Anaerobe 18 (2012) 229e234

Contents lists available at SciVerse ScienceDirect

Anaerobe
journal homepage: www.elsevier.com/locate/anaerobe

Molecular biology, genetics and biotechnology

Identification, Isolation and characterization of a novel azoreductase from

Clostridium perfringens
Jessica M. Morrison, Cristee M. Wright, Gilbert H. John*
Department of Microbiology and Molecular Genetics, Oklahoma State University, 307 Life Science East, Stillwater, OK 74078, USA

a r t i c l e i n f o a b s t r a c t

Article history: Azo dyes are used widely in the textile, pharmaceutical, cosmetic and food industries as colorants and
Received 15 August 2011 are often sources of environmental pollution. There are many microorganisms that are able to reduce
Received in revised form azo dyes by use of an azoreductase enzyme. It is through the reduction of the azo bonds of the dyes
4 December 2011
that carcinogenic metabolites are produced thereby a concern for human health. The field of research
Accepted 7 December 2011
Available online 13 December 2011
on azoreductases is growing, but there is very little information available on azoreductases from
strict anaerobic bacteria. In this study, the azoreductase gene was identified in Clostridium per-
fringens, a pathogen that is commonly found in the human intestinal tract. C. perfringens shows high
Keywords:
Azoreductase
azoreductase activity, especially in the presence of the common dye Direct Blue 15. A gene that
Clostridium perfringens encodes for a flavoprotein was isolated and expressed in Escherichia coli, and further purified and
Azo dyes tested for azoreductase activity. The azoreductase (known as AzoC) was characterized by enzymatic
Direct Blue 15 reaction assays using different dyes. AzoC activity was highest in the presence of two cofactors, NADH
NADH and FAD. A strong cofactor effect was shown with some dyes, as dye reduction occurred without the
FAD presence of the AzoC (cofactors alone). AzoC was shown to perform best at a pH of 9, at room
temperature, and in an anaerobic environment. Enzyme kinetics studies suggested that the associ-
ation between enzyme and substrate is strong. Our results show that AzoC from C. perfringens has
azoreductase activity.
Ó 2011 Elsevier Ltd. All rights reserved.

1. Introduction azoreductases reduce the dyes to their component aromatic

Azo dyes are synthetic organic colorants used widely in the
manufacture of textiles, pharmaceuticals, cosmetics, and a wide
variety of foods. Each year, almost 1 million tons of azo dyes are
produced worldwide [1]. Most of the dyes are released into the
environment as effluent in industrial wastewater and, because of
their recalcitrance, persist there as pollutants [2]. In addition, azo
dyes are linked to causing several types of cancers in humans [3].
Azoreductases cleave the azo linkage (N^N) of azo dyes in
a reductive process that produces aromatic amines and decolor-
izes the dye [2,4]. The genes encoding azoreductases have been
cloned and characterized from a number of bacterial strains
[2,5e8]. The enzymes, reported to be flavoproteins, range from 19
to 30 kDa in size and require either NADH or NADPH as electron
donors. Bacteria from the human intestinal tract can be exposed to
azo dyes from environmental contamination and from consump-
tion of dyes in foods and drugs [9,10]. In the intestine, bacterial
* Corresponding author. Tel.: þ1 405 744 7914; fax: þ1 405 744 6790.
E-mail address: gilbert.john10@okstate.edu (G.H. John).
amines. Some of these amines are carcinogenic and mutagenic to
humans, causing cancer of the kidney, bladder, stomach, and liver
[3,11,12]. Several species of intestinal bacteria with azoreductase
activity have been isolated and studied [13e17]. Among those
having high azoreductase activity is the anaerobic bacterium
Clostridium perfringens.
C. perfringens is a Gram-positive, rod-shaped, anaerobic and
spore-forming bacterium [18]. Some strains contain catalase,
peroxidase, and superoxide dismutase but still require low
oxygen tension and low oxidation reduction potential.
C. perfringens is considered a pathogen as it produced entero-
toxins that cause a range of symptoms from mild enterotoxaemia
to fatal gas gangrene [18]. The bacterium possesses both anaer-
obic respiration and fermentative capabilities, which provides it
with a diverse metabolic capacity [18]. One major metabolic
activity found is azoreductase [19]. The current study isolated an
azoreductase gene from the chromosome of C. perfringens,
expressed the gene in Escherichia coli, and purified and charac-
terized the enzyme activity using several azo dyes. This is the
first time a flavoprotein from C. perfringens has been identified as
having azoreductase activity.

