Gene-Edited MLE-15 Cells As A Model For The Hermansky Pudlak Syndromes.

AJRCMB Articles in Press. Published on 30-November-2017 as 10.1165/rcmb.
2017-0324MA
Page 1 of 31
Gene-edited MLE-15 cells as a model for the Hermansky Pudlak syndromes.

Seunghyi Kook*
Aidong Qi†
Ping Wang*
Shufang Meng*
Peter Gulleman†
Lisa R. Young†
Susan H. Guttentag*
*Division
of Neonatology and
†Divisionof Pediatric Pulmonary Medicine,
Department of Pediatrics,
Vanderbilt University School of Medicine,
Nashville, TN.1
Author contributions:
SK: developed reagents, guided the experiments, analyzed data, created figures, and wrote the
manuscript.
AQ: developed reagents, guided the experiments, and analyzed data.
PW, SM, PG: executed experiments and analyzed data.
LY: guided experiments, analyzed data, and edited the manuscript.
SG: conceived of the project, guided the experiments, analyzed data, created figures, and wrote the
manuscript.
Correspondence: Susan
Guttentag, MD
11111 Doctor’s Office Tower
2200 Children’s Way
Nashville, TN 37232-9544
Office: 615-322-3476
Fax: 615-343-1763
susan.guttentag@vanderbilt.edu
Running Head: Gene-edited MLE-15 for HPS cell modeling
1 This work was possible with the financial support of the American Heart Association (GRA 12050265/SG),
and National Institutes of Health (HL119503/LRY, and GM108807/SG). SG is the Julia Carell Stadler
Professor of Pediatrics.
Copyright © 2017 by the American Thoracic Society

AJRCMB Articles in Press. Published on 30-November-2017 as 10.1165/rcmb.2017-0324MA
Page 2 of 31
1 Abstract:
2 Defining the mechanisms of cellular pathogenesis for rare lung diseases such as Hermansky
3 Pudlak syndrome (HPS) is often complicated by loss of the differentiated phenotype of
4 cultured primary alveolar type 2 (AT2) cells, and by a lack of durable cell lines that are
5 faithful to both AT2 cell and rare disease phenotypes. We used CRISPR/Cas9 gene editing
6 to generate a series of HPS-specific mutations in the MLE-15 cell line. The resulting MLE-
7 15/HPS cell lines exhibit preservation of AT2 cellular functions, including formation of
8 lamellar body-like organelles, complete processing of Surfactant protein B (SP-B), and
9 known features of HPS specific to each trafficking complex, including loss of protein
10 targeting to lamellar bodies. MLE-15/HPS1 and MLE-15/HPS2 (with a mutation in Ap3b1),
11 express increased MCP-1 (macrophage chemotactic protein-1), a well-described mediator
12 of alveolitis in HPS patients and mouse models. We now show that MLE-15/HPS9 and
13 pallid AT2 cells (with a mutation in Bloc1s6) also express increased MCP-1, suggesting that
14 mice and humans with BLOC-1 mutations may also be susceptible to alveolitis. In addition
15 to providing a flexible platform to examine the role of HPS-specific mutations on trafficking
16 in AT2 cells, MLE-15/HPS cell lines provide a durable resource for high throughput
17 screening and studies of cellular pathophysiology that are likely to accelerate progress
18 toward developing novel therapies for this rare lung disease.
19
20 Keywords:
21 CRISPR/Cas9, gene editing, MLE-15 cell line, Hermansky Pudlak syndrome

Page 3 of 31
1 Introduction:
2 The Hermansky Pudlak syndromes constitute a family of genetic diseases in which the
3 affected genes encode subunits of multimeric complexes that are used in protein and
4 membrane targeting to lysosome-related organelles, specifically the Biogenesis of
5 Lysosome-related Organelle Complexes-1, -2, and -3 (BLOC-1-3), and the Adaptor Protein 3
6 complex (AP-3) (1). Whereas albinism and bleeding diathesis are common to all HPS
7 patients significant morbidity and mortality result from pulmonary fibrosis in selected
8 genotypes, specifically those affecting BLOC-3 and AP-3. Advances in the mechanistic
9 understanding of HPS lung disease have been possible using mouse models (2), and have
10 demonstrated the central role of the AT2 cell in the pathogenesis of fibrotic lung disease in
11 BLOC-3 and AP-3 subtypes (3). However, progress identifying how the underlying cell
12 biology of HPS causes AT2 cell injury has been limited by the lack of robust cellular models
13 that can be easily manipulated in culture.
14 CRISPR/Cas9 gene editing has been used to generate small mutations in a site-directed
15 manner for permanent gene inactivation in a variety of cell types through a process of non-
16 homologous end joining that creates microinsertions or microdeletions (indels) of the
17 targeted sequence (4). We have developed MLE-15 cell lines in which a subunit of each of
18 the four HPS-related trafficking complexes has been inactivated using CRISPR/Cas9 gene
19 editing. The MLE-15 cell line was chosen for its close similarity to primary AT2 cells. The
20 MLE-15 cell line was established from tumors in transgenic mice expressing the SV40 early
21 region including the large T antigen from a well-characterized 3.7 kDa region of the human
22 SFTPC promoter (5, 6). The initial characterization of MLE-15 cells demonstrated
23 expression of RNA for most surfactant proteins, expression of SFTPB proprotein, and
24 multivesicular bodies and lamellar body-like structures (6). Further characterization by
25 others has also demonstrated expression of Surfactant protein A (SFTPA) and Surfactant
26 Protein C (SFTPC) proprotein, processing of SFTPB proprotein to its mature 8 kDa form,
27 and secretion of SFTPB mature protein into culture media (6, 7).
28 We targeted mutations in MLE-15 cells that would inactivate representative HPS genes
29 associated with fibrotic lung disease in humans (Hps1 of the BLOC-3 complex associated
30 with HPS type 1 (8-10), and Ap3β1 of the AP-3 complex associated with HPS type 2 (11)), a

Page 4 of 31
1 subtype of HPS not associated with fibrotic lung disease (Hps3 of the BLOC-2 complex
2 associated with HPS type 3 (12, 13)), and one of the very rare BLOC-1 mutations (Bloc1s6
3 also known as pallidin) (14). We demonstrate that gene editing disrupted the targeted
4 genes, with the expected additional effect of reduced expression of non-targeted subunits
5 of the respective BLOC or AP-3 complexes (13, 15-17). Gene editing resulted in misrouting
6 of known cargo proteins, and increased MCP-1 expression as expected from prior work (2,
7 3, 18-20). Together, these experiments demonstrate that the MLE-15/HPS cell lines
8 faithfully replicate several known characteristics of primary AT2 cells from HPS mouse
9 models, providing a robust platform from which to elucidate cellular mechanisms of AT2
10 cell injury in this family of rare lung diseases.

Page 5 of 31
1 Materials and Methods
2 Additional methodologic details available in an on-line Supplement.

