Journal of Clinical Virology 24 (2002) 79 – 84

www.elsevier.com/locate/jcv

Polymerase chain reaction for laboratory diagnosis of orf

virus infections
Einar G. Torfason *, Sigrún Guðnadóttir
Department of Medical Virology, Landspı́tali-Uni6ersity Hospital, PO Box 8733, IS-128 Reykja6ik, Iceland

Received 16 April 2001; accepted 31 August 2001

Abstract

Background: The orf virus of sheep and goats is one of several zoonotic parapoxviruses. In the ovine/caprine host
it causes contagious ecthyma (contagious pustular dermatitis, scabby mouth), but in humans it normally causes
solitary or clustered orf lesions, typically on hands, arms or face. In addition to disease in the animals, the virus can
be quite a nuisance as an occupational hazard in farmers and butchers. Clinical diagnosis is often possible, but
laboratory diagnosis is sometimes necessary. For virus isolation, primary ovine or bovine cells, not routinely present,
are needed. Serological methods exist, but electron microscopy is the most commonly used method. Objecti6es: To
develop a reliable method for the laboratory diagnosis of orf zoonoses, without virus culture and without access to
an electron microscope. Study design: A suitable primer pair was designed for orf polymerase chain reaction (PCR),
using the Oligo software and sequence information from GenBank. Orf positive controls and specimens were kindly
provided by several public health centers. Molluscum contagiosum specimens were provided by a dermatologist.
HSV-1, HSV-2 and VZV positive swab specimens came from our routine diagnostic service. Asymptomatic skin
specimens were obtained from sheep heads from the abattoir, and swab specimens from the heads of asymptomatic
sheep. Selected amplified orf PCR positive specimens were sequenced to ensure the authenticity of the PCR products.
Orf positive specimens were sent to another laboratory for electron microscopy. Results and conclusions: A robust
PCR was developed, with very small inter-run variation. All specificity demands were met, and the sensitivity seems
to be good or excellent. All negative specificity controls from cell cultures and non-orf viruses were negative.
Twenty-two (95.7%) of 23 scab or swab specimens with suspected orf etiology were orf PCR positive. Five of eight
skin specimens from sheep heads from the abattoir were positive, and all 11 swab specimens from asymptomatic sheep
were negative. Electron microscopy demonstrated orf-like particles in orf-PCR positive specimens. This PCR seems
to be suitable as a diagnostic test for orf in humans, but asymptomatic virus shedding in sheep or goats may
complicate veterinary applications of the assay. © 2002 Elsevier Science B.V. All rights reserved.

Keywords: Contagious ecthyma; Contagious pustular dermatitis; Parapoxvirus; Scabby mouth; Zoonosis

1. Introduction
* Corresponding author. Tel.: + 354-560-2400; fax: + 354-
560-2406. The orf virus is the type species of the para-
E-mail address: einarg@landspitali.is (E.G. Torfason). pox6irus genus. It is the causal agent of conta-

