C L I N I C A L A N D L A B O R A T O R Y I N V E S T I G A T IO N S DO I 1 0 . 1 1 1 1 / j . 1 3 6 5 - 2 1 3 3 . 2 0 0 6 . 0 7 3 4 8 .

TNF-a gene 1031 T/C polymorphism in Turkish patients

with Behçet’s disease
A. Akman, N. Sallakci,* M. Coskun,* A. Bacanli, U. Yavuzer,
E. Alpsoy and O. Yegin*
Akdeniz University School of Medicine, Departments of Dermatology and Venerology,*Pediatric Immunology and
Physiology, 07070 Antalya, Turkey

Summary

Correspondence Background Genetic factors that predispose individuals to Behçet’s disease (BD) are
Erkan Alpsoy. considered to play an important role in development of the disease. The tumour
E-mail: ealpsoy@akdeniz.edu.tr necrosis factor (TNF)-a gene, which is closely linked to the HLA-B51 gene, is
involved in susceptibility for BD. Recently, a polymorphism at position )1031
Accepted for publication
18 January 2006
within the TNF-a promoter region was demonstrated to be responsible for sus-
ceptibility to BD in a British population. However, the functional effects of this
Key words polymorphism have not yet been determined.
1031 T/C, Behçet’s disease, ELISPOT, functional Objectives To investigate the possible relation of the TNF-a–1031 T/C polymorph-
polymorphism, TNF-a ism with susceptibility to BD in a Turkish population and to determine the func-
tional importance of this polymorphism.
Methods Ninety-nine unrelated patients (47 women, 52 men; mean ± SD age,
34Æ10 ± 10Æ53 years) with BD and 103 ethnically matched healthy controls
(52 males, 51 females; mean ± SD age, 40Æ25 ± 14Æ15) were enrolled in the
study. For genotyping, polymerase chain reaction – restriction fragment length
polymorphism (PCR-RFLP) analysis was employed. The functional importance
of TNF-a–1031 T/C polymorphism was determined with an enzyme-linked
immunospot (ELISPOT) assay. For this purpose, mononuclear cells obtained
from BD patients and controls were analysed for TNF-a and interferon (IFN)-c
production.
Results A significant difference was observed between BD patients and controls
with respect to the allele frequency of TNF-a–1031C [P ¼ 0Æ018, OR ¼ 1Æ83,
95% confidence interval (CI) ¼ 1Æ07–3Æ13]. When the allele frequencies were
analysed according to the clinical features, the T allele in patients with positive
skin pathergy test (SPT) was significantly increased when compared with those
of patients without these findings (P ¼ 0Æ004, OR ¼ 2Æ75, 95% CI ¼ 1Æ3–5Æ86).
To demonstrate the frequency of TNF-a and IFN-c producing cells, mononuclear
cells from four representative individuals of each genotype were used and the
spontaneous and stimulated TNF-a and IFN-c values (spot numbers) were ana-
lysed. Compared with the control groups, a significant increase was observed in
the number of cells producing TNF-a obtained from BD patients (P < 0Æ001).
Moreover, the stimulation index for TNF-a [bacterial lipopolysaccharide (LPS)
stimulated/unstimulated] was higher for the CC genotype (9 ± 9Æ5) with respect
to the other genotypes (TT; 1Æ3 ± 0Æ3 and TC; 1Æ2 ± 0Æ2). While the difference
in the spontaneous IFN-c values between groups were not statistically significant,
the stimulated IFN-c values were found to be significantly increased in the BD
group when compared with the healthy control group (P ¼ 0Æ004).
Conclusions Our results showed that, in the Turkish population the TNF-a–1031C
allele is associated with susceptibility to BD. On the other hand, carrying the T
allele may render patients more prone to developing a positive skin pathergy
test. In addition, ELISPOT assays revealed that BD patients exhibited a significantly

350
2006 British Association of Dermatologists • British Journal of Dermatology 2006 155, pp350–356
 TNF-a gene polymorphism in Behçet’s disease, A. Akman et al. 351

higher number of mononuclear cells producing TNF-a, and cells obtained from
patients with a CC genotype had a stronger response to LPS stimulation. The
strong IFN-c response upon LPS stimulation in BD patients supports the previous
findings that BD is a Th1 driven disease. These findings suggest that the TNF-a–
1031 polymorphism may have a functional effect and could explain the reason
for high levels of TNF-a production observed in BD patients.

