Stem Cell Reports

Ar ticle

MEIS1 Regulates Hemogenic Endothelial Generation, Megakaryopoiesis, and

Thrombopoiesis in Human Pluripotent Stem Cells by Targeting TAL1 and FLI1
Hongtao Wang,1,2,6 Cuicui Liu,1,2,6 Xin Liu,1,2,6 Mengge Wang,1,2 Dan Wu,1,2 Jie Gao,1,2 Pei Su,1,2
Tatsutoshi Nakahata,3 Wen Zhou,4 Yuanfu Xu,1,2 Lihong Shi,1,2 Feng Ma,1,5,* and Jiaxi Zhou1,2,*
1State Key Laboratory of Experimental Hematology, Institute of Hematology & Blood Diseases Hospital, Tianjin 300020, China
2Center for Stem Cell Medicine, Chinese Academy of Medical Sciences & Department of Stem Cells and Regenerative Medicine, Peking Union
Medical College, Tianjin 300020, China
3Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto 606-8507, Japan
4School of Basic Medical Science and Cancer Research Institute, Central South University, Changsha 410013, China
5Institute of Blood Transfusion, Chinese Academy of Medical Sciences & Peking Union Medical College, Chengdu 610052, China
6Co-first author

*Correspondence: mafeng@hotmail.co.jp (F.M.), zhoujx@ihcams.ac.cn (J.Z.)

https://doi.org/10.1016/j.stemcr.2017.12.017

SUMMARY

Human pluripotent stem cells (hPSCs) provide an unlimited source for generating various kinds of functional blood cells. However, effi-
cient strategies for generating large-scale functional blood cells from hPSCs are still lacking, and the mechanism underlying human he-
matopoiesis remains largely unknown. In this study, we identified myeloid ectopic viral integration site 1 homolog (MEIS1) as a crucial
regulator of hPSC early hematopoietic differentiation. MEIS1 is vital for specification of APLNR+ mesoderm progenitors to functional he-
mogenic endothelial progenitors (HEPs), thereby controlling formation of hematopoietic progenitor cells (HPCs). TAL1 mediates the
function of MEIS1 in HEP specification. In addition, MEIS1 is vital for megakaryopoiesis and thrombopoiesis from hPSCs. Mechanisti-
cally, FLI1 acts as a downstream gene necessary for the function of MEIS1 during megakaryopoiesis. Thus, MEIS1 controls human hema-
topoiesis in a stage-specific manner and can be potentially manipulated for large-scale generation of HPCs or platelets from hPSCs for
therapeutic applications in regenerative medicine.

INTRODUCTION tion process can be monitored by the sequential onset of

Hematopoietic stem cell (HSC) transplantation has success-
fully been used to treat patients suffering from hematopoietic
diseases and malignancies. However, the availability and
immunological incompatibility of HSCs limit their clinical
applications (Copelan, 2006). Human pluripotent stem cells
(hPSCs), including human embryonic stem cells (hESCs) and
human induced pluripotent stem cells (hiPSCs), are capable
of long-term proliferation and can differentiate into all three
embryonic germ layers in vitro, providing a potential renew-
able source for generating transplantable HSCs (Inoue et al.,
2014). However, despite considerable progress in methods
of optimizing hematopoietic differentiation, the efficient
generation of HSCs and other genuine functional blood cells
from hPSCs has been unsuccessful (Kaufman, 2009; Slukvin,
2016; Vo and Daley, 2015). Therefore, a better understanding
of the hematopoietic differentiation progress of hPSCs
and its regulatory mechanism is highly demanded before
adequate numbers of robustly transplantable HSCs or other
functional blood cells from hPSCs can be generated.
Hematopoietic differentiation from hPSCs goes through a
sequential series of cell-fate decisions, including specifica-
tion of mesoderm, lateralization of mesoderm, formation
of the hemogenic endothelium progenitors (HEPs), and gen-
eration of hematopoietic progenitors through endothelial to
hematopoietic transition (Slukvin, 2016). The differentia-
markers including BRACHYURY, APLNR, CD31/CD34, and
CD43/CD45 (Slukvin, 2016). Each stage in hematopoietic
differentiation from hPSCs is precisely regulated by different
transcriptional factors. Our study has demonstrated that
MSX2 is essential for the induction of mesoderm from
hPSCs (Wu et al., 2015). The reciprocal repression of
NANOG and CDX2 directs mesoderm specification into
anterior and posterior subtypes (Mendjan et al., 2014). It
has been shown that ectopic expression of RUNX1a pro-
motes hematopoietic commitment of hESCs by increasing
the expression of mesoderm and hematopoietic develop-
ment-associated genes (Ran et al., 2013). TAL1 has been re-
ported to promote hematopoietic differentiation of hPSCs
through accelerating the generation of HEPs (Real et al.,
2012). In line with the critical roles of transcription factors
in hematopoietic specification from hPSCs, a recent study
demonstrates that the combination of GATA2/ETV2 or
GATA2/TAL1 can directly program hPSCs to hemogenic
endothelium-like cells with distinct hematopoietic poten-
tial (Elcheva et al., 2014). Therefore, exploring novel tran-
scription factors implicated in hematopoietic commitment
of hPSCs is highly beneficial for large-scale production of
transplantable HSCs from hPSCs in vitro.
MEIS1 (myeloid ectopic viral integration site 1 homolog)
belongs to the MEIS subfamily of TALE (three-amino-acid
loop extension) homeodomain-containing transcription

Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018 j ª 2018 Institute of Hematology & Blood Diseases Hospital. 447
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
factors. MEIS1 was first identified in BXH-2 leukemic mice,
and its aberrant overexpression is required for the induc-
tion and maintenance of MLL-fusion-induced leukemia
(Collins and Hess, 2016). MEIS1 shows high expression in
HSCs and is downregulated during differentiation except
in the megakaryocytic lineage in which it is highly ex-
pressed (Pineault et al., 2002). Meis1-deficient zebrafish
presents severely impaired primitive and definitive hema-
topoiesis (Cvejic et al., 2011). Mice lacking Meis1 show
extensive hemorrhaging in the trunk and die at embryonic
day 14.5. Furthermore, the number of HSCs in Meis1/
fetal liver is dramatically reduced, and the cells fail to pro-
tect lethally irradiated mice (Azcoitia et al., 2005; Gonza-
lez-Lazaro et al., 2014; Hisa et al., 2004), suggesting the
essential role of Meis1 in early mouse hematopoiesis. How-
ever, the stage at which Meis1 regulates early hematopoie-
sis and the underlying mechanism remain to be elucidated.
In addition, the role of MEIS1 in early hematopoietic differ-
entiation in humans is still undefined.
The embryonic lethality observed in Meis1/ mice re-
sults from failure of lymphatic-venous separation during
embryonic angiogenesis due to the absence of megakaryo-
cytes (Carramolino et al., 2010). Elevated expression of
Meis1 in mouse embryonic stem cells promotes megakaryo-
cytic progenitor differentiation while suppressing erythroid
progenitor development at the megakaryocyte-erythroid
progenitor (MEP) stage (Cai et al., 2012). MEIS1 overexpres-
sion directs human hematopoietic progenitor cells (HPCs)
toward the MEP fate and enhances megakaryocytic colony
formation ability (Zeddies et al., 2014). Although these
studies demonstrate the importance of MEIS1 in megakar-
yocytic differentiation, the precise roles of MEIS1 in mega-
karyocytic maturation, platelet formation, and the underly-
ing mechanisms remain to be defined.
In this study, by taking advantage of a chemical-defined
hematopoietic differentiation model, whole-genome gene
profiling and the CRISPR/CAS9 technology, we identified
MEIS1 as a crucial regulator for hPSC differentiation into
functional hematopoietic cells. We also found that MEIS1
regulates hematopoietic differentiation in a stage-specific
manner and by targeting the transcription factors TAL1
and FLI1. Together, we define a role of MEIS1 in human
development, unveil new mechanisms for human hemato-
poiesis, and contribute potential new strategies to regener-
ative medicine.
RESULTS
MEIS1 as a Potential Regulator of Early Human
Hematopoietic Differentiation
To identify key regulators of human early hematopoietic
differentiation, we induced directed hematopoietic differ-
448 Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018
entiation of H1 hESCs in a chemically defined system
(CDS) by using a previously reported strategy with
modifications (Pang et al., 2013; Wang et al., 2012) (Fig-
ure S1A). We performed time course RNA sequencing
(RNA-seq) analysis in hESC samples collected from day
0 to day 4 after differentiation. Gene set enrichment
analysis (GSEA) demonstrated that hematopoiesis-related
genes were significantly enriched in the differentiated cells
at day 4 compared with undifferentiated cells, thus vali-
dating our screening strategy for hematopoietic gene
screening (Figure 1A). To identify key transcription factors
governing differentiation, 68 transcriptional factors upre-
gulated gradually and steadily during early hematopoietic
differentiation of H1 hESCs were selected (see Table S5).
After 4 days of differentiation, the mRNA levels of all these
factors increased by more than 10-fold (Figure 1B and
Table S5; false discovery rate [FDR] < 0.01). Interestingly,
several previously reported genes crucial for mammalian
hematopoiesis such as GATA2, HOXA9, GFI1, HOXA7,
and HOXA5 were identified (Dou et al., 2016; Huang
et al., 2015; Ramos-Mejia et al., 2014; Sandler et al.,
2014), thereby validating the screening strategy (Figure 1B).
We were particularly interested in MEIS1 because of its
previously documented roles in leukemogenesis and early
hematopoiesis in animals (Azcoitia et al., 2005; Collins
and Hess, 2016).
We first confirmed MEIS1 upregulation during early he-
matopoietic differentiation of both H1 hESCs and an hiPSC
line, BC1 (Chou et al., 2011) (Figure 1C). MEIS1 upregula-
tion was also observed in H1 and BC1 cells induced to un-
dergo hematopoietic differentiation in the presence of the
mouse AGM-S3 (mAGM-S3) feeder cells (Figure 1D), which
have been shown to efficiently induce hematopoietic dif-
ferentiation of hPSCs (Mao et al., 2016). With this method,
CD43+ and CD45+ HPCs can be generated in a stepwise
manner (Figure S1B). Furthermore, in both CDS and
mAGM-S3 co-culture systems, CD43+ cells could further
differentiate into CD45+ hematopoietic cells (Figure S1C)
and generated all types of hematopoietic colonies
including BFU-E, CFU-E, CFU-GM, and CFU-GEMM (Fig-
ure S1D). These data demonstrated that both methods led
us to successfully generate functional hematopoietic cells
from hPSCs. We therefore further measured the expression
of MEIS1 in different populations of hematopoietic cells. In
CD43+ and CD45+ hematopoietic cells derived from H1
and BC1 cells, MEIS1 showed expression levels comparable
to that in human cord-blood-derived CD34+ cells. In
contrast, MEIS1 expression was nearly undetectable in un-
differentiated cells (Figures 1E and 1F). In addition, we also
detected the expression of other hematopoietic differentia-
tion-associated transcriptional factors listed in Figure 1B.
As shown in Figure S1E, GATA2 and GFI1 showed com-
parable expression levels in the hematopoietic cells derived
A B Figure 1. MEIS1 as a Potential Regulator
Enrichment score (ES)

REGULATION OF HEMAPOIESIS
0.30
of Early Hematopoietic Differentiation
NES=2.008288 Days of differentiation
0.25 of hPSCs
0.20 P=0.0014 0 2 3 4
0.15 (A) GSEA comparison of the differentiated
0.10
0.05 cells at day 4 with undifferentiated cells:
GATA2
the enrichment of genes involved in regu-
lation of hematopoiesis (top) and positive
D4 D0 regulation of hematopoiesis (bottom) in the
POSITIVE REGULATION GFI1 differentiated cells at day 4. NES, normal-
Enrichment score (ES)

OF HEMAPOIESIS MEIS1 ized enrichment score.

0.30
NES=1.7990957
HOXA9
0.25 (B) Heatmaps of gradually increased tran-
0.20 P=0.0075
0.15 scriptional factors during early hematopoi-
0.10
0.05 HOXA7 etic differentiation from H1 hESCs. RNA-
HOXA5 seq analysis was performed on samples
-3 +3 collected at day 0, day 2, day 3, and day 4 of
D4 D0 differentiation.
C D (C and D) Time course analysis of MEIS1
expression during hematopoietic differen-
MEIS1 Relative expression

MEIS1 Relative expression

H1 BC1 H1 BC1
500 300 30 200
tiation of hESCs (H1) or hiPSCs (BC1) under
400 chemically defined condition (C) or in
20 150
300 200 mAGM-S3 co-culture (D).
100
200 100 10 (E and F) Real-time PCR analysis of MEIS1 in
100 50
CD34+ cells from human cord blood and the
0 0 0 0
hematopoietic cells derived from H1 or BC1
cells under chemically defined condition
Chemically defined system mAGM-S3 coculture system
(E) or cultured with the mAGM-S3 co-culture
E F system (F). Relative expression is normal-
MEIS1 relative expression

