Journal of Integrative Agriculture 2017, 16(6): 1304–1311

Available online at www.sciencedirect.com

ScienceDirect

RESEARCH ARTICLE

Agronomic characterization and genetic analysis of the supernume­

rary spikelet in tetraploid wheat (Triticum turgidum L.)

ZHANG Rui­qi1*, HOU Fu1*, CHEN Juan1, CHEN Shu­lin2, XING Li­ping1, FENG Yi­gao1, CAO Ai­zhong1

1
College of Agronomy, Nanjing Agricultural University/National Key Laboratory of Crop Genetics and Germplasm Enhancement/
Cytogenetic Institute, Jangsu Collaborative Innovation Center of Modern Crop Production, Nanjing 210095, P.R.China
2
College of Agronomy, Henan Agricultural University/Collaborative Innovation Center of Henan Grain Crops, Zhengzhou 450002,
P.R.China

Abstract
The supernumerary spikelets (SS) characters of tetraploid wheat (Triticum turgidum L.) resulting in more spikelets and kernels
per spike, thus enhancing sink capacity may contribute to potential wheat yield improvement. In order to investigate the
effect of different SS types on agronomic characters and understand the genetic base of SS phenotype in tetraploid wheat,
near isogenic lines (NILs), bh-50 with normal spikelets (NS), bh-51 with four-rowed spikelets (FRS), bh-52 with short-ram-
ified spikelets (SRS), and bh-53 with long-ramified spikelets (LRS) in a Triticum durum cv. ZY1286 genetic background
were developed by continuous backcrossing. Agronomic characters showed that the SS phenotype lines, bh-51, bh-52
and bh-53 have significant increase in the number of spikelets and grains per spike compared with the NS phenotype line
bh-50 (P<0.05), and bh-53 line showed much more increase than those of bh-51 and bh-52. However, bh-53 had the lowest
grain weight and the longest spike development stage than those of other spike phenotypes. These results indicated that
the different SS types have different effects on the agronomic and spike characters. Genetic analysis through bh-50/bh-51
and bh-51/bh-53 F2 populations showed that a recessive major gene controlled the spike architecture to transform from
NS to FRS, and a dominant major gene determined the change of spike phenotype from FRS to RS. DNA sequences of
TtBH/WFZP ortholog on chromosome 2AS revealed that a single nucleotide polymorphism (SNP) substitution happened in
the open reading frame (ORF) region of all the SS tetraploid wheat accessions, which may lead to the generation of lateral
meristems between glume and lemma during the immature spike development. While the fates of the lateral meristems,
developing into lateral spikelets or branched spikelets, may be determined by another major gene. Our results presented
here may advance our understanding and knowledge of the genes and genetic pathways determining the spike architecture
development in wheat.

Keywords: tetraploid wheat (Triticum turgidum L.), ramified spikelet, four-rowed spikelet, TtBH/WFZP alleles

