Blackwell Science, LtdOxford, UKMMIMolecular Microbiology 1365-2958Blackwell Publishing Ltd, 2003502609621Original ArticleK. Savijoki et al.

RecA and CIpP modulate the expression of HdiR

Molecular Microbiology (2003) 50(2), 609–621 doi:10.1046/j.1365-2958.2003.03713.x

Heat and DNA damage induction of the LexA-like

regulator HdiR from Lactococcus lactis is mediated by
RecA and ClpP

Kirsi Savijoki,1,2 Hanne Ingmer,3 Dorte Frees,3 involved in DNA replication, repair and mutagenesis
Finn K. Vogensen,2 Airi Palva1 and Pekka Varmanen1* (reviewed in Friedberg et al., 1995), and while the error-
1
University of Helsinki, Faculty of Veterinary Medicine, free pathway repairs most lesions, the elimination of some
Department of Basic Veterinary Sciences, Division of lesions is inherently mutagenic (SOS mutagenesis)
Microbiology and Epidemiology, PO Box 57, 00014 (reviewed in Walker et al., 2000; Woodgate, 2001). Exten-
Helsinki University, Helsinki, Finland. sive studies of the Gram-negative bacterium Escherichia
Departments of 2Dairy and Food Science, DK-1958, and coli have established the current paradigm of the SOS
3
Veterinary Microbiology, DK-1870, The Royal Veterinary response. Under physiological conditions, the SOS regu-
and Agricultural University, Frederiksberg C, Denmark. lon is repressed by the LexA bound to its consensus
binding sites located in the promoter regions of target
genes including lexA itself, recA and the umuDC operon
Summary
(Friedberg et al., 1995; Fernandez de Henestrosa et al.,
The SOS response is a paradigm for bacterial cells 2000; Courcelle et al., 2001). Upon DNA damage, RecA
response to DNA damage. Yet some bacteria lack a binds to single-stranded DNA regions generated by
homologue of the SOS regulator, LexA, including the replication blocks, which leads to the formation of a nucle-
Gram-positive, Lactococcus lactis. In this organism oprotein filament (RecA*) (Kowalczykowski, 1991). The
we have identified a negative transcriptional regula- activated RecA* possesses recombinase and co-protease
tor, HdiR that induces target gene expression both activities (Kowalczykowski et al., 1994), the latter being
upon DNA damage and heat shock. Gel mobility shift required for self-cleavage of LexA, the SOS mutagenesis
assays revealed that the binding site for HdiR is protein UmuD and several phage repressor proteins
located within an inverted repeat structure. HdiR is (Little, 1984; 1991; Kim and Little, 1993). The RecA*-
able to carry out a self-cleavage reaction in vitro at promoted self-cleavage occurs between the Ala84 and
high pHs, while in vivo it undergoes RecA-dependent Gly85 residues of LexA resulting in inactivation of the
self-cleavage in the presence of a DNA-damaging repressor activity and induction of the SOS regulon (Little,
agent. Intriguingly, the N-terminal cleavage product of 1984). In the absence of RecA*, LexA is cleaved at high
HdiR retains DNA binding activity, and only when pH demonstrating that the protein is truly able to perform
degraded by the Clp protease, is gene expression self-cleavage (Little, 1991; Smith et al., 1991).
induced. Thus, the activity of HdiR in response to DNA Most of the SOS mutagenesis is caused by the DNA
damage is controlled by sequential proteolysis, polymerase V encoded by the umuDC operon (Tang et al.,
involving self-cleavage and Clp-dependent degrada- 1998; 1999; Reuven et al., 1999). When the replication
tion of HdiR. During heat-stress, limited self-cleavage fork encounters a lesion that cannot be repaired, error-
occurs; however, recA and clpP are still required for prone replication across the replication block is required
full induction of target gene expression. Thus, our and DNA PolV performs the translesion synthesis (Pham
data show that common elements are involved in both et al., 2001). The PolV complex consists of one molecule
the DNA damage and the heat-mediated induction of of UmuC together with two molecules of activated UmuD
the HdiR regulon. (UmuD¢) that arises from self-cleavage of the native
UmuD in a reaction resembling the self-cleavage of LexA
(Burckhardt et al., 1988). Because the activity of the PolV
Introduction
is mutagenic, elaborate mechanisms are employed to
The ability to repair DNA is a basic feature of all living keep the level of the Umu proteins to a minimum (Wood-
organisms. DNA damage induces the expression of genes gate and Levine, 1996; Smith and Walker, 1998). At the
transcriptional level, expression of the umuDC operon
is tightly regulated by the LexA, while at the post-
Accepted 7 July, 2000. *For correspondence. E-mail
pekka.varmanen@helsinki.fi; Tel. (+358) 9 19149787; Fax (+358) 9 translational level the amount of the mutagenically inactive
19149799. and active forms of the UmuD are controlled by the Lon
© 2003 Blackwell Publishing Ltd
610 K. Savijoki et al.
and ClpXP proteases, respectively (Frank et al., 1996;
Gonzalez et al., 1998; 2000). The ClpXP complex, which
consists of a proteolytic subunit, ClpP, associated with the
ClpX ATPase, is also involved in the degradation of the
self-cleaved fragments of LexA (Flynn et al., 2003). In a
very recent report, the degradation of the N-terminal frag-
ment of LexA by the ClpXP has been shown to be impor-
tant for survival of E. coli during DNA damage, which was
suggested to be a result of retention of some repressor
activity (Neher et al., 2003)
In organisms other than E. coli, the induction and reg-
ulation of the SOS response pathways are less well
understood. SOS-like responses have been detected in
several bacteria and the LexA homologues characterized
to date appear to be functionally conserved (reviewed in
Eisen and Hanawalt, 1999). However, the composition,
as well as the regulation of the LexA regulon, exhibits
great diversity (reviewed in Eisen and Hanawalt, 1999;
Campoy et al., 2002). In the Gram-positive Bacillus subti-
lis, the induction of the SOS response occurs basically in
a manner analogous to E. coli (Raymond-Denise and
Guillen, 1991; 1992), but during competence develop-
ment ComK can alleviate LexA repression of recA gene
expression without displacing LexA (Haijema et al., 1996;
Hamoen et al., 2001). This process is controlled by pro-
teolysis of ComK by the ATP-dependent proteolytic com-
plex ClpCP complex, which consists of the ATPase ClpC
and ClpP (Turgay et al., 1998). The ClpCP protease also
degrades the heat shock regulator CtsR in B. subtilis
(Krüger et al., 2001). Besides the LexA in E. coli, the
regulators such as the cell-cycle regulator protein CtrA in
Caulobacter crescentus (Jenal and Fuchs, 1998) and the
transcriptional activator PopR in Streptomyces lividans
(Viala and Mazodier, 2002) have also been shown to be
substrates for ClpP. However, less is known about the
ClpP-mediated degradation in terms of gene regulation in
other prokaryotes.
In the present study, we have identified a novel LexA-
like repressor, HdiR, from the Gram-positive bacterium,
Lactococcus lactis that co-operates the response to both
DNA damage and heat shock in a single regulatory
molecule.
Results
Identification of HdiR from Lactococcus lactis ssp.
cremoris MG1363
In search of substrate proteins for the L. lactis Clp pro-
tease, we examined whether the L. lactis ssp. cremoris
MG1363 genome encodes a homologue of UmuD.
Western blot analysis using a polyclonal antibody raised
against E. coli UmuD showed that L. lactis MG1363
does not encode a close homologue of UmuD (data not
© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 609–621
shown). Furthermore, a search of the L. lactis ssp. lactis
IL1403 genome sequence failed to reveal an umuD
gene, although genetic evidence has established that
UmuC is present in L. lactis IL1403 (Bolotin et al.,
2001). However, when we did the search using an
UmuD-like protein encoded by the Tn5252 transposon
element present in the Streptococcus pneumoniae
genome (Munoz-Najar and Vijayakumar, 1999), we
retrieved a protein (YnaB) with 32% identity (Bolotin
et al., 2001). The region of the highest similarity is cen-
tred on the three conserved domains typical of the
LexA-family of proteins, including LexA, UmuD, MucA,
RumA and cI-like phage repressors (Little, 1984; Perry
et al., 1985; Kulaeva et al., 1995). The amino acids
Ala84, Gly85, Ser119 and Lys156 involved in the RecA-
dependent self-cleavage of the E. coli LexA (Little, 1984;
Slilaty and Little, 1987) are also conserved in the
IL1403 YnaB (Ala126, Gly127, Ser160, Lys200) (data
not shown). Distinct from the transposon UmuD, YnaB
carries a putative N-terminal helix–turn–helix motif
(HTH) and is therefore classified as a putative transcrip-
tion regulator (Bolotin et al., 2001). Thus, based on the
sequence analysis YnaB has resemblance to both LexA
and UmuD. Notably, a BLAST search against the IL1403
genome suggests that L. lactis is devoid of conserved
LexA (data not shown).
In order to characterize YnaB further, we sequenced
the gene encoding the YnaB orthologue from MG1363,
and based on our subsequent studies, it was named as
a heat shock and DNA-damage induced regulator
(hdiR). The hdiR gene encodes a protein of 252-amino-
acid residues with a calculated molecular mass of
28.7 kDa. The deduced amino acid sequence of HdiR
shares 90% identity with the YnaB from IL1403 and
homologues are present in species of Streptococcus
and Staphylococcus (data not shown). Although, these
uncharacterized proteins share only 26–32% overall
amino acid identity with the HdiR, the amino acids,
flanking the residues typical for self-cleavage of LexA
proteins, are conserved and they all contain an N-termi-
nal HTH motif. Multiple alignments of HdiR homologues
and LexA proteins are presented as Supplementary
material (Fig. S1).
In L. lactis MG1363, the hdiR gene is preceded by a
putative conserved prokaryotic vegetative promoter, a
ribosome binding site (S.D.), as well as two inverted
repeats (Fig. 1A). The more distant inverted repeat 2 (IR2)
resembles a typical rho-independent type transcription
terminator that presumably terminates expression of the
upstream located ynaC (Fig. 1A). The proximal inverted
repeat 1 (IR1) is located two nucleotides upstream of the
putative -35 region. No apparent transcription terminator
structures were identified immediately downstream of
hdiR, suggesting that hdiR forms a dicistronic operon