Behçet’s disease (BD) is a chronic, relapsing, systemic vasculi- and independent association with the TNF-a promoter allele
tis of unknown aetiology.1,2 Patients with BD exhibit elevated TNF-a–1031C with susceptibility to BD in the British popula-
levels of pro-inflammatory cytokines and the affected organs tion. Therefore, we aimed to investigate the possible relation of
show a significant neutrophil and lymphocyte infiltration.3,4 the TNF-a–1031 T/C polymorphism with susceptibility to BD
Current evidence suggests that the activated lymphocytes con- in the Turkish population. In addition, we utilized the ELISPOT
tribute to neutrophil and endothelial cell activation in these assay to detect TNF-a and IFN-c production by circulating
patients. Serum levels of neutrophil priming cytokines such as mononuclear cells in BD and control groups for each genotype
tumour necrosis factor (TNF)-a, interleukin (IL)-1b and IL-8 to determine the functional effect of the TNF-a–1031 T/C poly-
as well as myeloperoxidase levels generated by active neu- morphism.
trophils are known to be raised in patients.5–7 Overexpression
of pro-inflammatory cytokines from various cellular sources
Patients and methods
seems to be responsible for the enhanced inflammatory reac-
tion in BD, and it may be associated with the genetic suscepti-
Subjects
bility.3 Genetic factors that predispose individuals to BD are
considered to play important roles in the development of the Ninety-nine unrelated patients (47 women, 52 men;
disease. Familial aggregation studies in patients with BD indi- mean ± SD age, 34Æ1 ± 10Æ5 years) with BD, diagnosed
cate a strong genetic background and a complex inheritance according to the criteria of the International Study Group for
model.8 Several studies have demonstrated a significant associ- Behçet’s disease23 and 103 ethnically matched healthy controls
ation and an increased incidence of HLA-B51; however, the (52 males, 51 females; mean ± SD age, 40Æ2 ± 14Æ2) attend-
presence of HLA-B51 alone is not sufficient to explain all the ing the Dermatology & Venereology outpatient clinic at the
symptoms seen in BD, and in agreement with this, recent University of Akdeniz Hospital were enrolled in the study in
studies suggest the involvement of other genes.8–11 TNF-a is compliance with the principles of the Declaration of Helsinki.
encoded by the gene TNF which is located in the class III The mean ± SD duration of the disease was 6Æ9 ± 6Æ5 years
region of the major histocompatibility complex on chromo- (range 1–31 years). The control group had neither family his-
some 6 and is closely linked to the HLA-B51 gene locus.12 tory nor symptoms related to BD. The clinical features of the
This region remains a major challenge because of extensive patients with BD are summarized in Table 1.
linkage disequilibrium across this highly polymorphic region.
The important pro-inflammatory cytokine, TNF-a, is secreted
Genotyping
by monocytes or lymphocytes in many inflammatory and auto-
immune diseases, such as sepsis, inflammatory bowel disease, For genotyping, polymerase chain reaction – restriction frag-
rheumatoid arthritis, Graves disease and severe adult periodonti- ment length polymorphism (PCR-RFLP) was employed.
tis. It is a multifunctional pro-inflammatory cytokine and a pri-
mary mediator that is involved in the early phase of the cytokine Table 1 The clinical features of patients with Behçet’s disease
cascade and plays an important role in the initiation and regula-
tion of the immune responses.13–16 Some evidence indicates Clinical Patients
that TNF-a plays a critical role in the pathogenesis of BD. TNF-a characteristics (n ¼ 99) %
and soluble TNF receptors are increased in the serum of patients Oral ulcer 99 100
with the active disease.17 It has been demonstrated that the Genital ulcer 86 86Æ9
T lymphocytes expressing the c/d receptor in BD are activated Papulopustular lesions 63 63Æ6
in vivo and produce increased amounts of TNF-a and interferon Articular involvement 74 74Æ7
Erythema nodosum 35 35Æ3
(IFN)-c compared with healthy controls.2,4,18,19 TNF-a increa-
Ocular symptoms 29 29Æ3
ses the expression of the CD11b-CD18 that are constitutively Thrombophlebitis 9 9Æ1
present on the polymorphonuclear neutrophils membrane and Neurological involvement 5 5Æ1
facilitate their rolling and diapedesis through the vascular endot- Gastrointestinal involvement 2 2
helial wall.20 Blockade of TNF-a with infliximab, a chimeric The skin pathergy test 56 56Æ6
monoclonal antibody, is effective in diminishing the severity of HLA-B51 33 33Æ3
systemic BD.21 Ahmad et al.22 have recently determined a novel

2006 British Association of Dermatologists • British Journal of Dermatology 2006 155, pp350–356
352 TNF-a gene polymorphism in Behçet’s disease, A. Akman et al.