1386-6532/02/$ - see front matter © 2002 Elsevier Science B.V. All rights reserved.
PII: S 1 3 8 6 - 6 5 3 2 ( 0 1 ) 0 0 2 3 2 - 3
80 E.G. Torfason, S. Guðnadóttir / Journal of Clinical Virology 24 (2002) 79–84
gious ecthyma (contagious pustular dermatitis,
scabby mouth) in sheep and goats worldwide
(Fenner, 1996; Murphy et al., 1999). The orf virus
can also infect other ruminants, as well as hu-
mans. Other zoonotic parapoxviruses are pseudo-
cowpox virus (paravaccinia, milker’s nodule) and
bovine papular stomatitis virus in cattle, ausdyk
virus in camels, and seal parapox virus in grey
seals (Fenner, 1996; Murphy et al., 1999).
Zoonotic parapoxviruses in Finnish and Norwe-
gian reindeer and Norwegian musk ox have been
reported (Büttner et al., 1995; Falk, 1978). Para-
poxviruses have also been found in chamois an-
telopes, red deer and squirrels (Fenner, 1996;
Murphy et al., 1999; Haig et al., in press).
The virus particles are ovoid, 260 by 160 nm,
containing : 135 kbp linear dsDNA with closed
hairpin loop ends (Moss, 1996). Genes are located
on both strands with left and right orientation.
Variation is greatest near the termini, but essential
genes are located in the conserved central part of
the genome. The viral DNA and RNA poly-
merases are eucaryotic-like. At least eight genes
encode the viral RNA polymerase complex. Infec-
tivity is resistant to organic solvents and desicca-
tion but is destroyed by heating to 58– 60 °C for
30 min (Fenner, 1996; Moss, 1996).
In sheep and goats the lesions commonly ap-
pear on the muzzle and lips (scabby mouth),
sometimes also affecting the gums and tongue,
especially in young lambs. Eyelids, feet and teats
can also be affected (Murphy et al., 1999). Severe
facial and oral lesions in lambs may interfere with
suckling. Ewes suckling infected lambs may de-
velop lesions on their udders (Fenner, 1996). Re-
infection, chronic infections, and virus remaining
viable in scabs shed by infected animals make the
virus difficult to eradicate from flocks, but vacci-
nation of ewes with commercial non-attenuated
virus several weeks before lambing can minimize
the risk of orf in young lambs (Baxby, 1998;
Murphy et al., 1999).
Zoonosis occurs most frequently during lamb-
ing, shearing, docking, drenching or slaughtering
(Murphy et al., 1999). Infection occurs through
abrasions in the skin. Lesions in humans proceed
from macular through papular to large nodules,
sometimes papillomatous, following an incuba-
tion period of 2–4 days (Murphy et al., 1999).
The lesions are most often localized on hands,
arms or face. Solitary lesions are more frequent
than multiple lesions. Duration is from 4 to 9
weeks (Murphy et al., 1999), usually 6– 7 weeks
(Buchan, 1996). Healing is complete without
scars, but secondary infections may retard heal-
ing. Fever, swelling of the draining lymph nodes
or blindness following an eye infection are seen
only rarely. Erythema multiforme, toxic erythema
or allergic reaction, as well as blisters on arms,
body, face or mouth in association with orf have
been reported in at least one study (Buchan,
1996). Reinfection in humans is frequent (Buchan,
1996; Murphy et al., 1999), but usually less severe
(Haig et al., in press).
The purpose of the present study was to de-
velop a reliable method for the laboratory diagno-
sis of orf zoonoses. Orf in humans can resemble
or coincide with herpes or papilloma and possibly
other infections. Several specimens are sent to our
laboratory each year with requests for orf diag-
nostics. Electron microscopy is widely used for
diagnosis of ‘orf/paravaccinia’ (Baxby, 1998;
Murphy et al., 1999), but we do not have access
to an electron microscope. Until now, virus isola-
tion under suboptimal conditions has been the
sole available method in our laboratory. Appro-
priate primary cell cultures for orf isolation are
not routinely available, and virus isolation at-
tempts have therefore aimed at excluding other