TATAAT
TTGATT TATAAT
Fig. 1. Partial nucleotide sequence of the MG1363 hdiR region.
A. DNA sequence of the putative regulatory region and the 5¢ end of the HdiR coding region. The predicted -10/-35 hexanucleotides are boxed.
The translation stop codon of the upstream ynaC, the putative ribosome-binding site (SD) and the start codon of the HdiR are in boldface. IR1
and IR2 are shown by dotted arrows. Arrows that start with a dot show the primers used to generate DNA fragments for the DNA binding assays.
B. The nucleotide sequence surrounding the IR1 region of the hdiR and IR1-like sequences preceding the ynaB and umuC genes in IL1403.
Asterisks denote to identical nucleotides.
together with the downstream located ynaA gene (data
not shown).
hdiR expression is regulated by heat and DNA damage in
L. lactis MG1363
In E. coli, autoregulated expression of LexA is induced by
DNA damaging conditions (Brent, 1982). Because HdiR
resembles LexA, we examined whether the DNA cross-
linking agent, mitomycin C (MMC), induces HdiR expres-
sion. Northern blot analysis of the L. lactis MG1363
revealed a single hdiR-specific transcript of 1.0 kb, indi-
cating that hdiR (756 bp) forms a dicistronic operon with
the ynaA gene (200 bp) that locates downstream of hdiR
(data not shown). Furthermore, hdiR expression in
MG1363 was induced ~15-fold by 20 min exposure to
MMC (Fig. 2A).
We also examined if hdiR is induced by other environ-
mental conditions, such as heat shock at 38.5∞C, cold
shock at 10∞C, low pH (pH 4.0) or sodium chloride (1.5%)
and observed that only heat-shock affected hdiR expres-
sion (data not shown). While the optimum of hdiR expres-
sion in the presence of MMC is reached between 15 and
30 min (data not shown), an ~15-fold induction was
already reached 5 min after shifting the cells to elevated
temperature (Fig. 2B). Curiously, prolonged incubation at
an elevated temperature showed that hdiR expression
was re-repressed back to the level prior to induction
already after 20 min. In the presence of MMC, however,
the level of hdiR expression was still six times the un-
induced level after 60 min (Fig. 2A and B).
© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 609–621
RecA and CIpP modulate the expression of HdiR 611
TTGACA
TTGACA
TTGACA
HdiR is a DNA-binding protein that regulates its
own expression
In order to determine if hdiR expression is autoregulated,
we constructed a mutant strain (PV114) that expresses a
derivative of HdiR (HdiR¢) lacking the HTH motif potentially
involved in DNA binding. Northern blot analysis revealed
that in the absence of DNA damage, hdiR¢ expression was
increased 20-fold compared with the level in wild-type (wt)
cells, and it was unaffected by DNA damage (Fig. 2A). As
these results suggested that hdiR expression is autoreg-
ulated, we used a mobility shift assay to examine if HdiR
is able to bind to its promoter region. To this end, we
purified HdiR from E. coli cells expressing a histidine-
tagged derivative of HdiR (data not shown). When HdiR
was incubated with a DNA fragment covering -221 to +5
relative to the hdiR start codon, we found that increasing
amounts of HdiR retarded the mobility of the fragment
(Fig. 3A, lanes 1–3). When we performed the assay with
a fragment covering the region -372 to -82 relative to
the translation start site, HdiR binding was completely
abolished (data not shown), indicating that HdiR binds a
site located between IR2 and the hdiR start codon. Fol-
lowing cloning of IR1 and IR2 sequences as 22 bp frag-
ments into pBluescript-II SK+, we observed that only the
IR1 containing DNA was retarded by HdiR (Fig. 3B). Thus,
IR1 contains the target sequence of HdiR.
HdiR regulates the expression of UmuC in L. lactis
With the aim of identifying genes in the HdiR regulon, we
used a proteomic approach to find proteins, whose expres-
612 K. Savijoki et al.
Fig. 2. Northern analysis of hdiR and umuC expression.
A. hdiR expression in MG1363 and PV114 cells before (0¢) and 20,
40 and 60 min after the addition of MMC (3 mM).
B. hdiR expression in MG1363 cells before (0¢) and 5 and 20 min after
transfer from 25∞C to 38.5∞C.
C. umuC expression in PV121 (MG1363 with pKS50) and in PV122
(PV114 with pKS50) cells before (0¢) and 20 min after the addition of
MMC (3 mM). The bar diagrams show the relative mRNA induction
ratios calculated by dividing the signal from the RNA sample by the
signal from the MG1363 (A and B) or the PV121 (C) cells at 0 min.
The RNA amounts on the membrane were corrected after rRNA
hybridization (data not shown).
sion was changed in PV114 compared with those expre-
ssed in MG1363. However, we were unable to detect any
changes in the overall protein patterns between the wt and
the PV114 mutant strains when cells were grown in a
chemically defined media at 30∞C and pulse labelled with
[35S]-methionine followed by separation of proteins by two-
dimensional protein gel electrophoresis (data not shown).
Alternatively, we searched the IL1403 genome sequence
databank (http://spock.jouy.inra.fr/) with the IR1 core motif
(ATCAGW5CTGAT) and found an almost identical
sequence that partially overlaps the putative -10 region
of the umuC gene (Fig. 1B). Southern analysis of MG1363
with a probe derived from the IL1403 umuC gene indicated
that MG1363 is devoid of an umuC homologue (K. Savijoki,
unpubl. data). Therefore, we examined if HdiR binds to the
umuC promoter region amplified from the IL1403 genome.
In gel retardation experiments, HdiR, indeed, retarded the
© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 609–621
252 bp fragment carrying the IL1403 umuC promoter
(Fig. 3A, lanes 7–9). To confirm that HdiR regulates umuC
expression in vivo, we introduced a plasmid carrying the
IL1403 umuC structural gene and its putative promoter
region (pKS50) into wt (MG1363) and PV114 cells to obtain
PV121 and PV122 respectively. When PV121 and PV122
were treated with MMC, Northern blot analysis revealed
two umuC-specific transcripts (2.4 kb and 1.4 kb), which
both were induced by MMC in wt cells (PV121) and only
marginally (<1.5-fold) in the strain encoding HdiR¢ (PV122)
(Fig. 2C). However, in the absence of MMC, the expression
of both umuC transcripts were 4.4-fold higher in PV122
compared with PV121, showing that HdiR regulates the
expression of umuC from IL1403.
In many bacteria, LexA regulates the expression of recA
(Friedberg et al., 1995). Therefore, we investigated if HdiR
Fig. 3. DNA binding of HdiR.
A. The binding of the His6-HdiR to the putative promoter regions of
the MG1363 hdiR, IL1403 recA and IL1403 umuC. Reaction contain-
ing 35 ng of the PCR-derived DNA fragments preceding the hdiR
(lanes 1–3), recA (lanes 4–6) and umuC (lanes 7–9) mixed with 0 ng
(lane 1, 4 and 7), 14 ng (lane 2, 5 and 8) or 28 ng (lanes 3, 6 and 9)
of the HdiR.
B. The binding of the His6-HdiR to the pBluescript-II SK+ multiple
cloning site containing IR1 (lanes 1–3) or IR2 (lanes 4–5). Reaction
containing 35 ng of the PCR-derived DNA fragments from pBlue-
script-IR1 (lanes 1–3) and from pBluescript-IR2 (lanes 4–5) mixed
with 0 ng (lane 1), 14 ng (lane 2 and 4) or 28 ng (lanes 3 and 5) of
the HdiR. Reactions were separated in a 5% PAGE followed by
staining the gel with EtBr and scanning with a Fluor-S Imager (Bio-
Rad). The positions of unbound (or free) DNA (U) and protein–DNA
complexes (B) are indicated.