Genomic DNA was isolated from peripheral blood cells, using
a DNA isolation kit according to the manufacturer’s instruc-
tions (Roche, Gebze, Turkey). The 264-bp region of the TNF-
a gene, encompassing the )1031 T/C polymorphism site,
was amplified via polymerase chain reaction (PCR) using the
sense (5¢TATGTGATGGACTCACCAGGT) and antisense
(5¢CCTCTACATGGCCCTGTCTT) primer pair. Initially, the PCR
reaction was subjected to denaturation for 5 min at 95 C,
followed by 30 cycles of amplification (1 min at 95 C,
1 min at 60 C and 1 min at 72 C). A final elongation step
(5 min at 72 C) was applied at the end of the 30 cycles.
Amplified products were purified using phenol/chloroform
and the DNA was precipitated by ethanol. The final product
was re-suspended in 30 lL of sterile ddH2O and 10 lL was
used for RFLP analysis. For this purpose, DNA was incubated
with 1 U of BbsI (New England Biolabs, Hitchin, U.K.) restric-
tion enzyme at 37 C for 3 h. The end products were then
subjected to agarose gel electrophoresis and the DNA bands
were visualized using ethidium bromide. Genotyping was per-
formed according to the band patterns obtained by the BbsI
digest.
The DNA obtained from the T/T homozygote individuals
cannot be digested by BbsI, thus revealing a full-length 264-bp
product. On the other hand, the DNA obtained from the C/C
homozygote individuals is digested by BbsI and two fragments
of 193 and 71 bp are produced. When all three bands were
visualized, the individuals were genotyped as being T/C
heterozygotes.
1 · 106 mL)1 for IFN-c in complete RPMI 1640 based medium
supplemented with 10% fetal bovine serum (FBS), L-glutamine
(200 mmol L)1, GIBCO BRL, Gaithersburg, MD, U.S.A.), MEM-
sodium pyruvate (100 mmol L)1, GIBCO BRL), penicillin–
streptomycin (Amresco; Solon, OH, U.S.A.), and 5 · 10)5
mol L)1 2-mercaptoethanol (SIGMA; St Louis, MO, U.S.A.).8
Next, cells (40 000 cells 100 lL)1 for TNF-a and 100 000
cells 100 lL)1 for IFN-c) were placed in the wells of the
ELISPOT plate followed by addition of 100 lL complete med-
ium containing lipopolysaccharide (LPS) (5 lg mL)1; SIGMA);
the control wells received only complete medium. The tests
were performed in duplicate. Plates were incubated at 37 C for
14 h followed by staining. Finally, spots were evaluated and
counted with an automated ELISPOT reader (CTL Europe;
Germany), the means of the duplicates were calculated and the
results were given as spot numbers and stimulation index (LPS
stimulated/unstimulated).
Statistical analysis
We used v2 analysis to compare the allele and genotype fre-
quencies of the cases and controls. To assess whether any of
the common clinical features of BD are more commonly asso-
ciated with the TNF-a–1031 T/C polymorphism, we com-
pared the frequencies of alleles in the presence of the
involvement of various systems by using v2 analysis. The
TNF-a and IFN-c ELISPOT values in the groups were com-
pared using the Wilcoxon signed ranks test.