Received 27 May, 2016 Accepted 8 August, 2016 1. Introduction

Correspondence ZHANG Rui-qi, Tel: +86-25-84399031, E-mail:
zrq@njau.edu.cn; CAO Ai-zhong, Tel: +86-25-84395344,
E-mail: caoaz@njau.edu.cn The spike of wheat, specifically called compound inflores-
*
These authors contributed equally to this study. cence, is normally composed of sessile spikelets arranged
© 2017, CAAS. All rights reserved. Published by Elsevier Ltd. in two opposite rows along the main axis (rachis). Three
doi: 10.1016/S2095-3119(16)61469-7 components of wheat grain yield are spikes per m2, grains
 ZHANG Rui-qi et al. Journal of Integrative Agriculture 2017, 16(6): 1304–1311
per spike and grain weight. The grains per spike can be
dissected into two subcomponents: spikelets per spike and
grains per spikelet. Supernumerary spikelets (SS) trait in
wheat, including ‘Miracle’ wheat in Triticum turgidum and
other branched types in Triticum aestivum, resulting in more
spikelets and kernels may be more important to boost the
yield potential of wheat (Klindworth et al. 1990b; Miralles
and Slafer 2007; Muramatsu 2009).
Phenotypes of parts of rachis nodes with lateral branch-
like structures and SS are known as ramified spikelets (RS)
and four-rowed spikelets (FRS) in T. turgidum (Klindworth
et al. 1990a; Zhang et al. 2013). RS refers to additional
spikelets on an extended rachilla developed from axillary
resembling secondary spikes, terms like ‘short ramified
spikelets’ (SRS) and ‘long ramified spikelets’ (LRS) are
used to distinguish different RS types (Klindworth et al.
1990a). A lateral sessile spikelet developed from axillary
and two spikelets per rachis node formed is referred to FRS
(Zhang et al. 2013). The studies aimed at understanding
the genetics of SS character in T. turgidum which have been
performed for many years. Results indicated that this trait
is recessive and involves one or more genes. Patil (1958)
reported that a single recessive gene determined RS. But
Klindworth et al. (1990a) suggested that RS trait in tetraploid
wheat was quantitatively inherited, determined by a single
major gene acting along with an unknown number of minor
genes through the monosomic analysis. The major gene is
located on the chromosome 2AS and a minor gene is locat-
ed on chromosome 2B. Subsequently, a major recessive
gene determined RS trait was mapped on the short arm of
chromosome arm 2A using molecular markers and three
F2 populations of tetraploid wheat (Haque et al. 2012) and
Zhang et al. (2013) also mapped a recessive gene located
on 2AS that controlled the FRS character in tetraploid wheat.
However, in hexaploid wheat, three genes designated as
Ramifera (Rm), Tetrastichon (Ts), and Normalizator (Nr)
were suggested to control SS phenotype (Koric 1980) and
Peng et al. (1998) reported the presence of major genes
on chromosomes 2D, 4A, 5A, and a minor gene on 4B
controlling the SS trait. Recently, seven QTLs located on
five chromosomes (2D, 5B, 6A, 6B, and 7B) were identi-
fied to control the SS trait in common wheat by using the
genome-wide genetic dissection (Echeverry-Solarte et al.
2014). These differences in the number of genes deter-
mined SS character between tetraploid wheat and hexaploid
wheat could be the result of the differences in materials and
approaches used to classify SS traits. Multiple genetic loci
mapped in tetraploid and hexaploid wheat suggested that
more than one molecular system may regulate the spike
character in wheat.
The genetic determinants that regulated inflorescence
specification in grass species have been better understood.
1305
Some genes affected meristem initiation of spikelet forma-
tion, such as branched silkless1 (bd1) in maize (Chuck
et al. 2002) and frizzy panicle (fzp) in rice (Komatsu et al.
2003), have been cloned, which encode members of the
ethylene-responsive element-binding factor (ERF) family
of APETALA2 (AP2) transcription factors, and function to
repress lateral branch meristem formed. Moreover, orthol-
ogous genes playing the similar role in inflorescence devel-
opment have been identified in other grasses like barley and
sorghum. It would be interesting to find out if genes con-
trolling SS trait in wheat belong to the same gene families as
reported in Poaceae. Dobrovolskaya et al. (2015) reported
that SS formation in hexaploid bread wheat appears to be
under the control of FRIZZY PANICLE (WFZP) homoeol-
ogous genes located on 2AS, 2BS and 2DS, respectively.
Structural and functional characterization of the three wheat
FRIZZY PANICLE (WFZP) homoeologous genes revealed
that mutations of WFZP-D and WFZP-A caused the SS
phenotype. Poursarebani et al. (2015) suggested that a
single amino acid substitution in the DNA-binding domain of
TtBH that located on 2AS led to branched head in tetraploid
wheat. Sequence alignment showed that both genes were
the homologous genes of bd1 and fzp1. Although these
results contribute to understanding of the genetic basis of
spike architecture in wheat, it is still confusing that if only
alleles of TtBH/WFZP play the roles during the subsequent
floral differentiation process since the RS and FRS traits
in tetraploid wheat are distinct from the SS phenotype in
hexaploid bread wheat.
In the present study, we developed the near isogenic
lines (NILs) with different spike phenotypes in tetraploid
wheat genetic background. Their agronomic characters and
inheritance of SS trait in tetraploid wheat were analyzed. In
addition, sequence alignment and molecular marker analysis
of the alleles of TtBH/WFZP were performed. These results