1075-9964/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.anaerobe.2011.12.006
230 J.M. Morrison et al. / Anaerobe 18 (2012) 229e234
2. Materials and methods
2.1. Bacterial strains, Cultivation, Plasmids, and Azo dyes
C. perfringens ATCC 3626 was grown on sheep blood agar plates
in an anaerobic jar for 3 days and used to inoculate 10 ml of
anaerobic brain heart infusion broth (BHI) in an anaerobic chamber.
The broth culture was used for the preparation of chromosomal
DNA and for inoculating additional tubes of 10 ml anaerobic BHI for
assays. TOP10 cells (Invitrogen) were used for initial cloning.
NovaBlueDE3 and BL21pLysS cells (Novagen) were used for
expression. For initial cloning, the host cells were grown in Luria
Bertani (LB) medium containing 50 mg/ml ampicillin. For protein
expression, the host strain was grown in LB medium containing
50 mg/ml ampicillin and 12.5 mg/ml tetracycline. Plasmid pCR 2.1-
TOPO (Invitrogen) was used for initial cloning. The pET-15b
plasmid (Novagen) was used for protein expression. The azo dyes
were purchased from the following companies: Direct Blue 15 (MP
Biomedicals), Methyl Red (Acros Organics), Tartrazine (Sigma-
eAldrich), Trypan Blue (Kodak), Congo Red (SigmaeAldrich),
Eriochrome Black T (MCB), Buffalo Black NBR (Allied Chemical),
Janus Green (SigmaeAldrich) and Cibacron Brilliant Red 3B-A
(SigmaeAldrich).
2.2. Reduction of Azo dyes by C. perfringens whole cells
A volume of 100 ml fresh C. perfringens culture was used to
inoculate 10 ml of anaerobic BHI under anaerobic conditions.
Stock solutions of 1 mg/ml were prepared for the azo dyes Direct
Blue 15, Methyl Red, and Tartrazine and added to each respective
tube to a final concentration of 10 mM. Each assay consisted of
10 ml BHI containing 10 mM dye, 10 ml BHI inoculated with only
C. perfringens, and 10 ml BHI inoculated with both 10 mM dye and
C. perfringens and were performed in triplicate. The samples were
kept at 37  C without agitation. One milliliter samples were
removed every 1.5 h for a minimum of 6 h with a sterile needle
and syringe followed by centrifugation at 14,000 g for 1 min. The
absorbance of Direct Blue 15, Methyl Red, or Tartrazine in the
supernatant was measured spectrophotometrically at 606.5 nm,
430 nm, and 427 nm, respectively. The pellet was resuspended in
1 ml of sterile water and the absorbance was measured at
600 nm. The ability of C. perfringens cells to reduce higher
concentrations of azo dye and the effect of these concentrations
on cell growth was further tested in the presence of 20 mM and
40 mM Methyl Red. The ability of C. perfringens to reduce other
azo dyes was tested in the presence of 10 mM concentrations of
Janus Green, Congo Red, and Trypan Blue in BHI. The assays were
similar to those just described, however, measurements were
taken once and only after incubation for 12 h in the presence of
each dye.
2.3. Identification of the azoC gene in C. perfringens
TBLASTN and TBLASTP software (National Center for Toxico-
logical Research) was used to search the C. perfringens chromosome
for proteins showing homology to the deduced nucleotide and
amino acid sequences of the azoreductases from E. coli, Entero-
coccus faecalis, Staphylococcus aureus and Bacillus OY1-2. A list of
known bacterial azoreductases and their conserved domains was
obtained from the Universal Protein Resource (UniProt) Knowl-
edgebase. The Protein Family Database (PFAM) was used to identify
proteins with these conserved domains within the C. perfringens
chromosome and also to compare their function(s) to that of known
azoreductases.
2.4. Cloning of the C. perfringens azoC ORF and expression of AzoC
in E. coli
Genomic DNA was extracted from a fresh 10 ml culture of C. per-
fringens ATCC 3626 according to the Masterpure Gram Positive DNA
Purification Kit (Epicentre Biotechnologies). The azoC open reading
frame was amplified using C. perfringens genomic DNA as template.
The forward primer (flavoF3) included an Xho1 site before the start
codon: 50 - CGGCCTCGAGATGAAAGTATTATTAGTTA e 30 . The reverse
primer (flavo0915r) included a BamH1 site downstream of the azoC
ORF: 50 GTGAAAGGATCCTTATCTAATAAAATTAGTTCTTTCTCTTTC 30 .
