16BIT0356 Manav Jain

Java Lab Cycle Sheet

Ques 1

Write a program to demonstrate the knowledge of students in basic Java concepts. Eg., Write a
program to read the First name and Last name of a person, his weight and height using command
line arguments. Calculate the BMI Index which is defined as the individual's body mass divided by
the square of their height.

Category BMI Range-Kg/m2

Underweight <18.5
Normal (healthy weight) 18.5 to 25
Overweight 25 to 30
Obese Class Over 30
Display the name and display his category based on the BMI value thus calculated.

Code:
import java.util.*;
import java.lang.*;
import java.io.*;
public class one {
public static void main(String args[])
{
System.out.println("\n\t\tWelcome Manav Jain 16BIT0356\n");
Scanner sc = new Scanner(System.in);
System.out.println("Enter the First and Last name of person (Sepreated by space) :");
String x = sc.next();
String p = sc.next();
System.out.println("Enter the Height of "+x+" "+p+" Person (in cm): ");
double y = sc.nextDouble();
System.out.println("Enter the Weight of "+x+" "+p+" Person (in kg): ");
double z = sc.nextDouble();
double b = z/((y/100)*(y/100));
String bmi = Double.toString(b)+ " Kg/m2";
String a;
if(b < 18.5)
{
a = "Underweight";
}
else if(b>=18.5 && b<=25)
{
a = "Normal (healthy weight)";
}
else if(b>25 && b<=30)
{
a = "Overweight";
}
else
{
a = "Obese Class";
}
System.out.println("\n"+x+" "+p+" :"+" "+a+" "+"BMI - "+bmi);
}
}

Output

Ques 2
Write a program to demonstrate the knowledge of students in multidimensional arrays and
looping constructs.

Eg., If there are 4 batches in BTech(IT) learning ‘ITE2005’ course, read the count of the slow
learners (who have scored <25) in each batch. Tutors should be assigned in the ratio of 1:4 (For
every 4 slow learners, there should be one tutor). Determine the number of tutors for each
batch. Create a 2-D jagged array with 4 rows to store the count of slow learners in the 4
batches. The number of columns in each row should be equal to the number of groups formed
for that particular batch ( Eg., If there are 23 slow learners in a batch, then there should be 6
tutors and in the jagged array, the corresponding row should store 4, 4, 4, 4, 4,3). Use for-each
loop to traverse the array and print the details. Also print the number of batches in which all
tutors have exactly 4 students.
 Code:

import java.util.*;
import java.lang.*;
public class two
{
public static void main(String[] args) {
int i, j;
double t;
int arr[][] = new int[4][]; // Declaring 2-D array with 4 rows
Scanner sc = new Scanner(System.in); // input for each batch
for(i = 0; i < arr.length; i++)
{
System.out.print("Enter number of students for batch " + (i+1) + ": ");
t = sc.nextDouble();
arr[i] = new int[(int)Math.ceil(t/4)];
for(j = 0; j < arr[i].length; j++)
{
if(t >= 4)
{
arr[i][j] = 4;
}
else
{
arr[i][j] = (int)t;
}
t = t - 4;
}
}
// Displaying the values of 2D Jagged array
int cf = 0;
System.out.println("\n2D Jagged Array Contents are -\n");
for(int[] m:arr)
{
for(int k:m)
{
System.out.print(k+ " ");
if(k==4)
{
cf++;
}
}
System.out.println();
}
System.out.println("\nNumber of tutors with 4 students are: " + cf );
}
}
Output

Ques 3
Write a program to demonstrate the knowledge of students in String handling.

Eg., Write a program to read a chemical equation and find out the count of the reactants and
the products. Also display the count of the number of molecules of each reactant and product.
Eg., For the equation, 2NaOH + H2SO4 -> Na2SO4+ 2H2O, the O/P should be as follows.
Reactants are 2 moles of NaOH, 1 mole of H2SO4.
Products are 1 mole of Na2SO4 and 2 moles of H2O.

Code:
import java.util.*;
import java.lang.*;
import java.io.*;
public class three
{
public static void main(String args[])
{
Scanner sc = new Scanner(System.in);
System.out.println("Enter the Equation");
String a = sc.nextLine();
System.out.println("\r\n");
String[] b = a.split(" -> ",2);
String y = new String("Reactants are ");
for(String i:b)
{
 String[] c = i.split(" [+] ",5);
for(String j:c)
{
char x = j.charAt(0);
int m =0;
if(Character.isDigit(x)==true)
{
m = Character.getNumericValue(x);
y=y+m+" mole of "+j.substring(1)+", ";
}
else
{
m=1;
y=y+m+" mole of "+j+", ";
}
}
String z = y.substring(0,y.length()-2);
System.out.println(z+".");
y="";
y=y+"Products are ";
}
}
}

Output
Ques 4

Write a program to demonstrate the knowledge of students in advanced concepts of Java string
handling.

