach to
304 E. Ward et al.
detect symbiosis related genes involved in arbuscular mycorrhiza In: Azcon-

Aguilar, C. and Barea, J.M. (eds) Mycorrhizas in Integrated Systems: From Genes
to Plant Development. European Commission, Brussels, Belgium, pp. 195–198.
McClelland, M. and Welsh, J. (1995) DNA fingerprinting using arbitrarily primed
PCR. In: Dieffenbach, C.W and Dveksler, G.S. (eds) PCR Primer. A Laboratory
Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York,
pp. 203–211.
McClelland, M., Mathieu-Daude, F. and Welsh, J. (1995) RNA fingerprinting and
differential display using arbitrarily primed PCR. Trends in Genetics 11,
242–246.
McDermott, J.M., Brändle, U., Dutly, F., Haemmerli, U.A., Keller, S., Müller, K.E.
and Wolfe, M.S. (1994) Genetic variation in powdery mildew of barley:
development of RAPD, SCAR and VNTR markers. Phytopathology 84,
1316–1321.
Meksem, K., Leister, D., Peleman, J., Zabeau, M, Salamini, F. and Gebhardt, C. (1995)
A high-resolution map of the vicinity of the R1 locus on chromosome V of
potato based on RFLP and AFLP markers. Molecular and General Genetics 249,
74–81.
Meyer, R.C., Hedley, P.E., Waugh, R. and Machray, G.C. (1996) Organisation and
expression of a potato (Solanum tuberosum) protein kinase gene. Plant Science
118, 71–80.
Michelmore, R.W., Paran, I. and Kesseli, R.V. (1991) Identification of markers linked
to disease resistance genes by bulked segregant analysis: a rapid method to detect
markers in specific genome regions by using segregating populations. Proceed-
ings of the National Academy of Sciences USA 88, 9828–9832.
Michelmore, R.W., Kesseli, R.V., Francis, D.M., Fortin, M.G., Paran, I. and Yang,
C.-H. (1992) Strategies for cloning plant disease resistance genes. In: Gurr, S.J.,
McPherson, M.J. and Bowles, D.J. (eds) Molecular Plant Pathology: a Practical
Approach. IRL Press, Oxford, pp. 233–288.
Miklas, P.N., Stavely, J.R. and Kelly J.D. (1993) Identification and potential use of a
molecular marker for rust resistance in common bean. Theoretical and Applied
Genetics 85, 745–749.
Mindrinos, M., Katagiri, F., Yu, G.-L. and Ausubel, F.M. (1994) The A. thaliana
disease resistance gene RPS2 encodes a protein containing a nucleotide-binding
site and leucine-rich repeats. Cell 78, 1089–1099.
Mou, L., Miller, H., Li, J., Wang, E. and Chalifour, L. (1994) Improvements to the
differential display method for gene analysis. Biochemical and Biophysical
Research Communications 199, 564–569.
Murphy J.M. and Walton, J.D. (1996) Three extracellular proteases from Cochliobolus
carbonum: cloning and targeted disruption of ALP1. Molecular Plant–Microbe
Interactions 9, 290–297.
Mylona, P., Moerman, M., Yang, W.-C., Gloudemans, T., van de Kerckhove, J. van
Kammen, A., Bisseling, T. and Franssen, H.J. (1994) The root epidermis-specific
pea gene RH2 is homologous to a pathogenesis-related gene. Plant Molecular
Biology 26, 39–50.
Naqvi, N.I and Chattoo, B.B. (1996) Development of a sequence characterized
amplified region (SCAR) based indirect selection method for a dominant blast-
resistance gene in rice. Genome 39, 26–30.
Nicholson, P., Lees, A.K., Maurin, N., Parry, D.W. and Rezanoor, H.N. (1996)
Development of a PCR assay to identify and quantify Microdochium nivale var.
nivale and Microdochium nivale var. majus in wheat. Physiological and Molecular
Plant Pathology 48, 257–271.
Nielsen, K.K., Bojsen, K., Roepstorff, P. and Mikkelsen, J.D. (1994) A
hydroxyproline-containing class IV chitinase of sugar beet is glycosylated with
xylose. Plant Molecular Biology 25, 241–257.
Nielsen, K.K., Nielsen, J.E., Madrid, S.M. and Mikkelsen, J.D. (1996) New antifungal
proteins from sugar beet (Beta vulgaris L.) showing homology to non-specific
lipid transfer proteins. Plant Molecular Biology 31, 539–552.
Nikolskaya, A.N., Panaccione, D.G. and Walton, J.D. (1995) Identification of peptide
synthetase-encoding genes from filamentous fungi producing host-selective
phytotoxins or analogs. Gene 165, 207–211.
Nuovo, G.J. (1995) In situ PCR. In: Dieffenbach, C.W and Dveksler, G.S. (eds) PCR
Primer. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, New York, pp. 235–248.
Paran, I and Michelmore, R.W. (1993) Development of reliable PCR-based markers
linked to downy mildew resistance genes in lettuce. Theoretical and Applied
Genetics 85, 985–993.
Perkin Elmer (1995) AFLP plant mapping kit protocol (P/N 402083).
Procunier, J.D., Townley-Smith, T.F., Fox, S., Prashar, S., Gray, M., Kim, W.K.,
Czarnecki, E. and Dyck, P.L. (1995) PCR-based RAPD-DGGE markers linked
to leaf rust resistance genes Lr29 and Lr25 in wheat (Triticum aestivum L.).
Journal of Genetics and Breeding 49, 87–91.
Rafalski, J.A. and Tingey, S.V. (1993) Genetic diagnostics in plant breeding: RAPDs,
microsatellites and machines. Trends in Genetics 9, 275–280.
Robb, E.J. and Nazar, R.N. (1996) Factors contributing to successful PCR-based
diagnostics for potato and other crop plants. In: Marshall, G. (ed.) British Crop
Protection Council Monograph, No. 65. Diagnostics in Crop Production. British
Crop Protection Council, Farnham, pp. 75–84.
Roberts, J.K. and Pryor, A. (1995) Isolation of a flax (Linum usitatissimum) gene
induced during susceptible infection by flax rust (Melampsora lini). The Plant
Journal 8, 1–8.
Sambrook, J. Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A laboratory
Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
New York.
Schachermayr, G., Siedler, H., Gale, M.D., Winzeler, H., Winzeler, M. and Keller, B.
(1994) Identification and localization of molecular markers linked to the Lr9 leaf
rust resistance gene of wheat. Theoretical and Applied Genetics 88, 110–115.
Schaeffer, H.J., Leykam, J. and Walton, J.D. (1994) Cloning and targeted gene
disruption of EXG1, encoding exo-β-1,3-glucanase, in the phytopathogenic
fungus Cochliobolus carbonum. Applied and Environmental Microbiology 60,
594–598.
Schäfer. W. (1994) Molecular mechanisms of fungal pathogenicity to plants. Annual
Review of Phytopathology 32, 461–477.
Sharma, P., Lönneborg, A. and Stougaard, P. (1993) PCR-based construction of
subtractive DNA library using magnetic beads. BioTechniques 15, 610–611.
306 E. Ward et al.
Siebert, P.D., Chenchik, A., Kellogg, D.E., Lukyanov, K.A. and Lukyanov, S.A.
(1995) An improved PCR method for walking in uncloned genomic DNA.
Simon, L., Lévesque, R.C. and Lalonde, M. (1992) Rapid quantitation by PCR of
endomycorrhizal fungi conlonizing roots. PCR Methods and Applications 2,
76–80.
Staub, J.E., Serquen, F.C. and Gupta, M. (1996) Genetic markers, map construction
and their application in plant breeding. Hortscience 31, 729–740.
Straus, D. and Ausubel, F.M. (1990) Genomic subtraction for cloning cDNA
corresponding to deletion mutations. Proceedings of the National Academy of
Sciences USA. 87, 1889–1893.
Sun, T.-P., Goodman, H.M. and Ausubel, F.M. (1992) Cloning the Arabidopsis GA1
locus by genomic subtraction. The Plant Cell 4, 119–128.
Tagu, D., Python, M., Crétin, C. and Martin, F. (1993) Cloning symbiosis-related
cDNAs from eucalypt ectomycorrhiza by PCR-assisted differential screening.
Tahiri-Alaoui, A. and Antoniw, J.F. (1996) Cloning of genes associated with the
colonization of tomato roots by the arbuscular mycorrhizal fungus Glomus
mosseae. Agronomie 16, 563–571.
Takenaka, S. (1995) Dynamics of fungal pathogens in host tissues. Canadian Journal
of Botany 73 (Suppl. 1), S1275–S1283.
Templeton, M.D., Sharrock, K.R., Bowen, J.K., Crowhurst, R.N. and Rikkerink,
E.H.A. (1994) The pectin lyase-encoding gene (pnl) family from Glomerella
cingulata: Characterization of pnlA and its expression in yeast. Gene 142,
141–146.
Thomas, C.M., Vos, P., Zabeau, M., Jones, D.A., Norcott, K.A., Chadwick, B.P. and
Jones, J.D.G. (1995) Identification of amplifed restriction fragment polymor-
phism (AFLP) markers tightly linked to the tomato Cf-9 gene for resistance to
Cladosporium fulvum. The Plant Journal 8, 785–794.
Timmerman, G.M., Frew, T.J., Weeden, N.F., Miller, A.L. and Goulden, D.S. (1994)
Linkage analysis of er-1, a recessive Pisum sativum gene for resistance to
powdery mildew fungus (Erysiphe pisi D.C.) Theoretical and Applied Genetics
88, 1050–1055.
Vad K., de Neergaard, E., Madriz-Orden̆ana, K., Mikkelsen, J.D. and Collinge, D.B.
(1993) Accumulation of defence-related transcripts and cloning of chitinase
mRNA from pea leaves (Pisum sativum L.) inoculated with Ascochyta pisi Lib.
Plant Science 92, 69–79.
Van Etten, H., Soby, S., Wasmann, C. and McCluskey, K. (1994) Pathogenicity genes
in fungi. In: Daniels, M., Downie, J.A. and Osbourn, A.E. (eds) Advances in
Molecular Genetics of Plant–Microbe Interactions, Vol. 3. Kluwer, Dordrecht,
pp. 163–170.
Vos, P., Hogers, R., Bleeker, M., Reijans, van de Lee, T., Hornes, M., Frijters, A., Pot,
J., Peleman, J., Kuiper, M. and Zabeau, M. (1995) AFLP: a new technique for
DNA fingerprinting. Nucleic Acids Research 23, 4407–4414.
Ward, E. (1994) Use of the polymerase chain reaction for identifying plant pathogens.
In: Blakeman, J.P. and Williamson, B. (eds) Ecology of Plant Pathogens. CAB
International, Wallingford, pp. 143–160.
Waugh, R. and Powell, W. (1992) Using RAPD markers for crop improvement.
Trends in Biotechnology 10, 186–191.
Wechter W.P., Whitehead, M.P., Thomas, C.E. and Dean, R.A. (1995) Identification
of a randomly amplified polymorphic DNA marker linked to the Fom2
Fusarium wilt resistance gene in muskmelon MR-1. Phytopathology 85,
1245–1249.
Welsh, J., Chada, K., Dalal, S.S., Ralph, D., Cheng, R. and McClelland, M. (1992)
Arbitrarily primed PCR fingerprinting of RNA. Nucleic Acids Research 20,
4965–4970.
Wieland, I., Bolge, G., Asouline, G. and Wigler, M. (1990) A method for difference
cloning: gene amplification following subtractive hybridization. Proceedings of
the National Academy of Sciences, USA 87, 2720–2724.
Williams, J.G.K., Hanafey, M.K., Rafalski, J.A. and Tingey, S.V. (1993) Genetic
analysis using random amplified polymorphic DNA markers. Methods in
Enzymology 218, 704–740.
Wu, S., Kriz, A.L. and Widholm, J.M. (1994) Molecular analysis of two cDNA clones
encoding acidic class I chitinase in maize. Plant Physiology 105, 1097–1105.
Young, N.D. (1990) Potential applications of map-based cloning to plant pathology.
Physiological and Molecular Plant Pathology 37, 81–94.
Young, N.D. (1995) Isolation and cloning of plant disease resistance genes. In: Singh,
R.P. and Singh, U.S. (eds) Molecular Methods in Plant Pathology. CRC Press,
Boca Raton, Florida, pp. 221–234.
Xu, J. and Kasha, K.J. (1992) Transfer of a dominant gene for powdery mildew
resistance and DNA from Hordeum bulbosum into cultivated barley H. vulgare.
Theoretical and Applied Genetics 84, 771–777.
Zhu, Q., Dabi, T., Beeche, A., Yamamoto, R., Lawton, R. and Lamb, C. (1995)
Cloning and properties of a rice gene encoding phenylalanine amonia-lyase.
Plant Molecular Biology 29, 535–550.
Zimmermann, K. and Mannhalter, J.W. (1996) Technical aspects of quantitative
competitive PCR. BioTechniques 21, 268–279.
PCR as a Tool for the 14
Investigation of Seed-borne
Disease
D.A. Pearce
Division of Terrestrial and Freshwater Life Sciences, British Antarctic
Survey, High Cross, Madingley Road, Cambridge CB3 0ET, UK
14.1 Introduction to Seed-borne Disease
Seed-borne diseases are defined as diseases which have one or more stages of
their life cycle associated with the seed. For example, nearly all the major
fungal pathogens of rice have been reported to be seed-borne. The range of
organisms infecting seed is extensive (Tables 14.1–14.3). However, very little
is known about the role and importance of seed-borne fungal inoculum in
the dissemination and development of even the most common diseases.
Ninety per cent of all food crops are propagated by seed, and the nine most
widely grown crops in world agriculture (wheat, sugar beet, rice, maize,
barley, groundnut, soybean, common (Phaseolus) bean and sorghum), are all
affected by seed-borne diseases.
The importance of seed as a vector of a range of diseases is well
established (Neergaard, 1977), and there is a significant economic impact of
seed-borne disease, particularly in under-developed countries where routine
chemical treatment of seed is prohibitively expensive, and individual farmers
can suffer huge yield reductions. For example, an average 4% overall crop
loss of the wheat harvest in the US could include individual farmers’ losses
of over 80% in an infected field. Similarly, an average 2% overall crop loss
of the rice harvest in the Philippines could include individual farmers losses
of over 58% in an infected field.
Seed diseases and seed-borne diseases can be caused by a number of differ-
ent factors: microorganisms (including viruses, bacteria, fungi and nematodes),
physiological factors (including nutrient deficiency, growth in an unsuitable
environment, phytotoxicity, ageing and congenital disorders) and mechanical
factors (due to processing or handling equipment and insect injury).
310 D.A. Pearce
Table 14.1. Relative frequency of different organisms as

seed-borne pathogens (Richardson, 1996).
No. %
Fungi 915 72
Bacteria 111 9
Viruses and viroids 238 19
Nematodes 13 1
Table 14.2. Major seed-borne organisms prevalent in Nepal (Rajbhandary and Shrestha,
1992).
Loss
Host Causal agent Disease (%)
Rice Alternaria padwickii Pink kernel