MEIS1 relative expression

H1 BC1 H1 BC1 ized to the level (= 1) of mRNA in undif-

1000 1500 800 1000 ferentiated H1 or BC1 cells.
800 1000 600 800 Error bars represent mean ± SEM of samples
600 500 600 from three independent experiments.
100 400
400 400
200 50 200 200
0 0 0 0
PSCs
PSCs

PSCs

PSCs
CD43+ cells
CD45+ cells

CD43+ cells
CD45+ cells

CD43+ cells
CD45+ cells

CD43+ cells
CD45+ cells
CB CD34+ cells

CB CD34+ cells

CB CD34+ cells

CB CD34+ cells

Chemically defined system mAGM-S3 coculture system

from hPSCs and the CD34+ cells isolated from human cord for the MEIS1 gene in H1 hESCs and BC1 cells using the
blood. However, the expression of HOXA genes (HOXA5, CRISPR/CAS9 technology. Small guide RNAs (sgRNAs) tar-
HOXA7, and HOXA9) in the hematopoietic cells derived geting different exons of the human MEIS1 gene were de-
from hPSCs was obviously lower than that of the CD34+ signed and tested for their genome editing efficacy (Figures
cells isolated from human cord blood. Consistent with 2A, S2A, and S2B). After several clone picking selections, we
our results, low expression of HOXA genes can also be generated cell clones with homozygous MEIS1 deletion
found in published transcriptome analysis of hPSC-derived in both H1 hESCs and BC1 cells with E3G1 sgRNA. Expres-
hematopoietic cells (Dou et al., 2016; Ferrell et al., 2015; Ng sion of MEIS1 was completely absent (Figure 2B), while
et al., 2016). Thus, we identified MEIS1 as a potential regu- sequencing analysis confirmed frameshifts due to deletion
lator of early hematopoietic differentiation in hPSCs. or insertion (Figure 2C). We also included a MEIS1 hetero-
zygous clone derived from H1 hESCs in parallel with the
MEIS1 Deletion Impairs Early Hematopoietic MEIS1 homozygous clones for future analyses.
Differentiation MEIS1 deletion had no effect on hPSC pluripotency. Both
We next addressed the potential role of MEIS1 in hemato- MEIS1/ H1 cells and MEIS1/ BC1 cells grew as compact
poietic specification of hPSCs. We created targeted deletion and morphologically normal colonies. Real-time PCR,

Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018 449

A B
C (D) Real-time PCR analysis of POU5F1, SOX2,
D E
western blot, and immunofluorescence analyses further
showed that MEIS1 deletion did not alter the expression
of pluripotency markers such as NANOG, OCT4, and
SOX2 (Figures 2D, 2E, and S2C).
In contrast, MEIS1 deletion profoundly impaired he-
matopoietic differentiation of hPSCs. In experiments
with the mAGM-S3 co-culture system, MEIS1 deletion
reduced the number of CD43+ HPCs by 2-fold, as assessed
with flow cytometry and immunofluorescence analysis
in both H1 cells (wild-type [WT] 9.17% ± 0.65%
versus MEIS1/ 4.20% ± 0.52%, p < 0.01) and BC1 (WT
5.57% ± 0.42% versus MEIS1/3.03% ± 0.07%, p < 0.05)
cells (Figures 3A and S2D). Similar decrease in CD43+
HPCs was observed in cells produced under the CDS condi-
tion (H1, WT 5.20% ± 0.15% versus MEIS1/ 2.24% ±
0.27%, p < 0.001; BC1, WT 7.84% ± 0.62% versus MEIS1/
450 Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018
Figure 2. Establishment of MEIS1-
Deleted hPSC Lines Using the CRISPR/
CAS9 Technology
(A) Schematics of the Cas9/sgRNA-target-
ing sequences at the human MEIS1 locus.
(B) Western blotting analysis of MEIS1 in
H1, H1 MEIS1+/, and H1 MEIS1/ cells or
BC1 and BC1 MEIS1/ cells. WT and MEIS1-
deleted hPSCs were treated with 10 mM
retinoic acid for 4 days. Tubulin was used as
a loading control.
(C) DNA-sequencing results of H1 MEIS1+/,
H1 MEIS1/, and BC1 MEIS1/ cells.
and NANOG in undifferentiated H1, H1
MEIS1+/, and H1 MEIS1/ cells or BC1
and BC1 MEIS1/ cells. Relative expression
is normalized to the level (= 1) of mRNA in
H1 or BC1 cells.
(E) Western blotting analysis of OCT4, SOX2,
and NANOG in undifferentiated H1, H1
MEIS1+/, and H1 MEIS1/ cells or BC1
and BC1 MEIS1/ cells. Tubulin was used
as a loading control.
Error bars represent mean ± SEM of samples
from three independent experiments. NS,
not significant.
3.44% ± 0.48%, p < 0.01) (Figure S2E). To further demon-
strate that MEIS1 deletion impairs hematopoietic differen-
tiation of hPSCs, we measured the induction of CD45+ he-
matopoietic cells, which arise from CD43+ HPCs (Slukvin,
2016). Indeed, the number of CD45+ cells was much lower
with MEIS1 deletion in both H1 hESCs (H1 WT 7.70% ±
0.76% versus H1 MEIS1/ 2.55% ± 0.92%, p < 0.05) and
BC1 cells (BC1 WT 5.06% ± 0.36% versus BC1 MEIS1/
2.48% ± 0.20%, p < 0.01) (Figure 3B). The decrease in
CD43+ and CD45+ HPCs was also observed in MEIS1 het-
erozygous cells (Figures 3A and 3B). Thus, MEIS1 deletion
impairs hematopoietic differentiation of hPSCs.
MEIS1 Deletion Suppresses HEP Specification
The decrease in production of hematopoietic cells from
hPSCs caused by MEIS1 deletion may result from (1)
A H1 BC1 B H1 BC1
Figure 3. MEIS1 Deletion Impairs Early
** * Hematopoietic Differentiation of hPSCs
*
NS * * by Suppressing HEP Specification
% CD43+ cells

% CD45+ cells
12 6 10 6
(A) Flow cytometry analysis of the percent-
9
6
4
5
4 age of CD43+ hematopoietic precursors at
3 2 2 day 7 of differentiation from WT and MEIS1-
0 0 0 0 deleted hPSCs in mAGM-S3 co-culture.
(B) Flow cytometry analysis of the per-
centage of CD45+ blood cells at day 12 of
C differentiation from WT and MEIS1-deleted
hESCs PS LM HEPs HPCs hPSCs in mAGM-S3 co-culture.
(C) Representative flow cytometry dot plots
D0 D1 D3 D5 D7 showing the sequential emergence of
24.8 3.57 8.05 brachyury+ mesoderm cells, APLNR+ lateral
mesoderm cells, CD31+CD34+ HEPs, and
SSC

SSC

SSC
CD31

CD43+ hematopoietic cells during hPSC he-

matopoietic differentiation in the mAGM-S3
BRACH APLNR CD34 CD43
co-culture system.
D H1 BC1 E H1 BC1
(D) Flow cytometry analysis of the percent-
NS **
age of APLNR+ lateral mesoderm cells at day 3
NS *** of differentiation from WT and MEIS1-deleted
NS *
% CD31+CD34+ cells
% APLNR + cells

30 60 3 3 hPSCs in mAGM-S3 co-culture system.