3 Plasmid construction for generating mutations in cell lines
4 Supplement Table 1 lists the single-guidance RNA (sgRNA) sequences used to generate
5 plasmids used for developing each MLE-15/HPS cell line as well as the flanking genomic
6 PCR primers that facilitated screening and sequencing of genomic PCR and RT-PCR
7 products.
8 MLE-15 cell culture

9 MLE-15 cells were originally obtained from Dr. Jeffrey Whitsett (Cincinnati Children’s
10 Hospital Medical Center, Cincinnati, OH) and cultured as previously described (6) as
11 detailed in the on-line Supplement.
12 Transfection and puromycin selection

13 MLE-15 cells were transfected by Nucleofection (Lonza) using Amaxa® Cell Line
14 Nucleofector® Kit T (VCA-1002) and Nucleofactor II device using the X005 cycle. Media
15 supplemented with 5 ug/ml of puromycin were added 24 hours after transfection to select
16 for positive clones as detailed in the Supplement.
17 Animals
18 Wild type (WT) C57BL/6J, Hps1ep/ Hps1ep (pale ear), Ap3b1pe/Ap3b1pe (pearl),
19 Hps3coa/Hps3coa (cocoa), and Bloc1s6pa/ Bloc1s6pa (pallid) were bred and maintained at the
20 Laboratory Animal Facility at Vanderbilt University Medical Center as previously described
21 (18). All animal protocols were reviewed and approved by the Institutional Animal Care
22 and Use Committees of Vanderbilt University Medical Center, and adhered to the principles
23 of the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Both
24 male and female mice were used between 8-10 wk of age. Lung homogenates for Western
25 immunoblotting were generated from flash frozen lung tissue after lavage as previously
26 described (21).
27 AT2 cell isolation
28 Preparation of AT2 cells was carried out as previously described (21), with the following
29 modification. Epithelial cells were separated from macrophages and other blood cells by

Page 6 of 31
1 negative selection on antibody-coated plates (42 ug CD45 and 16 ug CD32 antibodies, BD

2 Pharmingen, San Jose, CA) prior to plating.
3 Quantitative real-time PCR analysis
4 Total RNA was isolated and reverse transcribed by standard methods using the Qiagen
5 RNEasy kit (Qiagen) and SuperScript VILO cDNA synthesis kit (Invitrogen), with additional
6 details in the Supplement.
7 Immunoblotting
8 Immunoblotting was performed as previously described (18), using 80-100 µg of proteins
9 in each lane of pre-cast 4-12% NUPAGE gels (ThermoFisher Scientific). Blots were
10 incubated with the primary antibodies as described previously (18). Antibodies used and
11 procedure details are listed in the Supplement.
12 Immunocytochemistry and Fluorescence Microscopy

13 Primary AT2 and MLE-15 cells were transfected by Nucleofection as described above using
14 plasmids expressing ABCA3-EGFP, or ABCA3-mCherry and EGFP-RAB38, and cells were
15 plated onto coverslips for immunostaining and fluorescence microscopy as described in the
16 Supplement.
17 Measurement of MCP-1
18 MCP-1 levels in cell culture media were measured by ELISA per manufacturer’s
19 recommendations (R&D Systems, #MJE00). RNA was prepared from the cells for qPCR
20 analysis of Ccl2 RNA expression as described above.
21
22 Statistical Methods:
23 Differences in amplification efficiencies between the sample groups in qPCR experiments
24 were assessed using one-way analysis of variance (ANOVA), with post-hoc testing using the
25 Kruskal-Wallis test for differences in normalized expression between groups. Comparison
26 of MCP-1 levels between two groups was conducted using the Mann-Whitney U test.
27 PRISM 6 (version 6.0c; GraphPad Software, La Jolla, CA) was used for all statistical analysis,
28 and values of p < 0.05 were considered as significant.
29

Page 7 of 31
1 Results
2 Generation of MLE-15/HPS clones and validation of gene expression.
3 Using two guidance RNAs, we targeted larger genomic segments for gene editing such that
4 two Cas9-mediated double-stranded DNA breaks would result in a deletion easily detected
5 by gel electrophoresis of genomic PCR products. This strategy is best illustrated in Figure
6 1, in which a single PCR product resulted from a large deletion on both alleles of the MLE-
7 15/HPS9 clone shown in Figure 1D. In practice, we found that most clones demonstrated
8 the expected large genomic deletion only on one allele, accompanied by a small indel on the
9 other allele. This is best illustrated in Figure 1B for the MLE-15/HPS2 clone and Figure
10 1C for the MLE-15/HPS3 clone. The MLE-15/HPS1 clone shown in Figure 1A
11 demonstrated a small indel on one allele (lower band) and a large insertion of non-specific
12 sequence on the other allele (upper band). Sequencing of genomic PCR products (Table 1)
13 enabled us to distinguish small indel products from wild type (WT) sequence, eliminating
14 heterozygous clones (0.1% of clones screened). In parallel experiments, we transfected
15 MLE-15 cells with an empty pX459 vector (no sgRNA) to control for any potential effects of
16 puromycin selection. These parent cell lines (labeled pX459 in Figure 1) behaved similarly
17 to WT MLE-15 cells.
18 Validation studies were performed using clones grown for fewer than 10 passages after
19 confirmation by genomic PCR sequencing. Validation of a representative MLE-15/HPS1
20 clone appears in Figure 1A. Sequencing of RT-PCR products from MLE-15/HPS1 RNA
21 demonstrated the small deletion found by genomic PCR sequencing (Table 1); the faint
22 bands of larger size did not yield interpretable sequence. BLOC-3 is a heterodimer of the
23 HPS1 and HPS4 proteins (9, 10). The pale ear mouse contains a 7 bp duplication flanking a
24 large insertion within exon 19 of Hps1, resulting in a premature stop codon within the
25 inserted element (22). Immunoblotting for HPS1 and HPS4 confirmed both proteins
26 expressed in lung homogenate from WT mice, and in WT and empty vector (px459) MLE-
27 15 cells, but not in lung homogenate from pale ear mice or the MLE-15/HPS1 gene-edited
28 cells.
29 Validation of the MLE-15/HPS2 clone with a mutation in Ap3b1 appears in Figure 1B.
30 Sequencing of RT-PCR products from MLE-15/HPS2 RNA demonstrated the same small

Page 8 of 31
1 (larger product) and large deletions (smaller product) predicted from genomic PCR
2 sequencing. AP-3 is a heterotetrameric complex consisting of two large subunits (δ and β)
3 and two smaller subunits (µ and σ) (23). The pearl mouse has a mutation of the Ap3b1
4 gene involving a 793 base pair tandem duplication that results in a reading frame shift and
5 premature stop codon, truncating the protein 130 amino acids from the amino terminus
6 (11). Immunoblotting showed the β1 subunit of AP-3 in lung homogenate from WT mice,
7 and in WT and empty vector MLE-15 cell lysates, but not in pearl mouse lung homogenate
8 or MLE-15/HPS2 cell lysate. In addition, immunoblotting for the µ1 subunit of AP-3 was
9 significantly reduced in both lung homogenate from pearl mice and MLE-15/HPS2 cells,
10 reflecting prior observation that loss of one AP-3 subunit results in degradation of other
11 AP-3 subunits (24).
12 The MLE-15/HPS3 clone (Figure 1C) presented a technical challenge because of a paucity
13 of suitable antibody reagents to confirm loss of the murine HPS3 protein. Sequencing of
14 RT-PCR products from the MLE-15/HPS3 clone confirmed the deletions found in genomic
15 PCR sequencing, similarly predicting a frameshift mutation and a shortened HPS3 protein.
16 BLOC-2 is a heterotrimeric complex of HPS3, HPS5, and HPS6 proteins (13). The cocoa
17 mouse carries a splice site mutation resulting in a frameshift and loss of expression of the
18 Hps3 mRNA (25). We performed immunoblotting for HPS6 because deletion of one subunit
19 of BLOC-2 has been shown to promote degradation of the other subunits (13). Lung
20 homogenate from cocoa mice and from MLE-15/HPS3 cells indeed demonstrated reduced
21 HPS6 protein compared to WT lung homogenate and lysates from WT and empty vector
22 MLE-15 cells.
23 The largest HPS-related complex is BLOC-1, consisting of 8 different protein subunits (26).
24 A substitution at nucleotide 787 of Bloc1s6 (also known as pallidin or HPS9) leads to a
25 premature stop codon and no protein expression in pallid mice (27). RT-PCR using the
26 MLE-15/HPS9 clone demonstrated a single product, larger than the WT product due to
27 elimination of an mRNA splice site as predicted from genomic PCR screening (Figure 1D).
28 We found no evidence of BLOC1s6 protein expression in lung homogenate from pallid mice
29 or in MLE-15/HPS9 cells when compared to WT lung homogenate, or lysates from empty
30 vector cells (pX459) and WT MLE-15 cells. Moreover, DTNBP1 (also known as dysbindin),