Bipolaris oryzae Brown spot 5–20
Pyricularia oryzae Blast 10–30
Xanthomonas campestris pv. Bacterial blight 10–25
oryzae
Wheat Alternaria alternata Black point
Bipolaris sorokiniana Brown spot
Tilletia caries Bunt <5
T. laevis Bunt <5
T. indica Karnal bunt
Ustilago tritici Loose smut 5–10
Maize Bipolaris maydis Leaf blight 10–20
B. turcicum Leaf blight 10–20
Fusarium moniliforme Kernel rot 10–30
Crucifers Alternaria brassicae Leaf spot 5–20
A. brassicicola Leaf spot 5–20
Sclerotinia sclerotiorum Stalk rot 5–15
Xanthomonas campestris pv. Black rot 10–30
campestris
Soybean Cercospora kikuchi Purple seed stain
Colletotrichum dematium Anthracnose
Soybean mosaic virus Hilum bleeding
Investigation of Seed-borne Disease 311
Table 14.3. Important seed-borne fungal pathogens in Nepal (Manandhar et al., 1992).
Total Total Pathogen species of

Genus of pathogen species hosts economic importance Host
Alternaria 11 35 A. brassicae and A. Crucifers

brassiacola
A. padwickii Rice
A. triticina Wheat
Aspergillus 2 17 A. flavus and Groundnut, maize
Bipolaris B. oryzae Rice
B. sorokiniana Wheat
Botryodiplodia 1 1 B. theobromiae Maize
Botrytis 1 3 B. cinerea Chickpea
Cercospora 2 2 C. kikuchii Soybean
C. oryzae Rice
Colletotrichum 3 5 C. capsici Chilli
C. Iindemuthianum Beans
C. truncatum Soybean
Diplodia 1 1 D. maydis Maize
Drechslera 12 16 D. tritici-repentis Wheat
Fusarium 9 33 F. moniliforme Rice and maize
F. oxysporum Legumes
Phoma 1 9 P. glumarum Rice
Protomyces 1 1 P. macrosporus Coriander
Pyricularia 2 2 P. oryzae Rice
Tilletia 3 2 T. indica, T. laevis and Wheat
T. tritici
Ustilaginoidea 1 1 U. virens Rice
Ustilago 3 3 U. maydis Maize
With the increasing distribution of germplasm between researchers and

countries, it is important that germplasm banks and international trade do
not harbour and distribute seed-borne pathogens, as fungal pathogens can
travel on, in or with seed batches. Major plant diseases that have been spread
around the world through trade (though not necessarily in seed) include
powdery mildew (on grapes), citrus canker, potato wart, wheat flag smut and
Dutch elm disease. In order to reduce such transmission routes, safeguards
have been introduced to prevent the spread of pests and pathogens while
allowing safe, uninterrupted seed movement. These safeguards vary widely
from country to country, but include rules and regulations, import permits,
phytosanitary certificates, inspections, treatments, isolation, passage through
quarantine greenhouses and seed health testing. Seed health tests seek to
establish the presence of a pathogen in the seed and to make an estimate of
the extent of this infection within the seedlot (Reeves, 1995).
312 D.A. Pearce
14.2 Problems Encountered in the Study of Seed-borne

Disease
Imported seed and the transport of plant varieties from one geographical
region or ecological zone to another is increasing, and this practice may
introduce new diseases where they had not been encountered previously.
Seed-borne inoculum may give rise to progressive disease development in the
crop, and symptoms of disease may not be apparent immediately in the
germinating seed. The causes of poor germination are often not identified by
farmers and this is further complicated by the fact that the incidence of fungal
infection of seed is not necessarily translated into subsequent incidence of
disease. Seed that is infested with a fungal pathogen may be discoloured and
poorly filled and thus have a poor market value, and seed that appears
healthy may harbour low populations of the pathogen that later serve as an
inoculum source. Little work has been undertaken to date to determine the
relative significance of different sources of inoculum in disease development
for even the most widely grown crops. It is, therefore, important to: (i)
understand the structure of fungal populations; (ii) determine whether
individual strains can be identified; (iii) determine how quickly the patho-
genic strains adapt to their plant hosts; (iv) determine how rapidly they might
adapt to changes in the cultivars grown; and (v) ascertain whether alternative
hosts are significant to the life cycle or to disease dissemination. There are
already relatively straightforward methods to differentiate between different
species in a pathogen complex but it remains particularly difficult to
differentiate between virulent and non-virulent strains of the same pathogen
species.
14.3 Methods Available in the Study of Seed-borne Disease
Traditional methods in the recognition and detection of seed-borne organ-

isms include: (i) direct observation; (ii) microscopic examination of imbibed
seeds; (iii) examination of cultured organisms removed by washing; (iv)
examination of seed after incubation (including the blotter test and the agar
plate test); and (v) examination of growing plants (‘growing-on’ test). Each
of these requires three steps: extraction, isolation and identification (Reeves,
1995). Such methods can be adapted to discriminate between particular
species through exploitation of nutritional requirements. For example,
Gnanamanickam et al. (1994) used selective media to detect Xanthomonas
oryzae pv. oryzae in rice seed. However, despite the semi-selectivity of the
media chosen, the sensitivity of the seed assay remained inadequate because
even the faster growing X. o. oryzae strains were not recovered unless present
in relatively high concentrations (2 × 105 to 1 × 106 c.f.u. ml–1) in the seed
extract. Detection of seed-borne X. o. oryzae on semi-selective media has
been a challenge because the pathogen grows very slowly, and growth is
suppressed by contaminating bacteria found on seed. The more traditional

methods suffer the disadvantage that they are slow and the sensitivity and
accuracy of diagnosis can be a problem.
The last decade has seen great advances in diagnostic technology,
especially in the development of rapid and sensitive methods (Pearce and
Holderness, 1996; Richardson, 1996). Recently, there has been a change in
emphasis from a more traditional morphological approach to identification
of plant pathogens (for example, spore size, shape and colony colour) to a
more functional approach based on aspects of the life cycle (for example,
mechanism of spore production, DNA relationships and physiological
attributes). This has come about firstly through immunodetection techniques
(including polyclonal antisera and monoclonal antibodies, enzyme-linked
immunosorbent assay (ELISA) and immunofluorescence microscopy), and
then methods currently in use and under development for the differentiation
of different strains of filamentous fungi, which include the use of secondary
metabolites, mycotoxins/antibiotics, protein electrophoresis, isoenzyme
electrophoresis, fatty acid analysis (Paterson and Bridge, 1994) and DNA-
based technology. DNA-based methods have included restriction fragment
length polymorphism (RFLP) and pulse-field gel electrophoresis (PFGE)
methods (Kasuga et al., 1993), and PCR amplification of various genome
regions including rRNA genes and random amplified polymorphic DNA
(RAPD) (Schots et al., 1994).
Ball and Reeves (1991, 1992) reviewed the use of ELISA, PCR, RAPD
and similar methods to identify pathogens on seed, but the effort to date
has been concentrated on the detection of bacteria and viruses. There is
currently much effort being devoted to the further development of such
techniques; Slack et al. (1996) have prepared a comparison of PCR, ELISA,
and DNA hybridization for the detection of Clavibacter michiganensis
subsp. sepedonicus in field-grown potatoes. Seed-borne organisms, how-
ever, can provide particular problems not necessarily encountered with
organisms in pure culture. For example, RAPD cannot be used directly
to detect seed-borne organisms because of non-specific hybridization of
the primer which may occur with extraneous DNA from seed extracts
(Reeves, 1995), and although PCR techniques have been used for the
characterization and identification of fungi, little attention has been given
to the detection of seed-borne pathogens (Reeves, 1995). Lange (1986)
examined nucleic acid techniques for the detection of seed-borne viruses,
and their use for the detection of plant pathogenic bacteria (Rasmussen
and Reeves, 1992) and seed-borne diseases (Reeves, 1995) has been
reviewed. Blakemore et al. (1994), by testing fungi isolated from seeds,
noted that such methods are not yet at a stage for incorporation into seed
health tests, but because of their high sensitivity, these techniques will
continue to be used to detect microorganisms which are difficult to culture
or difficult to identify.
314 D.A. Pearce
14.4 PCR Methods Available for the Study of Seed-borne

Diseases
The ability to amplify DNA from crude mycelial preparations is an
important factor in the identification of filamentous fungi from plant
material, as is the ability of the PCR reaction to use small amounts of
material and even partly degraded materials of poor quality. Due to these
features many potential sources of fungi can be used, such as unpurified
genetic material or material taken directly from soil, growing mycelia,
museum specimens and spores (Foster et al., 1993). The first stage in the
analysis of seed-borne organisms is the culture of the organism from the
seed; this is necessary, because PCR can detect dead bacteria and fungi
which would not be a problem in seed. Where only one organism is
present, or where a species-specific test is to be used, this can be
undertaken in small volumes (500 µl) of a rich liquid growth medium over
72 h at 30°C. DNA can then be extracted using a range of different
techniques including that of rapid extraction (Cenis, 1992; Raeder and
Broda, 1985; Zolan and Pukilla, 1986). Specific DNA fragments can be
amplified by PCR and products separated by gel electrophoresis. Banding
patterns can be used to distinguish between species or varieties (Ball and
Reeves, 1991). PCR can be carried out with RAPD primers (Williams et
al., 1990); these are very short primers, not having identified DNA
sequences, and usually 8–12 bases long (Caetano Anolles et al., 1992) which
will hybridize to a large number of arbitrary sites in the genome (Fox,
1993). RAPD bands aid identification where this is primarily difficult.
Examples are shown in Figs 14.1 and 14.2.
Higher specificity than that obtained with RAPD can be achieved by
using variable non-translated repeat (VNTR)-derived oligonucleotides as
PCR primers. This molecular method for differentiating fungal populations,
and for differentiating between isolates, has been widely established and
tested in the field (for example, see Bridge et al. 1997 and Pearce et al. 1996).
Representative oligonucleotide primers can be selected to give either a high
or a low discrimination between strains. Amplification products obtained
from a range of isolates can then be used to group different strains of the same
species. Following initial work with Sarocladium oryzae and Bipolaris oryzae
(Fig. 14.3), the method has been tested against other common rice pathogens
including Gerlachia oryzae, Fusarium moniliforme, Pyricularia oryzae and
Rhizoctonia solani (Bridge et al., 1997; Pearce et al., 1996).
PCR-based methods have also been used in the investigation of air-borne
spread of fungal pathogens. For example, a PCR-based method has been
developed for the identification of Tilletia indica, the causal agent of Karnal
bunt of wheat (Smith et al., 1996). Oligonucleotide primers were designed
from a sequence derived from cloned DraI fragments of mitochondrial
DNA and were used to analyse teliospores which had been germinated from
a seed wash extraction method of infested grain. The results demonstrated
that T. indica could be reliably detected at an infestation level of five

teliospores per 50 g grain.
Fig. 14.1. Banding patterns obtained from Sarocladium oryzae from RAPD primers.
Panel A: the first nine horizontal lanes show banding patterns for DNA from nine different
strains amplified using primer A11. The next ten lanes show patterns from ten isolates
amplified using primer no. 71. The last lane shows the molecular size markers. Panel B: the
first nine horizontal lanes show DNA from nine isolates amplified using primer A13, lane
10 shows one isolate amplified using primer A14, and lane 11 shows one isolate using
primer A13. The next seven were amplified using primer A14. The last lane shows the
molecular size markers.
316 D.A. Pearce
Fig. 14.2. Panel A: isolates of Bipolaris oryzae amplified with one of three RAPD primers.
Size markers are shown in lane 2. Panel B: ten isolates of Bipolaris oryzae amplified with
two RAPD primers. Size markers are shown in lane 3.
14.5 Applications of PCR in the Analysis of Seed-borne

Disease
14.5.1 Fungi
The utility of PCR as a specific and sensitive assay for plant pathogen
identification is well documented (Henson and French, 1993; Smith et al.,
1996). PCR and its applications in fungal disease diagnosis have also been
described on many occasions (for example, Annamalai et al., 1995). PCR has
also been shown to be a useful tool in the assessment of seed-borne
inoculum, in measuring seed-borne inoculum potential, the extent of
transmission from seed to crop, the extent and intensity of disease in the crop
and seed-borne inoculum in relation to yield reduction and crop losses
(Pearce and Holderness, 1996). PCR methods have been used in numerous
other studies for identifying fungal pathogens from seed, including the
Fig. 14.3. Eight isolates of Sarocladium oryzae and eight isolates of Bipolaris oryzae
tested with VNTR primers. Panel A: Primer GF, S. oryzae lanes 1–3, 7–9 and 11.
B. oryzae lanes 4 and 5 and 12–17. Size markers are shown in lane 6. Panel B: Primer RY,
S. oryzae lanes 1, 5 and 6. B. oryzae lanes 2–4, 7–11 and 17. Size markers are shown in
lane 2.
detection of Pyrenophora species, Fusarium moniliforme, Stenocarpella

maydis, and the Phomopsis/Diaporthe complex (see Blakemore et al., 1994).
A PCR-based method has been developed for the identification of Tilletia
indica, causal agent of Karnal bunt of wheat, in seed wash (Smith et al., 1996)
and to develop an assay to detect Fusarium poae in wheat (Parry and
Nicholson, 1996). The latter assay was highly sensitive; it was capable of
detecting F. poae at less than 1% seed infestation and it overcame problems
of conventional isolation methods such as competition from other fungi. The
key advantage here is that the method can detect specific pathogens in the
presence of more aggressive species.
318 D.A. Pearce
14.5.2 Other pathogens