binds to the recA promoter region of IL1403. However, we
were unable to detect such a binding (Fig. 3A, lanes 4–
6). Furthermore, Northern blot analysis showed that
expression of recA was identical in MG1363 and PV114
indicating that HdiR is not a repressor of recA expression
(data not shown).
Cleavage of HdiR is stimulated by RecA
A cardinal feature of the members of the LexA protein
family is their ability to perform self-cleavage in vivo requir-
ing an activated form of RecA, while self-cleavage occurs
spontaneously in vitro at high pH (Little, 1991). To inves-
tigate if HdiR undergoes pH-dependent self-cleavage, we
incubated the purified His6-HdiR protein at various pHs
and observed that self-cleavage of His6-HdiR proceeded
spontaneously at pH 8.0–10, resulting in two products of
~14 and ~16 kDa respectively. After raising polyclonal
antibodies against His6-HdiR protein, we analysed the
cleavage products by Western blot analysis and did not
detect any additional protein bands (Fig. 4B). N-terminal
sequence analysis of the smaller C-terminal cleavage
product revealed a sequence, Gly–Phe–Gln–Thr–Ala–
Asn, showing that the cleavage had occurred between the
Ala126 and Gly127 residues.
Next, we examined if RecA stimulates HdiR self-cleav-
age in vivo. However, the chromosomally expressed HdiR
was not detectable by Western blot analysis, either in the
presence or absence of heat or MMC (data not shown).
Therefore, we facilitated the detection by overexpressing
HdiR from a plasmid carrying the hdiR gene inserted
behind a constitutive promoter. The resulting plasmid,
pKS49, was transferred into wt and the recA mutant
Fig. 4. pH-dependent cleavage of the His6-HdiR in the pH range of
6.0 to pH 10.
A. Visualization of the autodigestion reactions containing 500 ng of
the purified HdiR on SDS–PAGE gels stained with Coomassie brilliant
blue.
B. The autodigestion reactions containing 100 ng of the HdiR analy-
sed by Western blotting with anti-His6-HdiR antibodies (1:5000). The
HdiR-derived peptides with calculated molecular masses are indi-
cated with arrows on the right.
© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 609–621
RecA and CIpP modulate the expression of HdiR 613
VEL1122 (Duwat et al., 1995a) to obtain the strains KS78
and KS80 respectively. Subsequently, we examined the
stability of HdiR under DNA damaging conditions by
exposing both strains to MMC followed by inhibition of
protein synthesis by chloramphenicol (CAM). At the time
points indicated, protein extracts were analysed by West-
ern blot analysis (Fig. 5A). The result revealed that in the
strain lacking RecA (KS80), the amount of HdiR remained
unaltered 45 min after the addition of CAM, whereas HdiR
was rapidly cleaved in the presence of RecA, leaving
essentially no unprocessed HdiR 30 min after blocking
the protein synthesis. These results show that the self-
cleavage of HdiR in vivo is dependent on the RecA.
Because hdiR is induced by heat, we next investigated
if RecA-mediated self-cleavage of HdiR occurs also under
heat-stress conditions. When the in vivo stability of HdiR
was analysed as described above, we found that the
amount of intact HdiR in the wt (KS78) cells decreased,
albeit slowly, after the addition of CAM, whereas HdiR
remained stable in the recA mutant cells (KS80) (Fig. 5C).
Furthermore, we were unable to detect the cleavage prod-
ucts in recA mutant cells, whereas a small amount of
~14 kDa fragment appeared in samples obtained from the
wt cells (Fig. 5C), indicating that self-cleavage of HdiR
occurs also under heat-shock conditions. However,
because only a low level of self-cleavage appears to take
place during heat-stress, we wished to determine if recA
plays a role in inducing hdiR expression under these con-
ditions. When we examined hdiR expression in the recA
mutant cells, we found, as expected, that induction by
MMC was eliminated in the absence of RecA (see
Fig. 7C). We also observed that induction by heat was
completely abolished in cells lacking RecA, demonstrating
that RecA, indeed, is required for heat induction of hdiR.
ClpP modulates HdiR activity
According to several independent Northern analyses the
maximum induction level of hdiR expression is reached
between 15 and 30 min after addition of MMC (data not
shown). When comparing the relatively slow induction of
hdiR expression in response to MMC (Fig. 2A) with the
rapid self-cleavage of overexpressed HdiR under the
same conditions (Fig. 5A), the results suggested that
cleavage of HdiR might not be sufficient to induce expres-
sion. Therefore, we examined the DNA binding activity of
self-cleaved HdiR. Interestingly, HdiR incubated overnight
at pH 10 was still capable of retarding the hdiR and umuC
promoter fragments in the gel-shift assay (Fig. 6A and B,
lanes 4 and 5), where the migration of the DNA–protein
complex was faster compared with the reactions contain-
ing equal amounts of HdiR incubated at pH 7 (Fig. 6A and
B, lanes 2 and 3). These results show that HdiR cleavage
products are still able to bind the target sequence.
614 K. Savijoki et al.

Fig. 5. In vivo stability of the HdiR.

A. KS78, KS79, and KS80 cells treated with MMC (3 mM) followed by sample withdrawal at 0, 15, 30 and 45 min after the addition of CAM
(50 mg ml-1).
B. KS78 and KS79 cells treated with MMC followed by 0, 15, 30, 45 and 60 min after the addition of CAM.
C. KS78, KS79 and KS80 cells shifted from 25∞C to 38.5∞C followed by sample withdrawal at 0, 10, 20, 30 and 45 min after the addition of CAM.
Protein samples (50 mg) were analysed by SDS–PAGE, followed by Western blotting with anti-His6-HdiR antibodies (1:5000). An unknown protein,
independent of HdiR overproduction (data not shown), migrating below the unprocessed HdiR was recognized by the antibody in all the protein
samples. This protein was used as an internal control for loading of equal amounts of protein samples.