Page 9 of 31
1 another BLOC-1 subunit, was significantly reduced in both pallid lung homogenate and
2 MLE-15/HPS9 cells compared to WT lung homogenate or MLE-15 cells.
3 We next assessed for preservation of AT2 cell phenotype, specifically related to the
4 lamellar body-like organelles of MLE-15 cells, in the gene-edited MLE-15/HPS cells (Figure
5 1E). Prior studies have shown that BLOC-3 and AP-3 disruption do not impair trafficking of
6 ABCA3 to lamellar bodies, nor do they impair processing of SP-B proprotein to mature 8
7 kDa SP-B or trafficking of SP-B to lamellar bodies (18, 21, 28). Given the presence of small
8 lamellar body-like organelles in MLE-15 cells and the role of ABCA3 in phospholipid
9 transfer into lamellar bodies (29-31), we first assessed the expression of Abca3 in WT MLE-
10 15 cells and MLE-15/HPS clones. Compared to the original MLE-15 cells, qPCR
11 demonstrated a modest increase in Abca3 RNA only in the MLE-15/HPS2 clone, but qPCR
12 cycle thresholds which ranged from 25.6-26.3 suggested low Abca3 RNA expression. We
13 were unable to detect any endogenous ABCA3 protein by immunoblotting or by
14 immunostaining using a reliable monoclonal antibody (3C9; Abcam ab24751; data not
15 shown) likely due to low ABCA3 abundance. By comparison, Sftpb RNA expression was
16 robust in WT MLE-15 and MLE-15/HPS cells with qPCR cycle thresholds ranging from 17.7-
17 18.2, and MLE-15/HPS1 and /HPS9 clones specifically showed a significant but modest
18 increase in Sftpb RNA. Immunoblotting demonstrated SFTPB proprotein and the major 25
19 kDa intermediate, as well as fully processed 8 kDa SFTPB in all MLE-15/HPS clones,
20 although overall expression in MLE-15 cells was much lower compared to WT mouse lung
21 lysate (32).
22 Immunostaining for SFTPB in WT MLE-15 cells has been shown previously to localize to
23 small organelles of ~500 nm (7) . Because we were unable to successfully immunostain for
24 endogenous ABCA3, we transfected MLE-15 cells to express human ABCA3-EGFP. In WT
25 MLE-15 cells and MLE-15/HPS clones (Supplemental Figure E1), ABCA3-EGFP
26 surrounded individual SFTPB-positive puncta in the perinuclear region. These data
27 demonstrate that gene editing preserves important aspects of AT2 cell phenotype in MLE-
28 15/HPS cells.
29 MLE-15/HPS2 and MLE-15/HPS1 cell lines exhibit disrupted trafficking of known lamellar
30 body cargo proteins.

Page 10 of 31
1 AP-3 and BLOC complexes facilitate the targeting of proteins relevant to lysosome-related
2 organelles. Lamellar bodies are lysosome-related organelles containing many
3 transmembrane proteins within their limiting membrane (33, 34) but lamellar body
4 trafficking has been incompletely characterized. To date, there are no BLOC-1- or BLOC-2-
5 dependent cargo proteins that could be used to test disruption of lamellar body targeting in
6 gene-edited MLE-15/HPS3 or MLE-15/HPS9 cells. We recently showed that AP-3 was
7 necessary for lamellar body targeting of LIMP2 in primary AT2 cells (18). In keeping with
8 our prior report, MLE-15/HPS2 cells demonstrated disruption of LIMP2 targeting to
9 ABCA3-mCherry-positive organelles (Figure 2A).
10 RAB38 decorates lamellar bodies of AT2 cells in a GTP-dependent manner (19). Using
11 LIMP2 as an endogenous marker of lamellar bodies, endogenous RAB38 was localized to
12 the lamellar body limiting membranes of WT mouse AT2 cells but not in pale ear mouse
13 AT2 cells that are defective in BLOC-3 (Figure 2B). We transfected MLE-15 and MLE-
14 15/HPS1 cells to express human RAB38-EGFP and ABCA3-mCherry and similarly found a
15 loss of RAB38 targeting to ABCA3-mCherry-positive organelles in the MLE-15/HPS1 cells
16 (Figure 2C). Disruption of BLOC-3 function was not associated with loss of endogenous
17 RAB38, nor did it alter the effectiveness of RAB38-EGFP expression (Figure 2D). Since
18 BLOC-3 has been validated as a guanine nucleotide exchange factor (GEF) for RAB32 and
19 RAB38 (35), these experiments indicate that BLOC-3 provides the GEF function that is
20 necessary for targeting RAB38-EGFP specifically to lamellar bodies in AT2 cells.
21 MLE-15/HPS1, /HPS2, and /HPS9 cells secrete increased MCP-1 into culture media.
22 Recent studies have provided strong evidence that injury to primary AT2 cells is central to
23 the development of pulmonary fibrosis in HPS (2, 20, 21). MCP-1, also known as CCL2, is
24 an important driver of macrophage alveolitis in HPS1 patients (36) and mice (2). By qPCR,
25 WT MLE-15 and MLE-15/HPS3 cells exhibited low levels of Ccl2 RNA, whereas Ccl2 RNA
26 was significantly elevated in MLE-15/HPS1 and MLE-15/HPS2 cells (Figure 3A), consistent
27 with prior reports of primary AT2 cells from cocoa, pale ear, and pearl mice, respectively
28 (2, 20). Pallid mice carrying a mutation in Bloc1s6 have not been examined previously for
29 MCP-1 production. Primary AT2 cells from pallid mice (Figure 3B) and MLE-15/HPS9 cells
10