PCR has been used in studies identifying other pathogens from seed
including the detection of Pseudomonas syringae pv. pisi (Rasmussen and
Wulff, 1990), the halo blight bacterium Pseudomonas syringae pv. phaseoli-
cola in phaseolus bean seeds (Prosen et al., 1991; Tourte and Manceau, 1991),
and in the recognition and detection of the Xanthomonas pathogens that
cause cereal leaf streak in seed.
Maes et al. (1996) have suggested that PCR-based techniques could be
useful for the identification of bacteria in seed, and Bariana et al. (1994) have
developed a method for detection of five seed-borne legume viruses in one
sensitive multiplex PCR test. PCR has been used to develop a rapid and
sensitive colorimetric detection of Xanthomonas axonopodis pv. citri by
immunocapture and a nested-PCR (Hartung et al., 1996).
14.6 Limitations of the PCR Method

The PCR method has a great deal of potential in seed pathology, but there
are also a number of problems and limitations associated with its use.
Limitations of PCR reactions described elsewhere in this book will also
apply to the study of seed pathology. In particular, there are a number of
variables within the PCR itself which must be optimized for each primer–
species combination. The dNTP concentration must be optimized and
increasing the MgCl2 concentration from 1 to 10 mmol l–1 can have a
dramatic effect on the specificity and yield of the amplification (Saiki, 1990).
Studies with Bipolaris and Sarocladium oryzae isolated from rice seed Oryza
sativa have shown that there can be both an increase and a decrease in the
number of VNTR bands produced when the annealing temperature is raised
from 35 to 47°C (Bridge et al., 1997; D.A. Pearce unpublished work). High
primer concentrations can promote mispriming and the accumulation of
non-specific PCR products when different buffers are used. Other variables
which require optimization include cycle temperatures and durations, primer
concentration and sample concentration and purity. Such problems are
compounded when the reaction mixture becomes more complicated, for
example, Bariana et al. (1994) stated that the multiplex assay was less robust
and required very specific conditions. As several factors all affect the
specificity and efficiency of DNA amplification, optimization is essential.
No single protocol will be suitable for all applications, and each new PCR
application will require optimization.
The problems associated with PCR reactions in terms of consistency and
accuracy of consecutive reactions require the preparation of adequate
controls for each PCR run. Such controls should include a strain with a
known banding pattern (from a previous run) and an internal positive control
to ensure that a negative result is not the result of failure of the PCR reaction,
such as may be caused by inhibitors in the sample extract. It is also important
in seed pathology to conduct some form of pathogenicity test to back up the

data. This is important, as the PCR reaction works equally well for dead and
for living material, and so may amplify plant DNA. Virulence analysis and
pathogenicity testing can also determine whether the increased occurrence of
a particular strain is due to increased transmission in the seed or to a higher
virulence. Care must be taken to prevent extraneous DNA from contaminat-
ing the reaction. All stock solutions must be fresh and sterile, and the
possibility of carry-over contamination must be minimized.
Interference may occur at two stages of the strain analysis, either at the
extraction stage when the fungus is isolated from the seed or in the PCR
reaction mixture. An example of interference at the extraction stage is given
by Gnanamanickam et al. (1994) who experienced problems in the detection
of Xanthomonas oryzae pv. oryzae in rice seed. In this case direct isolation
from seed is difficult, because X. o. oryzae grows slowly on media and does
not compete with faster growing contaminant bacteria that may show similar
colony characteristics and pigmentation. An example of interference at the
amplification stage is where the PCR method is most effective with purified
DNA but also works with crude preparations; crude DNA samples from
seed may contain large amounts of extraneous DNA and this could result in
considerable non-specific hybridization with primer DNA (Vivian, 1992).
During multiplex PCR, it is important to select primers which do not anneal
to each other; where a mixture of genomic DNA from two different fungi is
used as template for different primers, competition between the two
amplicons can cause inconsistent results. Chemicals from the environment,
or other components of the seed/plant tissue, may interfere with the PCR.
Hartung et al. (1996) found that a nested PCR improved the sensitivity from
the single-stage PCR approximately 50- to 160-fold. However, they also
found that the addition of citrus extracts and copper (used in leaf sprays)
inhibited nested PCR amplification of Xanthomonas axonopodis pv. citri.
A number of studies have been conducted to determine the reproducibil-
ity of PCR in differentiating fungal populations. For example, Slack et al.
(1996) compared PCR, ELISA and DNA hybridization for the detection of
Clavibacter michiganensis subsp. sepedonicus in field-grown potatoes. They
found that the results of each assay were significantly affected by inoculum
dose, cultivar and sampling date. Of the inoculated samples 36.2, 35.8 and
29.1% tested positive by PCR, ELISA and DNA respectively.
14.7 Further Method Development
A current major disadvantage in the use of nucleic acid methods in seed

health testing is that of quantification (Reeves, 1995) because it is not yet
possible to determine the number of infected seeds in a batch, and there is a
need to link presence per se with a measurement of potential future disease
incidence. Colhoun (1983) has considered the need to be able to measure the
320 D.A. Pearce
inoculum load on individual seeds in order to calculate threshold levels for

seed health tests.
The choice of primers is important and can be improved, as it is
suggested that primers with longer sequences of bases (up to about 20) are
less likely to be present at random, even in the large genomes of plants (Fox,
1993) and will, therefore, achieve specific hybridizations.
Numerous minor manipulations can be made to the reaction process, in
order to increase processing speed and to increase accuracy. For example, the
use of cell lysates instead of extracted DNA obviates the DNA extraction
step, inactive primers which are activated by the first denaturation step
prevent primer dimers from forming and computer analysis packages, for
example GELCOMPAR, can speed interpretation of results.
Vera-Cruz et al. (1996) have used repetitive extragenic palindromic
(REP)-PCR and RFLP analysis to measure haplotypic variation in X. oryzae
pv. oryzae within a single field. Their technique involved the analysis of the
genomic structure of the field population by repetitive sequence-based PCR,
with oligonucleotide primers corresponding to interspersed repeated
sequences in prokaryotic genomes and RFLP with the insertion sequence
IS1113. REP-PCR involves the use of specific primers (BOX, ERIC, ERIC2,
REP and REP2). Competitive PCR may allow some degree of quantification
of pathogens present in seed batches (Nicholson et al., 1993).
Amplified fragment length polymorphism (AFLP) may provide greater
specificity and reliability, as would DNA probes that can be obtained by
excising species-specific bands from a gel (Blakemore et al., 1992). Specific
primers, obtained by sequencing such a band, could be used to develop a
PCR-based test and provide a means of accurate identification and sensitive,
rapid detection.
The internal transcribed spacer (ITS) of the ribosomal DNA (rDNA)
subunit repeat was sequenced in representative isolates of Cylindrocladium
floridanum and Cylindrocarpon destructans (Hamelin et al., 1996). These
sequences were aligned and compared with ITS sequences of other fungi in
the GenBank database. Two internal primers were then synthesized for the
specific amplification of portions of the ITS regions of each of the species.
These products were then used to develop a test in which species-specific
fragments were amplified directly from infected roots from which one or two
of the fungi had been isolated. ITS regions evolve rapidly, and may vary
among species within a genus or among populations.
Nested PCR, in which a second round of PCR using primers internal to
those of the first round is performed (Schesser et al., 1991), may be used to
overcome non-specific amplification products from other organisms and
from host tissues. Multiplex PCR would allow simultaneous testing for more
than one organism by the use of mixtures of primers which are specific for
individual organisms. Ligase chain reaction (LCR), like PCR, is a DNA
amplification system that is highly specific and very sensitive (Lee, 1993) and
even a single mismatch can prevent the reaction. High specificity has,
however, meant that it has not yet been used in plant pathology (Reeves,
1995).
14.8 Future Potential for the Study of Seed-borne Disease
There is a wide range of potential applications of PCR methodology in

the analysis of seed-borne disease transmission. The potential exists for
the use of the PCR method with washings from seed samples (Vivian,
1992) and without the need for extraction and isolation of the organism
(Ball and Reeves, 1991). The revision of species concepts in individual
pathogen populations is also being enhanced by the use of such molecular
techniques.
Factors limiting the transmission of seed-borne disease can be
enhanced in order to reduce disease transmission and enhance yield. In
order to do this, it is important to know exactly what influence the
alteration of cultural practices is having on the seed-borne element of
transmission. These factors could include the impact of climate, storage,
seed crop management, location of production, adjustment of cultural
practices, chemical protection, protective inoculation, seed treatment and
seed health testing (Misra et al., 1995). Disease management can involve
the adjustment of sowing dates, deep ploughing, balancing host nutrition,
intercropping, management of pollen and removal of collateral hosts.
Control and monitoring of seed exchange can prevent the spread of
pathogens limited to a small area. Other parts of the cropping cycle which
can be exploited for disease management include: storage practices, the
number of crops grown per year or the order of crops, climate, planting
method, seed treatment and plant density.
PCR is, therefore, a useful tool for the investigation of seed-borne
disease. PCR can be used in plant pathology to understand the structure of
fungal populations, of both pathogens and their non-pathogenic antagonists,
determine whether individual races exist; for example, is the Sarocladium
oryzae that infects rice (Oryzae sativa) the same pathogen that attacks
Bamboo (Bambusa spp.) or is it a different species? (See Bridge et al., 1989.)
PCR methods may allow pathologists to determine how quickly a particular
pathogen is evolving, or adapting to a new host or cultivar, and whether
alternative hosts are significant to the pathogen life cycle or disease
dissemination.
References
Amatya, P., Dahal, G. and Manandhar, H.K. (1992) Plant pathology in Nepal. In:
Mathur, S.B., Amatya, P., Shrestha, K. and Manandhar, H.K. (eds) Plant Diseases,
Seed Production and Seed Health Testing in Nepal. Proceedings of the
322 D.A. Pearce
first HMG/DANIDA/FAO training course in seed health testing techniques.

DGISP, Denmark.
Annamalai, P., Ishii, H., Lalithakumari, D. and Revathi, R. (1995) Polymerase chain
reaction and its applications in fungal disease diagnosis. Zeitschrift für Pflanzen-
krankheiten und Pflanzenschutz 102(1), 91–104.
Ball, S.F.L. and Reeves, J.C. (1991) The application of new techniques in the rapid
testing for seed-borne pathogens. Plant Varieties and Seeds 4, 169–176.
Ball, S. and Reeves, J. (1992) Appication of rapid techniques to seed health testing –
prospects and potential. In: Duncan, J.M. and Torrance, L. (eds) Techniques for
the Rapid Detection of Plant Pathogens. Blackwell Scientific Publications,
Oxford. pp. 193–207.
Bariana, H.S., Shannon, A.L., Chu, P.W.G. and Waterhouse, P.M. (1994) Detection of
five seedborne legume viruses in one sensitive multiplex polymerase chain
reaction test. Phytopathology 84(10), 1201–1205.
Blakemore, E.J.A., Reeves, J.C. and Ball, S.F.L. (1992) Research note: polymerase
chain reaction used in the development of a DNA probe to identify Erwinia
stewartii, a bacterial pathogen of maize. Seed Science and Technology 20,
331–335.
Blakemore, E.J.A., Jaccoud Filho, D.S. and Reeves, J.C. (1994) PCR for the detection
of Pyrenophora species, Fusarium moniliforme, Stenocarpella maydis, and the
Phomopsis/Diaporthe complex. In: Schots, A., Dewey, F.M. and Oliver, R. (eds)
Modern Assays for Plant Pathogenic Fungi: Identification, Detection and
Quantification. CAB International, Wallingford, UK, pp. 205–213.
Bridge, P.D., Hawksworth, D.L., Kavishe, D. and Farnell, P.A. (1989) A revision of
the species concept in Sarocladium, the causal agent of sheath-rot in rice and
bamboo blight, based on biochemical and morphometric analyses. Plant
Bridge, P.D., Pearce, D.A., Rivera, A. and Rutherford, M.A. (1997) VNTR derived
oligonucleotides as PCR primers for population studies in filamentous fungi.
Caetano Anolles, G., Bassam, B.J. and Gresshoff, P.M. (1992) Primer–template
interactions during DNA amplification fingerprinting with single arbitrary
oligonucleotides. Molecular and General Genetics 235, 157–165.
Cenis, J.L. (1992) Rapid extraction of fungal DNA for PCR amplification. Nucleic
Colhoun, J. (1983) Measurement of inoculum per seed and its relationship to disease
expression. Seed Science and Technology 11, 665–671.
Foster, L.M., Kozak, K.R., Loftus, M.G., Stevens, J.J. and Ross, I. (1993) The
Research 97, 769–781.
Fox, R.T.V. (1993) Principles of Diagnostic Techniques in Plant Pathology. CAB
International, Wallingford.
Gnanamanickam, S.S., Shigaki, T., Medalla, E.S. and Mew, T.W. (1994) Problems in
detection of Xanthomonas oryzae pv. oryzae in rice seed and potential for
improvement using monoclonal antibodies. Plant Disease 78, 173–178.
Hamelin, R.C., Bérubé, P., Gignac, M. and Bourassa, M. (1996) Identification of root
rot fungi in nursery seedlings by nested multiplex PCR. Applied and Environ-
mental Microbiology 62 (11), 4026–4031.
Hartung, J.S., Pruvost, O.P., Villemot, I and Alvarez, A. (1996) Rapid and sensitive
colorimetric detection of Xanthomonas axonopodis pv. citri by immunocapture