20 40 2 2
(E) Flow cytometry analysis of the per-
centage of CD31+CD34+ HEPs at day 5 of
10 20 1 1
differentiation from WT and MEIS1-deleted
0 0 0 0 hPSCs in mAGM-S3 co-culture.
(F) Schematic diagram showing the HEP po-
tential analysis of APLNR+ cells at day 3 of
F differentiation in mAGM-S3 co-culture system.
Sorting VEGF
APLNR+ cells
FACS, fluorescence-activated cell sorting.
hPSCs bFGF FACS (G) Flow cytometry analysis of the per-
analysis
mAGM-S3 36h centage of CD31+CD34+ HEPs transited from
Day3 APLNR+ cells.
(H) Flow cytometry analysis of the percent-
G H I age of APLNR+ lateral mesoderm cells at day
H1 BC1
NS *** 3 of differentiation from H1 hESCs without
**
% CD31+CD34+ cells

% CD31+CD34+ cells

* doxycycline (Dox ) or with 1 mg/mL

% APLNR + cells

***
50 30 6
50
40 40 doxycycline (Dox +), which induces MEIS1
20 4
30 30 expression in mAGM-S3 co-culture.
20 20 10 2 (I) Flow cytometry analysis of the percentage
10 10
0 0 0 0 of CD31+CD34+ HEPs at day 5 of differentia-
Dox - + Dox - + tion from H1 hESCs without or with MEIS1
overexpression in mAGM-S3 co-culture.
Error bars represent mean ± SEM of samples
from three independent experiments. NS,
not significant, *p < 0.05, **p < 0.01, and
***p < 0.001.

suppressed proliferation or increased apoptosis of hemato- etic cell precursors with MEIS1 deletion might result from
poietic cells or (2) decreased generation of hematopoietic decreased numbers of CD43+ and CD45+ HPC generation.
cell precursors. To distinguish between these possibilities, The entire hematopoietic differentiation process from
we assessed the rates of proliferation and apoptosis of H1 hESCs could be monitored in both the CDS and
CD43+ HPCs. No significant changes in the fraction of the mAGM-S3 culture system (Figures 3C and S1A).
cycling or apoptotic cells were detected in CD43+ hemato- Furthermore, CD31+CD34+ cells derived from H1 hESCs
poietic cells with MEIS1 deletion in both H1 hESCs and could further differentiate into both endothelial cells
BC1 cells (Figures S2F and S2G). These results led us to hy- and hematopoietic cells in the OP9 co-culture model
pothesize that the impaired generation of early hematopoi- (Uenishi et al., 2014) (Figure S3A). These results confirmed

Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018 451

A B WT Figure 4. MEIS1 Regulates the Specifica-
WT MEIS1-/- MEIS1-/- tion of HEP Cells by Targeting TAL1
H1 BC1
FlI1 1.5 1.5
(A) Heatmaps of 70 downregulated genes

Relative mRNA level

APLN
* * * ** * * * ** in cells differentiated from H1-MEIS1/
TAL1 1.0 1.0 compared with those from differentiated H1
cells.
MYB
0.5 0.5 (B) Real-time PCR analysis of TAL1 in cells
differentiated from WT and MEIS1-deleted
0.0 0.0
FLI1 APLN TAL1 MYB FLI1 APLN TAL1 MYB
hPSCs at day 3 of differentiation in chemi-
-3 +3 cally defined medium.
(C and D) Time course analysis of gene
expression of MEIS1 and TAL1 in H1 (C) or
C H1
D BC1 BC1 (D) during hematopoietic differentia-
200 Relative mRNA level 80 tion in chemically defined medium with
Relative mRNA level

MEIS1 MEIS1 real-time PCR. All values are normalized to

150 TAL1 60 TAL1 the level (= 1) of mRNA in cells cultured in
100 40 mTeSR1 before differentiation (0 hr).
(E) Expression of FLAG-MEIS1 protein in
50 20
hPSCs infected with a lentivirus carrying the
0 0 MEIS1-2A-GFP cassette. Vector carrying
0hr 24hr 36hr 48hr 60hr 72hr 84hr 0hr 24hr 36hr 48hr 60hr 72hr 84hr only GFP was used as a control.
(F) Flow cytometry analysis of the percent-
age of CD31+CD34+ HEPs differentiated
E F WT from WT and MEIS1-deleted hPSCs without
H1 BC1 MEIS1-/- or with TAL1 overexpression. GFP+ gated
WT MEIS1-/- WT MEIS1-/- NS NS events are shown.
% CD31+CD34+ cells

FLAG-TAL1 - + - + - + - +
25 * 25 * Error bars represent mean ± SEM of samples
20 20 from three independent experiments. NS,
FLAG 15 15 not significant, *p < 0.05 and **p < 0.01.
10 10
TUBULIN 5 5
0 0
H1 BC1