Template DNA and primers for the control reaction were
provided in the TOPO TA cloning kit (Invitrogen). PCR was carried
out in a Perkin Elmer 480 DNA thermal cycler. Conditions for
amplification were followed as outlined in the TOPO TA cloning
manual (Invitrogen) - one cycle of 2 min at 94  C, 25 cycles with
each cycle consisting of 1 min at 94  C, 1 min at 55  C, and 1 min at
72  C, and a final extension of 7 min at 72  C. The products were
analyzed on a 1% agarose gel after staining with ethidium bromide.
The PCR product containing the azoC ORF was directly cloned
into pCR 2.1-TOPO TA vector (Invitrogen) and sequenced. The TOPO
clone and pET15b (Novagen) were each cleaved by sequential
digestion with XhoI and BamHI restriction enzymes, each time at
37  C for 12 h. The 721 bp product from cleavage of the TOPO clone
was purified using the QIAquick Gel Extraction Kit (QIAGEN) and
ligated between the XhoI and BamHI sites of pET15b in a reaction
containing 0.1U T4 DNA ligase and carried out at 4  C for 16 h. A 2 ml
volume of the ligation mixture was used to transform 20 ml of
NovaBlueDE3 cells (Novagen). Following plasmid extractions,
positive clones were confirmed by PCR with the insert specific
primers flavoF3 and flavo0915r and by simultaneous cleavage with
XhoI and BamHI. The recombinant DNA (pAzoC) was used to
transform BL21pLysS cells, which were deficient in protease
activity, and used for expression of the azoreductase.
BL21pLysS cells harboring pAzoC were grown at 37  C overnight
in 300 ml of LB broth containing 50 mg/ml ampicillin and 34 mg/ml
chloramphenicol. BL21pLysS lacking the plasmid was cultured
under the same conditions in the presence of 34 mg/ml chloram-
phenicol and used as a control. The cultures were grown and the
total protein isolated as described in Macwana et al [20]. The
concentration of total protein (mg/ml) was determined using
a Nanodrop spectrophotometer. The samples were analyzed by
SDS-PAGE to confirmed molecular weight and expression levels.
2.5. Purification of the enzyme
The NovaBlue (DE3) E. Coli cells containing the pAzoC and His-tag
as prepared above were used to inoculate LB broth and protein was
grown and isolated as described in Macwana et al [20]. The protein
was purified using nickel-nitrilotriacetic acid (Ni-NTA) slurry (Clon-
Tech) in a 1:1 ratio of supernatant to slurry. Purification also followed
the procedure detailed in Macwana et al [20]. All purification elutions
were analyzed with SDS-PAGE gel and protein concentration was
determined with a Nanodrop spectrometer, using the Molar Extinc-
tion Coefficient of the protein (0.880) to determine the protein
concentration. The Molar Extinction Coefficient was determined by
using the NCBI database. All samples were concentrated using an
Amicon Ultrafiltration cell under Nitrogen pressure and a Millipore
filter (Regenerated Cellulose membrane, NMWL 10,000) to achieve
a suitable protein concentration of between 2 and 5 mg/mL.
2.6. Pure enzyme assays under anaerobic and aerobic conditions
Assays for azoreductase activity for the pure AzoC protein were
carried out both anaerobically and aerobically. All experiments
 J.M. Morrison et al. / Anaerobe 18 (2012) 229e234
were performed in triplicate. Enzyme reactions were carried out in
a 1.5 mL-polystyrene cuvette (SigmaeAldrich) with a total reaction
volume of 1 mL. The buffer used in most cases (except for specific
pH experiments) was 25 mM TRIS, pH 9.0. Although different azo
dyes were tested the final concentration tested was consistently
20 mM. Experiments were performed to determine the optimal
enzyme concentration in the reaction by altering the concentration
of the protein and once the optimal AzoC concentration was found,
different cofactors were tested (NADH and NADPH). The concen-
tration of NADH (Acros Organics) was also altered in experiments to
determine optimal conditions for dye reduction (10 mM NADH).
FAD (SigmaeAldrich) and FMN (SigmaeAldrich) were both tested
as cofactors and FAD was found to be an essential component to the
azoreductase function of AzoC at an optimal concentration of
2 mM.
Reactions were prepared by mixing the appropriate buffer, azo
dye, water and the enzyme together in the cuvette and bubbling
with nitrogen at a rate of 1 nitrogen bubble per second for 10 min.