and a nested-polymerase chain reaction assay. Phytopathology 86, 95–101.
Henson, J.M. and French, R. (1993) The polymersae chain reaction and plant disease
diagnosis. Annual Review of Phytopathology 31, 81–109.
Kasuga, T., Woods, C., Woodward, S. and Mitchelson, K.R. (1993) Heterobasidion
annosum 5.8S ribosomal DNA and internal transcribed spacer sequence: rapid
identification of European intersterility groups by ribosomal DNA restriction
polymorphism. Current Genetics 24, 433–436.
Lange, L. (1986) The practical application of new developments in test procedures
for the detection of viruses in seed. Developments in Applied Biology 1,
269–281.
Lee, H. (1993) Infectious disease testing by ligase chain reaction. Clinical Chemistry
39, 729–730.
Maes, M., Garbeva, P. and Kamoen, O. (1996) Recognition and detection in seed of
the Xanthomonas pathogens that cause cereal leaf streak using rDNA spacer
sequences and polymerase chain reaction. Phytopathology 86, 63–69.
Manandhar, H.K., Shrestha, K. and Amatya, P. (1992) Seed-borne fungal diseases. In:
Seed Production and Seed Health Testing in Nepal. Proceedings of the first
HMG/DANIDA/FAO training course in seed health testing techniques.
DGISP, Denmark.
Misra, J.K, Gergon, E.B. and Mew, T.W. (1995) Storage fungi and seed health of rice:
a study in the Philippines. Mycopathologia 131, 13–24.
Neergaard, P. (1977) Seed Pathology. Macmillan Press, London.
Nicholson, P., Rezanoor, H.N. and Su, H. (1993) Use of random amplified
polymorphic DNA (RAPD) analysis and genetic fingerprinting to differentiate
isolates of race O, C and T of Bipolaris maydis. Journal of Phytopathology 139,
261–267.
Parry, D.W. and Nicholson, P. (1996) Development of a PCR assay to detect Fusarium
poae in wheat. Plant Pathology 45, 383–391.
Paterson, R.R.M. and Bridge, P.D. (1994) Biochemical Techniques for Filamentous
Fungi. CAB International, Wallingford.
Pearce, D.A. and Holderness, M. (1996) Methods of identification for fungi. Planning
Workshop on Seed Health for Disease Management, International Rice Research
Institute, Los Baños, Laguna, The Philippines, January 22–25.
Prosen, D., Hatziloukas, E., Panopoulos, N.J. and Schaad, N.W. (1991) Direct
detection of the halo blight pathogen Pseudomonas syringae pv. phaseolicola in
bean seeds by DNA amplification. Phytopathology 81, 1159 (abstract).
Raeder, U. and Broda, P. (1985) Rapid preparation of DNA from filamentous fungi.
Rajbhandary, K.L. and Shrestha, K. (1992) Plant diseases in seed production. In:
Seed Production and Seed Health Testing in Nepal. Proceedings of the first
HMG/DANIDA/FAO training course in seed health testing techniques.
DGISP, Denmark.
Rasmussen, O.F. and Reeves, J.C. (1992) DNA probes for the detection of plant
pathogenic bacteria. Journal of Biotechnology 25, 203–220.
Rasmussen, O.F. and Wulff, B.S. (1990) Detection of Pseudomonas syringae pv. pisi
using PCR. In: Durbin, R.D., Surico, G. and Mugnai, L. (eds) Proceedings 4th
324 D.A. Pearce
International Working Group on Pseudomonas syringae Pathovars. Stamperia

Granducale, Florence, pp. 369–376.
Reeves, J.C. (1995) Nucleic acid techniques in testing for seed-borne diseases. In:
Skerritt, J.H. and Appels, R. (eds) New Diagnostics in Crop Sciences. CAB
International, Wallingford.
Richardson, M.J. (1996) Seed mycology – centenary review. Mycological Research
100(4), 385–392.
Saiki, R.K. (1990) Amplification of genomic DNA. In: Innis, M.J., Gelfand, D.H.,
Sninsky, J.J. and White,T.J. (eds) PCR Protocols: a Guide to Methods and
Applications. Academic Press, New York, pp. 13–20.
Schesser, K., Luder, A. and Henson, J.M. (1991) Use of polymerase chain reaction to
detect the take-all fungus Gaeumannomyces graminis, in infected wheat plants.
Schots, A., Dewey, F.M. and Oliver, R. (1994) Modern Assays for Plant Pathogenic
Fungi: Identification, Detection and Quantification. CAB International, Wall-
ingford.
Slack, S.A., Drennan, J.L. and Westra, A.A.G. (1996) Comparison of PCR, ELISA
and DNA hybridization for the detection of Clavibacter michiganensis subsp.
sepedonicus in field-grown potatoes. Plant Disease 80, 519–524.
Smith, O.P., Peterson, G.L., Raymond, J.B., Schaad, N.W. and Bonde, M.R. (1996)
Development of a PCR-based method for identification of Tilletia indica, causal
agent of Karnal bunt of wheat. Phytopathology 86, 115–122.
Tourte, C. and Manceau, C. (1991) Direct detection of Pseudomonas syringae
pathovar phaseolicola using the polymerase chain reaction (PCR) In: Durbin,
R.D., Surico, G. and Mugnai, L. (eds) Proceedings 4th International Working
Group on Pseudomonas syringae Pathovars. Stamperia Granducale, Florence,
pp. 377–379.
Vera-Cruz, C.M., Ardales, E.Y., Skinner, D.Z., Talag, J., Nelson, R.J., Louws, F.J.,
Leung, H., Mew, T.W. and Leach, J.E. (1996) Measurement of haplotypic
variation in Xanthomonas oryzae pv. oryzae within a single field by rep-PCR and
RFLP analyses. Phytopathology 86, 1352–1359.
Vivian, A. (1992) Identification of plant pathogenic bacteria using nucleic acid
technology. In: Duncan, J.M. and Torrance, L. (eds) Techniques for the Rapid
Detection of Plant Pathogens. Blackwell Scientific Publications, Oxford,
pp. 145–161.
Zolan, M.E. and Pukilla, P.J. (1986) Inheritance of DNA methylation in Coprinus
cinerus. Molecular and Cellular Biology 6, 195–200.
Future Directions for PCR in 15
Mycology
S. Sreenivasaprasad and P.R. Mills
Department of Plant Pathology and Microbiology, Horticulture
Research International, Wellesbourne, Warwickshire, CV35 9EF, UK
15.1 Introduction
Polymerase chain reaction (PCR)-based amplification of target nucleic acids

was conceived by Kary Mullis in California in 1983 (Mullis, 1990). To date
it is estimated that since the first publication in 1985 there have been over
40,000 references to PCR (White, 1996). Over the last decade PCR has
become one of the most important and powerful tools in molecular biology.
Two crucial technological developments – the introduction of thermostable
DNA polymerases and automated thermal cyclers – have led to the common
use of PCR for research and diagnostic purposes. Considerable effort is
underway to make the PCR technology more robust, cost effective and user
friendly.
In this chapter, some of the recent developments in amplification and
detection technologies, the currently available diagnostic PCR kits, future
applications of PCR in mycology and perspectives are discussed. A number
of PCR based applications (Table 15.1) are currently used routinely by many
laboratories and will not be covered in detail here. Further information on
these techniques can be obtained from other reviews (Erlich and Arnheim,
1992; Foster et al., 1993).
15.2 Molecular Ecology, Epidemiology and Strain Typing
Integration of genetic markers with biological traits has helped to address

questions on mating systems, origin of strains, gene flow, and host–parasite
and symbiotic interactions. RFLP-based markers have been used extensively
326 S. Sreenivasaprasad and P.R. Mills
Table 15.1. Present applications of PCR in mycology.
RAPD–PCR
RT–PCR
Inverse PCR
PCR mutagenesis
PCR gene construction
PCR SOEing*
*Splicing by overlap extension.
for this purpose. Recently, PCR technology has enabled rapid strides to be
taken in this area. PCR-based multilocus genotyping is likely to resolve
questions such as the enhanced virulence or transmissibility of strains and
also the complexity of the pathogen population of a disease outbreak. For
example, multilocus genotyping (arbitrarily primed PCR) of the asexual
human fungal pathogen Coccidioides immitis revealed that the haploid
organism was completely recombining, within geographically isolated pop-
ulations, even though no sexual stage had been recorded (White, 1996). Such
data can be used to trace the geographic origin of an infection/pathogen. In
agricultural ecosystems such high resolution genetic information will be
important to determine whether sexual recombination and gene flow are
occurring regularly during a pathogen’s life history. Reassortment of the
virulence genes, leading to new combinations, could very quickly overcome
genes introduced for resistance. PCR is also likely to negate the limitations
imposed on our understanding of microbial diversity using traditional
microbiological methods. A number of PCR-based techniques suitable for
these applications are emerging.
15.2.1 Amplified fragment length polymorphism (AFLP) analysis

AFLP is a tool that allows differentiation between individuals, genotypes and
strains and the assessment of genetic diversity and phylogeny. Originally
developed for genetic mapping in plants (Vos et al., 1995), this technique has
the characteristics of an ideal system for detecting genetic variation.
The AFLP markers generated are ‘neutral’ (i.e. not subject to natural
selection) and are generated from a large number of independent loci from
different parts of the genome. The profiles generated are reported to be
highly reproducible, because of the high stringency PCR due to the nature
of the primers (Majer et al., 1996; Mueller et al., 1996).
AFLP analysis involves selective amplification of fragments from
restriction enzyme digests of genomic DNA. Approximately 500 ng of
genomic DNA is digested simultaneously with a hexanucleotide-cutter
EcoRI and a tetranucleotide-cutter MseI. This results in more than 150,000
fragments from a fungal genome of approximately 5 × 107 bp. The digested
Future Directions 327
fragments are ligated with an MseI adaptor and a biotinylated EcoRI adaptor.
Fragments with the EcoRI adaptor are captured using streptavidin beads for
PCR. The numerous, small Mse–Mse fragments are discarded. Primers are
designed to match each of the restriction enzyme adaptor sequences with the
addition of an arbitrary two base extension at the 3′ ends and PCR is then
performed at high stringency (Fig. 15.1). This leads to the amplification of a
manageable number of fragments. Usually 50–70 fragments can be resolved
from one PCR on denaturing polyacrylamide gels and the whole procedure
can be completed in 2 days. Ready-to-use kits (e.g. Life Technologies, Perkin
Elmer/Applied Biosystems) are available for AFLP analysis.
15.2.2 Long PCR

Restriction fragment length polymorphisms (RFLPs) in rDNA and mtDNA
have been used extensively in assessing genetic diversity and species
relationships in various fungi. Conventionally, polymorphisms are detected
by Southern hybridization of the digested genomic DNA samples with a
specific probe (e.g. Sreenivasaprasad et al., 1992). RFLPs from PCR
amplified segments (up to 2.0–2.5 kb) of rDNA have also been used in similar
studies (e.g. Muthumeenakshi, 1996).
Recent development of the ‘long PCR’ technique, which employs two
DNA polymerases (non-proofreading Taq and a proofreading Pwo) has led
to the amplification of 10–40 kb fragments. This has opened up new
possibilities for the rapid generation of RFLPs and mapping.
Amplification of full-length animal mitochondrial DNA by long PCR,
by using a set of forward and reverse primers from the 16S RNA gene, has
recently been reported (Nelson et al., 1996). The size of mtDNA in animals
ranges from 16 to 20 kb. However, amplification of full-length mtDNA from
fungi is likely to be more challenging because the size of mtDNA in fungi
varies between 20 and 170 kb (Taylor, 1986). Nonetheless, using appropriate
primers, large fragments can be amplified by long PCR to generate RFLPs.
Fragments of rDNA of up to 7 kb have been amplified from Trichoderma
spp. with universal ribosomal primers (White et al., 1990) in long PCR, and
used to detect RFLPs (S. Muthumeenakshi, Warwickshire, 1996, personal
communication).
A rapid vector-independent restriction mapping technique has also been
developed using long PCR. PCR primers are radioactively labelled to serve
as probes for DNA fragments generated by partial digestion of the PCR
product. This method has been used to generate restriction maps of 8–18 kb
fragments directly amplified from human genomic DNA (Her and Wein-
shilboum, 1995).
Another application of long PCR is in repetitive-element based PCR
(REP-PCR). Dispersed repeat sequences in Magnaporthe grisea are being
used extensively to genotype the isolates by Southern hybridization-based
fingerprinting (Levy et al., 1991; Xia et al., 1993). Recently, REP-PCR has
Fig. 15.1. Amplified fragment length polymorphism (AFLP) technique.

been developed for genotyping M. grisea isolates (George et al., 1997). Two
outwardly directed primers, designed from a repetitive element sequence,
were used in combination with long PCR to generate distinct banding
patterns (Fig. 15.2) with M. grisea isolates from different hosts. The
amplicons ranged in size from 0.4 kb to longer than 23 kb, although most
scorable bands were less than 23 kb in size. The PCR profiles generated
differentiated the rice-infecting and rice non-infecting M. grisea isolates.
Robust groupings and close correspondence between the Pot2 REP-PCR
and MGR586 RFLP lineages were observed upon cluster analysis of PCR
profiles from clonal as well as highly diverse rice-infecting M. grisea
populations.
Fig. 15.2. Flowchart showing the REP-PCR technique.