may be available to understand the genetic basis of wheat
spike architecture and facilitate high-yield wheat breeding
by genetic manipulations.
2. Materials and methods
2.1. Plant materials
Ten tetraploid wheat accessions (T. turgidum L.) with dif-
ferent spike architectures were used in the present study.
Among them, 0879 and 0976 were the NS trait and SS-0880
was a natural mutant with the FRS character and frs1 locus
controlled this trait has been mapped on chromosome arm
2AS using 0976/SS-0880 F2 population (Zhang et al. 2013).
Another seven RS type germplasm, including SS-0881,
SS-0882, SS-0883, SS-0884, SS-0886, SS-0887, and
SS-0888 were all derived from natural mutants. The ten
1306 ZHANG Rui-qi et al. Journal of Integrative Agriculture 2017, 16(6): 1304–1311
tetraploid wheat (T. turgidum L.) accessions were originated
from traditional domestic varieties of China and maintained
at the Cytogenetic Institute, Nanjing Agricultural University,
China. Semi-dwarf and normal spike variety, T. durum L.
ZY1286 was introduced from International Maize and Wheat
Improvement Center (CIMMYT). All the plants were planted
in the greenhouse with spacing in the 25 cm-rows and 2 m
of row length and six plants per row. Plant height (cm) was
evaluated on the average of 10 individual plant heights.
Spike length (cm), spikelets per spike and grains per spike
were calculated on the average of 15 individual plants for
each line. 1 000-kernel weight (g) was determined by an
average of three 1 000-kernel weight.
2.2. Nucleotide sequencing of TtBH/WFZP alleles
Genomic DNA of parents and progenies were extracted
from seedling leaves with the hexadecyltrimethy ammo-
nium bromide (CTAB) method described by Doyle and
Doyle (1990). Primers were designed spanning the TtBH/
WFZP alleles sequences in tetraploid wheat, based on the
sequence of Chinese Spring, IWGSC_CSS_2BS_scaf-
fold_5209668, because the homoeologous sequence of
FZP located on chromosome arm 2AS of Chinese Spring
(CS) cannot be available as it is caused by the sequenced
gaps. We carried out a PCR assay using LA Taq poly-
merase (TaKaRa, Japan) for amplification sequences. Of
these primers, P1 and WFZP_2A_R5 were used to am-
plify the sequence on 2AS. P1 and P2, P3 and P4 were
used to amplify TtBH/WFZP alleles sequence on 2BS
(Table 1). PCR cycles used were one cycle of 94°C for
4 min, 33 cycles of 95°C for 15 s, 60°C for 1 min, and 70°C
for 2 min, followed by one cycle of 72°C for 7 min. The
PCR fragments were eluted from 0.8% agarose gels and
cloned into the pGEM-T Easy Vector (Promega, Madison,
WI, USA). Monoclones containing inserts of the correct
size were sequenced using the dideoxynucleotide chain
termination method by Shanghai Bioasia Biotechnology
Co. Ltd., China. Sequence analyses and characterization
were performed using DNAMAN Software.
2.3. Scanning electron microscopy
Scanning electron microscopy (SEM) was performed on
immature spike tissues of NILs by a Hitachi S-4700 Scanning
Electron Microscope (Hitachi High-Technologies Co., Tokyo,
Japan). The procedures for SEM followed Yi et al. (2005).
2.4. Data analysis
Chi-squared tests, variance and multiple comparisons anal-
ysis were performed by SAS 8.0 software.
Table 1 Primers used to amplify the TtBH/WFZP alleles in
tetraploid wheat
Primer1) Direction Sequence (5´→3´)
P1 Forward ACCACCTCCTCAACCTAAGC
P2 Reverse TGTGAGAGGAAGCTGAAGGG
P3 Forward CCTCCCTCCATAGTGAGCAC
P4 Reverse TCAGTGTGAGAGGAAGCTGA
WFZP_2A_R5 Reverse GGATCGGGGTGGATAGATTG
P5 Forward CGGTGCCTCCCAGATGATG
P6 Reverse AGTGGATGCTGGCGCGGCGC
1)
WFZP_2A_R5 was developed by Dobrovolskaya et al. (2015).
3. Result
3.1. Development of NILs with different spike phe­
notypes
In ZY1286/SS-0888 F2 population, except the individuals
with parental spike phenotypes NS and LRS, the intermedi-
ate phenotypes plants with FRS and short ramified spikelets
(SRS) were observed. We selected an individual with LRS
trait as same as the donor parent SS-0888 was crossed
with ZY1286. In their F2 population, a LRS individual was
uncreasingly backcrossed using ZY1286 as recurrent par-
ent. After four backcrosses, we selected four stable spike
phenotypes, bh-50 with NS trait, bh-51 with FRS trait, bh-52
with SRS trait, and bh-53 with LRS trait in BC4F2:3 population
(Fig. 1). The four lines obtained by a single seed descent
could be regarded as NILs with different spike phenotypes
and their successive inbreeding progenies planted in the
greenhouse for spike phenotype observation.
3.2. Agronomic characters of NILs
The entries of NILs (BC4F4 and BC4F5) were planted in the
greenhouse in two years and the agronomic data were
shown in Table 2. After backcrossing four times, the NILs
have the similar plant height but their growth periods were
different. The bh-53 line with the LRS trait delayed 5–6 d
in days to heading compared with three other lines. Also,
bh-53 needed more 4–6 d than other NILs in days to flower.
The other three NILs have the similar development stages
on the days to heading and also the days to anthesis. The
spike character showed that all the SS phenotype lines,
bh-51 (FRS), bh-52 (SRS), and bh-53 (LRS) significantly
increased the number of spikelets and grains per spike
compared with the NS phenotype lines bh-50 (P<0.05)
and bh-53 increased much more than bh-51 and bh-52.
Interestingly, the spikelets and seeds per spike of SRS
phenotype line, bh-52 had no obvious difference with the
FRS phenotype line bh-51 in 2013–2014 and reduced
significantly in 2014–2015 (P<0.05). In grain weight, there
 ZHANG Rui-qi et al. Journal of Integrative Agriculture 2017, 16(6): 1304–1311 1307