Immediately following the nitrogen bubbling, mineral oil was
added to the top of the cuvette to prevent the introduction of
oxygen into the newly anaerobic system. Aerobic experiments were
performed without the nitrogen bubbling step and without the
addition of mineral oil. To begin the reaction, 10 mM NADH and
2 mM FAD were mixed together separately and then added to the
reaction and mixed together carefully as to not introduce oxygen
into the system. The reaction was scanned using a Shimadzu UV-
1650 PC spectrophotometer. Each azo dye was scanned prior to the
reaction with the spectrophotometer to determine the optimal
absorbance for each dye (all dye absorption values were above
340 nm and extinction coefficients were used in determining the
final concentration of dyes). In some cases, an absorbance was
selected that was not the optimal due to interference by the
absorbance of FAD, which is an orange color. The absorbencies
tested were as follows: Direct Blue 15 (602.5 nm), Cibacron Brilliant
Red 3B-A (534.00 nm), Congo Red (531.00 nm), Tartrazine
(425.00 nm), Janus Green (597.50 nm), Trypan Blue (533.50 nm),
Buffalo Black NBR (614.50 nm), Methyl Red (430.00 nm) and Erio-
chrome Black T (527.50 nm). Dye concentration was interpolated
from absorbencies by making standard curves of dye concentra-
tions to find the extinction coefficient. This was determined to be
a spectrophotometer-specific equation of a best fit line. Experi-
ments were also done to determine the optimal order of the
addition of reactants to the system where each of the components
(dye, AzoC, cofactors) were added last in separate experiments.
2.7. Pure enzyme assays e cofactor effect
To determine the effect of the cofactor on the enzyme reaction,
experiments were performed that lacked the azoreductase and
contained a protein control, albumin (SigmaeAldrich). The protein
control would serve to show whether the azoreductase was causing
the reduction of the dye or if the cofactors and the presence of
a protein was causing the reduction. Experiments were also per-
formed that did not contain a protein and showed the effects of the
cofactors themselves. In the case of the protein control, 138 mg of
albumin was added to the reaction in place of the AzoC. For the
cofactor controls, only NADH and FAD were added to the reaction;
no protein was present in these experiments.
2.8. Pure enzyme assays e optimal temperature
To determine the optimal temperature for the azoreductase
enzyme to work, experiments were carried out at several different
temperatures (25  C/room temperature, 30  C, 37  C and 45  C).
Prior to the reaction taking place, all components except for the
231
cofactors were incubated in their cuvette in a water bath to reach
the desired temperature. The cuvette was moved to the spectro-
photometer to begin the experiment with the cofactors and then
promptly moved back to the water bath. The absorbance was
recorded every 5 min until the reading reached a plateau.
2.9. Pure enzyme assays e optimal pH
To determine the optimal pH for AzoC to work, several different
pH buffers were prepared to test azoreductase activity: Sodium
acetate pH 4.0 and 5.0, Potassium Phosphate pH 6.0 and 7.0, TRIS
pH 8.0 and 9.0, Sodium bicarbonate pH 10.0 and 11.0, and Potas-
sium chloride pH 12.0. Enzyme experiments were conducted as
described above by only changing the pH of the buffer used.
2.10. Pure enzyme assays e effect of oxygen
Since AzoC is from an anaerobic organism, there was curiosity as
to the effect of oxygen on the protein itself. To study this, anaerobic
and aerobic experiments were performed and compared as
mentioned above. In another experiment, an anaerobic reaction at
the optimal conditions was prepared and taken to complete dye
reduction. Following dye reduction, the cuvette was bubbled again
(in one case with Nitrogen and in another case with Oxygen). Dye
and cofactors were added into the reaction and the cuvette scan-
ned. This provides an understanding of the regeneration of the
enzyme in the presence of oxygen as compared to anaerobically.
2.11. Pure enzyme assays e enzyme kinetics
A brief study of the enzyme kinetics was performed by taking
one component of the experiment (dye, FAD, NADH) and changing
the concentration of that component while keeping the others
constant. The optimal conditions were 20 mM dye, 10 mM NADH
and 2 mM FAD. During the kinetics experiments, the optimal
concentration of one of these components was tested by either
increasing or decreasing in hopes of finding a saturation point for
the enzyme. Results were graphed and analyzed by a Lineweaver-
Burke plot to determine Km and Vmax.