15.3 Diagnostic PCR
PCR-based detection of pathogenic fungi directly from infected tissue has

been reported for several important systems (Lévesque et al., 1994; Sreeniva-
saprasad et al., 1996). PCR has also been used to monitor mycorrhizal
symbionts (Henrion et al., 1994) and to detect pathogens directly from soil
(Henson et al., 1993). Recently, a nested multiplex PCR approach has been
developed to simultaneously detect conifer root rot fungi Cylindrocarpon
destructans and Cylindrocladium floridum (Hamelin et al., 1996).
With most of these PCR methods, which are based on rDNA sequences,
infected tissue with dead mycelium might also test positive as the DNA could
still be amplified. It would be preferable to discriminate between viable and
non-viable propagules of the pathogen, particularly in the context of
certification programmes and quarantine tests. In order to detect the viable
propagules only, it would be necessary to develop reverse transcriptase
(RT)–PCR-based tests, using RNA as the source of amplification. Species-
specific primers from rDNA sequences can be used in RT–PCR, although it
is not certain whether amplification of ribosomal RNA can always be
directly correlated with viable biomass. RT–PCR amplification of sequences
such as chitin synthase genes and ergosterol biosynthetic genes can be more
reliably related to the viability of the propagules. These RT–PCR tests based
on gene sequences, however, are likely to be less sensitive as the abundance
of these messages is much lower as compared with the ribosomal RNAs.
Currently, a number of diagnostic kits (Table 15.2) are available for
routine use in forensic and clinical laboratories as a result of concerted
research and development efforts between academia and industry, backed by
strong funding. Similar advances can be envisaged for PCR application in
mycology in biomedical fields.
Table 15.2. Some of the currently available forensic and clinical diagnostic kits (Graham,
1994; Whelen and Persing, 1996) as examples of the range of PCR applications.
Kit name Basis of detection Use
AmpliType PM Five independently inherited Forensic testing and human

genetic loci identity
AmpliFLP D1S80 16 bp Repeat on chromosome Forensic testing and human
one identity
Enviroamp Legio. 5S Ribosomal RNA gene and Detection of Legionella
macrophage Legionella
infectivity potentiator gene
Amplicor Myco. 16S Ribosomal RNA gene probe Detection of Mycobacterium
tuberculosis
Amplicor hep. RT–PCR of viral RNA Detection of hepatitis C virus
15.3.1 Data processing

The expected improvements in diagnostic capability necessitate the avail-
ability of software packages suitable for different applications. User-friendly
interactive systems that answer questions in an efficient and simple manner
are likely to facilitate the introduction of diagnostics into the user’s
environment.
15.4 Genome Mapping and Sequencing
PCR has contributed to rapid completion of physical maps of human and

other genomes (Graham, 1994; Marx, 1995; Abramowitz, 1996). PCR was
used as the basis for translating the various physical mapping markers into
a common language of short fragments of single-copy DNA sequence called
sequence-tagged sites (STSs). Generally, 200–500 bp of sequence data would
define an STS. An STS is unique to that particular genome and can be
specifically amplified by PCR. An STS detection PCR assay can be carried
out using two primers (~ 20 bases) designed to be complementary to the two
strands and at opposite ends of the sequence segment. Thus, a 100 kb clone
can be mapped by determining the order of a series of STSs and measuring
the distances between them. This information can be completely described in
a database along with the conditions for the PCR assay (Olson et al., 1989).
PCR has also had a considerable effect on genetic mapping through the
amplification of the short tandem repeats (STRs) which are stretches of
tandemly repeated short nucleotide motifs present in most eukaryotic
genomes (Kashi et al., 1997). These elements occur as interspersed repeats
and may be found by screening a genomic library. PCR primers can be
designed for STR amplification by subcloning and sequencing (Litt, 1994).
These STRs can be used both as polymorphic markers for measuring the
frequency of recombination within families and also to interrelate physical
and genetic maps. Further, substantial progress has been made in the analysis
of complementary DNA clones to generate a segment of sequence called an
expressed sequence tag (EST) by PCR as part of the Human Genome Project
(White, 1996). A large volume of EST sequences is available from various
animal and plant systems e.g. Arabidopsis (Newman et al., 1994). ESTs are
generated by partial sequencing on cDNA clones. Clones from randomly
primed cDNA libraries or partial cDNA clones can be used to generate this
information rapidly. ESTs are useful for the identification and isolation of
new genes, the identification of coding regions in genomic sequences and for
genome mapping. PCR methods have also been used to map ESTs to specific
chromosomes (Adams et al., 1991).
The wider application and success of genome sequencing projects
depend on the availability of rapid and cost-effective sequencing technology.
As part of the Arabidopsis genome sequencing initiative, a microthermal
cycler has been developed with which 0.5 µl sample volumes and 40 s cycle
times can be achieved (Marziali et al., 1997). The two strategies presently
employed are shotgun sequencing and primer walking. However, both of
these approaches have time-consuming procedures. Large scale template
preparation, generation of redundant sequences and the assembly of contigs
are some of the major disadvantages with the former. With the latter, primer
synthesis can be expensive and slow and automation is more complicated.
The use of presynthesized libraries of primers with different sequences has
been proposed to eliminate the primer synthesis step (Studier, 1989).
Individual short primers from such a library are either ligated (Szybalski,
1990) or assembled without ligation (Beskin et al., 1995) to make unique
sequencing primers. More recently, a conceptually new technique known as
differential extension with nucleotide subsets (DENS) has been developed
(Raja et al., 1997).
15.4.1 Differential extension with nucleotide subsets (DENS)

DNA sequencing using DENS is a two stage process (Fig. 15.3). Initially,
a short primer is allowed to extend at 20–30°C with only two out of
the four dNTPs present in the reaction mix. Primer (a partially degenerate
octamer or a hexamer) extension depends on how soon a base
corresponding to the dNTPs not used in the reaction is present in the
strand being synthesized. This leads to differential extension of the primer,
at different sites, depending on the template sequence. The intended
priming site, the primer and the two dNTP subsets are chosen to maximize
the length of the primer at that site. Elsewhere in the template, at randomly
located priming sites, the primer extensions are likely to be substantially
shorter. Subsequently, a termination reaction is performed at higher
temperature with all four dNTPs present, similar to normal cycle
sequencing. The higher annealing and extension temperature permits a
sequence pattern to be generated only from the maximally extended site.
Differential extension products of the same primer are shorter to anneal
and extend and do not produce the sequence pattern. Although, at present,
a <10% failure rate of DENS is expected because of the superimposed
non-target sequence, further optimization of the procedures and conditions
is likely to improve the usefulness of this technique.
With the increasing interest in mapping and sequencing of fungal
genomes, particularly Aspergillus and Neurospora (Bennett, 1997; Hamer,
1997), it is likely that PCR will have a major impact in this area.
15.5 Gene Expression
Various life processes, such as development, differentiation and response to

stress, are controlled by regulation of gene expression. Identification and
Fig. 15.3. Differential extension with nucleotide subsets technique for sequencing.
isolation of the differentially expressed genes are essential to understand and

manipulate these biological processes. Conventionally, differential hybrid-
ization of cDNA libraries has been used to isolate these genes. Recently,
various techniques that combine the advantages of PCR have been
developed.
15.5.1 Differential display reverse transcription–PCR

Differential display reverse transcription–PCR (DDRT–PCR) was devel-
oped for isolating tumorigenesis-related genes from mice (Zhang and
Medina, 1993) and humans (Liang et al., 1992), and has also been applied in
the analysis of tomato fruit ripening-related genes (Oh et al., 1995). The
technique facilitates rapid isolation of differentially expressed genes via PCR
without the construction and screening of cDNA libraries.
The total mRNA pool from a sample is reverse-transcribed into 12
subpopulations of cDNA using 12 different anchored oligo-dT primers (e.g.
T11AC). The cDNA subpopulations are then PCR-amplified using the same
anchored primer and an arbitrary 10-mer. Additional cDNAs comprising
each subpopulation are amplified by using alternative arbitrary primers (Fig.
15.4). The composite PCR profile is representative of the mRNAs contained
in each population.
Radiolabelled amplification products derived from the same anchor/
arbitrary primer combinations with different samples are displayed in
adjacent lanes on polyacrylamide gels, to locate the differentially expressed
genes. The gene fragments are excised, eluted, cloned and sequenced to
identify the gene. These fragments can also be used as probes on genomic/
cDNA libraries to clone complete genes.
DDRT–PCR is potentially faster than differential hybridization of
cDNA libraries and initially gained wide attention. Despite this, some doubts
have been raised as to the wider applicability of this technique as it might be
biased for high copy number mRNA species and inappropriate where only
a few genes might vary. A number of modifications have been made to the
original protocol to optimize the technique, for example the use of longer
primers to reduce the level of false positives, and to improve reproducibility.
Several ready-to-use kits are now commercially available (e.g. Gene Hunter,
Pharmacia).
15.5.2 Suppression PCR

This is a technique used to selectively amplify differentially expressed (target)
cDNA fragments whilst simultaneously suppressing non-target amplifica-
tion. Suppression PCR is specifically designed to equalize the abundance of
messages within target cDNA to enable the isolation of even rare transcripts
(Diatchenko et al., 1996).
Tester and driver double-stranded cDNAs are prepared from the two
mRNA samples under comparison. Two tester populations are created with
Fig. 15.4. RNA differential display technique.

Fig. 15.5. Suppression PCR technique.
Continued opposite
Fig. 15.5 continued.
different adaptors but the driver has no adaptors. The first hybridization
between excess driver cDNA and each population of the tester cDNA
results in equalization of message abundance and enrichment of differ-
entially expressed sequences in the tester. The second hybridization
between fresh driver cDNA and the two primary hybridization samples
mixed together leads to the generation of differentially expressed gene
templates for PCR.
Using suppression PCR, only the differentially expressed sequences are

amplified exponentially during a first round PCR. A second round PCR with
nested primers results in reduced background and enrichment of target
sequences (Fig. 15.5).
This technique requires only 0.5–2.0 µg of poly(A)+ RNA as starting
material and is designed to amplify rare transcripts, typically the most
difficult to obtain. Suppression PCR does not involve physical separation of
single-stranded and double-stranded cDNA. Strategic design and use of
adaptors suppress the amplification of most types of molecules including the
molecules where panhandle-like structures are formed by the long inverted
repeats. Suppression PCR can thus achieve greater than 1000-fold enrich-
ment for differentially expressed cDNA (Clontech, 1995). A ready-to-use
commercial kit is available from Clontech.
15.5.3 In situ PCR

This technique is used to amplify target DNA or RNA within intact cells,
permitting the correlation of PCR results with cellular localization and
morphology. Fixed cells or tissue are permeabilized and contained and PCR
reagents are added to this. Thermal cycling through suitable parameters is
followed by detection of PCR products using appropriate methods e.g.
fluorescence microscopy. Lack of uniform equipment is perceived as the
major problem in performing and reproducing in situ PCR. Techniques
adapted for in situ thermal cycling, in particular, vary widely. With the
availability of new in situ PCR systems (e.g. Perkin Elmer/Applied Bio-
systems) it is expected that this technique can be performed consistently,
reproducibly and reliably (Perkin Elmer, 1994).
In situ PCR is an emerging tool in virology, cancer research and
developmental biology. This technique is likely to be employed with various
fungal systems. For example it has been applied in the study of arbuscular
mycorrhizal (AM) fungi to confirm the presence of different alleles in AM
fungal genes and to identify different nuclear populations within a single AM
spore (Berta et al., 1996).
In the last few years, there has been an upsurge in understanding the
molecular basis of differentiation and development in both pathogenic and
beneficial fungi. Various PCR-based techniques are likely to be applied
widely on a routine basis.
15.6 Amplification Technology
Rapid advances are being made in the miniaturization of the PCR instru-
ments and also in reducing the time required for amplification. For example,
by adapting PCR on to a microinstrumentation platform and using suitable
detection chemistries in minute disposable chambers (0.5–50 µl), 30 cycles
can be completed in 10–20 min on a very small instrument (White, 1996).

Similarly, the use of silicon chambers which require only 10 µl reactions and
are heated resistively can reduce amplification time by an order of magnitude.
Under these conditions 30 cycles may be completed in 7 min on a
microfabricated prototype. Results for a variety of loci using these systems
were comparable with the results from conventional PCR. This apparatus
was about the size of a scientific calculator including power supply and
control electronics and four 9 V batteries allowed 2.5 h of operation
(Abramowitz, 1996). Such portable and convenient devices are likely to be
used for on-field/on-site diagnosis.
Progress in the automation of nucleic acid extraction in combination
with the advances in PCR technology are likely to lead to the availability of
completely automated instrument systems for diagnostic clinics in the
foreseeable future.
15.7 Detection Technology
A number of techniques (Graham, 1994) can be used to analyse PCR

products (Table 15.3). Among these methods, scintillation proximity assay
(Amersham), electrochemiluminescence (Perkin Elmer) and microwell
assays (e.g. Roche) are suitable for analysing a large number of samples
routinely.
Further progress is being made in developing novel amplicon analysis
and detection methods. DNA can be bound to a 96-well polystyrene
microtitre plate by non-covalent interactions e.g. by 500 mM NaCl or
streptavidin coating, or immobilized probes can be used to capture bio-
tinylated PCR products. The plate-bound amplicons can then be analysed by
enzyme-assisted colorimetric detection which enables the simultaneous
handling of numerous samples. A variation of this method is the use of a
biotinylated primer and a modified triphosphate (digoxigenin-11-dUTP) in
PCR (Fig. 15.6). Detection is achieved by capturing the biotinylated
Table 15.3. Amplicon analysis methods.
Electrophoresis
Hybridization
Direct sequencing
Laser/ALF detection
HPLC
Electrochemiluminescence
Scintillation proximity assay
Microwell assay
amplicons and using anti-digoxigenin antibody conjugated to alkaline

phosphatase and suitable substrates (O’Donnell-Maloney et al., 1996).
Furthermore, by marking a specific primer with a unique hapten, e.g.
digoxigenin or fluorescein, each reaction can be detected using hapten-
specific antibodies labelled with different enzyme reporters, such as alkaline
phosphatase or horseradish peroxidase. This system permits the detection of
two different targets from a single reaction by different colour reactions
(Tobe et al., 1996).
Another method of amplicon detection is the use of a biotinylated
primer and a fluorescently labelled primer in PCR. Streptavidin captured
amplicons are denatured, the fluorescently labelled strand is hybridized
to an array of immobilized probes on a glass slide and the hybridization
pattern and polymorphisms are detected by fluorescence scanning (Fig.
15.7). An example of the use of this method is the identification of
polymorphisms from exon 4 of the human tyrosinase gene (O’Donnell-
Maloney et al., 1996).
Detection methods that utilize reporter dyes are being integrated into
new ‘kinetic’ thermal cyclers which can monitor the products during
amplification. It is expected that these combined instrument–reagent systems
Fig. 15.6. Detection method using a colorimetric assay.