were no obvious differences between bh-50 and bh-51 in
two years. However, their grain weights were significantly
higher than those of bh-52 and bh-53 lines and bh-53 has
the lowest grain weight among the four NILs.
3.3. Sequence analysis of the TtBH/WFZP alleles
In order to confirm whether alleles of TtBH/WFZP play the
roles like rice and maize on the SS character in tetraploid
wheat, the TtBH/WFZP alleles on 2AS and 2BS, respec-
tively, were isolated in NILs and other SS tetraploid wheat.
A 2 354-bp DNA fragment of TtBH/WFZP allele located on
chromosome arm 2AS was screened by P1/WFZP_2A_R5
amplification (Fig. 2-A), including 98 bp upstream sequence,
900 bp ORF and 1 356 bp downstream sequence (Gen-
bank KT724716). Sequence alignment revealed that the
sequences in bh-51, bh-52, bh-53, and other SS tetraploid
wheat, SS-0880, SS-0881, SS-0882, SS-0883, SS-0884,
SS-0886, and SS-0887 were completely identical but there
were two single nucleotide polymorphisms (SNPs) in these
sequences comparing with the sequence in NS lines bh-50,
ZY1286 and 0976. One SNP located on the open reading
frame (ORF) region leads to a single amino acid substitution
Fig. 1 Spike architecture of the near-isolate lines (NIL). bh-50
is normal spikelet (NS), bh-51 is four-rowed spikelet (FRS),
bh-52 is short-ramified spikelet (SRS) and bh-53 is long-ramified
spikelet (LRS).
of leucine to proline at position 96 (L96P) within the AP2/ERF
protein domain, which was the consistent result reported by
Poursarebani et al. (2015). Another SNP located on the
1 249 bp out of ORF region may be a nonsense mutation
(Fig. 3). In addition, a 924-bp ORF DNA sequence of TtBH/
WFZP allele on chromosome arm 2BS was achieved when
using P1 and P2, P3 and P4 to amplify the tetraploid wheat.
Sequence alignment revealed that there were no differenc-
es between NS and SS lines on TtBH/WFZP alleles DNA
sequences located on chromosome 2BS.
3.4. Genetic analysis of the spike phenotype
The number of SS and NS individuals in main ear in two
F2 populations was listed in Table 3. The F1 spike trait of
cross ZY1286/bh-51 was NS and 111 of 141 F2 individuals
exhibited NS trait, while 30 individuals exhibited the FRS
trait. The chi-square test showed that the ratio was χ2<χ20.05
(χ20.05=3.84), being consistent to 3 to 1, which evidently
indicated that the FRS character of bh-51 was controlled
by a recessive gene, and was in consistent with our previ-
ous result of genetic analysis using the cross 0879 (NS)/
SS-0880 (FRS) that the recessive gene, frs1 was mapped
on the chromosome 2AS in that population (Zhang et al.
2013). To further confirm the relationship between TtBH/
WFZP alleles and the spike phenotypes in tetraploid wheat,
molecular marker P5/P6 (Fig. 2-B) developed based on the
SNP locus (T287C) was used to genetic analysis in ZY1286/
bh-51 F2 population. The patterns of the amplification by
PCR using P5/P6 as primers showed that all the 30 FRS
plants had the presence of 177 bp specific band like parent
bh-51, and 32 individuals with NS trait were all without the
177 bp specific band as same as parent ZY1286, suggesting
this marker may co-segregate with FRS trait. For crossing
bh-51 (FRS)/bh-53 (LRS), all the F1 hybrids (40 plants) were
RS character. While there were some individuals with the
intermediate RS character between SRS and LRS in F2
population. We consider all the plants with the branched
spikelet in main spike as RS type. As shown in Table 3, 122
of 154 individuals exhibited RS trait, while 32 individuals
exhibited the FRS trait in bh-51/bh-53 F2 population. The