Detection of mononuclear cells secreting tumour necrosis Results

factor-a and interferon-c by enzyme-linked immunospot
assays
The ELISPOT analysis has been performed as suggested by the
manufacturer (TNF-a; BD Biosciences Pharmingen, Cat. No:
551951 and IFN-c; Euroclone Ltd U.K. Cat. No: DSH051-20;
BD Biosciences Pharmingen, San Diego, CA, U.S.A.). Briefly,
TNF-a and IFN-c ELISPOT plates were coated with the capture
antibody overnight. The next day, peripheral blood mono-
nuclear cells were separated by histopaque density gradient and
the cell count adjusted to 4 · 105 mL)1 for TNF-a and
Analysis of tumour necrosis factor a–1031 single
nucleotide polymorphism
The distribution of the TNF-a–1031 alleles and genotype fre-
quencies in patients with BD and controls are shown in
Table 2. A significant difference was observed between
patients with BD and controls, with respect to the allele fre-
quency of TNF-a–1031C (P ¼ 0Æ018, OR ¼ 1Æ83, 95% CI ¼
1Æ07–3Æ13). The allele frequencies of TNF-a–1031 T/C were
not found to be significantly different with respect to sex

Table 2 Allele and genotype frequencies of TNF-a–1031C in patients with Behçet’s disease (BD) and healthy controls, and in BD patients with
the positive skin pathergy test and the negative skin pathergy test

Alleles (%) Genotypes (%)

TNF-a–1031 C T C T/T T/C C/C

a
Patients with Behçet’s disease (n ¼ 99) 151 (76Æ3) 47 (23Æ7) 57 (57Æ6) 37 (37Æ4) 5 (5)
Healthy controls (n ¼ 103) 176 (85Æ4) 30 (14Æ6) 73 (71) 30 (29) –
Patients with the positive skin pathergy test (n ¼ 56) 96 (85Æ7)b 16 (14Æ3) 41 (73Æ7) 14 (25) 1 (1Æ8)
Patients with the negative skin pathergy test (n ¼ 43) 59 (69) 27 (31) 20 (47) 19 (44) 4 (9)
a
P ¼ 0Æ018 (OR ¼ 1Æ83, 95% confidence interval ¼ 1Æ07–3Æ13) between patients with Behçet’s disease and healthy controls; bP ¼ 0Æ004
(OR ¼ 2Æ75, 95% confidence interval ¼ 1Æ3–5Æ86) between patient groups with the positive skin pathergy test and the negative skin pather-
gy test.

2006 British Association of Dermatologists • British Journal of Dermatology 2006 155, pp350–356
 TNF-a gene polymorphism in Behçet’s disease, A. Akman et al. 353

(in women: 74% vs. 26%, in men: 82Æ4% vs. 17Æ6%) or posi-
tivity of HLA-B51 (in patients carrying HLA-B51: 81Æ8% vs.
18Æ2%, in patients not carrying HLA-B51: 76Æ5% vs. 23Æ5%).
However, when the allele and genotype frequencies were
analysed according to the clinical features, it was seen that the
TNF-a–1031 T-allele frequency was significantly higher in
patients with a positive skin pathergy test (SPT) compared
with those of patients with negative SPT (P ¼ 0Æ004, OR ¼
2Æ75, 95% CI ¼ 1Æ3–5Æ86).
Analysis of enzyme-linked immunospot assays
The number of TNF-a and IFN-c producing mononuclear cells
isolated from 12 BD patients and eight control subjects are
shown in Table 3. Five of those patients were on the treat-
ment, and only one of them had active disease at the time of
the ELISPOT assay (Table 3). As seen in the table, regardless
of the genotype, patients with BD have higher numbers of
TNF-a producing mononuclear cells compared with the
controls (P < 0Æ001). In addition, BD patients with a CC gen-
otype exhibited an even higher number of mononuclear cells
producing TNF-a upon LPS stimulation, displaying a fold-
increase of 9 ± 9Æ5 compared with TT (1Æ3 ± 0Æ3) and TC
(1Æ2 ± 0Æ2) genotypes. On the other hand, the number of
mononuclear cells producing IFN-c did not show a significant
difference between the controls and patients with BD. Never-
theless, upon LPS stimulation, cells from patients with BD
showed a significant fold-increase with respect to the cells
from the control group (P < 0Æ001).
Discussion
Compared with western countries, BD is more frequent along
the ancient ‘Silk Road’ extending from Eastern Asia to the
Mediterranean basin. Association between geographical disease
distribution and HLA-B51 has invoked the widely held belief
that genetic risk factors were propagated by migrant traders
along the Silk Road 2000 years ago.3,24 Besides HLA-B51,

Table 3 Number of spot-forming cells for TNF-a and INF-c produced by mononuclear cellsa isolated from patients with Behçet’s disease and
healthy controls