3. Results
3.1. Identification and cloning of AzoC in C. perfringens and dye
reduction by whole cells
To determine the presence of azoreductase activity in
C. perfringens, the culture was grown separately in the presence of
several different azo dyes. C. perfringens cultures were able to
completely (100%) reduce Direct Blue 15 after 4 h under anaerobic
conditions (data not shown). No dye reduction was seen in the
accompanying control (no whole cells). Janus Green, Tartrazine,
and Methyl Red were completely reduced after 12 h but the
controls also showed dye reduction. To test the effect of Direct Blue
15 on culture growth, the cell pellet was compared to dye reduc-
tion. The cell pellet absorbance increased as the dye absorbance
decreased (data not shown). The data suggested that Clostridium
perfrigens contains an azoreductase.
Since the nucleotide and amino acid sequences of known
azoreductases revealed no conserved sequences based on primary
alignments, a more rigorous screening method was implemented.
The putative azoreductase gene from C. perfringens was identified
by first identifying bacterial azoreductase conserved domains
which were found to be homologous to either an FMN_reductase or
a flavodoxin_2 conserved region. Using PFAM, a single putative
NAD(P)H-dependent FMN reductase having a conserved
232 J.M. Morrison et al. / Anaerobe 18 (2012) 229e234
FMN_reductase domain was identified in the C. perfringens chro-
mosome. The gene, annotated as a hypothetical protein was
designated azoC for the purpose of our study. Analysis of the gene
position within the genome revealed the ORF to be part of an
operon with four other ORFs e two hypothetical proteins with
unknown function, a probable anaerobic ribonucleotide reductase,
and a hypothetical protein with a annotated function associated
with 20 -deoxyribonucleotide metabolism (Fig. 1). The putative azoC
ORF was rescued by PCR amplification, producing a DNA fragment
of 721 bp which was subsequently cloned into the pET15b vector
and expressed in BL21pLysS (Fig. 1). The induced protein produced
a band at 22.6 kDa based on the SDS-PAGE gel (Fig. 2). A size
exclusion affinity column using standard molecular weight markers
showed the enzyme to be a tetramer, approximately 90.4 kDa (data
not shown). The cell-free extract containing the induced AzoC was
bright yellow in color, and characteristics peaks at w375 nm and
w450 nm indicated the presence of flavin molecules.
3.2. Pure enzyme assays e initial work and cofactor effect
Bacterial azoreductases require NADH and/or NADPH as an
electron donor and the cofactor FMN and/or FAD can serve as
a prosthetic group. AzoC was determined to be NADH-dependent as
it demonstrated the highest activity compared to the lower activity
of NADPH (data not shown). FAD and FMN were also tested and the
results showed that when only one was present, less than 10%
Direct Blue 15 dye reduction occurred with AzoC, but when
combined with NADH a greater reduction occurred, as 100% of the
dye was reduced (data not shown). The cofactor combination of
FAD/NADH and AzoC showed a 5-fold increase in dye reduction
compared to FAD alone. The FMN/NADH combination and AzoC
showed an 8.5-fold increase in dye reduction compared to FMN
alone. To demonstrate the cofactor effect, a comparison of two
combinations (dye reduction with and without AzoC) was per-
formed. Interestingly, the two combinations produced different
results. The first combination showed FMN/NADH/AzoC and FMN/
NADH/Albumin had similar rates of Direct Blue 15 reduction. The
second combination showed FAD/NADH/AzoC was significantly
greater than FAD/NADH/Albumin (data not shown). When no
protein was present, a slight reduction in dye absorbance occurred
with FAD/NADH (less than 35% dye reduction) but a larger reduc-
tion occurred with FMN/NADH (100% dye reduction) suggesting
that the reduction in dye was caused by the cofactors. The optimal
rate was determined to be FMN/NADH/AzoC.
3.3. Pure enzyme assays e optimal temperature
The optimal temperature of AzoC was between 30  C and 37  C
(Fig. 3). It appears that temperatures that are near body tempera-
ture are the most optimal. Interestingly, when comparing the
cofactor effect at 37  C versus 25  C, the cofactor effect is less at
25  C, supporting the choice to perform experiments at 25  C (room
Fig. 1. Region view of CPE0915 in the C. perfringens Chromosome [21]. CPE0911 e gluthatione peroxidase; CPE0917 e probable anaerobic ribonucleotide reductase; CPE0912,
CPE0913, CPE0916, CPE0918, CPE0919, CPE0920, CPE0922, CPE0923 e hypothetical proteins; CPE0914, CPE0915, CPE0921, CPE0924 e conserved hypothetical proteins. CPE0915
represents the putative azoC.
temperature). AzoC at 37  C showed a 2.0-fold increase over its
control, while AzoC at 25  C showed a 2.4-fold increase over its
control.