Page 11 of 31
1 (Figure 3C) both exhibited increased MCP-1 in culture media, and increased Ccl2 RNA by
2 qPCR when compared to WT primary AT2 and MLE-15 cells.
3
4 Discussion
5 The efficient gene editing of MLE-15 cells afforded by CRISPR/Cas9 provides a valuable
6 tool for cell modeling of rare genetic lung diseases. Our long term goal is to examine BLOC
7 and AP-3 functions in lamellar body trafficking and to understand the role of disrupted
8 trafficking on AT2 cell injury, so it was critical to choose a cell line demonstrating a stable
9 AT2 cell phenotype for gene editing. Expression of fully processed SP-B protein and
10 presence of lamellar organelles that undergo regulated secretion of surfactant proteins in
11 MLE-15 cells (7) imply sufficient proteolytic machinery, intact trafficking pathways, and
12 functional exocytosis that would contribute to robust MLE-15 CRISPR cell models of HPS.
13 Although WT MLE-15 cells have low endogenous Abca3 expression, we found that ABCA3-
14 EGFP trafficked appropriately to small organelles containing SP-B, and that SFTPB
15 proprotein was appropriately processed to the mature 8 kDa product, suggesting that MLE-
16 15 cells exhibit essential pathways for lamellar body homeostasis. Importantly, the
17 trafficking of exogenous ABCA3 and endogenous SFTPB were not disrupted in MLE-15/HPS
18 clones in keeping with prior reports from mouse models of HPS and HPS patients (18, 21,
19 28).
20 HPS was an ideal family of rare lung diseases to demonstrate the usefulness of gene editing
21 of cell lines because comparisons of MLE-15/HPS cells could be made to lung tissue from
22 HPS mice. As predicted (13, 15-17), targeting a single subunit (Bloc1s6, Hps3, Hps1, and,
23 Ap3b1) from each trafficking complex (BLOC-1, -2, -3, and AP-3, respectively) for gene
24 disruption also resulted in loss of other subunits of the complex in each MLE-15/HPS clone.
25 The definitive test of successfully gene-edited MLE-15/HPS clones would be disruption of
26 protein trafficking, but there is a general lack of understanding of suitable AT2 cell cargo
27 proteins using BLOC and AP-3 trafficking. We were limited to demonstrating disrupted AP-
28 3 trafficking in MLE-15/HPS2 cells and BLOC-3 disruption in MLE-15/HPS1 cells. LIMP2 is
29 the only known lamellar body protein that has been shown to be trafficked by an HPS-
30 related complex, specifically AP-3 (18). Loss of AP-3 in the MLE-15/HPS2 clone disrupted
11

Page 12 of 31
1 LIMP2 trafficking to lamellar body-like organelles consistent with our prior studies using
2 primary AT2 cells (18). The MLE-15/HPS1 cell line has enabled us to advance our
3 understanding of the role of BLOC-3 in lamellar body homeostasis by demonstrating that
4 BLOC-3 provides the GEF function that enables RAB38 targeting to lamellar bodies.
5 Finally, MLE-15/HPS cells would be valuable reagents to investigate mechanisms of HPS

6 lung disease. MCP-1 production and a macrophage-predominant alveolitis are well-known
7 features of HPS1 patients (36). Primary AT2 cells from pale ear and pearl mice, but not
8 cocoa mice, adapt to HPS subunit loss and trafficking complex dysfunction in part by
9 increasing production of MCP-1 (20, 21), and the MLE-15/HPS1, /HPS2, and /HPS3 clones
10 behaved predictably in this respect. We extended these observations to the rare BLOC-1
11 mutations, showing increased MCP-1 production from primary AT2 cells from both pallid
12 mice and MLE-15/HPS9 cells. These data predict that patients with HPS9 and other BLOC-
13 1 mutations are likely to exhibit increased alveolar MCP-1 and may be at risk for
14 pulmonary fibrosis similarly to HPS1 patients. We have demonstrated the strength and
15 potential value of gene editing MLE-15/HPS cell lines by validating some of the known
16 effects of HPS mutations on AT2 cell physiology through comparisons between primary
17 AT2 cells from HPS mouse models and MLE-15/HPS cells. MLE-15/HPS clones provide a
18 robust alternative to primary AT2 cell culture as we begin to examine the impact of HPS
19 mutations on AT2 cell physiology.
20 The limitations of the MLE-15/HPS gene-edited cells as a model also deserve comment.
21 Some mutations of HPS genes in humans, including HPS1 and AP3B1 (15, 16), have been
22 associated with detectable amounts of residual protein subunits that may be important in
23 the pathogenesis of HPS types 1 and 2. It is not clear whether the ER stress responses
24 described in some studies of HPS reflect residual HPS subunit expression or are part of a
25 cellular response to disrupted protein trafficking (37). The MLE-15/HPS1, /HPS2, and
26 /HPS9 clones clearly demonstrate loss of the target protein by immunoblotting and thus
27 may represent a more extreme phenotype than the natural human diseases, affording an
28 opportunity to understand the impact of residual subunit expression on cell stress
29 responses. Another limitation is that we were unable to fully validate the MLE-15/HPS3
30 clone due to a lack of reagents to detect murine HPS3 by immunoblotting, and a lack of
12

Page 13 of 31
1 suitable cargo proteins to test for disruption of BLOC-2 trafficking. The Hps3 genomic and
2 mRNA sequences from MLE-15/HPS3 cells demonstrate a reading frame shift that predicts
3 HPS3 loss, but the presence of reduced HPS6 leaves open the possibility that we have not
4 achieved sufficient loss of the HPS3 protein. We anticipate fully validating the MLE-
5 15/HPS3 cells in the future as antibody reagents become available and cargo proteins are
6 identified. Finally, the MLE-15 cells are a transformed cell line and exhibit unrestrained
7 proliferation that is dependent upon the continuous expression of the SV40 large T antigen
8 (5). There are circumstances where this may be a liability, and so confirmation of findings
9 in primary AT2 cells is always recommended. The MLE-15/HPS clones reduce the reliance
10 on primary AT2 cells for detailed mechanistic studies of protein trafficking, cellular
11 function and disease pathogenesis that are challenging to do with primary AT2 cells that
12 lose their differentiated phenotype in cell culture or achieve inadequate protein
13 inactivation by transient experimental strategies, such as siRNA. Moreover, the MLE-
14 15/HPS clones may foster enhanced drug discovery through high throughput screening
15 that would be difficult with primary AT2 cells.
16
13

Page 14 of 31
1 Acknowledgements
2 The authors would like to thank Dr. Daniel Swarr (Cincinnati Children’s Hospital Medical
3 Center, Cincinnati, OH) for advice in developing the original strategy for gene editing using
4 CRISPR/Cas9. Experiments, image analysis, and presentation using the Nikon Spinning
5 Disk MCN T-2216 were performed in the Vanderbilt Cell Imaging Shared Resource and
6 Nikon Center of Excellence (supported by NIH grants CA68485, DK20593, DK58404,
7 DK59637 and EY08126). Finally, the authors would like to acknowledge the continued
8 encouragement and support of the patients and families in the HPS community who inspire
9 our work.
14