Eg., (Bioinformatics: finding genes) Biologists use a sequence of letters A, C, T, and G to

model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends
before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3
and the gene does not contain any of the triplets ATG, TAG, TAA, and TGA. Write a program
that prompts the user to enter a genome and displays all genes in the genome. If no gene is
found in the input sequence, displays no gene. Here are the sample runs:

Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT

O/P: TTT
GGGCGT
Code:
import java.util.*;
import java.lang.*;
import java.io.*;
public class four
{
public static void main(String[] args)
{
Scanner sc = new Scanner(System.in);
System.out.println("Enter the String");
String a = sc.nextLine();
for(int i=0;i<a.length()-2;i++)
{
String b = a.substring(i,i+3);
if(b.equals("ATG"))
{
int x;
x = a.indexOf(b,i);
System.out.println(x);
aaa:
for(int j=i+3;j<a.length()-2;j++)
{
String c = a.substring(j,j+3);
if(c.equals("TAG") || c.equals("TAA") || c.equals("TGA"))
{
int y;
y = a.indexOf(c,j);
System.out.println(y);
String z = a.substring(x+3,y);
if(y-x-3!=0)
{
for(int k=0;k<z.length()-2;k++)
 {
String e = z.substring(k,k+3);
if(e.equals("ATG") || e.equals("TAG") || e.equals("TAA") ||
e.equals("TGA"))
{
break aaa;
}
}
System.out.println(z);
break aaa;
}
else
{
System.out.println("No Gene");
}
}
}
}
}
}
}

Output
Ques 5

Write a program to demonstrate the knowledge of students in working with classes and objects.
Eg.,Create a class Film with string objects which stores name, language and lead_actor and
category (action/drama/fiction/comedy). Also include an integer data member that stores the
duration of the film. Include parameterized constructor, default constructor and accessory functions
to film class. Flim objects can be initialized either using a constructor or accessor functions. Create
a class FilmMain that includes a main function. In the main function create a vector object that
stores the information about the film as objects. Use the suitable methods of vector class to iterate
the vector object to display the following
a. The English film(s) that has Arnold as its lead actor and that runs for shortest duration.
b. The Tamil film(s) with Rajini as lead actor.
c. All the comedy movies.

Code:

class Film{
String name;
String language;
String lead_actor;
String category;
int duration;
Film(){
name = null;
language = null;
lead_actor = null;
category = null;
duration = 0;
}
Film(String n, String l, String a, String c, int d){
name = n;
language = l;
lead_actor = a;
category = c;
duration = d;
}
}
public class FlimMain {
public static void main(String[] args) {
Film[] films = new Film[5];
films[0] = new Film();
films[0].name = "Golmal Again";
films[0].language = "Hindi";
films[0].lead_actor = "Ajay";
films[0].duration = 8000;
films[0].category = "Comedy";
films[1] = new Film();
films[1].name = "Terminator";
films[1].language = "English";
films[1].lead_actor = "Arnold";
films[1].duration = 6000;
films[1].category = "Action";
films[2] = new Film();
films[2].name = "Robot 1";
films[2].language = "Tamil";
films[2].lead_actor = "Rajini";
films[2].duration = 7000;
films[2].category = "Comedy";

films[3] = new Film();

films[3].name = "Terminator 2";
films[3].language = "English";
films[3].lead_actor = "Arnold";
films[3].duration = 5000;
films[3].category = "Drama";
films[4] = new Film();
films[4].name = "Robot 2";
films[4].language = "Tamil";
films[4].lead_actor = "Rajini";
films[4].duration = 8888;
films[4].category = "fiction";
int min = 9999;
int jmin = 0;
System.out.println("\n");
System.out.println("(a):");
for(int j = 0; j < 5; j++)
{
if(films[j].lead_actor.equals("Arnold"))
if(films[j].duration < min){
min = films[j].duration;
jmin = j;
}
}
System.out.println("Shortest Arnold film is " + films[jmin].name + " and duration is " + min +
"Seconds.");
System.out.println("\n");
System.out.println("(b):");
for(int j = 0; j < 5; j++)
{
if(films[j].lead_actor.equals("Rajini") && films[j].language.equals("Tamil"))
{
System.out.println("Tamil movie is " + films[j].name + " with Rajini as lead Actor.");
}
}
System.out.println("\n");
System.out.println("(c):");
for(int j = 0; j < 5; j++)
{

if(films[j].category.equals("Comedy"))
{
System.out.println("Comedy movie: " + films[j].name);
}
}
 }
}

Output