TNF-a IFN-c
Study Genotype
groups (TNF-a–1031T/C) Unstimulated LPS Unstimulated LPS
Patient 1 TT 288 492 16 180
Patient 2b TT 304 349 15 76
Patient 3c TT 245 271 15 214
Patient 7 TT 243 263 26 203
Median 26 310 1 19
Patient 4 TC 273 372 2 106
Patient 5 TC 441 479 54 165
Patient 6 TC 397 417 26 191
Patient 10 TC 274 362 28 444
Median 335Æ5 394Æ5 27 178
Patient 8c CC 192 373 29 344
Patient 9d CC 437 528 66 425
Patient 11 CC 8 92 40 188
Patient 12c CC 16 342 37 85
Median 104 357Æ5 38Æ5 266
Patient mean 25 ± 13* 36 ± 11* 2±1 21 ± 12**
values ± SD
Control 2 TT 5 317 7 35
Control 3 TT 20 31 8 31
Control 6 TT 15 56 14 70
Control 7 TT 26 116 10 66
Median 17Æ5 86 9 50Æ5
Control 1 TC 28 46 89 130
Control 4 TC 8 257 21 69
Control 5 TC 21 230 46 88
Control 8 TC 32 248 44 90
Median 24Æ5 239 45 89
Control mean 1 ± 9Æ5* 20 ± 160* 2±2 7 ± 3**
values ± SD
a
4 · 104 ⁄ cells for TNF, 10 · 104 ⁄ cells for IFN, bpatient 2, colchicine (1 mg day)1) and aspirin (100 mg day)1), cpatients 3, 8 and 12 were
receiving colchicine (1 mg day)1), dpatient 9, colchicine (1 mg day)1) and salazopyrine (500 mg day)1) at the time of enzyme-linked im-
munospot analysis. Only patient 9 had active disease — she had arthritis of the left sacroiliac joint. *P < 0Æ001, **P ¼ 0Æ004.

2006 British Association of Dermatologists • British Journal of Dermatology 2006 155, pp350–356
354 TNF-a gene polymorphism in Behçet’s disease, A. Akman et al.
many other genes within the close vicinity of this locus have
been analysed for a possible association with the occurrence
of BD. TNF-a is one such example of a gene domain close to
the HLA class I region, and the contribution of TNF gene
polymorphisms to MHC-associated diseases has been thor-
oughly investigated.25 Because the serum levels of certain
cytokines, including TNF-a, have been found to be increased
in patients with BD,26,27 association of TNF-a polymorphisms
with this particular disease has been of great interest.22,28,29
Considering the effect of geographical variations on occur-
rence of this disease, it was important to genotype a group of
healthy Turkish individuals and patients with BD for TNF-a–
1031 polymorphism. In agreement with previously published
data, we have also found an association between the TNF-a–
1031C polymorphism and susceptibility to BD.22 However,
this polymorphism was found to be independent of HLA-B51.
Differently from the previously published data, we extended
our research to analyse the genotypes of patients according to
their clinical features.
Another interesting finding was that patients with a positive
SPT were found to have a higher frequency of the )1031T
allele. Previously, we reported that the positive SPT areas in male
patients with BD displayed a higher androgen receptor index
when compared with the nonlesional skin areas.30 In addition,
SPT have been found to be more strongly positive among males
compared with female patients, indicating that androgens might
play a role both in occurrence and also in increased positivity of
the SPT in male patients with BD. In this current study, we
found that out of 56 patients with positive SPT, 32 were male
and 25 of those were homozygotes for TNF-a–1031T (T/T),
whereas seven of them were heterozygotes (T/C). These results
indicate that the positivity of SPT depends on sex as well as on
carrying a T allele on the )1031 region of the TNF-a gene.
Notably, in patients with hyperandrogenism, it was shown that
there was a decrease in frequency of the )1031C allele.31 The
effect of the TNF-a-1031T/C polymorphism on androgen levels
is not yet clear. However, according to the present data, it is
likely that carrying a C allele at this location may have a prevent-
ive role for the development of SPT.
Besides BD, several other inflammatory diseases, such as
Graves disease,14 Crohn disease15,32,33 and severe adult perio-
dontitis,16 have been associated with different single nucleo-
tide polymorphisms (SNP) of the TNF-a gene promoter
region. However, the published data regarding the function-
ality of these SNPs are rather controversial. This controversy
arises mainly from the techniques used to analyse the func-
tional importance of the TNF-a promoter region polymor-
phisms. Using in vitro techniques, such as transient transfection
assays, and comparing variant TNF enhancer/promoter repor-
ter gene constructs, it has been shown that the )1031CC cau-
ses an increase in TNF-a production.34 On the contrary, when
techniques like allele-specific transcript quantification were
used, no difference was observed between various TNF-a pro-
moter SNPs and mRNA levels.35 Given the controversial
results, we were tempted to analyse four individuals from
each genotype for production of TNF-a and IFN-c. To this