CD31+CD34+ cells generated in both cultures are func- APLNR+ cells (Figure 3G). Interestingly, MEIS1 level was
tional intact HEPs. No significant changes in the fraction much higher in CD31+CD34+ cells than in APLNR+ cells
of brachyury+ mesoderm cells or APLNR+ lateral mesoderm derived from H1 hESCs and BC1 cells (Figure S3E).
cells were observed with MEIS1 deletion (Figures 3D and Finally, we asked whether MEIS1 plays a causal role in
S3B). In contrast, MEIS1 deletion in H1 hESCs caused the HEP specification, and we overexpressed MEIS1 in H1
population of CD31+CD34+ HEPs to reduce by approxi- hESCs. MEIS1 overexpression significantly enhanced the
mately 3-fold (2.39% ± 0.17% versus 0.86% ± 0.05%, production of CD31+CD34+ HEPs while exerting little
p < 0.01) (Figure 3E, left). A similar decrease was also effect on APLNR+ cell induction (Figures 3H and 3I).
observed in BC1 cells (Figure 3E, right). Similar decreases Together, our findings demonstrated that MEIS1 acts as a
in CD31+CD34+ HEPs were also observed in H1 hESCs pivotal regulator of hPSC early hematopoietic differentia-
and BC1 cells under CDS conditions (Figure S3C). Further- tion and specifically controls HEP specification from
more, the defects of HEP generation caused by MEIS1 dele- APLNR+ lateral mesoderm cells.
tion could be rescued by forced expression of MEIS1
(Figure S3D). MEIS1 Controls HEP Specification by Targeting TAL1
To directly test whether MEIS1 deletion impairs HEP To investigate the molecular mechanism by which MEIS1
specification, we sorted APLNR+ cells and induced them controls HEP specification, we performed RNA-seq analysis
to HEPs by adding vascular endothelial growth factor of cells undergoing HEP transition, with or without MEIS1
(VEGF) and basic fibroblast growth factor (bFGF) to the cul- deletion. After differentiation, a large number of genes
ture (Figure 3F). As expected, MEIS1 deletion profoundly were downregulated in MEIS1-deleted H1 hESCs compared
inhibited the transition of CD31+CD34+ HEPs from with the WT cells (Figure 4A, Table S5, FDR < 0.01). Among