When observing self-cleavage of HdiR in vivo, we had
noted that only the 14.5 kDa N-terminal cleavage product
was visible and that this product also appeared unstable
(Fig. 5A). Given the resemblance of HdiR to LexA and
UmuD, which both, after processing, are targets of the Clp
proteolytic complex, we examined HdiR stability in a strain
lacking ClpP (Frees and Ingmer, 1999). After MMC addi-
tion, we found that the half-life of unprocessed HdiR was
increased ~30% in the absence of ClpP compared with
the wt cells (Fig. 5A). Furthermore, in the clpP mutant,
both of the HdiR cleavage products were visible (Fig. 5A
and B), and while the half-life of the 14.5 kDa fragment in
© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 609–621
the wt cells was 22 min ± 2min (determined between 15
and 60 min), this fragment was not degraded in the clpP
mutant cells (Fig. 5B). These results show that both of the
HdiR cleavage products are targets of the Clp protease.
Next, we studied the effect of ClpP on HdiR stability
after heat shock and saw that while the amount of the
HdiR decreased in the wt cells, no significant change was
detected in cells lacking ClpP (Fig. 5C). Additionally, a
faint band at 14 kDa could be detected in all the time
points of the wt cells, while in the clpP mutant strain it was
only detected in the sample withdrawn 45 min after the
addition of CAM.

Fig. 6. Effect of self-cleavage on DNA binding of the His6-HdiR. Prior
to gel mobility shift assay, His6-HdiR (25 ng ml-1) was incubated for
16 h in 50 mM Tris-HCl pH 7.0 or 50 mM glycine pH 10.0.
A. Reactions with the hdiR promoter (35 ng) fragment and 12.5 ng
(lanes 2 and 4) or 25 ng (lanes 3 and 5) of the His6-HdiR incubated
at pH 7.0 (lanes 2 and 3) and at pH 10 (lanes 4 and 5).
B. Reactions with the umuC promoter (35 ng) and 12.5 ng (lanes 2
and 4) or 25 ng (lanes 3 and 5) of the His6-HdiR incubated at pH 7.0
(lanes 2 and 3) and at pH 10 (lanes 4 and 5). Lanes 1 refer to
promoter fragments incubated without His6-HdiR. The positions of
unbound (or free) DNA (U) and protein–DNA complexes (B) are
indicated.
In order to confirm that ClpP modulates the activity of
the HdiR in vivo, we analysed hdiR expression by North-
ern analysis of the wt and clpP mutant strains. The result
demonstrates that in the absence of ClpP the induction of
the hdiR expression in response to MMC (Fig. 7A) and
heat (Fig. 7B) was reduced fourfold compared with the
induction obtained in the wt cells. Thus, cells lacking ClpP
are restricted in their ability to induce the HdiR regulon
demonstrating that ClpP modulates its activity in vivo.
HdiR is required for optimal growth of MG1363
Because our data demonstrated that HdiR activity is mod-
ulated by heat and MMC, we wished to determine if HdiR
is important for viability under these conditions. Therefore,
we attempted to construct a deletion mutant lacking the
entire hdiR reading frame. However, our repeated
attempts for creating such a strain have been unsuccess-
ful. Alternatively, we examined the ability of the wt and
PV114 mutant cells to grow in the presence and absence
of MMC and at an elevated temperature (37∞C), and found
no difference in the colony forming ability between the two
strains. However, PV114 generally required longer time of
incubation to form colonies of same size as MG1363
under all conditions tested (data not shown). PV114 was
complemented with a plasmid (pKS47) encoding HdiR,
but not the downstream encoded YnaA, to obtain KS74.
pKS47 was also introduced into MG1363 yielding KS73.
The growth rates of the KS73, KS74 and their parental
strains (MG1363, PV114) carrying the vector, pCI372,
were measured using the Bioscreen monitoring system.
© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 609–621
RecA and CIpP modulate the expression of HdiR 615
The results from the growth experiments carried out at
30∞C without MMC using five parallel samples revealed
that while the doubling time for MG1363(pCI372) was
59.1 min (SD 1.66), it was increased in PV114(pCI372) to
78.2 min (SD 2.26). When the strains were cultivated at
an elevated temperature (37∞C), the PV114(pCI372) failed
to initiate growth, whereas the KS74 and KS73 and
MG1363(pCI372) grew exponentially with the generation
times 149.8 min (SD 10.91), 138.2 min (SD 4.97) and
152.8 min (SD 4.57) respectively. These results show that
when HdiR lacks the HTH domain, the strain has a growth
defect, which abolishes growth at a high temperature
under the conditions used.
Discussion
In bacterial cells, DNA damage response relies on LexA-
like transcriptional regulators, which in the absence of
DNA damage bind to DNA sequences located upstream
of target genes, and upon DNA damage undergo RecA-
mediated self-cleavage to relieve the repression of target
gene expression (Little and Mount, 1982; Little, 1984; Kim
and Little, 1993). We have characterized a transcriptional
regulator, HdiR, from the Gram-positive bacterium, Lacto-
coccus lactis that possesses several LexA-like features
including negative auto-regulation of its own synthesis,
induction by MMC and self-cleavage between the con-
served Ala and Gly residues. Prior to LexA-like self-
cleavage, RecA binds to single-stranded DNA regions,
while polymerizing into a nucleoprotein filament. This
change enables RecA to act as co-protease in the self-
cleavage reactions of LexA, UmuD and phage repressor
proteins (Little and Mount, 1982; Little, 1984; Kim and
Little, 1993). Thus, a similar activation of RecA is likely to
precede the HdiR self-cleavage.
When the stability of the overexpressed HdiR was
assessed in wt cells exposed to MMC, only the larger, N-
terminal part of the two HdiR cleavage products was vis-
ible and the half-life of this fragment was ~22 min. How-
ever, in the absence of clpP encoding the proteolytic
subunit of the Clp protease complex (Maurizi et al., 1990),
both of the cleavage products were stabilized suggesting
they are targets of this protease. Curiously, we also noted
that the clpP mutation essentially abolished the induction
of hdiR expression by MMC, indicating that the N-terminal
HdiR cleavage product carrying the HTH motif retained its
DNA binding ability. This notion was confirmed by gel
retardation studies, where the cleaved HdiR retarded both
the hdiR and the umuC promoter fragments. The Clp
proteolytic complex has previously been implicated in the
degradation of self-cleavage products. The UmuD¢ is rap-
idly degraded by the ClpXP to avoid excess mutagenesis
(Frank et al., 1996) and in very recent studies also the
products of self-cleaved LexA are shown to be substrates
616 K. Savijoki et al.