2006 British Association of Dermatologists • British Journal of Dermatology 2006 155, pp350–356
end, we employed an ELISPOT assay and counted the number
of peripheral blood mononuclear cells producing these cytok-
ines when unstimulated or stimulated by LPS. We found that
the number of unstimulated mononuclear cells producing
TNF-a from patients was higher than the number of cells
obtained from the controls. This finding is specific to TNF-a
since we were not able to detect a significant difference in the
number of unstimulated cells producing IFN-c obtained from
both groups (Table 3). Upon LPS stimulation, the number of
cells producing TNF-a obtained from controls with )1031TT
and )1031TC genotypes displayed an 18Æ3- and a 13Æ1-fold
increase, respectively. However, a similar increase was not
observed in the number of cells obtained from patients. This
could be due to the fact that patients already had a high num-
ber of cells producing TNF-a (unstimulated), and additional in
vitro stimulation by LPS did not have the expected consequence
as the cells could be at their upper limits for TNF-a produc-
tion. Nevertheless, we observed a 9-fold increase in the num-
ber of TNF-a producing cells from patients with the )1031CC
genotype, whereas the number of cells from the )1031TT
homozygote or heterozygotic individuals were increased only
1Æ3- and 1Æ2-fold, respectively. We believe this is a potentially
interesting result suggesting that individuals with a )1031CC
genotype are capable of producing more TNF-a and also may
explain the high TNF-a serum levels observed in BD patients.
Treatment and active disease at the time of ELISPOT assay
might be considered to affect the results. Of the patients carry-
ing the TT genotype, patient 2 was receiving colchicine and
aspirin, and patient 3, colchicine. On the other hand, three of
the patients receiving colchicine (patients 8 and 12) or colchi-
cine and salazopyrine (patient 9) were carrying the CC geno-
type. It has been reported that aspirin can downregulate TNF
production by stimulated peripheral blood mononuclear cells.
In this report, the TNF levels were measured using the quanti-
tative sandwich enzyme-linked immunosorbent assay (ELISA)
technique.36 Patient 2 did not have a low TNF level but had a
low IFN production after stimulation. On the other hand,
there has been no study finding that colchicine and salazopy-
rine have an effect on the levels of TNF and IFN. These find-
ings also support that these drugs did not affect the high
cytokine levels in patients carrying the CC genotype. Only
patient 9 had active disease (arthritis of the left sacroiliac
joint) at the time of the ELISPOT assays. She had higher TNF
and IFN levels compared with other patients. Her active dis-
ease could explain the higher levels of these cytokines. How-
ever, the stimulation index was not higher in this patient
compared with other patients carrying the CC genotype. Nev-
ertheless, more work is needed, such as increasing the number
of subjects and also comparing the mRNA levels of TNF-a
before this particular SNP with functionality. Obviously, func-
tional SNPs within the promoter region of TNF-a are expected
to have an effect on mRNA levels and, as a consequence, on
protein levels. However, as TNF production seems to be MHC
associated, other genes residing in the MHC locus might have
an indirect effect on differential TNF-a production. Thus,
genes like SAPK-237 or IkbI38, which are both found in this