452 Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018

those, a number of mammalian hematopoiesis-associated
genes such as FLI1, APLN, TAL1, and MYB were signifi-
cantly downregulated, again showing that hematopoiesis
was impaired with MEIS1 deletion. Decreased gene expres-
sion of FLI1, APLN, TAL1, and MYB was further validated in
both H1 hESCs and BC1 cells with real-time PCR analysis
(Figure 4B). Due to their previously documented roles in
human hematopoiesis (Real et al., 2012; Yu et al., 2012),
we hypothesized that APLN or TAL1 might mediate the
function of MEIS1 during HEP specifications. To test this
hypothesis, we first applied APLN directly to MEIS1/
H1 hESCs induced to undergo hematopoietic differentia-
tion. Surprisingly, APLN addition failed to rescue the
decrease in CD31+CD34+ HEPs caused by MEIS1 deletion
(Figure S4A). We next focused on the role of TAL1 in medi-
ating the function of MEIS1. Time course analysis revealed
that MEIS1 was upregulated within 36–48 hr and by
approximately 10-fold at 48 hr after differentiation, when
APLNR+ lateral mesoderm cells emerged (Figure 4C). In
contrast, TAL1 began to increase after 60–72 hr of differen-
tiation induction. Similar results were observed in BC1 cells
(Figure 4D). In addition, MEIS1 was significantly upregu-
lated in APLNR+ cells compared with undifferentiated
hPSCs. In contrast, expression of TAL1 was extremely low
with little difference between APLNR+ cells and undifferen-
tiated hPSCs (Figures S4B and S4C). These results suggested
that the expression of MEIS1 preceded the induction
of TAL1 expression during hPSC early hematopoietic
differentiation. Meanwhile, forced expression of MEIS1
significantly increased the level of TAL1 at day 3 after differ-
entiation (Figure S4D), further implying that MEIS1 might
act as a potential upstream regulator of TAL1. We next
tested the role of TAL1 by expressing TAL1-2A-GFP in
hPSCs via lentiviral infection. Overexpression of TAL1
at both the protein and the mRNA level in H1
hESCs and BC1 cells was verified (Figures 4E and S4E).
Strikingly, flow cytometry analysis demonstrated that
TAL1 overexpression completely reversed the decrease in
CD31+CD34+ HEPs caused by MEIS1 deletion in both H1
hESCs and BC1 cells (Figure 4F). Thus, TAL1 mediates the
function of MEIS1 in converting APLNR+ cells to HEPs dur-
ing hPSC hematopoietic differentiation.
MEIS1/ Megakaryocytes Fail to Undergo
Polyploidization
The important roles of MEIS1 in hPSC early hematopoietic
differentiation led us to ask whether it might play additional
roles in HPC differentiation into multilineage functional
blood cells. We enriched CD43+ HPCs produced after
12-day differentiation from hPSCs and assessed their
behavior in the colony-forming unit (CFU) assay, and no sig-
nificant differences in colony numbers and types were de-
tected in cells with or without MEIS1 deletion (Figure S5A).
It was previously reported that Meis1 deletion disrupts
the generation of megakaryocytes in vivo (Azcoitia et al.,
2005; Carramolino et al., 2010; Gonzalez-Lazaro et al.,
2014; Hisa et al., 2004), leading us to determine the mega-
karyocytic potential of MEIS1/ HPCs in a more special-
ized culture system containing thrombopoietin (TPO) and
other cytokines. This was also because the CFU assay was
not well suited for assessing the differentiation potential
of HPCs to the megakaryocytic lineages. In this culture sys-
tem, large differentiated cells emerged at day 3 and peaked
in number at day 6, while proplatelets were also observed
at day 6 (Figure S5B). Flow cytometry, May-Grünwald Gi-
emsa (MGG) staining, and the spreading assay further
confirmed the generation of functional megakaryocytes
(Figures S5B and S5C). Similar to platelets from peripheral
blood, hPSC-derived platelet-sized particles (PLPs) re-
sponded normally to agonist stimulation as demonstrated
by adhesion, spreading, aggregation, and a-granule release
(Figures S5D–S5G), indicating that hPSC-derived megakar-
yocytes in our systems can produce viable and functional
intact PLPs. Interestingly, MEIS1 was upregulated during
the process (Figure S5H), suggesting that it might also play
a role in megakaryocytic differentiation. Indeed, by using
flow cytometry and immunostaining, we found that
MEIS1 deletion robustly inhibited the generation of
CD41a+CD42b+ megakaryocytes in both differentiating
H1 hESCs and BC1 cells (Figures 5A and S6A). In addition
to the overall decrease in CD41a+CD42b+ megakaryocytes,
quantification of cell diameters demonstrated that MEIS1-
deleted cells differentiated from HPCs were much smaller
compared with the WT cells (H1 hESCs 18.86 ± 0.45 mm
versus 29.07 ± 0.66 mm; BC1 cells 20.06 ± 0.48 mm versus
29.33 ± 0.78 mm, p < 0.001, n = 100) (Figures 5B and S6B).
The decrease in cell volume with MEIS1 deletion was also
shown in experiments with flow cytometry (Figure 5C).
Thus, MEIS1 is pivotal for hPSC megakaryocytic
differentiation.
The decrease in cell size caused by MEIS1 deletion sug-
gested that the CD41+ megakaryocytes produced from
MEIS1/ HPCs might fail to mature properly. In general,
the process of megakaryocyte maturation consists of three
major steps: the emergence and expansion of the demarca-
tion membrane system (DMS), polyploidization mediated
by endomitosis, and production of proplatelets followed
by the release of platelets (Machlus and Italiano, 2013).
To reveal the ultrastructure of the megakaryocytes derived
from hPSCs, we used thin-section electron micrography
to observe granules, mitochondria, DMS, and lobulated
nuclei, allowing us to clearly visualize these structures
in WT hPSC-derived megakaryocytes (Figure S6C, left).
In contrast, the granules and DMS in MEIS1/ mega-
karyocytes were largely absent (Figure S6C, right), sug-
gesting defects in the differentiation program. We therefore
Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018 453
A Figure 5. Megakaryocytes Generated
B C
determined polyploidization in hPSC-derived megakaryo-
cytes with or without MEIS1 deletion. MGG staining
showed that large-size megakaryocytes with high degree
of polyploidy were generated from WT H1 hESCs and
BC1 cells (Figure 5D). In contrast, the megakaryocytes
derived from MEIS1/cells were much smaller in size
and mostly contained two or even fewer nuclei (Figure 5D).
Analysis of DNA content further revealed that most mega-
karyocytes differentiated from MEIS1/ H1 hESCs were
arrested at 2N or 4N stage, with very few cells beyond
>8N stage (R8N, WT 36.56% ± 2.31% versus
454 Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018
from MEIS1/ HPCs Fail to Undergo
Polyploidization
(A) Flow cytometry analysis of the per-
centage of CD41a+CD42b+ megakaryo-
cytes at various stages of megakaryocytic
differentiation.
(B) Distribution of cell sizes (100 cells) in
each group as measured by a hemocytometer.
(C) The cell size at day 3 of megakaryo-
cytic differentiation as measured by flow
cytometry.
(D) Morphology analysis of megakaryocytes
at day 3 of megakaryocytic differentiation
by MGG staining (scale bar, 20 mm).
(E) Ploidy distribution of megakaryocytes at
day 3 of megakaryocytic differentiation was
analyzed by staining cellular DNA with
propidium iodide.
Error bars represent mean ± SEM of samples
from three independent experiments. NS,
not significant, *p < 0.05, **p < 0.01,
***p < 0.001. MK, megakaryocytic.
MEIS1/1.86% ± 0.72%, p < 0.001) (Figures 5E and S6D,
left). The same deficiency was also observed in megakaryo-
cytes derived from BC1 cells (R8N, WT 43.52% ± 5.90%
versus MEIS1/ 1.76% ± 1.27%, p < 0.001) (Figures 5E
and S6D, right). Together, our results demonstrated that
MEIS1 is vital for DMS development and polyploidization
during megakaryocyte maturation.
MEIS1 Deletion Abolishes Thrombopoiesis
Because DMS development and polyploidization are indis-
pensable for thrombopoiesis, we next explored the effects
A Figure 6. MEIS1 Deletion Completely Ab-
B differentiation.
C D
E F
of MEIS1 deletion on thrombopoiesis. While a large number
of proplatelet-forming megakaryocytes were found from
WT H1 hESCs and BC1 cells (Figure 6A, Movie S1), no pro-
platelets were detected in megakaryocytes derived from
MEIS1-deleted cells (Figure 6A and Movie S2). Thus, MEIS1
deletion completely abolishes thrombopoiesis. In keeping
with the results from MEIS1-deleted cells, many fewer pro-
platelets were produced from MEIS1+/ megakaryocytes
(Figure 6A). We next assessed platelet production directly
by measuring the percentages of PLPs collected from culture