Table 2 Agronomic characters of near isolate lines (NILs)

2013–2014 2014–2015
Plant Spikelets Grains 1 000-kernel Days Days Plant Spikelets Grains 1 000-kernel Days Days to
Lines
height per per weight to heading to height per per weight to flower
(cm) spike spike (g) (d) flower (d) (cm) spike spike (g) heading (d) (d)
bh-50 85.5 b 15.6 d 35.3 c 39.7 a 178 c 184 c 86.3 a 16.2 d 38.0 c 40.1 a 180 b 186 c
bh-51 86.3 ab 21.0 c 43.7 b 41.0 a 179 b 184 c 86.0 a 22.3 b 47.6 b 40.7 a 180 b 186 c
bh-52 88.0 a 22.3 bc 41.2 b 39.2 b 179 b 185 b 86.2 a 20.5 c 39.3 c 38.6 b 180 b 187 b
bh-53 84.7 b 30.1 a 56.0 a 34.1 c 183 a 190 a 85.3 a 31.7 a 57.5 a 33.9 c 185 a 192 a
Means followed by the same letters within a column are not significantly different at 5% as determined by the least significant difference.
1308 ZHANG Rui-qi et al. Journal of Integrative Agriculture 2017, 16(6): 1304–1311

chi-square test showed that the ratio was 3 to 1, suggest- A

ZY 8 8 8

D
N 2D
N 2B
b h 286

T2
ing that a dominant gene determined the spike phenotype

1
3
T

T
-0

-5

-5
-5
2A

2A
2B
1
SS

bh
bh
transformed from FRS to RS.

N
bp
bp
3.5. Electron microscopic observation of the imma­ 2 354
2 000
ture spike

For confirming the primary meristems of the lateral organs

developed in FRS and RS lines, the immature spikes of B
bh-50, bh-51 and bh-53 were scanned by using SEM

ZY 8 8 8

SS 880

SS 81

2
SS 86

88
8
(Fig. 4). The SEM patterns showed that the inflorescence

12
-0

-0
-0

-0
-5

-5

-5
SS
bh

bh

bh
meristem produced primary axillary meristem, glume primor-
bp bp
dia at the spikelet differentiation stage. The floret meristem
first initiated lemma and then formed the other floral organs 250 277

in the earliest floret differentiation stage. The locations

of branch-like meristem generated were between glume
and lemma meristems in bh-51 (FRS) and bh-53 (LRS),
indicating that the original lateral primordia are identical in
two spike types. It can also be observed that the lateral
meristem might be a slightly earlier initiation than that of
the floret meristem and were not generated from the floret
primordia in tetraploid wheat.
Fig. 2 The PCR amplified results. A, the agarose gel patterns
of primers P1/WFZP_2A_R5 amplified TtBH/WFZP allele
located on chromosome arm 2AS. B, the agarose gel patterns
of primers P5/P6 developed on the basis of SNP T287C found
between normal spikelet (NS) lines (bh-50 and ZY1286) and
supernumerary spikelets (SS) lines. The 277-bp aim band can
be amplified in SS accessions and missing in NS lines.