Fig. 7. Northern analysis of hdiR expression in MG1363 and mutant cells under DNA-damaging and heat-stress conditions.
A. hdiR expression in MG1363 and DFDclpP cells before (0¢) and 20, 40 and 60 min after the addition of MMC.
B. hdiR expression in MG1363 and DFDclpP cells before (0¢) and 5 and 20 min after heat-shock.
C. hdirR expression in MMC treated MG1363 (0¢ and 20¢) and VEL1122 cells (0¢, 20¢ and 40¢) and heat-shock treated VEL1122 cells (0¢, 5¢ and
20¢). The bar diagrams show the relative mRNA induction ratios calculated by dividing the signal from RNA sample by the signal from the MG1363
cells at 0 min. The RNA amounts on the membrane were corrected after rRNA hybridization (data not shown).

for the ClpXP protease (Flynn et al., 2003; Neher et al.,
2003). Thus, the Clp proteolytic complex appears to play
a conserved role in turnover of self-cleaved protein prod-
ucts. In the case of HdiR, the Clp proteolytic complex
regulates the DNA damage response, as the N-terminal
cleavage product can still repress gene expression, and
only when degraded by ClpP, is the response to DNA
damage induced. The deleterious effect of accumulation
of the LexA DNA-binding domain to cell survival after DNA
damage suggests a similar regulatory mechanism in E.
coli (Neher et al., 2003)
In addition to MMC, hdir expression is also induced by
heat. Although HdiR was unstable (half-life ~20 min)
under these conditions, it was threefold more stable than
in the presence of MMC. However, an ~15-fold induction
of hdiR expression was achieved already ~5 min after
applying of heat-shock, whereas 20 min were needed to
© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 609–621
reach the same level when cells were stressed with
MMC, suggesting that the stability of HdiR does not play
a crucial role in de-repressing the HdiR regulon under
heat-stress. However, induction of hdiR expression by
heat was completely eliminated in the recA mutant cells
and was greatly reduced in the absence of clpP, demon-
strating that both RecA and ClpP are clearly important for
the heat-shock induction. Although additional proteins
may be involved in this regulation, our data show that
common elements are involved in both the DNA dam-
aged induced and the heat-mediated induction of the
HdiR regulon.
LexA homologues are present in a number of bacteria
(Eisen and Hanawalt, 1999), particularly in those with
larger genomes (Koonin et al., 2000). Curiously, Staphy-
lococci contain both HdiR and LexA homologues
(Kuroda et al., 2001), suggesting that the two proteins

have separate biological functions. However, Lactococ-
cus and Streptococcus species appear to be devoid of
LexA and, thus, HdiR could be the DNA damage
response regulator in these organisms. To address this
issue, we made several attempts to identify HdiR target
genes; however, we only identified hdiR in L. lactis
MG1363, while umuC is a target for HdiR in L. lactis
IL1403. In addition, we specifically examined if recA
expression is repressed by HdiR, but did not detect any
differences in the expression between the wt and PV114
mutant cells expressing HdiR¢. Based on a recent study,
where it was shown that LexA from Rhodobacter
sphaeroides functions both as a repressor and as an
activator of gene expression (Tapias et al., 2002), we
also examined if HdiR is a positive regulator of recA
expression. After exposing wt and hdiR mutant cells to
MMC, we found that recA was only slightly induced
(~twofold), and that this induction was slightly reduced
in cells carrying HdiR¢ lacking the HTH domain (data not
shown). Thus, HdiR has only a marginal effect on recA
expression.
When we examined the phenotype of the mutant
cells expressing HdiR¢, we found that they were as
resistant as the wt cells to MMC, but were unable to
grow at high temperature. Therefore, the timely expres-
sion of a gene controlled by HdiR appears to be
required for growth at high temperatures. However, to
understand the physiological significance of the results
we need more information on the HdiR regulon. In this
paper, we have shown that the N-terminal half of HdiR
remains active following self-cleavage. Interestingly, the
C-terminal half of the protein was found to be highly
unstable and only detected in cells lacking ClpP, indicat-
ing that it might also harbour an important biological
function.
In our study, we have identified a novel type transcrip-
tional regulator whose expression responds to both DNA
damage and heat-stress. A link between the response to
heat shock and DNA damage in L. lactis has previously
been suggested by the findings that disruption of the L.
lactis recA gene results in temperature sensitivity (Duwat
et al., 1995a,b), and this sensitivity is suppressed by dis-
ruption of a gene, trmA (Duwat et al., 1999), which also
suppresses the temperature sensitivity of a clpP mutation
(Frees et al., 2001). Our present findings suggest that
HdiR may be such a link.
Experimental procedures
Bacterial strains, plasmids, oligonucleotides and
culture conditions
Strains and plasmids used in this study are listed in Table 1.
The oligonucleotides used are provided as Supplementary
material (Table S1). L. lactis strains were grown in M17
© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 609–621
RecA and CIpP modulate the expression of HdiR 617
medium (Terzaghi and Sandine, 1975) at 30∞C supplemented
with 0.5% glucose (GM17). When needed, chloramphenicol
(6 mg ml-1) or tetracycline was added in growth media. E. coli
strains were cultivated at 37∞C in Luria–Bertani (LB) medium
(Sambrook et al., 1989) supplemented with ampicillin (50–
100 mg ml-1) and/or kanamycin (25 mg ml-1).
Strain constructions
A replacement recombination technique was used to con-
struct the MG1363 mutant strain carrying a 64 bp in-frame
deletion in the hdiR gene to express HdiR without the putative
HTH motif. For this purpose, PCR products generated with
primers p15/p16 and p17/p18, respectively, were digested
with XbaI/PstI and PstI/SalI, respectively, and ligated with
XbaI/SalI cut pGhost8 (Maguin et al., 1996). The resulting
plasmid, pKS46, encoding two additional Ala residues at the
deletion site in hdiR was introduced into MG1363 followed by
plasmid integration and excision as described by Biswas
et al. (1993). The mutant strain carrying an in-frame deletion
in hdiR was assigned as PV114.
The PV114 strain was complemented by cloning the PCR
amplified hdiR gene region excluding the downstream
located ynaA with primers p19 and p20 as a XbaI–SalI frag-
ment (1 kb) on pCI372 (Hayes et al., 1991). The resulting
plasmid pKS47 was used to transform MG1363 and PV114
to obtain KS73 and KS74 respectively.
An umuC expression system in MG1363 and PV114 was
created by amplifying the umuC region from IL1403 using the
primer pair p33/p34 and cloning the resulting 1.78 kb PCR-
product as a BamHI–EcoRI fragment on pCI372. The result-
ing plasmid pKS50 was used to transform MG1363 and
PV114 to get PV121 and PV122 respectively.
An overexpression system for the HdiR in MG1363 and
mutant derivatives was created as follows. The hdiR struc-
tural gene (0.8 kb) and the ctsR promoter without the proba-
ble CtsR-binding region (130 bp) (Varmanen et al., 2000)
were generated by PCR using the primer pairs p32/p18 and
p30/p31 respectively. PctsR and hdiR fragments were digested
with EcoRI/BamHI and BamHI/SalI, respectively, ligated with
EcoRI–SalI cut pCI372. The resulting plasmid pKS49 was
transferred into MG1363, DFDclpP (Frees et al., 2001) and
VEL1122 (Duwat et al., 1995a) to get KS78, KS79 and KS80
respectively.
Molecular cloning techniques were performed essentially
as described by Sambrook et al. (1989).
Identification of the hdiR gene from MG1363
The internal gene fragment of the hdiR (667 bp) was ampli-
fied from MG1363 using the primer pair p1/p2 and cloned on
pCR2.1 (pKS36) in the E. coli TOP10F¢strain. The 5¢ region
of the hdiR was obtained by PCR using primer p3 designed
according to the predicted protein sequence of the ynaD that
locates 1.9 kb upstream of the ynaB in IL1403, and the hdiR
sequence specific primer p5. The 3¢ region was generated
using the primer p4 designed according to the predicted
protein sequence of the rplJ that locates 200 bp downstream
of the ynaB in IL1403, and the hdiR sequence specific primer
p6. The resulting PCR fragments were sequenced using a
set of sequence specific primers in reaction conditions spec-
618 K. Savijoki et al.
Table 1. Bacterial strains and plasmids.