Page 15 of 31
1 References
2
3 1. Vicary GW, Vergne Y, Santiago-Cornier A, Young LR, Roman J. Pulmonary Fibrosis in
4 Hermansky-Pudlak Syndrome. Ann Am Thorac Soc 2016;13:AnnalsATS.201603–
5 186FR–1846.
6 2. Young LR, Gulleman PM, Short CW, Tanjore H, Sherrill T, Qi A, McBride AP,
7 Zaynagetdinov R, Benjamin JT, Lawson WE, Novitskiy SV, Blackwell TS. Epithelial-
8 macrophage interactions determine pulmonary fibrosis susceptibility in Hermansky-
9 Pudlak syndrome. JCI Insight 2016;1:1–22.
10 3. Young LR, Gulleman PM, Bridges JP, Weaver TE, Deutsch GH, Blackwell TS,
11 McCormack FX. The alveolar epithelium determines susceptibility to lung fibrosis in
12 Hermansky-Pudlak syndrome. Am J Respir Crit Care Med 2012;186:1014–1024.
13 4. Doudna JA, Charpentier E. Genome editing. The new frontier of genome engineering
14 with CRISPR-Cas9. Science 2014;346:1258096–1258096.
15 5. Wikenheiser KA, Clark JC, Linnoila RI, Stahlman MT, Whitsett JA. Simian virus 40
16 large T antigen directed by transcriptional elements of the human surfactant protein
17 C gene produces pulmonary adenocarcinomas in transgenic mice. Cancer Res
18 1992;52:5342–5352.
19 6. Wikenheiser KA, Vorbroker DK, Rice WR, Clark JC, Bachurski CJ, Oie HK, Whitsett JA.
20 Production of immortalized distal respiratory epithelial cell lines from surfactant
21 protein C/simian virus 40 large tumor antigen transgenic mice. Proc Natl Acad Sci
22 USA 1993;90:11029–11033.
23 7. Grek CL, Newton DA, Qiu Y, Wen X, Spyropoulos DD, Baatz JE. Characterization of
24 alveolar epithelial cells cultured in semipermeable hollow fibers. Exp Lung Res
25 2009;35:155–174.
26 8. Oh J, Bailin T, Fukai K, Feng GH, Ho L, Mao JI, Frenk E, Tamura N, Spritz RA. Positional
27 cloning of a gene for Hermansky-Pudlak syndrome, a disorder of cytoplasmic
28 organelles. Nat Genet 1996;14:300–306.
29 9. Martina JA, Moriyama K, Bonifacino JS. BLOC-3, a protein complex containing the
30 Hermansky-Pudlak syndrome gene products HPS1 and HPS4. J Biochem
31 2003;278:29376–29384.
32 10. Nazarian R, Falcón-Pérez JM, Dell'angelica EC. Biogenesis of lysosome-related
33 organelles complex 3 (BLOC-3): a complex containing the Hermansky-Pudlak
34 syndrome (HPS) proteins HPS1 and HPS4. Proc Natl Acad Sci USA 2003;100:8770–
35 8775.
36 11. Feng L, Seymour AB, Jiang S, To A, Peden AA, Novak EK, Zhen L, Rusiniak ME, Eicher
37 EM, Robinson MS, Gorin MB, Swank RT. The beta3A subunit gene (Ap3b1) of the AP-
38 3 adaptor complex is altered in the mouse hypopigmentation mutant pearl, a model
39 for Hermansky-Pudlak syndrome and night blindness. Human Molecular Genetics
40 1999;8:323–330.
41 12. Anikster Y, Huizing M, White J, Shevchenko YO, Fitzpatrick DL, Touchman JW,
42 Compton JG, Bale SJ, Swank RT, Gahl WA, Toro JR. Mutation of a new gene causes a
43 unique form of Hermansky-Pudlak syndrome in a genetic isolate of central Puerto
44 Rico. Nat Genet 2001;28:376–380.
45 13. Gautam R, Chintala S, Li W, Zhang Q, Tan J, Novak EK, Di Pietro SM, Dell'angelica EC,
46 Swank RT. The Hermansky-Pudlak syndrome 3 (cocoa) protein is a component of the
15

Page 16 of 31
1 biogenesis of lysosome-related organelles complex-2 (BLOC-2). J Biochem

2 2004;279:12935–12942.
3 14. McGarry MP, Reddington M, Novak EK, Swank RT. Survival and lung pathology of
4 mouse models of Hermansky-Pudlak syndrome and Chediak-Higashi syndrome. Proc
5 Soc Exp Biol Med 1999;220:162–168.
6 15. Dell'Angelica EC, Shotelersuk V, Aguilar RC, Gahl WA, Bonifacino JS. Altered
7 trafficking of lysosomal proteins in Hermansky-Pudlak syndrome due to mutations
8 in the beta 3A subunit of the AP-3 adaptor. Molecular Cell 1999;3:11–21.
9 16. Chiang P-W, Oiso N, Gautam R, Suzuki T, Swank RT, Spritz RA. The Hermansky-
10 Pudlak syndrome 1 (HPS1) and HPS4 proteins are components of two complexes,
11 BLOC-3 and BLOC-4, involved in the biogenesis of lysosome-related organelles. J
12 Biochem 2003;278:20332–20337.
13 17. Starcevic M, Dell'angelica EC. Identification of snapin and three novel proteins
14 (BLOS1, BLOS2, and BLOS3/reduced pigmentation) as subunits of biogenesis of
15 lysosome-related organelles complex-1 (BLOC-1). J Biochem 2004;279:28393–
16 28401.
17 18. Kook S, Wang P, Young L, Schwake M, Saftig P, Weng X, Meng Y, Neculai D, Marks MS,
18 Gonzales L, Beers MF, Guttentag S. Impaired Lysosomal Integral Membrane Protein
19 2-dependent Peroxiredoxin 6 delivery to lamellar bodies accounts for altered
20 alveolar phospholipid content in Adaptor Protein-3-deficient pearl mice. Journal of
21 Biological Chemistry 2016;291:8414–8427.
22 19. Zhang L, Yu K, Robert KW, DeBolt KM, Hong N, Tao J-Q, Fukuda M, Fisher AB, Huang
23 S. Rab38 targets to lamellar bodies and normalizes their sizes in lung alveolar type II
24 epithelial cells. AJP: Lung Cellular and Molecular Physiology 2011;301:L461–77.
25 20. Young LR, Pasula R, Gulleman PM, Deutsch GH, McCormack FX. Susceptibility of
26 Hermansky-Pudlak mice to bleomycin-induced type II cell apoptosis and fibrosis.
27 American Journal of Respiratory Cell and Molecular Biology 2007;37:67–74.
28 21. Atochina-Vasserman EN, Bates SR, Zhang P, Abramova H, Zhang Z, Gonzales L, Tao J-
29 Q, Gochuico BR, Gahl W, Guo C-J, Gow AJ, Beers MF, Guttentag S. Early Alveolar
30 Epithelial Dysfunction Promotes Lung Inflammation in a Mouse Model of Hermansky
31 Pudlak Syndrome. Am J Respir Crit Care Med 2011;184:449–458.
32 22. Feng GH, Bailin T, Oh J, Spritz RA. Mouse pale ear (ep) is homologous to human
33 Hermansky-Pudlak syndrome and contains a rare “AT-AC” intron. Human Molecular
34 Genetics 1997;6:793–797.
35 23. Dell'Angelica EC, Ohno H, Ooi CE, Rabinovich E, Roche KW, Bonifacino JS. AP-3: an
36 adaptor-like protein complex with ubiquitous expression. EMBO J 1997;16:917–928.
37 24. Peden AA, Rudge RE, Lui WWY, Robinson MS. Assembly and function of AP-3
38 complexes in cells expressing mutant subunits. J Cell Biol 2002;156:327–336.
39 25. Suzuki T, Li W, Zhang Q, Novak EK, Sviderskaya EV, Wilson A, Bennett DC, Roe BA,
40 Swank RT, Spritz RA. The gene mutated in cocoa mice, carrying a defect of organelle
41 biogenesis, is a homologue of the human Hermansky-Pudlak syndrome-3 gene.
42 Genomics 2001;78:30–37.
43 26. Dell'angelica EC. The building BLOC(k)s of lysosomes and related organelles. Curr
44 Opin Cell Biol 2004;16:458–464.
45 27. Huang L, Kuo YM, Gitschier J. The pallid gene encodes a novel, syntaxin 13-
46 interacting protein involved in platelet storage pool deficiency. Nat Genet
16