3.4. Pure enzyme assays e optimal pH
The optimal pH of the reaction was determined to be pH 9.0
(Fig. 4). Upon further investigation of the protein, it was found that
the pI of the protein is 8.72 which correspond to the optimal pH.
3.5. Pure enzyme assays e effect of oxygen
When AzoC was exposed to oxygen, the specific activity was
significantly lower when compared to the anaerobic sample, as the
anaerobic sample was four-fold higher. Using the same sample
reaction, nitrogen was bubbled into sample to remove oxygen,
addition of cofactor and dye (reactivation), followed by measure-
ment. Again, using the same sample, air was bubbled into the
sample to add oxygen, reactivation, followed by measurements. It
was observed that the reduction of dye was significantly lower
when oxygen was present and faster when oxygen was removed
(data not shown).
3.6. Pure enzyme assays e enzyme kinetics
Enzyme kinetics experiments were completed to determine the
Km and Vmax values for azo dye, FAD and NADH. The data suggest
that the reaction specificity between the enzyme and substrates is
strong, producing Km values of 0.005uM, 0.00018 mM, and
0.0081 mM when the dye concentration, FAD concentration, and
NADH concentrations were varied, respectively. Vmax values were
0.42uM Direct Blue 15/min/mg AzoC, 0.012 mM FAD/min/mg AzoC,
and 0.26 mM NADH/min/mg AzoC.
4. Discussion
Our goal in this study was to isolate the gene responsible for the
azoreductase activity of C. perfringens and to overexpress the protein
in E. coli so that it could be purified and tested for activity. In our
previous study, we analyzed a 3.8 kb fragment of C. perfringens DNA
that had been shown to exhibit minimal activity [3], however no
azoreductase gene was identified [26]. In this study, we used infor-
mation from known bacterial azoreductases and located an open
reading frame in the C. perfringens chromosome that coded for
a putative azoreductase. The protein, AzoC, was overexpressed in
E. coli and the activity of the cell-free extract was tested on the
common dye Direct Blue 15. Our results suggest that AzoC reduces
Direct Blue 15 in a NADH-dependent process under anoxic conditions.
The protein was successfully purified using Ni-NTA affinity
chromatography. Out of the different dyes tested, Direct Blue 15
was determined to be reduced the most efficiently by the enzyme.
Interesting aspects of the enzyme reaction were observed, as it was
 J.M. Morrison et al. / Anaerobe 18 (2012) 229e234 233

Fig. 2. PCR amplification of the AzoC ORF and SDS-PAGE Analysis of AzoC. PCR amplification of AzoC ORF. Lane 1: Mid-range marker, Lane 2: azoC ORF. SDS-PAGE Analysis of AzoC.
Lane 1: Protein standard, Lane 2: Uninduced AzoC, Lane 3: Induced AzoC. Expression was induced with 1 mM IPTG for 3 h at 37  C.

found that, besides needing NADH for reduction, FAD was essential
for the enzyme to reach its full azoreductase potential. FMN did
produce a significant reduction in dye absorbance when combined
with NADH and AzoC, but the control (not AzoC) also produced
a similar drop in absorbance, suggesting that this combination of
cofactors is reducing the dye. The cofactors used in the experiment
(FAD and NADH) were shown to have a large effect on some dyes
(specifically Janus Green, Cibacron Brilliant Red 3B-A and Erio-
chrome Black T) suggesting that in some cases it is possible for the
cofactors alone to reduce the dye. Thus, cofactors only or in the
presence of a non-AzoC protein control should be used as a control
in order to ensure that the dye reduction that is occurring is due to
the azoreductase enzyme being tested and not other components
of the reaction.
The optimal conditions for the azoreduction reaction were
unexpected. The optimal pH was found to be at pH 9, which is
unusual for an intestine-dwelling organism. However, the pI of
AzoC was found to be 8.72, which corresponds to the optimal pH.
This suggests that AzoC may not be performing at its full potential
within the intestinal tract. Though the enzyme seemed to work best
at 30e37  C, the controls told a different story, as there was a strong
cofactor effect at these increased temperatures. The optimal
temperature was found to be at 25  C, which is also unusual for an
intestine-dwelling organism. However, C. perfringens is also
commonly found outside of the body and in the soil [18]. The
observed optimal conditions were demonstrated by enzyme
kinetics studies which supported high specificity in enzyme and
substrate binding, and reaction time.