4. Discussion
Wheat spike architecture is one of the most important traits
for yield improvement. The mutants with different spikelet
phenotypes are the basic materials for understanding the
molecular mechanisms of wheat spike character develop-
ment. Great efforts have been made to incorporate branch-
ing tetraploid wheat T. turgidum RS type into common and
more than 13 branching forms of spikes have been produced
in the same populations by several backcrosses between
tetraploid and hexaploid wheat (Alieva 2009; Zhang et al.
2012; Alieva and Aminov 2013). A famous common wheat
variety Fen 33 with the RS phenotype was used to genetic
analysis by several researchers (Li and Zhao 2000; Zhang
et al. 2012; Echeverry-Solarte et al. 2014). By contrast,
the genetic systems of SS trait in tetraploid wheat may be
easy to understand because of the absence of D genome.
However, the genetic characterization of RS trait in tetraploid
wheat is still confusing for us because the stable intermedi-
ate phenotypes cannot be classified as male or female par-
ent in the segregation population of the cross among NS and
RS varieties. The intermediate phenotypes also occurred in
the F2 individuals of the cross ZY1286 (NS)/SS-0888 (LRS)
in the present study. We selected the LRS individual to
cross with ZY1286 from F2 until BC4F1 achieved. In BC4F2
population, most agronomy characters of individuals were
similar with recurrent parent ZY1286 except for the spike
phenotypes. Four stable NILs, bh-50 with NS, bh-51 with
FRS, bh-52 with SRS and bh-53 with LRS were selected in
BC4F2:3 according to the major agronomy and spike traits.
The NS and LRS lines can be respectively classified as
ZY1286 and SS-0888 spike phenotypes, while intermediate
phenotypes FRS and SRS were distinguished from NS and
LRS means that they are determined by different genetic
systems. The spikes phenotype of bh-50 (NS)/bh-51 (FRS)
F1 plants showed the normal spike (NS) character and a
good fit to single-gene segregation ratios of normal spike
to four-rowed spike was revealed in F2 populations. This
result indicated that the FRS trait was controlled by a single
recessive gene, which is similar with the genetic analysis
when using the crossing 0976 (NS)/SS-0880 (FRS) (Zhang
et al. 2013). In another F2 population (bh-51/bh-53), the
ratio of FRS to RS was also good fit to 1 to 3, suggesting
a single dominant gene determined the spike phenotype
transformed from FRS to RS. Although the result was good
fit to a single gene segregation ratio, the conclusion that a
dominant gene conditioned the spike trait transformed from
FRS to RS trait was unsatisfactory, because the numbers of
branched spike among the RS individuals in bh-51/bh-53 F2
population were strikingly different, such as SRS and LRS
types. Therefore, we presumed that other gene(s) may
affect the tassel branch number. The ignorance of these
differences may result in neglecting the modification gene(s)
affected on the development of lateral-branched spikes.
The functions of AP2/ERF domain of orthologous genes
BD1 in maize and FZP in rice have been demonstrated
to prevent the generation of the lateral form (Chuck et al.
 ZHANG Rui-qi et al. Journal of Integrative Agriculture 2017, 16(6): 1304–1311 1309

Fig. 3 Alignment of TtBH/WFZP allele sequences located on chromosome arm 2AS of NIL-NS (bh-50), NIL-FRS (bh-51) and NIL-RS
(bh-53) amplified using P1/WFZP_2A_R5 primers. The red bars indicate the start and stop codons, respectively.

Table 3 Observed segregation for the numbers of normal spikelets (NS), four-rowed spikelets (FRS) and ramified spikelets (RS)
in F2 populations
Spike phenotype Observed segregation in F2 populations1) Expected
Cross Segregation ratio χ2
of F1 NS FRS RS Total segregation ratio
ZY1286×bh-51 NS 111 30 – 141 3.7:1 1.94 3:1
bh-51×bh-53 RS – 32 122 154 3.81:1 2.00 3:1
1)
–, no related type individual observed.