Strain or plasmid Relevant phenotype(s) or genotype(s) Source or reference

Strains
E. coli
TOP10F¢ F¢ {lacIq Tn10(TetR)} mcrA D(mrr-hsdRMS-mcrBC) f80lacZDM15 DlacX74 deoR recA1 araD139 Invitrogen
D(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG
M 15[pREP4] NaI s Str s rif s thi – lac – ara + gal + mtl – F – recA+ uvr + lon + with pREP4 Qiagen
L. lactis
IL1403 Plasmid free Chopin et al. (1984)
MG1363 Plasmid and prophage cured derivative of NCDO712 Gasson (1983)
PV114 MG1363 derivative expressing hdiR without the HTH motif This work
DFDclpP MG1363 DclpP Frees et al. (2001)
VEL1122 MG1363 recA::tet Duwat et al. (1995a)
KS73 MG1363 containing pKS47 This work
KS74 PV114 containing pKS47 This work
KS78 MG1363 containing pKS49 This work
KS79 DFDclpP containing pKS49 This work
KS80 VEL1122 containing pKS49 This work
PV121 MG1363 containing pKS50 This work
PV122 PV114 containing pKS50 This work
Plasmids
pCR2.1 Amr, vector for direct cloning of PCR amplified products Invitrogen
pCI372 Cmr, E. coli – Lactococcus shuttle vector Hayes et al. (1990)
pGhost8 Tetr, a thermosensitive derivative of pGK12 Maguin et al. (1996)
pQE-30 Amr, vector for overexpression of proteins with N-terminal His(6)-tag Qiagen
pBluescript-II SK+ Amr, cloning vector Stratagene
pQE-hdiR Amr, pQE derivative for overexpression of His-tagged HdiR This work
pKS36 Amr, pCR2.1with 0.7 kb PCR fragment of the hdiR This work
pKS46 Tetr, pGhost8 with 1.1 kb XbaI–SalI fragment containing 64 bp in-frame deletion in the hdiR This work
pKS47 Cmr, pCI372 with 1.0 kb XbaI–SalI fragment containing the hdiR gene region This work
pKS49 Cmr, pCI372 with 0.93 kb EcoRI–SalI fragment containing ctsR promoter and the hdiR This work
structural gene
pKS50 Cmr, pCI372 with 1.78 kb BamHI–EcoRI fragment containing the umuC gene region from IL1403 This work
pBluescript-IR1 Amr, E. coli vector carrying 22 bp fragment containing the IR1 preceding the hdiR This work
pBluescript-IR2 Amr, E. coli vector carrying 22 bp fragment containing the IR2 preceding the hdiR This work

ified by the Thermosequenase fluorescent labelled primer
cycle sequencing kit (Pharmacia Biotech). Reactions were
analysed using an ALFexpress DNA sequencer (Pharmacia
Biotech). The gene region of hdiR has been submitted to the
DDBJ/EMBL/GenBank databases under the Accession Num-
ber AJ557822.
Sequence comparisons were accomplished using the
National Center for Biotechnology Information (NCBI) BLAST2
network server at http://www.ncbi.nlm.nih.gov/BLAST.
RNA extraction and Northern blotting analyses
Total RNA was isolated from L. lactis strains grown exponen-
tially at 25∞C or 30∞C to an optical density OD600 = 0.3–0.4,
where they were either heat stressed by transferring from
25∞C to 38.5∞C, or kept at 30∞C and treated with 3 mM MMC.
Cell samples were withdrawn at the time intervals of 0, 5, 20
or 45 min when incubated at 38.5∞C and 0, 20, 40 and 60 min
when incubated with MMC. RNA isolation, blotting and
hybridization with radiolabelled probes were carried out as
described elsewhere (Pelle and Murphy, 1993; Varmanen
et al., 2000). The DNA probes for the clpP (366 bp) and recA
(750 bp) genes from MG1363 and the umuC gene (569 bp)
from IL103 were generated by PCR using the primer pairs
p11/p12, p7/p8 and p9/p10 respectively. The 667 bp hdiR-
specific probe was cut out from the pKS36 by EcoRI diges-
tion. Membranes were scanned using the GS-525 Molecular
Imager System (Bio-Rad) and quantified using Quantity One
(Version 4.2.1, Bio-Rad). RNA amounts on the membrane
were corrected by probing the membranes with a probe spe-
cific for L. lactis 16S rRNA.
Characterization of the PV114 strain
Colony forming ability of the wt (MG1363) and PV114 strains,
with or without MMC (0.1–3 mg ml) was studied by plating
assay described by Frees et al. (2001). Comparison of the
growth rates at 30∞C and 37∞C was carried out using the
Bioscreen C-monitoring system (Transgalactic Ltd). Each
well contained 300 ml growth medium inoculated with 0.1%
of an overnight culture grown at +30∞C.
Complementation of the PV114 strain with pKS47 was
analysed using the Bioscreen C-monitoring system. Shortly,
PV114 and MG1363 containing the pCI372 (control strains)
and the KS74 (PV114/pKS47) and the KS73 (MG1363/
pKS47) were cultivated at 30∞C and at 37∞C as described
above.
Overexpression and purification of the HdiR
The hdiR coding region was amplified using primer pair p21/
p22, digested with BamHI and SalI followed by cloning in the
respective sites in pQE30 (Qiagen). His6-HdiR was purified

© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 609–621


from E. coli M15[pREP4] carrying the pQE-6His-hdiR accord-
ing to the standard procedure recommended by Qiagen. The
purified His6-HdiR was used for custom antibody production
in rabbits and DNA gel mobility shift experiments.
Gel mobility shift
DNA fragments corresponding to the putative promoter
regions of the hdiR (206 bp) from MG1363, umuC (252 bp)
and recA (155 bp) from IL1403 were generated by PCR using
primer pairs p23/p24, p26/p27 and p28/p29 respectively. The
hdiR upstream region containing the IR2, but not the IR1,
was amplified using primers p15 and p25. Oligonucleotide
pairs 5¢-CTAGTTTATCAGTTTATCTGATAAAA-3¢/5¢-AATTTT
TTATCAGATAAACTGATAAA and 5¢-CTAGAAACCACTGT
TATCAGTGGTTT-3¢/5¢-AATTAAACCACTGATAACAGTGGT
TT-3¢ where annealed (overhangs are shown in italics),
treated with T4 polynuclotide kinase and ligated with XbaI–
EcoRI cut pBluescript-II SK+ to obtain pBluescript-IR1 and
pBluescript-IR2 respectively. The M13 rev and M13 uni prim-
ers were used to amplify 230 bp fragments from pBluescript-
IR1 and pBluescript-IR2 for gel mobility assay.
The reactions (15 ml) were assembled by mixing the PCR-
amplified fragment (35 ng) and the His6-HdiR (0–28 ng) in the
gel shift buffer (20 mM Tris-HCl, pH 7.5, 50 mM KCl, 40 mM
NaCl, 10 mM MgCl2, 0.5 mM DTT, 10% glycerol, 0.1 mg
ml-1 BSA and 1 mg sonicated herring sperm DNA). The effect
of autocleavage on DNA binding was studied using His6-HdiR
(12.5 ng and 25 ng) that had been incubated in 50 mM Tris-
HCl (pH 7) or 50 mM glycine (pH 10) at room temperature for
16 h. Gel-shift reactions were incubated at 25∞C for 15 min
followed by electrophoresis on a 5% polyacrylamide gel.
Gels were stained with ethidium bromide, scanned with a
Fluor-S imager and analysed using QuantityOne-software
(Bio-Rad).
Analysis of HdiR self-cleavage
Self-cleavage of the His6-HdiR was studied in the pH range
of 6.0–10 using a buffer system containing either 50 mM Bis-
Tris, Tris-HCl or glycine. Briefly, each reaction containing 2 mg
(10 ml) of the purified His6-HdiR was incubated at room tem-
perature for 16 h. The reaction products were separated in a
4–12% SDS–PAGE (Invitrogen) followed by staining with
Coomassie Brilliant blue R-250, or transfer to a nitrocellulose
membrane (0.45 mm, Bio-Rad) for Western blots with His6-
HdiR antibodies (1:5000) and HRP-conjugated goat anti-rab-
bit IgG (Bio-Rad) 1:50000. Detection was performed using
the SuperSignal West Dura Extended Duration kit according
to Pierce. Membranes were scanned on a GS-525 Molecular
Imager System (MultiAnalyst, Bio-Rad).
N-terminal sequence analysis
The components from the His6-HdiR self-cleavage reaction
were separated by reversed phase chromatography on a
1.0 ¥ 20 mm C1 (TSK-TMS250, TosoHaas) column using a
linear gradient (0–100% in 60 min) of acetonitrile in 0.1%
trifluoroacetic acid. The peaks were automatically collected
on a SMART™ (Pharmacia) liquid chromatograph and sub-
© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 609–621
RecA and CIpP modulate the expression of HdiR 619
jected to N-terminal sequence analysis using a Procise 494
A sequencer (Perkin-Elmer).
Determination of HdiR stability in vivo
Stability of the HdiR in the presence of MMC was studied by
cultivating L. lactis strains at 30∞C to OD600 = 0.5 followed by
the addition of 3 mM MMC and CAM (50 mg ml-1) after 1 min
to block the protein synthesis. Samples were withdrawn at
indicated time points and Protease Inhibitor Cocktail (PIC)
(Roche) was added prior to centrifugation. HdiR stability
under heat stress conditions was studied by shifting expo-
nentially growing (OD600 = 0.5) KS78, KS79 and KS80 cells
from 25∞C to 38.5∞C. Protein synthesis was blocked after 5
or 15 min by CAM and samples (15 ml) were withdrawn at
indicated times. Cell free extracts were obtained after homog-
enizing the cells (in 100 mM Tris-HCl pH 7.5, including PIC)
with glass beads (Ø 10 mm) and centrifugation. Protein con-
centrations were determined with the Protein Assay kit (Bio-
Rad). An equal amount of the protein (50 mg) was separated
in a SDS–PAGE (12%) (Invitrogen) and the HdiR stability was
analysed by Western blotting.
Acknowledgements
We are grateful to I. Palva for the helpful discussions and
critical reading of the manuscript. We would also like to thank
R. Woodgate for providing the E. coli UmuD antibodies and
N. Kalkkinen for N-terminal sequencing of HdiR self-cleavage
products. This work was supported by The NorFA, The
Finnish Food Research Foundation, The Wihuri Foundation,
The Danish Dairy Research Foundation, The Danish Food
Research Programme (FØTEK-2) and The Academy of
Finland.
Supplementary material
The following material is available from
http://www.blackwellpublishing.com/products/journals/
suppmat/mmi/mmi3713/mmi3713sm.htm
Fig. S1. Multiple amino acid sequence alignments of HdiR
and LexA homologues.
Table S1. Oligonucleotides used in this work.
References
Biswas, I., Gruss, A., Ehrlich, S.D., and Maguin, E. (1993)
High-efficiency gene inactivation and replacement system
for gram-positive bacteria. J Bacteriol 175: 3628–3635.
Bolotin, A., Wincker, P., Mauger, S., Jaillon, O., Malarme, K.,
Weissenbach, J., et al. (2001) The complete genome
sequence of the lactic acid bacterium Lactococcus lactis
ssp. lactis IL1403. Genome Res 11: 731–753.
Brent, R. (1982) Regulation and autoregulation by LexA pro-
tein. Biochimie 64: 565–569.
Burckhardt, S.E., Woodgate, R., Scheuermann, R.J., and
Echols, H. (1988) UmuD mutagenesis protein of Escheri-
chia coli, overproduction, purification, and cleavage by
RecA. Proc Natl Acad Sci USA 85: 1811–1815.
620 K. Savijoki et al.
Campoy, S., Mazon, G., Fernandez de Henestrosa, A.R.,
Llagostera, M., Monteiro, P.B., and Barbe, J. (2002) A new
regulatory DNA motif of the gamma subclass Proteobac-
teria, identification of the LexA protein binding site of the
plant pathogen Xylella fastidiosa. Microbiology 148: 3583–
3597.
Chopin, A., Chopin, M.-C., Moillo-Batt, A., and Langella, P.
(1984) Two plasmid determined restriction and modifica-
tion systems in Streptococcus lactis. Plasmid 11: 260–263.
Courcelle, J., Khodursky, A., Peter, B., Brown, P.O., and
Hanawalt, P.C. (2001) Comparative gene expression pro-
files following UV exposure in wt and SOS-deficient
Escherichia coli. Genetics 158: 41–64.
Duwat, P., Ehrlich, S.D., and Gruss, A. (1995a) The recA
gene of Lactococcus lactis, characterization and involve-
ment in oxidative and thermal stress. Mol Microbiol 17:
1121–1131.
Duwat, P., Sourice, S., Ehrlich, S.D., and Gruss, A. (1995b)
recA gene involvement in oxidative and thermal stress in
Lactococcus lactis. Dev Biol Stand 85: 455–467.
Duwat, P., Ehrlich, S.D., and Gruss, A. (1999) Effects of
metabolic flux on stress response pathways in Lactococ-
cus lactis. Mol Microbiol 31: 845–858.
Eisen, J.A., and Hanawalt, P.C. (1999) A phylogenomic study
of DNA repair genes, proteins, and processes. Mutat Res
435: 171–213.
Fernandez de Henestrosa, A.R., Ogi, T., Aoyagi, S., Chafin,
D., Hayes, J.J., Ohmori, H., and Woodgate, R. (2000)
Identification of additional genes belonging to the LexA
regulon in Escherichia coli. Mol Microbiol 35: 1560–1572.
Flynn, J.M., Neher, S.B., Kim, Y.-I., Sauer, R.T., and Baker,
T.A. (2003) Proteomic discovery of cellular substrates
of the ClpXP protease reveals five classes of ClpX-
recognition signals. Mol Cell 11: 671–683.
Frank, E.G.D., Ennis, D.G., Gonzalez, M., Levine, A.S.,
and Woodgate, R. (1996) Regulation of SOS mutagene-
sis by proteolysis. Proc Natl Acad Sci USA 93: 10201–
10296.
Frees, D., and Ingmer, H. (1999) ClpP participates in the
degradation of misfolded protein in Lactococcus lactis. Mol
Microbiol 31: 79–87.
Frees, D., Varmanen, P., and Ingmer, H. (2001) Inactivation
of a gene that is highly conserved in Gram-positive bacteria
stimulates degradation of non-native proteins and concom-
itantly increases stress tolerance in Lactococcus lactis. Mol
Microbiol 41: 93–103.
Friedberg, E.C., Walker, G.C., and Siede, W. (1995) DNA
Repair and Mutagenesis. Washington, DC: American Soci-
ety for Microbiology Press.
Gasson, M. (1983) Plasmid complements of Streptococcus
lactis NCDO712 and other lactic streptococci after proto-
plast-induced curing. J Bacteriol 154: 1–9.
Gonzalez, M., Frank, E.G., Levine, A.S., and Woodgate, R.
(1998) Lon-mediated proteolysis of the Escherichia coli
UmuD mutagenesis protein, in vitro degradation and iden-
tification of residues required for proteolysis. Genes Dev
12: 3889–3899.
Gonzalez, M., Rasulova, R., Maurizi, M.R., and Woodgate,
R. (2000) Subunit-specific degradation of the UmuD/D’het-
erodimer by the ClpXP protease, the role transrecognition
in UmuD¢ stability. EMBO J 19: 5251–5258.
© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 609–621
Haijema, B.J., van Sinderen, D., Winterling, K., Kooistra, J.,
Venema, G., and Hamoen, L.W. (1996) Regulated
expression of the dinR and recA genes during competence
development and SOS induction in Bacillus subtilis. Mol
Microbiol 22: 75–85.
Hamoen, L.W., Haijema, B., Bijlsma, J.J., Venema, G., and
Lovett, C.M. (2001) The Bacillus subtilis competence tran-
scription factor, ComK, overrides LexA-imposed transcrip-
tional inhibition without physically displacing LexA. J Biol
Chem 276: 42901–42907.
Hayes, F., Vos, P., Fitzgerald, G.F., de Vos, W.M., and Daly,
C. (1991) Molecular organization of the minimal replicon of
novel, narrow-host-range, lactococcal plasmid pCI305.
Plasmid 25: 16–26.
Jenal, U., and Fuchs, T. (1998) An essential protease
involved in bacterial cell-cycle control. EMBO J 17: 5658–
5669.
Kim, B., and Little, J.W. (1993) LexA and lambda Cl repres-
sors as enzymes, specific cleavage in an intermolecular
reaction. Cell 73: 1165–1173.
Koonin, E.V., Aravind, L., and Galperin, M.Y. (2000) Com-
parative-genomic view of the microbial stress response. In
Bacterial Stress Responses. Storz, G., and Hengge-
Aronis, R. (eds). Washington, DC: American Society for
Microbiology Press, pp. 417–444.
Kowalczykowski, S.C. (1991) Biochemistry of genetic
recombination: energetics and mechanism of DNA strand
exchange. Annu Rev Biophys Biophys Chem 20: 539–
575.
Kowalczykowski, S.C., Dixon, D.A., Eggleston, A.K., Lauder,
S., and Rehrauer, W.M. (1994) Biochemistry of homolo-
gous recombination in Escherichia coli. Microbiol Rev 58:
401–465.
Krüger, E., Zuhlke, D., Witt, E., Ludwig, H., and Hecker, M.
(2001) Clp-mediated proteolysis in Gram-positive bacteria
is autoregulated by the stability of a repressor. EMBO J
20: 852–863.
Kulaeva, O.I., Wootton, J.C., Levine, A.S., and Woodgate, R.
(1995) Characterization of the umu-complementing operon
from R391. J Bacteriol 177: 2737–2743.
Kuroda, M., Ohta, T., Uchiyama, I., Baba, T., Yuzawa, H.,
Kobayashi, I., et al. (2001) Whole genome sequencing of
meticillin-resistant Staphylococcus aureus. Lancet 357:
1225–1240.
Little, J.W. (1984) Autodigestion of LexA and phage lambda
repressors. Proc Natl Acad Sci USA 81: 1375–1379.
Little, J.W. (1991) Mechanism of specific LexA cleavage,
autodigestion and the role of RecA coprotease. Biochimie
73: 411–421.
Little, J.W., and Mount, D.W. (1982) The SOS regulatory
system of Escherichia coli. Cell 29: 11–22.
Maguin, E., Prevost, H., Ehrlich, S.D., and Gruss, A. (1996)
Efficient insertional mutagenesis in lactococci and other
gram-positive bacteria. J Bacteriol 178: 931–935.
Maurizi, M.R., Clark, W.P., Katayama, Y., Rudikoff, S., Pum-
phrey, J., Bowers, B., and Gottesman, S. (1990) Sequence
and structure of ClpP, the proteolytic component of the
ATP-dependent Clp protease of Escherichia coli. J Biol
Chem 265: 12536–12545.
Munoz-Najar, U., and Vijayakumar, M.N. (1999) An operon
that confers UV resistance by evoking the SOS mutagenic