AzoC was found to have a greater reducing potential for the dye
when under anaerobic conditions compared to aerobic conditions,
and may be sensitive to oxygen, which has been reported by others
[22]. This sensitivity may be due to oxygen oxidizing the cofactor
thereby inhibiting the enzyme reaction [23]. In addition, oxygen
may be a preferable electron acceptor over the azo groups of the
azo dyes [24,25]. However, it is possible that the oxygen is oxidizing
both the cofactors and dyes. When in the presence of oxygen, there
appears to be competition between the oxygen and the azo dye for
electrons from NADH. Thus, performing experiments under an
anaerobic environment provided optimal conditions for Direct Blue
15 reduction. On the other hand, without oxygen, an azo compound
will act as a sole oxidant, and its reduction rate will be influenced
by the flavin nucleotides.
It has been suggested that several different proteins within the
cell are capable of azoreduction, though this may not be their

Fig. 3. Effect of temperature on direct Blue 15 reduction. (For interpretation of the

references to colour in this figure legend, the reader is referred to the web version of Fig. 4. Effect of pH on direct Blue 15 reduction. (For interpretation of the references to
this article.) colour in this figure legend, the reader is referred to the web version of this article.)
234 J.M. Morrison et al. / Anaerobe 18 (2012) 229e234
primary function. In their study of azoreductase in E. coli, Nakanishi
and colleagues discovered that an enzyme thought to be an acyl
carrier protein (ACP) was responsible for the bacterium’s azo
activity [2]. When we searched the C. perfringens chromosome
(National Center for Biotechnology Information-NCBI), we discov-
ered two putative acyl carrier protein phosphodiesterases anno-
tated in the database - CP0587 and CP0837. The amino acid
sequence of CP0837, also annotated as CPE0791, shared 34% iden-
tity and 54% similarity to that of the E. coli AzoR. Similarly, it shared
34% identity and 55% similarity to the amino acid sequence of the
E. faecalis AzoA. It will be interesting to clone the CPE0791 ORF and
test the protein for azoreductase activity.
Researchers suggest several mechanisms by which anaerobic
bacteria are able to reduce azo dyes. One hypothesis is that these
organisms possess true azoreductases that are specific in their
function. Another hypothesis is that reduced electron carriers (eg.
flavins) mediate reduction by a redox mechanism in which azo dyes
are non-specific electron acceptors. Since our protein works best in
the presence of a flavin (FAD), it can be suggested that the second
mechanism is that which fits our AzoC.
In conclusion, our results showed that AzoC from C. perfringens
has azoreductase activity. Optimal conditions for the enzyme were
found to be pH 9.0 and at room temperature (25  C) and with the
cofactors NADH and FAD. A cofactor effect was observed during
experimentation, thereby the degree of reduction by the cofactors
should be considered. AzoC was also found to be oxygen sensitive,
as AzoC performs enzymatically more efficiently under anoxic
conditions than in the presence of oxygen. To our knowledge, this is
the first study in which the ORF for a putative azoreductase or
flavoprotein was rescued from a strict anaerobe, and demonstrated
to have azoreductase activity.
Acknowledgments
This material is based upon work supported by the National
Science Foundation Graduate Research Fellowship under grant
number 1144467. The authors would like to thank Shelby Rice and
Nyssa Cullin for their assistance with AzoC purification.
References
[1] Suzuki Y, Yoda T, Ruhul A, Sugiura W. Molecular cloning and characterization
of the gene coding for azoreductase from Bacillus sp. OY1-2 isolated from soil.
J Biol Chem 2001;276:9059e65.
[2] Naknishi M, Yatome C, Ishida N, Kitade Y. Putative acp phophodiesterase gene
(acpD) encodes an azoreductase. J Biol Chem 2001;276:46394e9.
[3] Rafii F, Coleman T. Cloning and expression in Escherichia coli of an azor-
eductase gene from Clostridium perfringens and comparison with azoreductase
genes from other bacteria. J Basic Microbiol 1999;39:29e35.
[4] Stolz A. Basic and applied aspects in the microbial degradation of azo dyes.
Appl Microbiol Biotechnol 2001;56:69e80.