2002; Komatsu et al. 2003). The BD1/FZP orthologous
genes in common and tetraploid wheat have been isolated,
respectively designed as WFZP and TtBH, and their function
proved in wheat as similar as in rice and maize (Dobrovol-
skaya et al. 2015; Poursarebani et al. 2015). In the present
study, the DNA sequences of TtBH/WFZP ortholog on 2AS
revealed that a single SNP T287C substitution happened in
the ORF region of bh-51, bh-52, bh-53 and other eight SS
tetraploid wheat accessions. P5/P6 marker developed on
the basis of this SNP was co-segregating with FRS pheno-
type demonstrated in bh-50/bh-51 F2 population. Although,
the NILs, bh-51, bh-52 and bh-53 have the different spike
phenotypes, the TtBH/WFZP orthologs on 2AS and 2BS of
bh-51, bh-52 and bh-53 were all identical DNA sequences.
1310 ZHANG Rui-qi et al. Journal of Integrative Agriculture 2017, 16(6): 1304–1311
A B
500 μm
WD20.0 mm 7.00 kV ×100
Fig. 4 Scanning electron microscopy (SEM) images of bh-50 (A), bh-51 (B) and bh-53 (C) in early floret differentiated stage. l,
lemma; gl, glume; fm, floret meristem; lm, lateral meristem.
Also, a single dominant gene determined the spike phe-
notype transformed from FRS to RS has been shown in
bh-51/bh-53 F2 population. Our results indicated that other
genes, besides the TtBH/WFZP orthologs, may also play
the key role in the development of the spike architecture in
tetraploid wheat. Scanning electron microscopy (SEM) per-
formed on immature spike tissues revealed that the primodia
positions of the FRS and RS were all between glume and
lemma meristems, revealing the function of TtBH/WFZP in
tetraploid wheat may be the prevention of the lateral meri-
stem formed on this location. While the fates of the lateral
meristem, developing into lateral spikelets or branched
spikes, may be determined by another major gene. These
results proved here may advance our understanding and
knowledge of the genes and genetic pathways determining
the spike architecture development in wheat.
The agronomic characters of NILs showed that the LRS
type has more seeds per spike, but lower grain weight and
longer spike development stage than those of other spike
phenotypes. More spikelets and seeds of LRS line means
that this phenotype can enhance sink capacity of wheat.
While the lower grain weight may be due to the insufficient
photosynthate, suggesting the source of the LRS should be
enhanced when using this spike type in wheat yield improve-
ment. Longer immature spike development stage of LRS
type than that of SRS indicated that the enhanced gene(s) of
lateral branched spikes may be related with the development
stages. Some genes related with development stages have
been demonstrated, such as wheat vernalisation pathway
genes and photosensitivity genes (Yan et al. 2004; Chen
et al. 2010; Qi et al. 2010; Zhang et al. 2015). Different
genotypes and their interactive effect of these genes were
tightly associated with the heading and flowering stages.
In addition, mutations in the maize LFY/FLO orthologs, zfl1
C
500 μm
500 μm
WD20.0 mm 7.00 kV ×100
WD20.0 mm 7.00 kV ×100
and zfl2, affected floral organs and tassel branch number
have been known (Bomblies et al. 2003). Knock-down of
the rice LFY/FLO ortholog, RFL, affects flowering time and
panicle branching (Rao et al. 2008). Whether the vernali-
sation, photosensitivity genotypes and LFY/FLO orthologs
enhanced the lateral branched spikes in tetraploid wheat
deserves further study.
5. Conclusion
The supernumerary spikelet phenotypes FRS and RS in
teraploid wheat are controlled by different genetic systems.
A recessive major gene controlled the spike architecture
to transform from NS to FRS, and a dominant major gene
determined the change of spike phenotype from FRS to RS.
TtBH/WFZP ortholog on 2AS may lead to the generation
of lateral meristems between glume and lemma during the
immature spike development. While the fates of the lateral
meristems, developing into lateral spikelets or branched
spikelets, may be determined by another major gene.
Acknowledgements
This research was supported by the State Transgenic
Project, China (2014ZX08009-40B) and the Fundamen-
tal Research Funds for the Central Universities, China
(KYZ201303).
References
Alieva A D. 2009. Source of a new type of spike branching in
hard wheats. Russian Agricultural Science, 35, 144–146.
Alieva A J, Aminov N K. 2013. Influence of D genome of wheat
on expression of novel type spike. Russian Agricultural
Science, 49, 1119–1126.
 ZHANG Rui-qi et al. Journal of Integrative Agriculture 2017, 16(6): 1304–1311
Bomblies K, Wang R L, Ambrose B A, Schmidt R J, Meeley R B,
Doebley J. 2003. Duplicate FLORICAULA/LEAFY homologs