supernatant at day 6 after differentiation. Consistent with
rogates Thrombopoiesis
(A) The morphology of representative pro-
platelets at day 6 of megakaryocytic dif-
ferentiation (scale bar, 20 mm).
(B) Flow cytometry analysis of the per-
centage of CD41a+CD42b+ PLPs in the cul-
ture supernatant at day 6 of megakaryocytic
(C) Generation of CD41a+CD42b+ megakar-
yocytes from HPCs with MEIS1 depletion
induced by shMEIS1-651 or shMEIS1-1088.
A scramble shRNA was used as a control.
(D) Generation of CD41a+CD42b+ PLPs
derived from HPCs without or with MEIS1
depletion.
(E) Phase-contrast images of proplatelet
formation from WT and MEIS1-deleted hPSCs
without or with MEIS1 overexpression.
Cells were cultured on plates precoated
with 100 mg/mL fibrinogen for convenient
observation. Vector carrying GFP was used as
a control (scale bar, 20 mm).
(F) Flow cytometry analysis of the percent-
age of CD41a+CD42b+ PLPs derived from WT
and MEIS1-deleted hPSCs without or with
MEIS1 overexpression.
Error bars represent mean ± SEM of samples
from three independent experiments. NS,
not significant, *p < 0.05, **p < 0.01,
***p < 0.001. MK, megakaryocytic.
the earlier findings, CD41a+CD42b+ PLPs were nearly unde-
tectable from culture supernatant of megakaryocytes with
MEIS1 deletion (H1 hESCs 57.26% ± 6.13% versus 4.53% ±
0.57%; BC1 cells 45.38% ± 4.33% versus 2.90% ± 1.81%;
p < 0.01) (Figure 6B).
To exclude the possibility that the decreased megakaryo-
cytic differentiation might result from earlier HEP defects
caused by MEIS1 deletion, we depleted MEIS1 directly in
CD43+ HPCs using small hairpin RNAs (shRNAs) and deter-
mined the impact on megakaryocytic differentiation and
platelet generation (Figure S6E). Indeed, MEIS1 knockdown
Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018 455
from CD43+ HPCs caused the same phenotype as observed
in MEIS1-knocked-out H1 hESCs (Figures 6C, 6D, and S6F).
These results indicated that MEIS1 deletion indeed
impaired megakaryopoiesis and thrombopoiesis, indepen-
dent of the earlier HEP defects.
To further confirm that the deficiency in thrombopoiesis
was due to the loss of MEIS1, we determined whether
MEIS1 ectopic expression could rescue the defects caused
by MEIS1 deletion (Figure S6G). As shown in Figures 6E
and 6F, overexpression of MEIS1 in WT HPCs failed to
further improve the efficiency of platelet generation. In
contrast, overexpression of MEIS1 markedly increased gen-
eration of PLPs from MEIS1/ HPCs. Strikingly, there was
no statistical difference between WT and MEIS1/cells
when MEIS1 was overexpressed. Together, we provide
evidence for an essential role of MEIS1 in human
thrombopoiesis.
MEIS1 Controls Megakaryocytic Specification by
Enhancing FLI1 Expression
We next assessed the mechanism by which MEIS1 controls
megakaryocytic maturation and thrombopoiesis. We con-
ducted RNA-seq analysis, aiming to identify the down-
stream targets that mediate the function of MEIS1. We
detected several hundreds of downregulated genes in cells
with MEIS1 deletion (p < 0.001, FDR< 0.001, Table S5).
GO analysis showed that 8 of the top 10 most significant
biological processes were associated with platelet functions
(Figure 7A). The GSEA based on KEGG gene sets also
showed significant enrichment in platelet-specific genes
in WT cells, whereas such enrichment was not seen in
MEIS1-deleted cells (Figure S7A). The results from large-
scale genomic analysis again demonstrated the reliability
of our platelet generation system and verified that MEIS1
deletion indeed severely impairs thrombopoiesis.
Among the genes with significantly altered expression, a
number of hematopoiesis-associated genes such as PBX1
and FLI1 were identified (Figure 7B and Table S5). We
focused on FLI1 because of its previously reported roles in
megakaryopoiesis (Li et al., 2015). Real-time PCR analysis
confirmed downregulation of FLI1 in MEIS1-deleted H1
hESCs and BC1 cells (Figure 7C). We then tested the func-
tion of FLI1 by overexpressing FLI1-P2A-GFP by using the
lentivirus system (Figure S7B). Ectopic expression of FLI1
was confirmed by real-time PCR and western blot analysis
(Figures S7C and S7D). Remarkably, FLI1 overexpression
nearly completely rescued the decrease in CD41a+CD42b+
megakaryocytes and the reduction in cell sizes caused by
MEIS1 deletion in H1 hESCs and BC1 cells (Figures 7D
and S7E). Thus, FLI1 is vital to mediate the function of
MEIS1 during megakaryopoiesis. Interestingly, in contrast
to the strong effect in rescuing megakaryocytic differentia-
tion, FLI1 overexpression only moderately reversed the de-
456 Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018
fects in proplatelet generation caused by MEIS1 deletion
(Figures 7E and S7F), suggesting that FLI1 only partially
mediates the function of MEIS1 during thrombopoiesis.
DISCUSSION
In summary, we identified MEIS1 as a potential regulator of
hPSC early hematopoietic differentiation. MEIS1 controls
specification of APLNR+ mesoderm progenitors to HEPs,
and TAL1 mediates this function of MEIS1. In addition,
MEIS1 is vital for megakaryocytic differentiation, poly-
ploidization, and subsequent platelet production from
hPSCs. FLI1 acts as a downstream gene necessary for the
function of MEIS1 during megakaryopoiesis and thrombo-
poiesis (Figure 7F). Together, we define a role of MEIS1 in
human development, unveil new mechanisms for human
hematopoiesis, and contribute potential new strategies to
regenerative medicine.
In addition to its function as an accelerator in the patho-
genesis of leukemia, MEIS1 has been shown to play crucial
roles in normal hematopoietic development. Embryonic
lethality at day 14.5 and hematopoietic, vascular, and
retinal defects were observed in MEIS1-deleted homozy-
gous animals (Azcoitia et al., 2005; Gonzalez-Lazaro et al.,
2014; Hisa et al., 2004). Meis1 conditional knockout in
adult mice also caused defects in adult erythropoiesis, meg-
akaryopoiesis, and HSC maintenance (Ariki et al., 2014; Ko-
cabas et al., 2012; Miller et al., 2016; Unnisa et al., 2012).
Despite these animal studies, the role of MEIS1 in human
early development has not been reported to date. Further-
more, how MEIS1 controls early hematopoiesis is even
less understood. Here by using the CRISPR/CAS9 technol-
ogy, we successfully created MEIS1 knockout cell lines in
hPSCs, leading us to define an essential role for MEIS1 in
human early hematopoiesis. In addition, we performed a
detailed analysis of the potential function of MEIS1 in early
hematopoietic development and presented evidence for a
critical and specific role of MEIS1 in transition of APLNR+
cells to CD31+CD34+ HEPs. Thus, the HSC decrease
observed in vivo in Meis1 knockout animals might also
result from the decrease in HEP generation.
By performing large-scale gene profiling analysis and
subsequent functional studies, we identified TAL1 as the
downstream transcription factor that mediates the func-
tion of MEIS1 in controlling HEP generation. Although
the role of TAL1 as a master regulator in HEP generation
in hESCs has been reported (Real et al., 2012), we estab-
lished a functional link between MEIS1 and TAL1 and
unveiled a new signaling mechanism that controls early
hematopoiesis. Our results also suggest that MEIS1 acts as
another master regulator of HEP generation and does so
by acting upstream of TAL1.
 Figure 7. MEIS1 Controls Megakaryo-
A WT vs MEIS1-/- B
WT MEIS1-/- cytic Specification by Enhancing FLI1
platelet activation Expression
platelet degranulation
MEIS1 (A) Top 10 biological functions of down-
platelet aggregation
regulation of platelet activation FLI1 regulated genes in cells with MEIS1 dele-
platelet-derived growth factor receptor signaling pathway PBX1 tion. RNA-seq analysis was performed on
positive regulation of blood coagulation samples collected from at day 0, day 3, and
positive regulation of hemostasis day 6 of megakaryocytic differentiation.
negative regulation of natural killer cell mediated cytotoxicity
(B) Heatmaps of top 20 downregulated
negative regulation of natural killer cell mediated immunity
positive regulation of coagulation transcriptional factors in cells with MEIS1
0 5 10 15 20 25 0.1 2.5
deletion during megakaryocytic differenti-
-log10 P value ation from H1 hESCs.
(C) Real-time PCR analysis of FLI1 in cells
C D differentiated from WT and MEIS1-deleted
hPSCs during megakaryocytic differentia-
H1 BC1 H1 BC1
tion. GAPDH was an internal control. All
% CD41a+CD42+ cells
FLI1 relative expression