[5] Blümel S, Stolz A. Cloning and characterization of the gene coding for the
aerobic azoreductase from Pigmentiphaga kullae K24. Appl Microbiol Bio-
technol 2003;62:186e90.
[6] Chen H, Wang RF, Cerniglia CE. Molecular cloning, overexpression, purifica-
tion, and characterization of an aerobic FMN-dependent azoreductase from
Enterococcus faecalis. Protein Expr Purif 2004;34:302e10.
[7] Chen H, Hopper SL, Cerniglia CE. Biochemical and molecular characterization
of an azoreductase from Staphylococcus aureus, a tetrameric NADPH-
dependent flavoprotein. Microbiology 2005;151:1433e41.
[8] Sugiura W, Yoda T, Matsuba T, Tanaka Y, Suzuki Y. Expression and charac-
terization of the genes encoding azoreductases from Bacillus subtilis and
Geobacillus stearothermophilus. Biosci Biotechnol Biochem 2006;70:1655e65.
[9] Marmion DM. Handbook of U.S. colorants: foods, drugs and cosmetics, and
medical devices. 3rd ed. New York: John Wiley & Sons; 1991.
[10] Dillon D, Combes R, Zeiger E. Activation by caecal reduction of the azo dye
D&C Red No. 9 to a bacterial mutagen. Mutagenesis 1994;9:295e9.
[11] Chung KT. Mutagenicity and carcinogenicity of aromatic amines metabolically
produced from azo dyes. Environ Carcino Ecotox Revs 2000;C18:51e74.
[12] Brown MA, DeVito SC. Predicting azo dye toxicity. Crit Rev Environ Sci Technol
1993;23:249e324.
[13] Chung KT, Stevens SE, Cerniglia CE. The reduction of azo dyes by the intestinal
Microflora. Crit Rev Microbiol 1992;18:175e90.
[14] Rafii F, Franklin W, Cerniglia CE. Azoreductase activity of anaerobic bacteria
isolated from human intestinal microflora. Appl Environ Microbiol 1990;56:
2146e51.
[15] Song Z, Zhou J, Wang J, Yan B, Du C. Decolorization of azo dyes by Rhodobacter
Sphaeroides. Biotechnol Lett 2003;25:1815e8.
[16] Walker R, Gingell R, Murrells DF. Mechanisms of azo reduction by Strepto-
coccus faecalis. I. optimization of assay conditions. Xenobiotica 1971;1:221e9.
[17] Gingell R, Walker R. Mechanisms of azo reduction by Streptococcus faecalis. II.
the role of soluble flavins. Xenobiotica 1971;1:231e9.
[18] Ryan K, Ray CG, Ahmad N, Drew WL, Plorde J. Sherris Medical Microbiology.
5th ed. Columbus: The McGraw-Hill Companies; 2010.
[19] Rafii F, Park M, Gamboa da Costa G, Camacho L. Comparison of the metabolic
activities of four wild-type Clostridium perfringens strains with their
gatifloxacin-selected resistant mutants. Arch Microbiol 2009;191:895e902.
[20] Macwana SR, Punj S, Cooper J, Schwenk E, John GH. Identification and Isola-
tion of an azoreductase from Enterococcus faecium. Curr Issues Mol Biol 2010;
12:43e8.
[21] J Craig Venter Institute, The Institute for genomic research comprehensive
microbial resource, viewed 17 May 2007, http://cmr.tigr.org/tigrscripts/CMR/
shared/RegionView.cgi?crumbs¼genomes&locus¼cpe0915&org_
search¼&begin_coord¼&end_coord¼&feat_type.
[22] Bragger JL, Lloyd AW, Soozandehfar SH, Bloomfield SF, Marriott C, Martin GP.
Investigations into the azo reducing activity of a common colonic microor-
ganism. Int J Pharm 1997;157:61e71.
[23] Chang JS, Chou C, Chen SY. Decolorization of azo dyes with immobilized
Pseudomonas luteola. Process Biochem 2001;35:757e63.
[24] Chung KT, Stevens SE. Degradation of azo dyes by environmental microor-
ganisms and helminthes. Environ Toxicol Chem 1993;12:2121e32.
[25] Srinivasan A, Viraraghavan T. Decolorization of dye wastewaters by bio-
sorbents: a review. J Environ Manage 2010;91:1915e29.
[26] Wright C. Molecular cloning and expression of a Putative-FMN-dependent
NADH- azoreductase from Clostridium perfirngens. Master thesis report,
1999, Oklahoma State University; p. 23.