viruses, rather than isolating the orf agent itself.
Therefore, we decided to develop polymerase
chain reaction (PCR) for the laboratory diagnosis
of orf infections. We decided to design a new
assay from orf sequence information and aim at
sufficient sensitivity for original specimens, with-
out any need for tissue culture enhancement.
One of the obstacles we had to encounter was
the lack of positive reference material, because we
had never isolated the virus, and attempts to
acquire orf strains from abroad have not met with
success. Therefore, we sent a circular to rural
public health centers in Iceland, requesting viral
culture specimens from lesions with the clinical
diagnosis of orf. This elicited a good response and
we got some orf positive specimens to start with.
 E.G. Torfason, S. Guðnadóttir / Journal of Clinical Virology 24 (2002) 79–84
2. Materials and methods
2.1. Primer design
Orf sequence information was downloaded
from GenBank. A 5261 bp sequence denominated
‘ORF-RPA’ (Accession number U33419), which
is similar to the A24R gene of vaccinia (U30342,
Mercer et al., 1995) was selected as a suitable
target. This gene encodes RPO132, a major com-
ponent of the viral RNA polymerase (Moss,
1996). The following primers flanking a 140 bp
sequence (including the primers) at position 985–
1125 were selected with the Oligo software.
Orf1: cgcagacgtggctgagtacgt
Orf2: tgagctggttggcgctgtcct
2.2. Specimens and controls
The present study included the following
specimens.)\
“ Twenty-three scab or swab specimens from 21
humans and one sheep with suspected orf.
“ Two human serum specimens where orf was
suspected.
“ Three biopsies and one swab from three indi-
viduals with molluscum contagiosum.
“ Three HSV-1 positive, two HSV-2 positive and
two VZV positive swab specimens from seven
individuals with lesions caused by these
herpesviruses.
“ Eight :0.5 cm2 healthy skin specimens from
the area around the horn base of five sheep
heads that another research group had ob-
tained from the abattoir.
“ Five of these came from farms in the mid-south
part of the country, and three from the south-
west area.
“ Eleven swab specimens from the horn area of
the skin of ten asymptomatic sheep at a small
hobby farm in the southwest part of Iceland.
Positive controls were prepared from specimens
with solid clinical evidence of orf and positive orf
PCR where the PCR product had been sequenced
to demonstrate orf specificity.
Negative specificity controls were prepared
81
from non-infected human, simian and ovine cell
cultures, as well as from an untyped human aden-
ovirus, herpes simplex type 1 and 2 viruses, vari-
cella-zoster virus, human cytomegalovirus, human
papilloma type 18 virus and Coxsackie B4 virus.
Non-orf parapoxviruses were not available in our
laboratory.
2.3. Preparation of specimens for PCR
The specimens were extracted with phe-
nol:chloroform:isoamyl alcohol (25:24:1), precipi-
tated with sodium acetate and isopropanol,
washed with 70% ethanol, and resuspended in 100
ml of lysis buffer (10 mM Tris pH 8.3, 50 mM
KCl, 2.5 mM MgCl2, 1 mg/ml gelatin, 0.45%
NP40, 0.45% Tween 20).
2.4. Composition of PCR reaction mixture
PCR Buffer II 50 mM KCl, 10 mM Tris–HCl,
pH 8.3
MgCl2 2.5 mM
dNTPs 200 mM each
Primers 0.5 mM each
AmpliTaq 2.5 units in each 100 ml
Gold reaction
Of each specimen, 25 ml dissolved in lysis buffer
or tenfold dilutions of this in water were added to
75 ml of a master mix. Reaction volume was 100
ml in thin-walled 0.2 ml tubes.
2.5. Cycling profile
A hot-start, two temperature cycling profile was
designed as follows in a PE9600 cycler.
One cycle of 94 °C for 12 min (‘Gold’ enzyme
activation).
Forty cycles of 94 °C for 30 s and 68 °C for 45 s.
One cycle of 65 °C for 3 min.
Final soaking at 4 °C.
2.6. Electrophoresis
Polyacrylamide gel electrophoresis was per-
formed in 4–20% gradient minigels (Mighty Small
82 E.G. Torfason, S. Guðnadóttir / Journal of Clinical Virology 24 (2002) 79–84