Fig. 15.7. Detection method based on amplicon hybridization to probe assays.
will enable rapid generation of both qualitative and quantitative data with
high throughput (White, 1996). Recently, a microvolume multisample
fluorimeter with rapid thermal cycling has been developed by Idaho
Technology, Idaho, USA. This instrument combines rapid thermal cycling

capability, and fluorescent monitoring by three different techniques (Wittwer
et al., 1997a, b).
Recently, scientists at USDA (Madison, Wisconsin) and Perkin Elmer
(California) have applied an automated TaqMan assay system to detect
Tilletia indica (Berthier-Schaad et al., 1997). The TaqMan system relies on the
ability of the 5′ nuclease activity of Taq polymerase. During amplification,
the reporter dye from the 5′ end of the probe is released and the resultant
increase in fluorescence is monitored in real time. Under optimal PCR
conditions, increase in fluorescent signal above the threshold level, by the
end of the amplification cycles, detects a sample as positive for T. indica.
Preliminary results on the comparison of classical PCR and TaqMan with T.
indica from ryegrass and other hosts yielded approximately 60% agreement.
With improvements in reliability, routine use of similar assay systems can be
envisaged.
15.8 Conclusion
Rapid advances are being made in both amplification and detection technolo-
gies to enable rapid and high throughput PCR analyses, and the number of
techniques available is continually increasing. In view of these developments,
PCR is likely to be one of the most widely used tools in mycology in the
broad context of genes and genomics as well as diagnostics.
References
Abramowitz, S. (1996) Towards inexpensive DNA diagnostics. Trends in Bio-
technology 14, 397–401.
Adams, M.D., Kelley, J.M., Gocayne, J.D., Dubnick, M., Polymeropoulos, M.H.,
Xiao, H., Merril, C.R., Wu, A., Olde, B., Moreno, R.F., Kerlavage, A.R.,
McCombie, W.R. and Venter, J.C. (1991) Complementary DNA sequencing:
expressed sequence tags and Human Genome Project. Science 252, 1651–1656.
Bennett, J.W. (1997) White Paper: Genomics for filamentous fungi. Fungal Genetics
and Biology 21, 3–7.
Berta, B., Simon, L. and Piche, Y. (1996) In situ PCR: applications and prospects in
the study of arbuscular mycorrhizal fungi. In: International Conference on
Mycorrhizae, Berkeley, 4–9 August 1996 (abstract).
Berthier-Schaad, Y., Bonde, M.R., Tooley, P.W., Peterson, G.L., Knorr, D. and Schaad,
N.W. (1997) A rapid, automated PCR-based technique for identification of
Tilletia indica. Phytopathology 87, S8 (abstract).
Beskin, A., Zevin-Sonkin, D., Sobolev, I. and Ulanovsky, L. (1995) On the mechanism
of the modular primer effect. Nucleic Acids Research 23, 2881–2885.
Clontech (1995) An innovative PCR-based method to selectively amplify differ-
entially expressed genes. Clontechniques 10, 2–5.
Diatchenko, L., Lau, Y.-F.C., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B.,
Lukyanov, S., Lukyanov, K., Gurskaya, N. and Sverdlov, E.D. (1996) Suppres-
sion subtractive hybridization: A method for generating differentially regulated
or tissue-specific cDNA probes and libraries. Proceedings of the National
Erlich, H.A. and Arnheim, N. (1992) Genetic analysis using the polymerase chain
reaction. Annual Review of Genetics 26, 479–506.
Foster, L.M., Kozak, K.R., Loftus, M., Stevens, J.J. and Ross, I.K. (1993) The
Research 97, 769–781.
George, M.L.C., Nelson, R.J., Zeigler, R.S. and Leung, H. (1997) Pot2 repetitive
element-based PCR (repPCR) allows rapid genetic analysis of Pyricularia grisea.
Phytopathology 87, S33 (abstract).
Graham, A. (1994) A haystack of needles: applying the polymerase chain reaction.
Chemistry and Industry 18, 718–721.
Hamelin, R.C., Berube, P., Gignac, M. and Bourassa, M. (1996) Identification of root
rot of fungi in nursery seedlings by nested multiplex PCR. Applied and
Hamer, L. (1997) From genes to genomes: Sequencing of filamentous fungal genomes.
Fungal Genetics and Biology 21, 8–10.
Henrion, B., Di Battista, C., Bouchard, D., Vairelles, D. Thompson, B.D., Le Tacon,
F. and Martin, F. (1994) Monitoring the persistence of Laccaria bicolor as an ecto-
mycorrhizal symbiont of nursery-grown Douglas fir by PCR of the rDNA
intergenic spacer. Molecular Ecology 3, 571–580.
Henson, J.M., Goins, T., Grey, W., Mathre, D.E. and Elliot, M.L. (1993) Use of
polymerase chain reaction to detect Gaeumannomyces graminis DNA in plants
grown in artificially and naturally infested soil. Phytopathology 83, 283–287.
Her, C. and Weinshilboum, R.M. (1995) Rapid restriction mapping by use of long
PCR. BioTechniques 19, 530–532.
Kashi, Y., King, D. and Soller, M. (1997) Simple sequence repeats as a source of
quantitative genetic variation. Trends in Genetics 13, 74–78.
Lévesque, C.A., Vrain, T.C. and De Boer, S.H. (1994) Development of a species-
specific probe for Pythium using amplified ribosomal DNA. Phytopathology 84,
474–478.
Levy, M., Romao, J., Marchetti, M.A. and Hamer, J.E. (1991) DNA fingerprinting
with a dispersed repeated sequence resolves pathotype diversity in the rice blast
fungus. Plant Cell 3, 95–102.
Liang, P., Averboukh, L., Keyomarsi, K., Sager, R. and Pardee, A.B. (1992)
Differential display and cloning of messenger RNAs from human breast cancer
versus mammary epithelial cells. Cancer Research 52, 6966–6968.
Litt, M. (1994) PCR of TG microsatellites. In: McPherson, M.J., Quirke, P. and
Taylor, G.R. (eds) PCR: a Practical Approach. IRL Press, Oxford, pp. 85–99.
Marx, J. (1995) A new guide to the human genome. Science 270, 1919–1920.
Research 100, 1107–1111.
Marziali, A., Federspiel, N. and Davis, R. (1997) Automation for the Arabidopsis
genome sequencing project. Trends in Plant Science 2, 71–74.
Mueller, U.G., Lipari, S.E. and Milgroom, M.G. (1996) Amplified fragment length
polymorphism (AFLP) fingerprinting of symbiotic fungi cultured by the

fungus-growing ant Cyphomyrmex minutus. Molecular Ecology 5, 119–122.
Mullis, K.B. (1990) The unusual origin of the polymerase chain reaction. Scientific
American 262, 56–65.
Muthumeenakshi, S. (1996) Molecular taxonomy of the genus Trichoderma. Unpub-
lished PhD thesis, The Queen’s University of Belfast, Belfast, UK.
Nelson, W.S., Prodöhl, P.A. and Avise, J.C. (1996) Development and application of
long-PCR for the assay of full-length animal mitochondrial DNA. Molecular
Ecology 5, 807–810.
Newman, T., de Bruijn, F.J., Green, P., Keegstra, K., Kende, H., McIntosh, L.,
Ohlrogge, J., Raikhel, N., Somerville, S., Thomashow, M., Retzel, E. and
Somerville, C. (1994) Genes galore: a summary of methods for accessing results
from large-scale partial sequencing of anonymous Arabidopsis cDNA clones.
Plant Physiology 106, 1241–255.
O’Donnell-Maloney, M.J., Smith, C.L. and Cantor, C.R. (1996) The development of
microfabricated arrays for DNA sequencing and analysis. Trends in Bio-
technology 14, 401–407.
Oh, B.-J., Balint, D.E. and Giovannoni, J.J. (1995) A modified procedure for PCR-
based differential display and demonstration of use in plants for isolation of
genes related to fruit ripening. Plant Molecular Biology Reporter 13, 70–81.
Olson, M., Hood, L., Cantor, C. and Botstein, D. (1989) A common language for
physical mapping of the human genome. Science 245, 1434–1435.
Perkin Elmer (1994) In situ PCR impacts virus, cancer and developmental biology
studies. Biosystems Reporter 23, 6–7.
Raja, M.C., Zevin-Sonkin, D., Shwartzburd, J., Rozovskaya, T.A., Sobolev, I.A.,
Chertkov, O., Ramanathan, Y., Lvovsky, L. and Ulanovsky, L.E. (1997) DNA
sequencing using differential extension with nucleotide subsets (DENS). Nucleic
Sreenivasaprasad, S., Brown, A.E. and Mills, P.R. (1992) DNA sequence variation and
interrelationships among Colletotrichum species causing strawberry anthrac-
nose. Physiological and Molecular Plant Pathology 41, 265–281.
Sreenivasaprasad, S., Sharada, K., Brown, A.E. and Mills, P.R. (1996) PCR-based detec-
tion of Colletotrichum acutatum on strawberry. Plant Pathology 45, 650–655.
Studier, F. W. (1989) A strategy for high-volume sequencing of cosmid DNAs –
random and directed priming with a library of oligonucleotides. Proceedings of
the National Academy of Sciences USA 86, 6917–6921.
Szybalski, W. (1990) Proposal for sequencing DNA using ligation of hexamers to
generate sequential elongation primers (SPEL-6). Gene 90, 177–178.
Taylor, J. W. (1986) Fungal evolutionary biology and mitochondrial DNA. Experi-
mental Mycology 10, 259–269.
Tobe, V.O., Taylor, S.L. and Nickerson, D.A. (1996) Single-well genotyping of
diallelic sequence variations by a two-color ELISA-based oligonucleotide
ligation assay. Nucleic Acids Research 24, 3728–3732.
Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Homes, M., Frijters, A.,
Pot, J., Peleman, J., Kuiper, M. and Zabeau, M. (1995) AFLP: a new concept for
DNA fingerprinting. Nucleic Acids Research 23, 4407–4414.
Whelen, A.C. and Persing, D.H. (1996) The role of nucleic acid amplification and
detection in the clinical microbiology laboratory. Annual Review of Micro-
biology 50, 349–373.
White, T.J. (1996) The future of PCR technology: diversification of technologies and
applications. Trends in Biotechnology 14, 478–483.
Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols: a Guide to
Wittwer, C.T., Herrmann, M.G., Moss, A.A. and Rasmussen, R.P. (1997a) Con-
tinuous fluoresence monitoring of rapid cycle DNA amplification. BioTech-
niques 22, 130–138.
Wittwer, C.T., Ririe, K.M., Andrew, R.V., David, D.A., Gundry, R.A. and Balis, U.J.
(1997b) The LightCycler™: a microvolume multisample fluorimeter with rapid
temperature control. BioTechniques 22, 176–181.
Xia, J. Q., Correll, J.C., Lee, F.N., Marchetti, M.A. and Rhoads, D.D. (1993). DNA
fingerprinting to examine microgeographic variation in the Magnaporthe grisea
(Pyricularia oryzae) population in two rice fields in Arkansas. Phytopathology
83, 1029–1035.
Zhang, L. and Medina, D. (1993) Gene expression screening for specific genes
associated with mouse mammary tumor development. Molecular Carcinogenesis
8, 123–126.
Index
Acaulospora 113 Anastomosis group (AG) 66, 140

Acaulosporaceae 118 see also Rhizoctonia solani
Acremonium 133 Antibodies 28, 267, 268, 279, 290, 313
A. chrysogenum 195, 197, 199 AP-PCR
A. alabamense 133 see Arbitrarily primed PCR
Actin genes 129–130 Arabidopsis 331
Aflatoxin 244–253, 256 A. thaliana 296
AFLP, see Amplified fragment length Arbitrarily primed PCR 8, 130, 138,
polymorphism 294
Agaricales 139 Arbuscular mycorrhizae 111–115, 118,
Agaricus bisporus 138, 139, 217, 221 119, 120
Agaricus caroli 139 Aristolochen synthase 255–258
Agaricus chionodermus 139 Armillaria 138–139
Agaricus excellens 139 A. borealis 139
Akanthomyces 160–161 A. calvescens 139
Alga 85, 86, 87, 89, 95, 141 A. cepistipes 139
Alternaria 137, 244 A. gemina 139
A. alternata 137 A. lutea 139
A. brassicae 311 A. mellea 138
A. brassicicola 311 A. ostoyae 139
A. padwickii 311 A. sinapina 139
A. triticina 311 A. tabescens 138
Amanita 111 Artenpaare 91
AM fungi, see Arbuscular mycorrhizae Arthoniales 90, 92
Amplified fragment length polymorphism Ascomycota 108, 131, 132, 156
8, 178, 296, 320, 326–327 Ascosphaera 156–157, 176
AmpliTaq 52 A. aggregata 156–157
see also DNA polymerases A. apis 157
347
348 Index
Ascosphaera continued see also Cloning and T/A cloning