Page 17 of 31
1 1999;23:329–332.
2 28. Guttentag SH, Akhtar A, Tao J-Q, Atochina E, Rusiniak ME, Swank RT, Bates SR.
3 Defective surfactant secretion in a mouse model of Hermansky-Pudlak syndrome.
4 American Journal of Respiratory Cell and Molecular Biology 2005;33:14–21.
5 29. Ban N, Matsumura Y, Sakai H, Takanezawa Y, Sasaki M, Arai H, Inagaki N. ABCA3 as a
6 lipid transporter in pulmonary surfactant biogenesis. J Biochem 2007;282:9628–
7 9634.
8 30. Fitzgerald ML, Xavier R, Haley KJ, Welti R, Goss JL, Brown CE, Zhuang DZ, Bell SA, Lu
9 N, McKee M, Seed B, Freeman MW. ABCA3 inactivation in mice causes respiratory
10 failure, loss of pulmonary surfactant, and depletion of lung phosphatidylglycerol. J
11 Lipid Res 2007;48:621–632.
12 31. Cheong N, Zhang H, Madesh M, Zhao M, Yu K, Dodia C, Fisher AB, Savani RC, Shuman
13 H. ABCA3 is critical for lamellar body biogenesis in vivo. J Biochem 2007;282:23811–
14 23817.
15 32. Guttentag SH, Beers MF, Bieler BM, Ballard PL. Surfactant protein B processing in
16 human fetal lung. Am J Physiol 1998;275:L559–66.
17 33. Ridsdale R, Na C-L, Xu Y, Greis KD, Weaver T. Comparative proteomic analysis of lung
18 lamellar bodies and lysosome-related organelles. PLoS ONE 2011;6:e16482.
19 34. Wang P, Chintagari NR, Narayanaperumal J, Ayalew S, Hartson S, Liu L. Proteomic
20 analysis of lamellar bodies isolated from rat lungs. BMC Cell Biol 2008;9:34.
21 35. Gerondopoulos A, Langemeyer L, Liang J-R, Linford A, Barr FA. BLOC-3 Mutated in
22 Hermansky-Pudlak Syndrome Is a Rab32/38 Guanine Nucleotide Exchange Factor.
23 Curr Biol 2012;1–5.doi:10.1016/j.cub.2012.09.020.
24 36. Rouhani FN, Brantly ML, Markello TC, Helip-Wooley A, O'Brien K, Hess R, Huizing M,
25 Gahl WA, Gochuico BR. Alveolar macrophage dysregulation in Hermansky-Pudlak
26 syndrome type 1. Am J Respir Crit Care Med 2009;180:1114–1121.
27 37. Mahavadi P, Korfei M, Henneke I, Liebisch G, Schmitz G, Gochuico BR, Markart P,
28 Bellusci S, Seeger W, Ruppert C, Guenther A. Epithelial stress and apoptosis underlie
29 Hermansky-Pudlak syndrome-associated interstitial pneumonia. Am J Respir Crit
30 Care Med 2010;182:207–219.
31 38. Korimilli A, Gonzales LW, Guttentag SH. Intracellular localization of processing
32 events in human surfactant protein B biosynthesis. J Biol Chem 2000;275:8672–8679.
33
34
17

Page 18 of 31
1 Tables
2 Table 1. Genomic and RT-PCR sequencing results from MLE-15/HPS clones
3
Gene Allele Genomic Sequence Variant2 Protein
target Mutation3
Hps1 Allele1 (upper band) C.103_104ins229 (net gain: 230)
!4
Allele 2 (lower band) C.14_96delins76 (net loss: 7) p.Leu5Trpfs*51
Ap3b1 Allele1 (upper band) g.825_830del (net loss: 6) p.Met1Ser
Allele 2 (lower band) g.825_951delinsA (net loss: 126) p.Met1Leu
Hps3 Allele1 (upper band) g.182_192del (net loss: 11) p.Val16fs*20
Allele 2 (lower band) g.189_316delinsTC (net loss: 127) p.Glu19Serfs*15
Bloc1s6 Allele1 g.40_111del (net loss: 72) p.Pro8Leufs*11
4
2 Genomic sequence variant: deletion mutation and insertion mutation by HGVS

nomenclature (http://varnomen.hgvs.org)
3 Protein mutation: translational consequence of deletion by HGVS nomenclature
4 ! Large genomic insertion resulted in a faint band containing non-specific sequence.
18

Page 19 of 31
1 Figure Legends
2 Figure 1: Confirmation of HPS gene editing in MLE-15 cells. Panels A-D combine
3 genomic PCR, RNA RT-PCR, and composite immunoblotting using lysates from WT MLE-15
4 cells (WT), a representative parent cell line created with an empty vector (pX459), a
5 representative gene-edited clone, and lung tissue from WT and HPS mice for: A. MLE-
6 15/HPS1 cells targeting Hps1, B. MLE-15/HPS2 cells targeting Ap3β1, C. MLE-15/HPS3
7 cells targeting Hps3, and D. MLE-15/HPS9 cells targeting Bloc1s6. The panels
8 representing genomic PCR identify with an asterisk the band resulting from DNA cleavages
9 using both sgRNA. Genomic and RT-PCR sequencing results appear in Table 1. Lung
10 homogenates were prepared for immunoblotting from adult lung tissue of C57Bl6/J (WT)
11 mice and the HPS strains pale ear (ep)/HPS1, pearl (pe)/HPS2, cocoa/HPS3, and pallid
12 (pa)/HPS9. Each lane contains 80 µg of total protein, and GAPDH immunoblotting is used
13 as a loading control. Non-specific bands are designated with an asterisk to the right of the
14 immunoblot, and bands representing the detected protein denoted with an arrowhead and
15 size markers appear to the left of the blot. E. Validation of AT2 cell characteristics after
16 MLE-15/HPS clone selection. Quantitative PCR from triplicate samples of MLE-15 cells
17 and MLE-15/HPS clones (n= 4-5 experiments; normalized to Rn18s and Gapdh RNA; mean
18 ± standard deviation with p-values listed below), and immunoblotting of WT mouse lung
19 homogenate, WT MLE-15 cell lysate and MLE-15/HPS cell lysate, using 100 µg protein per
20 lane, in addition to 25 µg lysate from cultured human fetal lung explants described
21 previously (38). Immunoblotting is shown for SFTPB with GAPDH as a loading control.
22 Arrowheads to the right of the image denote the positions of the SFTPB proprotein at 42
23 kD, the major 25 kD intermediate, a 10 kD intermediate common to human AT2 cells, and
24 the mature 8 kD SFTPB.
25
26 Figure 2: Disruption of protein trafficking to lamellar bodies in MLE-15/HPS cells.
27 A. Representative images of MLE-15/WT and MLE-15/HPS2 cells transfected with ABCA3-

28 mCherry and subsequently immunostained for the presence of endogenous LIMP2; nuclei
29 identified by DAPI staining. Scale bars represent 10 µm. B. Representative images of
19

Page 20 of 31
1 primary AT2 cells from WT and pale ear mice immunostained for endogenous LIMP2 and
2 RAB38. Scale bars represent 10 µm; nuclei identified by DAPI staining. C. Representative
3 images of MLE-15/WT and MLE-15/HPS1 cells 24h after transfection with ABCA3-mCherry
4 and EGFP- RAB38 plasmids. Scale bars represent 10 µm; nuclei identified by DAPI staining.
5 D. Immunoblots showing cell lysates from MLE-15/WT and MLE-15/HPS1 cells (80 µg
6 total protein each) using either RAB38 or GFP antisera to detect RAB38-GFP, with GAPDH
7 as a loading control.
9 Figure 3: MCP-1/Ccl2 expression by MLE-15/HPS cell lines.
10 A. Ccl2 qPCR using RNA from WT MLE-15 cells and MLE-15/HPS1, /HPS2, and /HPS3 cells
11 cultured for 24h (n= 7 experiments/triplicate samples; normalized to Rn18s and Gapdh;
12 mean ± standard deviation). B and C. MCP-1 expression in cell culture media by ELISA and
13 Ccl2 qPCR using (B) primary mouse AT2 cells from WT/C57Bl6 (mAT2 WT) and pallid
14 (mAT2 pallid) mice (n= 2 experiments/triplicate samples; qPCR normalized to Rn18s and
15 Gapdh; mean ± standard deviation), and (C) WT MLE-15 and MLE-15/HPS9 cells. (n= 3
16 experiments/triplicate samples; qPCR normalized to Rn18s and Gapdh; mean ± standard
17 deviation).
20