II, Hoefer) of acrylamide:bis-acrylamide, ratio 3. Results

29:1. Twenty-five microliter of 5× gel loading
buffer (2.5× TBE, 0.1% bromophenol blue, 20%
sucrose) were mixed with 100 ml of each amplified
specimen. Of this, 15 ml were loaded on 15-well
0.75 mm gels and run at 300 V in TBE buffer,
stained with ethidium bromide, and photographed
over UV-light at 300 nm. The presence of a 140
bp band was recorded as positive results.
2.7. Sequencing
Eight amplified specimens from seven humans
and one sheep were sent to CyberGene AB, Hud-
dinge, Sweden, for dye terminator sequencing of
both strands on an ABI PRISM 377 sequencer.
This was done to demonstrate the specificity of
the amplification, because none of the positive
controls had been confirmed as orf by laboratory
tests. The specimens represented different districts
in Iceland, separated for decades with fences to
prevent spread of ovine diseases. This was done to
see if there is any strain variation within this
relatively short sequence.
2.8. Electron microscopy
One orf-PCR positive original specimen
and one orf-inoculated cell culture specimen were
sent to another laboratory for electron mi-
croscopy.
A first trial run of the orf PCR with standard
AmpliTaq polymerase under conditions otherwise
as specified in Section 2 yielded relatively faint
bands at 140 bp with orf positive specimens, and
a considerable amount of non-specific products
and artefacts. In contrast, when AmpliTaq Gold
polymerase was substituted for the normal Ampli-
Taq enzyme, the 140 bp bands became sharp and
intensive, and the background and primer arte-
facts in the gel became minimal.
The 140 bp amplicon was obtained only with
the positive specimens and controls (Fig. 1).
Twenty-two (95.7%) of 23 scab or swab specimens
where orf was suspected were orf PCR positive,
and one scab specimen submitted as ‘probably
orf’ was negative. The two human serum speci-
mens were both orf PCR negative. The four mol-
luscum contagiosum specimens and the seven
swab specimens from HSV-1, HSV-2 and VZV
lesions were all negative. All five skin specimens
from sheep heads from the mid-south region were
orf PCR positive, two of them low-positive. In
contrast, all three sheep skin specimens from the
southwest region were negative. All 11 swab spec-
imens from asymptomatic sheep in the southwest
region were negative.
The negative specificity controls prepared from
non-infected cell cultures and non-orf viruses were
all orf PCR negative. Sequencing of eight of the

Fig. 1. Polyacrylamide gel electrophoresis of orf PCR positive and negative specimens and controls. Lane 1: marker (pBR322 Hae
III digest), lanes 2 –6: orf positive human specimens, lane 7: herpes simplex type 1 virus, lane 8: varicella-zoster virus, lane 9:
Coxsackie B4 virus, lane 10: human papilloma virus type 18, lane 11: herpes simplex type 2 virus, lanes 12 – 13: orf positive sheep
skin specimens, lane 14: negative control (lysis buffer, no template), and lane 15: positive control.
 E.G. Torfason, S. Guðnadóttir / Journal of Clinical Virology 24 (2002) 79–84 83

Fig. 2. Sequence comparison of GenBank sequence U33419 and eight amplified orf positive specimens. Primer sequences are shown
in boldface.