locus, could act as well as transcriptional regulators of the
TNF-a gene and might be responsible for the high levels of
TNF-a observed in patients with BD.
Although we were not able to detect a significant difference
in the number of unstimulated cells producing IFN-c between
patients and controls, upon LPS stimulation, increases observed
in the number of cells producing IFN-c from patients were
higher in all genotypes with respect to those seen in controls.
This suggests that the IFN-c response in BD patients is differ-
ent from the TNF-a response and that cells from patients with
BD are more responsive to stimulation for producing IFN-c.
This could be due to the very high TNF-a levels in BD
patients, which could potentiate IFN-c responsiveness.
In conclusion, we have demonstrated the relation of TNF-
a–1031CC genotype and BD in the Turkish population and
also correlation of this SNP with various clinical features seen
in BD. Our study is the second confirming that this particular
polymorphism is associated with BD. In addition, by measur-
ing the TNF-a production at a cellular level, we suggest that
)1031 SNP could have functionality and may have an effect
on high levels of TNF-a production.
Acknowledgments
The study was supported by Akdeniz University Scientific
Research Projects Unit.
References
1 Sakane T, Takeno M, Suzuki N, Inaba G. Behçet’s disease. N Engl J
Med 1999; 341:1284–91.
2 Verity DH, Wallace GR, Vaughan RW, Stanford MR. Behçet’s dis-
ease: from Hippocrates to the third millennium. Br J Ophthalmol
2003; 87:1175–83.
3 Sakane T, Suzuki N, Nagafuchi H. Etiopathology of Behçet disease:
immunological aspects. Yonsei Med J 1997; 38:350–8.
4 Gul A. Behçet’s disease: an update on the pathogenesis. Clin Exp
Rheumatol 2001; 19 (Suppl.): S6–12.
5 Mege J-L, Dilsen N, Sanguedolce V et al. Overproduction of mono-
cyte derived TNF, interleukin (IL) 6, IL 8 and increased neutrophil
superoxide generation in Behçet’s disease. A comparative study
with familial Mediterranean fever and healthy subjects. J Rheumatol
1993; 20:1544–9.
6 Accardo-Palumbro A, Triolo G, Carbone MC et al. Polymorphonu-
clear leukocyte myeloperoxidase levels in Behçet’s disease. Clin Exp
Rheumatol 2000; 18:495–8.
7 Katsantonis J, Adler Y, Orfanos CE, Zoubulis ChC. Adamantiades-
Behçet’s disease: serum IL-8 is a more reliable marker for disease
activity than C-reactive protein and erythrocyte sedimentation rate.
Dermatology 2000; 201:37–9.
8 Ohno S, Ohguchi M, Hirose S et al. Close association of HLA-Bw51
with Behçet’s disease. Arch Ophthalmol 1982; 100:1455–8.
9 Gul A, Inanc M, Ocal L et al. Familial aggregation of Behcet’s dis-
ease in Turkey. Ann Rheum Dis 2000; 59:622–5.
10 Alpsoy E, Yilmaz E, Coskun M et al. HLA antigens and linkage dis-
equilibrium patterns in Turkish Behçet’s patients. J Dermatol 1998;
25:158–62.
11 Mizuki N, Ohno S. Immunogenetic studies of Behcet’s disease. Rev
Rhum Engl Ed 1996; 63:520–7.