Page 21 of 31
Figure 1/Clone Validation
128x184mm (300 x 300 DPI)

Page 22 of 31
Figure 2/Disruption of protein trafficking to lamellar bodies in MLE-15/HPS
254x362mm (300 x 300 DPI)

Page 23 of 31
Figure 3/MCP-1/Ccl2 expression by MLE-15/HPS cell lines
127x181mm (300 x 300 DPI)

Page 24 of 31
On-line data supplement to:
Gene-edited MLE-15 cells as a model for the Hermansky Pudlak syndromes.

Seunghyi Kook*
Aidong Qi†
Ping Wang*
Shufang Meng*
Peter Gulleman†
Lisa R. Young†
Susan H. Guttentag*
*
Division of Neonatology and
†
Division of Pediatric Pulmonary Medicine,
Department of Pediatrics,
Vanderbilt University School of Medicine,
Nashville, TN

Page 25 of 31
Materials and Methods:
Plasmids and cloning

The CRISPR/Cas9 with T2A-puromycin co-expression vector, pSpCas9(BB)-2A-Puro
(pX459) vector was purchased from Addgene (plasmid no. 48139). The CHOPCHOP
online webtool (https://chopchop.rc.fas.harvard.edu) (1) was used for sgRNA design.
Cloning of sgRNA into pX459 was performed following a modified single-step digestion-
ligation protocol from the Zhang lab, available online at genome-engineering.org (2).
Two complimentary oligos containing guide sequence and BbsI ligation adaptors were
synthesized by Eurofins. Annealing of oligos (100 µM of each oligo in T4 Ligation Buffer
1X –total volume 20 µl @ 37°C for 30 min, 95°C for 5 min, and followed by ramp to
25°C at 5°C/min) was followed by simultaneous digestion and ligation of the annealed
oligo and pX459 vector using 1 µl of BbsI Fast Digest (FD1014, Thermo Scientific), 1 µl
of T4 Ligase (M0202S, NEB) and 2 µl of 10X Fast Digest Buffer (final volume 20 µl; @
37°C for 2 hr). This mixture was transformed into chemically competent DH5α cells. The
resulting plasmid DNA from positive clones was confirmed by gel electrophoresis of
double-digests using BbsI and AgeI, and then by Sanger sequencing performed at
GENEWIZ (South Plainfield, NJ).
MLE-15 Cell Line
MLE-15 cells were cultured in HITES medium (Dulbecco's medium: Ham's F12, 50:50
mix, 0.005 mg/ml of Insulin, 0.01 mg/ml of Transferrin, 30 nM of Sodium selenite, 10 nM
of Hydrocortisone, 10 nM of β-estradiol, 10 mM of HEPES, 2 mM of L-glutamine)
supplemented with 10% fetal bovine serum. Absence of mycoplasma in MLE-15 cell
cultures was verified with the LookOut Mycoplasma PCR Detection Kit (Sigma)
according to manufacturer’s instructions.
Clonal Selection
Three days after the puromycin treatment, cells were placed in fresh culture media
without puromycin and were allowed to recover for 3 days. The transfected and selected
cells were trypsinized and diluted to achieve 1 cell per 200 µl for seeding in 96-well
plates. Single-cell wells were progressively expanded in size up to 24-well plates, when

Page 26 of 31
they were split into duplicate plates so that one plate could be used for PCR and
sequencing of genomic DNA.
Genomic PCR
MLE-15 cell clones were trypsinized when confluent and genomic DNA was isolated
using Qiagen DNeasy tissue kit. Platinum Green Hot Start PCR 2X Master Mix with GC
enhancer (Invitrogen) was used to amplify 100-400 ng of genomic DNA in a 50 µl
reaction with specific primer sets for each target (Supplemental Table 1). PCR
products were eluted by QIAquick gel extraction kit (Qiagen), sized by gel
electrophoresis, and analyzed by Sanger sequencing.
Quantitative real-time PCR analysis
Quantitative real-time PCR was performed using Taqman PCR Master Mix (Applied
Biosystems) with quantification on an Applied Biosystems Step One Plus Cycler. The
following Taqman probes were used: Abca3 (ATP-binding cassette, sub-family A
(ABC1), member 3; Mm00550501_m1), Sftpb (surfactant associated protein B;
Mm00455681_m1), and Ccl2 (Mm00441242_m1). For each sample, expression was
normalized to housekeeping gene RNA expression using probes for Gapdh
(glyceraldehyde-3-phosphate dehydrogenase; Mm99999915_g1) and Rn18s
(Eukaryotic 18S rRNA; Hs99999901_s1).
Immunoblotting and immunocytochemistry
Primary antisera used in immunoblotting included: AP3B1 (GTX113878, Genetex);

AP3M1 (ab201227, Abcam); DTNBP1 (11132-1-AP, Proteintech); GAPDH (MAB374,
Chemicon/Millipore); GFP (JL-8, Clonetech); HPS1 (15077-1-AP, Proteintech); HPS4
(14627-1-AP, Proteintech); HPS6 (11371-1-AP, Proteintech); BLOC1S6 (10891-2-
AP, Proteintech); RAB38 (A-8, Santa Cruz Biotechnology); SFTPB (SP-B; ab40876,
Abcam). Species-specific secondary antisera were all conjugated to IR dyes of either
680 or 800 nm wavelengths (Rockland). Visualization of positive immunoblotting was
accomplished using the Odyssey Imaging System (LiCOR Biosciences, Lincoln, NB).
Where necessary, human fetal lung explants were cultured for 6 d in 10 nM
dexamethasone and 0.1 mM each of IBMX and 8-Br-cAMP to stimulate differentiation of

Page 27 of 31
AT2 cells as described previously (3), and homogenates were used as a comparison to
MLE-15 cell lysates in immunoblots.
Immunocytochemistry where necessary was conducted as previously described (4),