zfl1 and zfl2 control inflorescence architecture and flower
patterning in maize. Development, 130, 2385–2395.
Chen Y, Brett F C, Wang S W, Cao S H, Yan L L. 2010. Genetic
regulation of developmental phases in winter wheat.
Molecular Breeding, 26, 573–582.
Chuck G, Muszynski M, Kellogg E, Hake S, Schmidt R J. 2002.
The control of spikelet meristem identity by the branched
silkless1 gene in maize. Science, 298, 1238–1241.
Dobrovolskaya O, Pont C, Sibout R, Martinek P, Badaeva
E, Murat F, Chosson A, Watanabe N, Prat E, Gautier N,
Gautier V, Poncet C, Orlov Y, Krasnikov A A, Bergès H,
Salina E, Laikova L, Salse J. 2015. FRIZZY PANICLE drives
supernumerary spikelets in bread wheat. Plant Physiology,
167, 189–199.
Doyle J J, Doyle J L. 1990. Isolation of plant DNA from fresh
tissue. Focus, 12, 13–15.
Echeverry-Solarte M, Kumar A, Kianian S, Mantovani E E,
Simsek S, Alamri M S, Mergoum M. 2014. Genome-wide
genetic dissection of supernumerary spikelet and related
traits in common wheat. The Plant Genome, 7, 1–16.
Haque M A, Martinek P, Kobayashi S, Kita I, Ohwaku K,
Watanabe N, Kuboyama T. 2012. Microsatellite mapping
of the genes for semi-dwarfism and branched spike in
Triticum durum Desf. var. ramosoobscurum Jakubz.
“Vetvistokoloskaya”. Genetic Resources and Crop
Evolution, 59, 831–837.
Klindworth D L, Williams N D, Joppa L R. 1990a. Chromosomal
location of genes for supernumerary spikelets in tetraploid
wheat. Genome, 33, 515–520.
Klindworth D L, Williams N D, Joppa L R. 1990b. Inheritance
of supernumerary spikelets in a tetraploid wheat cross.
Genome, 33, 509–514.
Komatsu M, Chujo A, Nagato Y, Shimamoto K, Kyozuka J. 2003.
FRIZZY PANICLE is required to prevent the formation of
axillary meristems and to establish floral meristem identity
in rice spikelets. Development, 130, 3841–3850.
Koric S. 1980. Study of branched gene complex of T. aestivum
ssp. vulgare and its significance for wheat breeding. Journal
of Science Agricultural Research, 142, 271–282.
Li W P, Zhao W M. 2000. A breeding method for increasing
spikelet and studies on creation of new germplasm
resource in wheat. Acta Agronomica Sinica, 26, 222–230.
(in Chinese)
Miralles D J, Slafer G A. 2007. Sink limitations to yield in wheat:
How could it be reduced? Journal of Agricultural Science,
145, 139–149.
1311
Muramatsu M. 2009. A presumed genetic system determining
the number of spikelets per rachis node in the tribe Triticeae.
Breeding Science, 59, 617–620.
Patil J A. 1958. Inheritance study in wheat. Current Science,
27, 404−405.
Peng Z S, Yen C, Yang J L. 1998. Chromosomal location
of genes for supernumerary spikelet in bread wheat.
Euphytica, 103, 109–114.
Poursarebani N, Seidensticker T, Koppolu R, Trautewig C,
Gawroński P, Bini F, Govind G, Rutten T, Sakuma S,
Tagiri A, Wolde M G, Youssef M H, Battal A, Ciannamea S,
Fusca T, Nussbaumer T, Pozzi C, Börner A, Lundqvist U,
Komatsuda T, et al. 2015. The genetic basis of composite
spike form in barley and ‘Miracle-Wheat’. Genetics, 201,
155–165.
Qi Z J, Du P, Qian B L, Zhuang L F, Chen H F, Chen T T,
Shen J, Guo J, Feng Y G, Pei Z Y. 2010. Characterization
of a wheat - Thinopyrum bessarabicum (T2JS-2BS·2BL)
translocation line. Theoretical and Applied Genetics, 121,
589–597.
Rao N N, Prasad K, Kumar P R, Vijayraghavan U. 2008. Distinct
regulatory role for RFL, the rice LFY homolog, in determining
flowering time and plant architecture. Proceedings of
National Academy of Sciences of the United States of
America, 105, 3646–3651.
Yan L, Loukoianov A, Tranquilli G, Blechl A, Khan I A,
Ramakrishna W, SanMiguel P, Bennetzen J L, Echenique
V, Lijavetzky D, Dubcovsky J. 2004. The wheat VRN2 gene
is a flowering repressor down-regulated by vernalization.
Science, 303, 1640–1644.
Yi G, Choi J H, Jeong E G, Chon N S, Jena K K, Ku Y C, Kim
D H, Eun M Y, Jeon J S, Nam M H. 2005. Morphological
and molecular characterization of a new FRIZZY PANICLE
mutant, “fzp-9(t)”, in rice (Oryza sativa L.). Hereditas, 142,
92–97.
Zhang R Q, Hou F, Feng Y G, Zhang W, Zhang M Y, Chen P D.
2015. Characterization of a Triticum aestivum - Dasypyrum
villosum T2VS·2DL translocation line expressing a longer
spike and more kernels traits. Theoretical and Applied
Genetics, 128, 2415–2425.
Zhang R Q, Wang X E, Chen P D. 2013. Inheritance and
mapping of gene controlling four-rowed spike in tetraploid
wheat (Triticum turgidum L.). Acta Agronomica Sinica, 39,
29−33. (in Chinese)
Zhang W D, Li A F, Tian J C, Zhao L F. 2012. Development
of near isogenic lines of wheat carrying different spike
branching genes and their agronomic and spike characters.
Journal of Agricultural Science, 4, 215–221.
(Managing editor WANG Ning)