A. larvis 156 Bolbitius 139
A. subcuticulata 157 Boletinus 139
Aspergillus 131, 132, 187, 244, 251, 269, Boletus 109, 111
270, 272, 275–278, 332 Botryodiplodia theobromae 311
A. awamori 197–198, 199, 200 Botryodiploidin 254
A. flavus 70, 246, 249–250, Botrytis 311
252–253, 254, 267, 277, 311 B. cinerea 48, 53–59, 162, 311
A. fumigatus 267, 268, 269, Brassica 136
276–277 Bryophytes 87
A. giganteus 276 Burkholderia 118
A. nidulans 159, 188, 197–198, 199, Butyrivibrio fibrisolvens 225
217, 220, 221, 249–250, 252, Byssochlamys 251
277 B. nivea 255
A. niger 187, 188–189, 277
A. nominus 246
A. oryzae 199, 246, 250 Caliciales 90, 135
A. parasiticus 246, 249–250, 252–253 Calluna vulgaris 116
A. restrictus 277 Caloplaca 91
A. sojae 246, 250 Candida 70, 267, 269, 270, 272–274
A. terreus 277 C. albicans 267, 269, 271, 272–275,
A. versicolor 249, 252 280
Attine ants 139 C. glabrata 267, 272–275, 282
Aureobasidium pullulans 227 C. guilliermondii 272–274
C. krusei 267, 271, 272–275
C. parapsilosis 271, 272–275
Barley 295, 298, 309 C. pseudotropicalis 273
Basidiobolus 154 C. stellatoidea 273
B. ranarum 141 C. tropicalis 271, 272–275
Basidiomycete/Basidiomycota 108, 131, Capillary electrophoresis 6
205–234 Capillary PCR 279
Bean 295, 309 Cassette-primer PCR 215
Beauveria 159–163, 177 cDNA, see Complementary DNA
B. amorpha 159–161 Cellulase genes 210, 220–226, 234
B. bassiana 71, 159–162, 178 Cercospora kikuchii 311
B. brongniartii 159–162 Cercospora oryzae 311
B. caledonica 159–161 Ceriporiopsis subvermispora 211, 233
B. velata 159–160 Chaetomium 249
B. vermiconia 159–161 Chaetothyriales 136
Beet 309 Chelating agents 27
Bipolaris 249 Chitin synthase genes 69, 130, 274, 330
B. oryzae 311, 314–316, 317, 318 Chromosome walking 296
B. sorokiniana 311 Chrysosporium lignosum 211
Bjerkandera adusta 211 Chymosin 197–198, 200
Blastocladiella emersonii 131 Chytridiomycota 131
Blastomyces dermatitidis 281–282 Chytridium 141
Blastoschizomyces capitatus 275 Cladiaceae 90
Blotting, see Hybridization Cladonia chlorophaea 92–95, 97
Blunt end cloning 36 Cladoniaceae 90
Index 349
Cladosporium fulvum 294, 296 Cylindrocladium floridum 330

Clavibacter michiganensis subsp. Cytochrome P-450 reductase 188
sepedonicus 313, 319
Clavicipitales 132–133
Claviceps purpurea 243 DAF, see DNA amplification
Cloning 13, 21–37, 52, 59, 187–192, fingerprinting
195–196, 198, 220, 226, 291–293, Dam methylation 191
297, 334 see also Escherichia coli
see also Blunt end cloning, T/A DDRT, see Differential display reverse
cloning and Vectors transcriptase PCR
Cluster analysis 75, 158 Denaturing gradient gel
Coccidioides immitis 267, 281–282, 326 electrophoresis 6–7, 13, 234, 295
Cochliobolus carbonum 293 Dendrographa 91
Codon usage 25–26 DENS, see Differential extension with
Coenococcum geophilum 137 nucleotide subsets
Colletotrichum 11, 68, 71, 73, 134, 176 Detection 12, 243–262, 268–282,
C. capsici 311 290–291, 330–331, 339–342
C. gloeosporioides 134 DGGE, see Denaturing gradient gel
C. graminicola 134 electrophoresis
C. lindemuthianum 134, 311 Dievernia 91
C. malvarum 134 Differential display reverse transcriptase
C. orbiculare 134 PCR 14, 47–60, 195–196, 200,
C. sublineolum 134 234, 298, 334–335
C. trifolii 134 Differential expression with nucleotide
C. truncatum 311 subsets 332
Competitive RT–PCR, see Reverse Diplodia maydis 311
transcriptase PCR DNA amplification fingerprinting
Complementary DNA 29–31, 48–52, see also Random amplification
56–59, 181–189, 195–196, 197, polymorphic DNA, Simple
199, 208, 209, 211–217, 222–226, sequence repeats,
227, 230–234, 277, 291, 293, Arbitrarily primed PCR,
297–300, 331, 334–338 Enterobacterial repetitive
see also Library intergenic consensus,
Conidiobolus 154 Repetitive extragenic
C. coronatus 141 palindromic elements,
Coprinus 139 Satellites, Short tandem
Cordyceps 156 repeat and Variable
C. taii 163 non-translated repeat
Coriolus hirsutus 217–221 DNA extraction, general 10, 23, 126,
C. versicolor 211, 221 206–207
Cryphonectria parasitica 60, 217 from clinical samples 270
Cryptococcus 68 from food 252–253
C. neoformans 267, 269, 272, 273, from lichens 87–88
280–281 from soil 207
see also Filobasidiella neoformans DNA polymerases, features 22
Culmorin 259 see also AmpliTaq, Taq, Tth, Pfu,
Cyanobacteria 86–87, 89 Pwo and Vent
Cylindrocarpon destructans 330 Dot blots, see Hybridization
Cylindrocarpon heteronema 68 Dothideales 136
350 Index
Downy mildew 295 Fumonisins 244, 245, 259–260, 261

Drechslera tritici-repentis 311 Fungus–plant interactions 53–57,
107–120, 289–300
Fusarin 259
ECM fungi, see Ectomycorrhizae Fusarium 12, 65, 67, 69, 134, 159, 187,
Ectomycorrhizae 109–111, 118 244, 251, 259, 261, 267
EI-PCR, see Enzymatic inverse PCR F. avenaceum 67, 259
Elaphomyces 137 F. beomiforme 134
Electrophoretic karyotyping 125, 136 F. culmorum 67, 259
see also Pulse field gel F. graminearum 67, 199, 259–260
electrophoresis F. moniliforme 254, 259–260, 311,
Enterobacterial repetitive intergenic 314, 317
consensus 9, 70, 320 F. napiforme 259–260
Entomophaga 154–155 F. nyagamai 259–260
E. aulicae 155 F. oxysporum 67, 71, 72, 135, 190,
E. grylli 154, 178 200, 311
E. maimaiga 154–155 F. oxysporum f.sp. dianthi 70
Entomophthora 154 F. oxysporum f.sp. lycopersici 190
E. muscae 141 F. oxysporum f.sp. melonis 135
Entomophthorales 140–141, 154–156 F. poae 318
Enzymatic inverse PCR 192–193, 200 F. polyphialadicum 134
Epichloë 133 F. proliferatum 259–260
E. typhina 133 F. sambucinum 259
Eremascus 157 F. solani 254
ERIC, see Enterobacterial repetitive Fuscoboletinus 139
intergenic consensus Fumonisin 244, 256
Ericales 119
Erynia 154
E. kondoiensis 156 Gaeumannomyces–Phialophora
E. neoaphidis 154–156 complex 68, 133–134
Eryniopsis 154 G. graminis var. avenae 133
Erysiphales 137 G. graminis var. graminis 133
see also Powdery mildews G. graminis var. tritici 133, 298
Escherichia coli 187–188, 191, 193, 194, Ganoderma 139–140
226, 300 G. lucidum 139–140, 221
EST, see Expressed sequence tag Gaultheria shallon 116
Eurotiales 90 Generally recognized as safe 198,
Eurotium rubrum 132 199–200, 246, 250
Expressed sequence tag 331 Geosiphon pyriforme 141
Geotrichum 251
Gerlachia oryzae 314
Farrowia 249 Gibberella 134
Filobasidiella neoformans, see G. fujikuroi 60, 135
Cryptococcus neoformans Gigaspora margarita 112, 114, 115, 118
Fingerprinting, see DNA amplification Gliocladium 133
fingerprinting and RNA G. penicillioides 133
fingerprinting G. roseum 133
Fomes fomentarius 220 G. virens 133
Fumigaclavin 254 see also Trichoderma
Index 351
Gliomastix 133 108, 109–111, 113–115, 116, 126,

Gloeophyllum trabeum 220–221 129, 130, 132–141, 156, 157, 158,
Glomales 111–112, 141 160–162, 165–178, 211, 258–259,
Glomus 154 262271, 280, 281, 320
G. coronatum 113, 114–115 heterogeneity in ITS 73, 95–96, 115
G. dimorphicum 115 see also Intergenic spacer and
G. etunicatum 141 Ribosomal RNA gene
G. flavisporum 114 cluster
G. intraradices 112 Intron 73, 92–96, 97–98, 100, 116–117,
G. mosseae 70, 113–115, 298 135–136, 137–138, 159, 163, 187,
G. versiforme 114 195, 234
G. vesiculiferum 112 Inverse PCR 32–33, 189, 192–193, 197,
Gomphidius 109 200, 207, 210, 326
GRAS, see Generally recognized as safe IPCR, see Inverse PCR
Gremmeniella 68 In situ PCR 9, 291, 338
Groundnut 309 Inter-repeat PCR 9, 273
ITS, see Internal transcribed spacer
ITS heterogeneity, see Internal
Herbarium specimens 23, 89, 126 transcribed spacer
Hot start-PCR 5, 27
Histoplasma capsulatum 267, 281–282
HIV 267, 280–281 Laccaria bicolor 110–111
Hybridization, DNA/DNA 85, 125 Laccase genes 215–220, 234
dot blot 161, 197, 255, 260, 261 Lactarius 111
in situ 208 LA–PCR, see Long accurate PCR
Northern 47, 52, 57–59, 195, 208, Large subunit, see Ribosomal RNA gene
222, 227, 293, 298 cluster
Southern 47, 52, 57, 97, 111, 115, Larix 139
222, 225, 227, 230, 271, Lasallia 85, 91
273–274, 277, 279, 327 Lauderlindsaya borreri 91
subtractive 299–300 Lecanorales 90, 95–96, 135
Hymenoscyphus ericae 116–117 Lecanora dispersa 92
Hyphochytridium catenoides 131 Lecanora muralis 94
Hypocreaceae 133 Lentinula 176
Hypocreales 132–133 L. edlodes (syn. Lentinus
edlodes) 138, 221
Lentinus lateritia 138
IGS, see Intergenic spacer Lentinus novaezelandiae 138
Immunosuppression 267, 269, 277, Lentinus tigrinus 221
279–280 Leotiaceae 136
Insertion elements 90, 92–95, 97, 100, Leotiales 135
136 Leptosphaeria maculans 68, 136–137,
Intergenic spacer 11, 65–69, 108, 129, 290
130, 135, 138, 276 Lettuce 295
see also Internal transcribed spacer Library 21, 210, 215, 222–225, 227, 293,
and Ribosomal RNA gene 299, 334
cluster see also Complementary DNA
Internal transcribed spacer 11, 12, Lichenicolous fungi 87–88, 91
65–69, 71, 72, 89, 91, 97–98, 101, Ligase chain reaction 9–10, 321
352 Index
Ligation-mediated PCR 33 Muskmelon 295

Lignin 205–234 Mutagenesis 192–195
Lignin peroxidase gene 208–214, Mycobacterium tuberculosis 278
227–234 Mycocaliciaceae 90
Listeria monocytogenes 252–253 Mycoinsecticide 154, 165
Loculoascomycetes 137 Mycophenolic acid 254
Long accurate PCR 31 Mycotoxin 199, 200, 243–262
Long PCR 327–329
NASBA, see Nucleic acid sequence-

M13 phage 70, 277, 298 based amplification
Magnaporthe grisea 133, 327–329 Nectria 134, 156
Magnaporthe poae 68 Nectrioidea 133
Maize 309 Neocallimastix 141
Marcfortines 254 Neolentinus 138
Massospora 154 Neosartorya fischeri 132
Messenger RNA 14, 29–30, 34, 48–52, Neozygites 154
55–60, 126, 188, 189, 199, Nephroma 91
208–209, 222–226, 233, 297, 298, Nested PCR 7, 32, 271, 80, 281, 318, 320
300, 334 Neurospora 187, 332
Metarhizium 70, 133, 154, 157, 159, N. crassa 159, 217, 220, 221
163–178 Niebla 91
M. album 163, 168–178 Normandina pulchella 91
M. anisopliae 161, 163–178 Northern blot, see Hybridization
M. anisopliae var. frigidum 164–178 Nucleic acid sequence-based
M. anisopliae var. majus 163–178 amplification 9–10
M. cylindrosporae 163
M. flavoviride 160, 163–178
M. flavoviride var. minus 160, Ochratoxin A 243, 244, 256
163–178 Oidiodendron maius 116–117
M. guizhouense 163 Omphalina 91, 176
M. pingshaeme 163 Onygenales 90, 132
M. taii 163 Oomycetes 67–68, 141–142
Microdochium nivale 290 Ophiostoma 71, 134
Microhilum oncoperae 162 Ophiosphaerella herpotricha 68
Mitochondrial DNA 11, 73, 109, 129, O. korrae 68
135, 136–137, 140, 159, 195–196, Ordination 75
273, 279–280, 314, 327 Orygia vetusta 155
Moniliformin 259 Overlap PCR 194, 200
Monocillium 249
mRNA, see Messenger RNA
mtDNA, see Mitochondrial DNA Paecilomyces 132, 158
Monascus purpureus 132 P. amoenoroseus 158
Mucor 141, 154 P. farinosus 158
Multiclavula mucida 89 P. fumosoroseus 158–159
Multilocus genotyping, see Arbitrarily P. lilacinus 158–159
primed PCR P. varioti 277
Multiplex PCR 246–251, 257, 318–319, Panus 138
321 Paracoccidioides brasiliensis 267, 281
Index 353
Parmelia 95 P. citropathora 141