2006 British Association of Dermatologists • British Journal of Dermatology 2006 155, pp350–356
TNF-a gene polymorphism in Behçet’s disease, A. Akman et al. 355
12 Arayssi T, Hamdan A. New insights into the pathogenesis and ther-
apy of Behçet’s disease. Curr Opin Pharmacol 2004; 4:183–8.
13 Beutler B. TNF, immunity and inflammatory disease: lessons of the
past decade. J Invest Med 1995; 43:227–35.
14 Simmonds MJ, Heward JM, Howson JM et al. A systematic
approach to the assessment of known TNF-alpha polymorphisms
in Graves’ disease. Genes Immun 2004; 5:267–73.
15 Waschke KA, Villani AC, Vermeire S et al. Tumor necrosis factor
receptor gene polymorphisms in Crohn’s disease: association with
clinical phenotypes. Am J Gastroenterol 2005; 100:1126–33.
16 D’Aiuto F, Parkar M, Brett PM et al. Gene polymorphisms in
pro-inflammatory cytokines are associated with systemic inflamma-
tion in patients with severe periodontal infections. Cytokine 2004;
28:29–34.
17 Lee EB, Kim JY, Lee YJ et al. TNF and TNF receptor polymorphisms
in Korean Behçet’s disease patients. Hum Immunol 2003; 64:1190–4.
18 Evereklioglu C. Current concepts in the etiology and treatment of
Behçet disease. Surv Ophthalmol 2005; 50:297–350.
19 Sorimachi K, Akimoto K, Hattori Y et al. Secretion of TNF-alpha,
IL-8 and nitric oxide by macrophages activated with polyanions,
and involvement of interferon-gamma in the regulation of cytokine
secretion. Cytokine 1999; 11:571–8.
20 Salamone G, Trevani A, Martinez D et al. Analysis of the mecha-
nisms involved in the stimulation of neutrophil apoptosis by
tumour necrosis factor-alpha. Immunology 2004; 113:355–62.
21 Misumia M, Hagiwaraa E, Takeno M et al. Cytokine production
profile in patients with Behçet’s disease treated with infliximab.
Cytokine 2003; 24:210–18.
22 Ahmad T, Wallace GR, James T et al. Mapping the HLA association
in Behçet’s disease: a role for tumor necrosis factor polymor-
phisms? Arthritis Rheum 2003; 48:807–13.
23 International Study Group for Behçet’s Disease. Criteria for diagno-
sis of Behçet’s disease. Lancet 1990; 335:1078–80.
24 Alpsoy E. Behçet’s disease: treatment of mucocutaneous lesions.
Clin Exp Rheumatol 2005; 23:532–9.
25 Kimura T, Goto K, Yabuki K et al. Microsatellite polymorphism
within the MICB gene among Japanese patients with Behçet’s dis-
ease. Hum Immunol 1998; 59:500–2.
26 Akdeniz N, Esrefoglu M, Keles MS et al. Serum interleukin-2,
interleukin-6, tumour necrosis factor-alpha and nitric oxide levels
in patients with Behçet’s disease. Ann Acad Med Singapore 2004;
33:596–9.
27 Oztas MO, Onder M, Gurer MA et al. Serum interleukin 18 and
tumour necrosis factor-alpha levels are increased in Behçet’s dis-
ease. Clin Exp Dermatol 2005; 30:61–3.
28 Ates A, Kinikli G, Duzgun N, Duman M. Lack of association of
tumor necrosis factor-alpha gene polymorphisms with disease sus-
ceptibility and severity in Behçet’s disease. Rheumatol Int 2005.
29 Duymaz-Tozkir J, Gul A, Uyar FA et al. Tumour necrosis factor-
alpha gene promoter region -308 and -376 G–>A polymorphisms
in Behçet’s disease. Clin Exp Rheumatol 2003; 21 (Suppl.):S15–18.
30 Alpsoy E, Elpek O, Yilmaz F et al. Androgen receptor levels of oral
and genital ulcers and skin pathergy test in patients with Behçet’s
disease. Dermatology 2005; 210:31–5.
31 Escobar-Morreale HF, Calvo RM, Sancho J, San Millan JL. TNF-
alpha and hyperandrogenism: a clinical, biochemical, and molecu-
lar genetic study. J Clin Endocrinol Metab 2001; 86:3761–7.
32 Negoro K, Kinouchi Y, Hiwatashi N et al. Crohn’s disease is associ-
ated with novel polymorphisms in the 5¢-flanking region of the
tumor necrosis factor gene. Gastroenterology 1999; 117:1062–8.
33 Orchard TR, Chua CN, Ahmad T et al. Uveitis and erythema nodo-
sum in inflammatory bowel disease: clinical features and the role
of HLA genes. Gastroenterology 2002; 123:714–18.
356 TNF-a gene polymorphism in Behçet’s disease, A. Akman et al.
34 Higuchi T, Seki N, Kamizono S et al. Polymorphism of the 5¢-flank-
ing region of the human tumor necrosis factor (TNF)-alpha gene
in Japanese. Tiss Antigens 1998; 51:605–12.
35 Kaijzel EL, Bayley JP, van Krugten MV et al. Allele-specific quantifi-
cation of tumor necrosis factor alpha (TNF) transcription and the
role of promoter polymorphisms in rheumatoid arthritis patients
and healthy individuals. Genes Immun 2001; 2:135–44.
36 Zailaie MZ. Decreased proinflammatory cytokine production by
peripheral blood mononuclear cells from vitiligo patients following
aspirin treatment. Saudi Med J 2005; 26:799–805.

2006 British Association of Dermatologists • British Journal of Dermatology 2006 155, pp350–356
37 McDonnell PC, DiLella AG, Lee JC, Young PR. Localization of the
human stress responsive MAP kinase-like CSAIDs binding protein
(CSBP) gene to chromosome 6q21Æ3/21Æ2. Genomics 1995; 29:
301–2.
38 Albertella MR, Campbell RD. Characterization of a novel gene in
the human major histocompatibility complex that encodes a poten-
tial new member of the I kappa B family of proteins. Hum Mol Genet
1994; 3:793–9.