amplified positive specimens (Fig. 2) demonstrated was collected, there was one lesion, described as
that the amplicons were almost identical to the ‘abscess like’, that had been unsuccessfully culti-
original sequence in GenBank, validating these vated and treated for bacteria. Differential diagno-
specimens as positive controls. Geographical isola- sis for herpes vs. orf was requested. When the
tion of flocks of sheep for decades did not produce second specimen was collected, a second lesion had
variation in this particular sequence. Electron mi- developed on the same finger after surgical inter-
croscopy (Fig. 3) demonstrated the presence of vention. It is unclear whether the surgical interven-
‘brick shaped’ particles, :140 ×88 nm, pre- tion may have complicated the course and the
sumably naked orf virus particles. duration of the clinical infection, which according
to textbooks does normally not exceed 9 weeks
(Murphy et al., 1999).
4. Discussion One of the orf-PCR positive specimens was from
a garbage disposal worker with orf-like lesions on
Our orf PCR seems to be quite sensitive, and we fingers and the scalp. He had not been in any
have seen only minimal inter-run variation. Read- contact with sheep, but he had been working with
ing of results is easy, because the background is garbage containers from an abattoir. One week
negligible around the size (140 bp) of the orf later his fiancée developed an orf PCR positive
amplicon. Molluscum contagiosum, a common lesion on one of her thumbs. She had not either
poxviral infection in humans, does not react in this
been in any contact with sheep.
PCR. Therefore, this PCR seems suitable for labo-
ratory diagnosis of orf in humans.
The negative results with two human serum
specimens is consistent with the fact that orf lesions
are normally singular or as a localized cluster. This
may indicate that viremia is rare. The five positive
skin specimens from sheep heads indicate that orf
may be present in considerable amounts where
sheep are around. There were absolutely no visible
lesions on any of the sheep heads. Therefore, the
origin of the virus particles is uncertain, but virus
contamination from other individuals in the herd
seems likely. This should be kept in mind if this
PCR is used for laboratory diagnosis of orf in
animals, and also in humans shortly after exposure
to environment where sheep or goats are present.
In one human an infection of a little finger
seemed to persist for at least 14 weeks, and swab
specimens collected at 3 weeks and 14 weeks after
the onset of symptoms were both orf PCR positive, Fig. 3. Composite picture of four electron micrographs of
see lanes 4 and 5 in Fig. 1. When the first specimen orf-like particles seen in orf-PCR positive specimens.
84 E.G. Torfason, S. Guðnadóttir / Journal of Clinical Virology 24 (2002) 79–84
Acknowledgements
We thank the doctors and other medical profes-
sionals at various medical centers, who responded
so well to our requests for positive orf controls.
We also thank Dr Arthur Löve for his share in
our requests for the orf controls, and professor
emeritus Margrét Gudnadóttir for letting us ob-
tain skin samples from sheep heads in her posses-
sion, and for collecting swab specimens from
sheep at her hobby farm. Last, but not least, we
thank Dr Jón Hjaltalı́n Ólafsson for collecting the
molluscum contagiosum specimens in this study.
References
Baxby D. Poxviruses. In: Collier L, Balows A, Sussman M,
Mahy BWJ, editors. Topley and Wilson’s microbiology
and microbial infections, virology, vol. 1, 9th ed. London:
Arnold, 1998:367 – 83.
Buchan J. Characteristics of orf in a farming community in
mid-Wales. Br Med J 1996;313:203 –4.
Büttner M, von Einem C, McInnes C, Oksanen A. Klinik und
Diagnostik einer schweren Parapocken-Epidemie beim
Rentier in Finnland. Tierärztl Prax 1995;23:614 – 8.
Falk E. Parapoxvirus infections of reindeer and musk ox
associated with unusual human infections. Br J Dermatol
1978;99:647 – 54.
Fenner F. Poxviruses. In: Fields BN, Knipe DM, Howley PM,
Chanock RM, Melnick JL, Monath TP, et al., editors.
Fields virology, vol. 2, 3rd ed. Philadelphia: Lippincott –
Raven Publishers, 1996:2673 – 702.
Haig DM, McInnes CJ, Nettleton PF. Orf. Moredun Research
Institute http://www.mri.sari.ac.uk/immunology/or-
frev.htm.
Mercer AA, Lyttle DJ, Whelan EM, Fleming SB, Sullivan JT.
The establishment of a genetic map of orf virus reveals a
pattern of genomic organization that is highly conserved
among divergent poxviruses. Virology 1995;212:698 – 704.
Moss B. Poxviridae: the viruses and their replication. In:
Fields BN, Knipe DM, Howley PM, Chanock RM, Mel-
nick JL, Monath TP, et al., editors. Fields virology, vol. 2,
3rd ed. Philadelphia: Lippincott – Raven Publishers,
1996:2637 – 71.
Murphy FA, Gibbs EPJ, Horzinek MC, Studdert MJ. Poxviri-
dae. In: Murphy FA, Gibbs EPJ, Horzinek MC, Studdert
MJ, editors. Veterinary virology, 3rd ed. San Diego: Aca-
demic Press, 1999:277 – 91.