P. saxatilis 97–98, 99 P. clandestina 142
P. sulcata 97, 100 P. idaei 142
Parsimony 95–97, 128, 136, 154, P. infestans 56–57, 296
169–171 P. iranica 142
see also Cluster analysis and P. macrochlamydospora 142
Phylogenetic trees P. medicaginis 142
Patulin 244, 245, 254 P. megakarya 141
Pea 295 P. megasperma 131, 142
Peltigera 91 P. palmivora 141
Penicillin V amidase gene 190–191, P. pseudotsugae 142
200 P. sojae 142
Penicillium 11, 68, 131, 132, 244, 251 P. trifolii 142
P. camemberti 255 Plectomycetes 137
P. carneum 254 Pleospora herbarum 137
P. chrysogenum 195, 199, 277 Pleosporales 136
P. digitatum 254 Pleurotus ostreatus 211–215, 220, 221
P. italicum 251 Plicaria 136
P. marneffei 277 Pneumocystis carinii 72, 138, 267, 272,
P. nalgiovense 256 278–280, 282
P. paneum 254 Podospora anserina 159
P. patulum 245 Poly(A) tails 29–20, 48–52, 189, 195,
P. roqueforti 251, 253–258 215, 217, 226, 293, 297, 338
Penitrem A 244, 254 see also Messenger RNA
Peziza 136 Polyacrylamide gels 6, 51–52, 272, 273,
Pezizales 135–136 296, 298, 327, 335
PFGE, see Pulse field gel Polyporaceae 138
electrophoresis Polysaccharides 87, 89, 206
Pfu 23, 24, 28, 31, 36, 217 Pooideae 133
see also DNA polymerases Potato 296, 298, 300, 311
Phaeosphaeria 137 Powdery mildew 126, 137, 295, 311
Phialophora 133 Pr1 gene 164, 178
Phanerochaete chrysosporium 205, PR toxin 244, 245, 253–258
210–215, 221–225, 227–230, Primer-dimer 4, 24
231–233, 234 Primers 2, 4, 5, 9, 10, 23, 24, 28, 87, 165,
P. sordida 211 168, 193–194, 209, 210, 217, 259,
Phlebia brevispora 221 295, 297, 298, 300, 331, 332
P. radiata 221 anchored 48–52, 56, 58, 298
Phoma glumarum 311 degenerate 13, 24, 31, 32, 188–189,
Phomopsis 317 332
Phylogenetic trees 90–95, 127–128, extended 51
168–172 labelled 6, 339–341
see also Cluster analysis and melting point 28
Parsimony nested 32
Physconia 95, 97 specific 2, 4, 12, 29, 51, 65–70, 88,
Phytophthora 11, 68, 141–142 89–90, 100, 109, 111, 113,
P. cactorum 142 119, 126, 189, 192, 222, 225,
P. capsici 141 226, 227–230, 231–233, 234,
P. cinnamomi 70, 141–142 253, 255, 256, 268, 269,
354 Index
Primers, specific continued Ramalinopsis 91

273–275, 277, 280, 281, 296, Ramp-PCR 31
314, 320 Random amplification of cDNA
Probes 65, 67, 70, 110, 188, 210, 230, ends 29–31, 189, 215, 226, 293
233, 245, 248, 259–260, 271, Random amplification of polymorphic
273–275, 281, 297, 300 DNA 8, 11–12, 13, 63, 69–70,
Protomyces 132 72, 74, 75, 98, 107, 113, 117, 119,
P. inouyei 137 130, 136, 138, 139–140, 155–156,
P. lactucae–debilis 131 157–158, 159–162, 164, 165–178,
P. macrosporus 311 245, 259–261, 294–295, 313,
Proofreading 23, 327 314–316, 326
see also DNA polymerases see also DNA amplification
Proteins 24, 125, 128, 129–130, 178, fingerprinting
187, 188, 189, 190, 197–201, RAPD, see Random amplification of
294 polymorphic DNA
Protein disulphide isomerase 189 RAP-PCR, see RNA arbitrarily primed
Pseudallescheria boydii 272 PCR
Pseudocercosporella herpotrichoides rDNA, see Ribosomal RNA gene
68 cluster
Pseudocyphellaria 99 Recombination PCR 194, 200
Pseudomonas syringae 296, 318 REP 9, 70, 165–178, 320, 327–329
Pseudotsuga 139 Repetitive extragenic palindromic
Puccinia 140 elements, see REP
P. coronata 140 Representational difference analysis
P. graminis 67, 140 299
P. recondita 140 Restriction fragment length
Pulse field gel electrophoresis 296, 313 polymorphisms 7, 13, 65, 66–67,
see also Electrophoretic 72, 75, 108, 110, 111, 113, 117,
karyotyping 119, 125, 130, 134, 136, 138–141,
Pwo 327 155, 157, 160–162, 164, 294, 313,
see also DNA polymerases 320, 325, 327–329
Pyrenomycetes 137 Reverse transcriptase PCR
Pyrenophora 317 competitive 207, 209, 230–231,
Pyricularia oryzae 311, 314 234
Pythium 68, 141 general 7, 9, 29, 95, 195–196, 200,
P. heterothallicum 141 207, 208–209, 215–217,
P. splendens 141 222–225, 231–234, 293, 326,
P. sylvaticum 141 330
P. ultimum 67–68 see also Differential display reverse
transcriptase PCR
RFLP, see Restriction fragment length
Q-beta replicase (Qβ) 9 polymorphisms
Quantitative PCR 7, 290 Rhizoctonia 65–66
R. oryzae 66
R. solani 66 , 70, 140, 217, 220,
RACE, see Random amplification of 314
cDNA ends Rhizomucor miehei 199
Ramalina americana 98 Rhizopogon 109
Ramalinaceae 91 Rhizopus arrhizus 267, 272
Index 355
Ribosomal DNA, see Ribosomal RNA Scytalidium vaccinii 116

gene cluster SDA, see Strand displacement
Ribosomal RNA gene cluster 10–11, 12, amplification
63, 64–69, 71, 72–73, 74, 87, 89, Seedborne diseases 309–321
90–91, 92–96, 97, 99–100, 101, Sequence characterized amplified
108, 109–111, 112–113, 118, regions 12–13, 294–295
119, 126, 129, 130–142, 154–155, Shiitake 138
157, 159–161, 164, 245, 253, see also Lentinula
258–260, 269, 271, 273–275, Sequence tagged site (STS) 331
276–277, 279–280, 313, 320, 327, Short tandem repeat (STR) 331
330 Similarity coefficients 74
see also Intergenic spacer and Single-strand conformation
Internal transcribed spacer polymorphism 6–7, 13, 112,
Rice (Oryza sativa) 309, 318 271–272
RNA arbitrarily primed PCR 299 Siphulaceae 90
RNA extraction 206–207 Small subunit, see Ribosomal RNA gene
RNA fingerprinting 298–299 cluster
see also Differential display reverse Smittium 154
transcriptase PCR S. culisetae 140–141
Root 107, 109, 111, 116, 118–120, 298, Solorina 90–91
300 Sordariales 133
Rottboellia 134 Sorghum 309
RT–PCR, see Reverse transcriptase PCR Southern blot, see Hybridization
Russula amoenolens 110 Soybean 309
R. xerampelina 110 Species concepts 64
Rusts 140, 295 Sphaerophoraceae 90
Sphinctrinaceae 90
Spicellum roseum 133
Saccharomyces cerevisiae 187, 199, 225, Spizellomyces 141
273, 275, 280 Splicing by overlap extension (PCR-
Saitoella complicata 131 SOE) 326
Salmonella typhimurium 300 Sporothrix schenckii 71
Sarocladium oryzae 314–315, 317, 318, SSCP, see Single-strand conformation
321 polymorphism
Sarcoscypha 136 Simple sequence repeats (SSR) 296
Satellites see also DNA amplification
micro- 9, 70, 108, 114, 119, 178, 296 fingerprinting
mini- 9, 108 Stabilization, PCR reaction 27
see also DNA amplification Stenocarpella maydis 317
fingerprinting Stereocaulaceae 90
SCAR, see Sequence characterized Sterigmatocystin 245, 246–247, 252
amplified regions Sticta 99
Schizophyllum commune 226 Strand displacement amplification 9
Schizosaccharomyces pombe 188 Strongwellsea 154
Sclerotinia 68, 71 Subtractive hybridization, see
Sclerotiniaceae 136 Hybridization
Sclerotium 71 Sugar 309
Scutellospora 113 Suillus 109–110, 139
S. castanea 115 S. granulatus 139
356 Index
Suillus continued Tth 7, 29

S. grevillei 139 see also DNA polymerases
S. pungens 110 Tuber 68
Suppression PCR 334–338 T. aestivum 112
T. borchii 112
T. brumale 112
β-Tubulin gene 53–54, 69, 129–130, 135, T. excavatum 112
197, 233 T. ferrugineum 112
T2 toxin 243 T. maculatum 112
T/A cloning 35–36 T. magnatum 70, 112
see also Cloning T. melanosporum 112
Talaromyces bacillisporus 132 T. rufum 112
T. flavus var. macrosporus 132 Tylospora fibrillosa 110
Taphrina 132 Tyrosinase gene 340
T. populina 131
T. wiesneri 131
Taq 2, 5, 7, 8, 28, 31, 36, 127, 194, 206, Umbilicaria 85, 91
226, 252, 327, 342 U. cylindrica 99
see also DNA polymerases Ustilaginales 138
Telomere fingerprinting 162 Ustilaginoidea virens 311
Teloschistaceae 91 Ustilago maydis 138, 311
Template 1, 2, 5, 7, 10, 48–49, 196, Usnea 89
197, 208, 209, 210, 211, 222, 234,
341
Tetrahymena thermophila 96 Variable non-translated repeats 296,
Thermus aquaticus 2 314, 317
Thlaspi 136 see also DNA amplification
Tilletia indica 314, 319, 342 fingerprinting
T. laevis 311 Vector 189–195, 196, 198, 200, 226,
T. tritici 311 293
Tobacco necrosis virus 56 see also Cloning
Tolypocladium 159 Vent 24, 28
Tomato (Lycopersicon) 48, 53–59, 294, see also DNA polymerases
296, 298, 300, 334 Verticillium 65–67, 290–291
Torrubiella 156 V. albo-atrum 65, 67, 158
Touchdown-PCR 5 V. chlamydosporium 67
Trametes versicolor 221 V. dahliae 65, 67, 158
T. villosa 217, 221 V. lecanii 158
Transfer RNA (tRNA) 158–159 V. tricorpus 66
Trichocomaceae 132 VNTR, see Variable non-translated
Trichoderma 70, 327 repeats
T. reesei 221–222 Volvariella volvacea 138
T. virens 133
see also Gliocladium
Trichosporon beigelii 267 Wheat 295, 309, 311, 318
Trichothecens 245, 256, 259
Trichothecium roseum 133
Truffles 111, 136 Xanthomonas axonopodis pv. citri
see also Tuber 318–819
Index 357
Xanthomonas axonopodis continued Zearalenone 259

X. oryzae pv. oryzae 312, 319, 320 Zoophthora 154
Xanthoria 91 Z. phytonomi 156
Xylanase genes 210, 226–230, 234 Z. radicans 141, 154–156
Xylariales 132 Zygomycota 107, 131

P. D. Bridge, D. K. Arora, C. A. Reddy, R. P. Elander - Applications of PCR in Mycology (1998, CABI) PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

P. D. Bridge, D. K. Arora, C. A. Reddy, R. P. Elander - Applications of PCR in Mycology (1998, CABI) PDF

Uploaded by

Copyright:

Available Formats

APPLICATIONS OF PCR IN MYCOLOGY

Applications of PCR in Mycology

Tel: +44 (0)1491 832111 Tel: +1 212 726 6490

© CAB INTERNATIONAL 1998. All rights reserved. No

Library of Congress Cataloging-in-Publication Data

ISBN 0 85199 233 1

Typeset in 10/12pt Garamond by Solidus (Bristol) Ltd.

1. Polymerase Chain Reaction in Mycology: an Overview 1

2. Gene Cloning Using PCR 21

3. DDRT–PCR for Screening of Fungal Gene Expression 47

4. Interpretation of PCR Methods for Species Definition 63

5. PCR Applications in Studies of Lichen-forming Fungi 85

6. Applications of PCR for Studying the Biodiversity of

7. PCR Applications in Fungal Phylogeny 125

8. PCR Applications to the Taxonomy of Entomopathogenic

9. Application of PCR in Fungal Biotechnology 187

10. Application of PCR in Studying Lignocellulose Degradation

11. PCR Methods for the Detection of Mycotoxin-producing Fungi 243

12. PCR Diagnostics in Medical Mycology 267

13. Applications of PCR in Fungal–Plant Interactions 289

14. PCR as a Tool for the Investigation of Seed-borne Disease 309

15. Future Directions for PCR in Mycology 325

J.F. Antoniw, Crop and Disease Management Department, Institute for

F. Driver, CSIRO Division of Entomology, GPO Box 1700, Canberra, ACT

Ecology, Michigan State University, East Lansing, MI 48824-1101, USA

PCR in explaining fungal speciation in a more definitive manner. Chapters

6-APA 6-aminopenicillanic acid

STR short tandem repeat

1.1 Overview of PCR Methods

The polymerase chain reaction (PCR) is a powerful method with widespread

1.2 PCR: the Standard Method

1.2.1 Principles of PCR

1.2.2 PCR reaction components and conditions

Fig. 1.1. Principle of PCR amplification.

Template DNA 10–100 ng

(Filichkin and Gelvin, 1992) or by using particular experimental conditions

1.2.3 Practical considerations in PCR experiments

reference template DNA known to amplify) as false-negative amplifications

1.2.4 Analysis of PCR products

contrast to DGGE, SSCP analysis is performed in a polyacrylamide gel

1.3 PCR-derived Methods

1.3.1 Reverse transcription–PCR (RT–PCR)

1.3.2 Random PCR and other PCR fingerprinting methods

In contrast to ‘classical’ PCR, random PCR approaches do not require any

1.3.3 In situ PCR

1.4 PCR Alternatives

procedures can be found in Winn-Deen (1996). These can be used instead of

1.5 Applications of PCR in Mycology

1.5.1 Starting PCR with fungi

1.5.2 Taxonomy and characterization of fungi with PCR

variable and conserved regions, allowing the comparison and discrimination

1.5.3 PCR in the detection of fungi

from species-specific SCARs derived from RAPDs (Parry and Nicholson,

1.5.4 Genetic analysis and gene manipulations with PCR

Analysis of gene expression, and detection and quantification of RNA

PCR procedures, from the standard method to its modifications and

Anderson, J.B. and Stasovski, E. (1992) Molecular phylogeny of northern hemisphere

fingerprinting for the detection of genetic variation in fungi. Mycological

Rao, V.B. (1994) Direct sequencing of polymerase chain reaction-amplified DNA.

sequences in eubacteria and application to fingerprinting of bacterial genomes.

2.2 Tools Required

2.2.1 Available DNA polymerases

Table 2.1. Features of thermostable DNA polymerases.a,b