using digitonin to permeabilize cells. Primary antisera used in immunocytochemistry
included the following: rabbit polyclonal antibody to LIMP2 (LS-B305, LifeSpan
BioSciences, Inc. Seattle, WA; 1:250), rabbit polyclonal antibody to SFTPB (ab40876,
Abcam; 1:250), and mouse monoclonal antibody to RAB38 (sc-390176, Santa Cruz
Biotechnology, INC: 1:100). Secondary IgG antibodies included the following: Alexa
Fluor-488-conjugated goat anti-mouse (green); Alexa Fluor-594-conjugated goat anti-
rabbit (red) (Molecular Probes, Eugene, OR). Cells were mounted with ProLong Gold
antifade reagent (Molecular probes, Eugene, OR). Immunofluorescence was imaged
with Nikon Spinning Disk confocal microscope equipped with 60X and 100X lenses, and
NIS Elements software supported deconvolution of images.
Expression plasmids
The ABCA3-EGFP plasmid was the generous gift of Michael Beers and Surafel
Mulugeta (Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA),
and the ABCA3-mCherry plasmid was generated by excising human ABCA3 cDNA from
ABCA3-EGFP plasmid using XhoI and EcoRI restriction endonucleases and inserting it
into pmCherry2-N1. The pEGFP-C2-RAB38 plasmid was created by A. Hume
(University of Nottingham, Nottingham, England, UK) and was supplied to us by Michael
Marks (The Children’s Hospital of Philadelphia, Philadelphia, PA).
MCP-1 assay
Mouse primary cells were plated on 12-well plates (4 cm2) coated with Matrigel at a
density of 1×106 cells per well in triplicate wells in HITES media supplemented with 5%
fetal bovine serum and 10ng/ml of recombinant KGF. MLE-15 cells were plated on 6-
well plates (9 cm2) coated with Matrigel in triplicate at a density of 2×106 cells per well.
This enabled cell growth at similar cell density, which affects MCP-1 production. After
plating and attachment (48h for mAT2 and 24h for MLE-15 cells), fresh media was
replaced and then collected after 24 h to measure MCP-1 levels by ELISA per
manufacturer’s recommendations (R&D Systems, #MJE00).

Page 28 of 31

References:
1. Montague TG, Cruz JM, Gagnon JA, Church GM, Valen E. CHOPCHOP: a
CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Res
2014;42:W401–7.
2. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering
using the CRISPR-Cas9 system. Nat Protoc 2013;8:2281–2308.
3. Korimilli A, Gonzales LW, Guttentag SH. Intracellular localization of processing
events in human surfactant protein B biosynthesis. J Biol Chem 2000;275:8672–
8679.
4. Kook S, Wang P, Young LR, Schwake M, Saftig P, Weng X, Meng Y, Neculai D,
Marks MS, Gonzales L, Beers MF, Guttentag S. Impaired Lysosomal Integral
Membrane Protein 2-dependent Peroxiredoxin 6 Delivery to Lamellar Bodies
Accounts for Altered Alveolar Phospholipid Content in Adaptor Protein-3-deficient
pearl Mice. J Biol Chem 2016;291:8414–8427.

Page 29 of 31
Table E1
Oligonucleotides used to generate CRISPR plasmids, and for genomic PCR, and RT-
PCR, and sequencing.

Target Target sgRNA sgRNA Sequence (5’→ 3’) Genomic Primer Sequence (5’→ 3’) RT-PCR primer Sequence (5’→ 3’)
Complex Gene
BLOC3 Hps1 HPS1-gRNA#1 GAAGATGAAGTGCGTGTTGG F- GAACTAGTTTGGTTCGGTGTCC F- CCTGCTGTGTGCTTTGCCAAG
HPS1-gRNA#4 GCTCCAGCAGTCAGAGGATG R- ACCAAAGTTTGAAGACCACAGG R- GCAGGAAGGCGTGCAGGACCT
AP-3 Ap3b1 HPS2-gRNA#1 GAAACTGTTGCTAGACATCG F- TGAGTGTCCATTGTTTTGAAGC F- TTCGGTGTCCTCCGAACGCCA
HPS2-gRNA#8 AGCAGCGATTGGAAGAAGTG R- CTCAAGACATCAAAAGGCTGC R- CTTCAAAGCTCGCTGGAAAGTGC
BLOC2 Hps3 HPS3-gRNA#1 AGCAGGTAGTCCCCTGCCAG F- CTCTGCATCCACTTAGGGTAGC F- GGAGCAGCTCTCTAAGCTTGC
HPS3-gRNA#7 GCGCAGCACCCTGCCTAGCG R- CCTAGAAGAGCACCAATCCCTT R- CGCTCCTCTTACTCCTCCAAT
BLOC1 Bloc1s6 HPS9-gRNA#2 AGGACCCCGTCTGGAGGCGG F- CTGTGACTTCTCCACAGCACTC F- GTCACTTCCGTGTGCCTCGGC
HPS9-gRNA#5 CGCCGGGTACGGCTGTTTTG R- AAACCTTTAACACAAACCGCAC R- GTGAGTTCCTGGAGTGCTCGC

Page 30 of 31
Figure E1 Legend:
Colocalization of ABCA3-EGFP with endogenous SFTPB in MLE-15/HPS cells.
WT and HPS MLE-15 cells expressing EGFP-tagged ABCA3 (left panel) and
immunostained for endogenous SFTPB (middle panel); merge image is shown in the
right panel. Scale bar represents 10 µm.

Page 31 of 31
Figure E1/ABCA3-EGFP trafficking in MLE15/HPS clones
203x203mm (300 x 300 DPI)

Gene-Edited MLE-15 Cells As A Model For The Hermansky Pudlak Syndromes.

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Gene-Edited MLE-15 Cells As A Model For The Hermansky Pudlak Syndromes.

Uploaded by

Copyright:

Available Formats

AJRCMB Articles in Press. Published on 30-November-2017 as 10.1165/rcmb.

Gene-edited MLE-15 cells as a model for the Hermansky Pudlak syndromes.

Running Head: Gene-edited MLE-15 for HPS cell modeling

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

1 Materials and Methods

2 Additional methodologic details available in an on-line Supplement.

8 MLE-15 cell culture

12 Transfection and puromycin selection

27 AT2 cell isolation

Copyright © 2017 by the American Thoracic Society

1 negative selection on antibody-coated plates (42 ug CD45 and 16 ug CD32 antibodies, BD

3 Quantitative real-time PCR analysis

12 Immunocytochemistry and Fluorescence Microscopy

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

5 Finally, MLE-15/HPS cells would be valuable reagents to investigate mechanisms of HPS

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

1 biogenesis of lysosome-related organelles complex-2 (BLOC-2). J Biochem

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

2 Genomic sequence variant: deletion mutation and insertion mutation by HGVS

Copyright © 2017 by the American Thoracic Society

26 Figure 2: Disruption of protein trafficking to lamellar bodies in MLE-15/HPS cells.

27 A. Representative images of MLE-15/WT and MLE-15/HPS2 cells transfected with ABCA3-

Copyright © 2017 by the American Thoracic Society

9 Figure 3: MCP-1/Ccl2 expression by MLE-15/HPS cell lines.

Copyright © 2017 by the American Thoracic Society

Figure 1/Clone Validation

128x184mm (300 x 300 DPI)

Copyright © 2017 by the American Thoracic Society

Figure 2/Disruption of protein trafficking to lamellar bodies in MLE-15/HPS

254x362mm (300 x 300 DPI)

Copyright © 2017 by the American Thoracic Society

Figure 3/MCP-1/Ccl2 expression by MLE-15/HPS cell lines

127x181mm (300 x 300 DPI)

Copyright © 2017 by the American Thoracic Society

On-line data supplement to:

Gene-edited MLE-15 cells as a model for the Hermansky Pudlak syndromes.

Copyright © 2017 by the American Thoracic Society

Materials and Methods:

Plasmids and cloning

Copyright © 2017 by the American Thoracic Society

Quantitative real-time PCR analysis

Immunoblotting and immunocytochemistry

Primary antisera used in immunoblotting included: AP3B1 (GTX113878, Genetex);

Copyright © 2017 by the American Thoracic Society

Immunocytochemistry where necessary was conducted as previously described (4),

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

Copyright © 2017 by the American Thoracic Society

Figure E1/ABCA3-EGFP trafficking in MLE15/HPS clones

203x203mm (300 x 300 DPI)