response in streptococcal conjugative transposon Tn5252.
J Bacteriol 181: 2782–2788.
Neher, S.B., Flynn, J.M., Sauer, R.T., and Baker, T.A. (2003)
Latent ClpX-recognition signals ensure LexA destruction
after DNA damage. Genes Dev 17: 1084–1089.
Pelle, R., and Murphy, N.B. (1993) Northern hybridization,
rapid and simple electrophoretic conditions. Nucleic Acids
Res 21: 2783–2784.
Perry, K.L., Elledge, S.J., Mitchell, B., Marsh, L., and Walker,
G.C. (1985) umuDC and mucAB operons whose products
are required for UV light- and chemical-induced mutagen-
esis. Proc Natl Acad Sci USA 82: 4331–4335.
Pham, P., Bertram, J.G., O’Donnell, M., Woodgate, R., and
Goodman, M.F. (2001) A model for SOS-lesion-targeted
mutations in Escherichia coli. Nature 409: 366–370.
Raymond-Denise, A., and Guillen, N. (1991) Identification of
dinR, a DNA damage-inducible regulator gene of Bacillus
subtilis. J Bacteriol 173: 7084–7091.
Raymond-Denise, A., and Guillen, N. (1992) Expression of
the Bacillus subtilis dinR and recA genes after DNA
damage and during competence. J Bacteriol 174: 3171–
3176.
Reuven, N.B., Arad, G., Maor-Shoshani, A., and Livneh, Z.
(1999) The mutagenesis protein UmuC is a DNA poly-
merase activated by UmuD¢, RecA, and SSB and is spe-
cialized for Translesion Replication. J Biol Chem 274:
31763–31766.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecu-
lar Cloning: a Laboratory Manual. Cold Spring Harbor, NY:
Cold Spring Harbor Laboratory Press.
Slilaty, S.N., and Little, J.W. (1987) Lysine-156 and
serine-119 are required for LexA repressor cleavage, a
possible mechanism. Proc Natl Acad Sci USA 84:
3987–3991.
Smith, B.T., and Walker, G.C. (1998) Mutagenesis and more,
umuDC and the Escherichia coli SOS response. Genetics
148: 1599–1610.
Smith, M.H., Cavenagh, M.M., and Little, J.W. (1991) Mutant
© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 609–621
RecA and CIpP modulate the expression of HdiR 621
LexA proteins with an increased rate of in vivo cleavage.
Proc Natl Acad Sci USA 88: 7356–7360.
Tang, M., Bruck, I., Eritja, R., Turner, J., Frank, E.G., Wood-
gate, R., et al. (1998) Biochemical basis of SOS-induced
mutagenesis in Escherichia coli: Reconstitution of in vitro
lesion bypass dependent on the UmuD¢2C mutagenic com-
plex and RecA protein. Biochemistry 95: 9755–9760.
Tang, M., Shen, X., Frank, E.G., O’Donnell, M., Woodgate,
R., and Goodman, M.F. (1999) UmuD¢ (2)C is an error-
prone DNA polymerase, Escherichia coli pol V. Proc Natl
Acad Sci USA 96: 8919–8924.
Tapias, A., Fernández, S., Alonso, J.C., and Barbé, J. (2002)
Rhodobacter sphaeroides LexA has dual activity, optimis-
ing and repressing recA gene transcription. Nucleic Acids
Res 30: 1539–1546.
Terzaghi, B.E., and Sandine, W.E. (1975) Improved medium
for lactic streptococci and their bacteriophages. Appl
Microbiol 29: 807–813.
Turgay, K., Hahn, J., Burghoorn, J., and Dubnau, D. (1998)
Competence in Bacillus subtilis is controlled by regulated
proteolysis of a transcription factor. EMBO J 17: 6730–
6738.
Varmanen, P., Ingmer, H., and Vogensen, F.K. (2000) ctsR
of Lactococcus lactis encodes a negative regulator of clp
gene expression. Microbiology 146: 1447–1455.
Viala, J., and Mazodier, P. (2002) ClpP-dependent degrada-
tion of PopR allows tightly regulated expression of the
clpP3 clpP4 operon in Streptomyces lividans. Mol Microbiol
44: 633–643.
Walker, G.C., Smith, B.T., and Sutton, M.D. (2000) The SOS
response to DNA damage. In Bacterial Stress Responses.
Storz, G., and Hengge-Aronis, R. (eds). Washington, DC:
American Society for Microbiology Press, pp. 131–144.
Woodgate, R. (2001) Evolution of the two-step model for UV-
mutagenesis. Mutat Res 485: 83–92.
Woodgate, R., and Levine, A.S. (1996) Damage inducible
mutagenesis, recent insights into the activities of the Umu
family of mutagenesis proteins. Cancer Surv 28: 117–140.