NS NS
1.5 * * 50 50
WT values were normalized to the level (= 1) of
1.5 * * MEIS1-/-
40 40 mRNA in the cells derived from WT hPSCs.
1 1 30 30 (D) Flow cytometry analysis of the per-
0.5 0.5
20 20 centage of CD41a+CD42b+ megakaryocytes
10 10 differentiated from WT and MEIS1-deleted
0 0 0 0 hPSCs without or with FLI1 overexpression.
GFP+ gated events are shown.
(E) Flow cytometry analysis of the per-
centage of CD41a+CD42b+ PLPs differenti-
E F ated from WT and MEIS1-deleted hPSCs
WT cultured on plates precoated with fibrin-
H1 MEIS1-/- ogen without or with FLI1 overexpression.
GFP+ gated events are shown.
% CD41a+CD42+ PLPs

*
25
(F) A working model for MEIS1 function and
20
15 * mechanism in hPSC early hematopoietic and
10 megakaryocytic differentiation. LPM, lateral
5 plate mesoderm; HEP, hemogenic endothe-
0 lium progenitor; MKP, megakaryocyte pro-
genitor; MK, megakaryocyte; PLT, platelet.
Error bars represent mean ± SEM of samples
BC1 from three independent experiments. NS,
% CD41a+CD42+ PLPs

*
not significant, *p < 0.05.
15

10 *

In addition to the defects in HEP generation, we also tion in our system was the failure of the cells to undergo
identified defects in megakaryocytic differentiation and polyploidization. This function of MEIS1 has not been re-
platelet generation in cells with MEIS1 deletion, consistent ported earlier. Strikingly, nearly none of CD41+ megakaryo-
with the previously documented defects in megakaryocyte cyte generated from MEIS1/ HPC can develop beyond
lineage development in Meis1 mutant animals (Azcoitia the 4N stage, while live-imaging analysis clearly demon-
et al., 2005; Carramolino et al., 2010; Gonzalez-Lazaro strated that despite a small portion of CD41+ megakaryo-
et al., 2014; Hisa et al., 2004). However, in contrast to the cytes generated, no platelets can be produced from any
in vivo observations, generation of CD41+ megakaryocytes MEIS1/ megakaryocytes. These phenotypic defects point
from human hPSCs was impaired but not completely abro- to an equally important role for MEIS1 in thrombopoiesis
gated. Instead, the primary defect caused by MEIS1 dele- aside from its function in megakaryopoiesis. Together,

Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018 457

our studies markedly extend previous findings that overex-
pression of MEIS1 enhances MEP generation (Zeddies et al.,
2014), providing the direct evidence for a critical and spe-
cific function of MEIS1 in megakaryocyte polyploidization
and platelet derivation. At the mechanistic level, we found
that FLI1 acts downstream of MEIS1 to mediate the func-
tion of MEIS1 in megakaryopoiesis and thrombopoiesis.
Interestingly, FLI1 overexpression nearly completely
rescued differentiation of CD41+ megakaryocytes but
only partially increased platelet generation. Thus, a more
complete delineation of the detailed mechanisms underly-
ing MEIS1’s actions awaits future studies.
hPSCs have long been recognized as a potential source
for large-scale platelet generation in vitro for transfusion,
and large numbers of megakaryocytes can indeed be
derived from hiPSCs via reprogramming with various
gene combinations (Sim et al., 2016). Our findings high-
light the stage-specific functional significance of MEIS1,
TAL1, and FLI1 transcription factors during early hemato-
poiesis, megakaryopoiesis, and thrombopoiesis. This
knowledge can be proved invaluable for manipulating
cell fate during hematopoietic differentiation and for
large-scale megakaryocyte and platelet generation for
future clinical applications.
EXPERIMENTAL PROCEDURES
CD34+ Cell Preparation
Umbilical cordblood (CB) units were obtained from healthy full-
term neonates with informed consent from the parents and
approved by the ethics committee of the Institute of Hematology
and Blood Diseases Hospital, Chinese Academy of Medical Sci-
ences. CD34+ cells were isolated from CB using Ficoll-Hypaque
density centrifugation medium (Sigma-Aldrich, St. Louis, MO)
and MiniMACS CD34+ isolation kit (Miltenyi Biotec, Bergisch
Gladbach, Germany) according to the manufacturer’s instructions.
hPSC Hematopoietic Differentiation in Chemically
Defined Conditions
hPSC hematopoietic differentiation was carried out under chemi-
cally defined conditions as previously described with some modifi-
cation (Pang et al., 2013; Wang et al., 2012). hPSCs were dissociated
into a single-cell suspension using 1 mg/mL Accutase (Gibco) and
plated on Matrigel-coated dishes at a density of 3.5 3 104 cells/
well (12-well plate) in mTeSR1 medium with 10 mM Y27632
(Calbiochem). After 24 hr, hPSCs were induced for stepwise differen-
tiation. First, cells were cultured in Custom mTeSR1 medium supple-
mented with 40 ng/mL activinA (Peprotech) and 50 ng/mL BMP4
(Peprotech) for 2 days. Second, cells were incubated with Custom
mTeSR1 medium supplemented with 40 ng/mL VEGF (Peprotech)
and 50 ng/mL bFGF (Peprotech) for 2 days. Third, cells were
incubated with Custom mTeSR1 medium supplemented with
40 ng/mL VEGF, 50 ng/mL bFGF, and 20 mM SB 431542
(STEMGENT) for 3 days. Finally, differentiated cells were transferred
458 Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018
to low-attachment plates and cultured for 6 days in mTeSR1 medium
containing 50 ng/mL stem cell factor (SCF) (Peprotech), 50 ng/mL
TPO (Peprotech) and 50 ng/mL interleukin-3 (IL-3) (Peprotech),
1 mM GlutaMAX (Gibco), 2% B27 (Gibco), 0.1 mM monothiogly-
cerol (Sigma-Aldrich), 1% insulin-transferrin-selenium (Gibco),
1% N-acetylaspartate (Gibco), 1% penicillin/streptomycin.
hPSC Hematopoietic Differentiation in the mAGM-S3
Co-culture
Hematopoietic differentiation of hPSCs co-cultured with the
AGM-S3 cells was performed as previously described (Mao et al.,
2016). Before co-culture with hPSCs, mAGM-S3 cells were grown
to form an overgrown monolayer and treated with 5 ng/mL mito-
mycin C (Sigma-Aldrich) at 37 C for 2 hr. The hPSCs were prepared
as a suspension of small aggregates using 2 U/mL dispase and
plated on inactivated mAGM-S3 cells at a density of 20–30 aggre-
gates/well (six-well plate) in mTeSR1 medium. On the next day,
the medium was replaced with Iscove’s modified Dulbecco’s me-
dium supplemented with 10% fetal bovine serum (Gibco/Life
Technologies), 15 ng/mL VEGF (Peprotech), 1% nonessential
amino acid solution (Gibco), 100 mM 2-mercaptoethanol (Sigma-
Aldrich) and 1 mM L-glutamine (Gibco), 50 mg/mL L-ascorbic
acid (Sigma-Aldrich), 7 mg/mL human transferrin (Sigma-Aldrich).
The medium was changed every day.
Megakaryocytic Differentiation from hPSCs
After 10 days of hematopoietic differentiation of hPSCs under the
mAGM-S3 co-culture, cobblestone-like cells were mechanically de-
tached and replated onto mitotically inactivated mAGM-S3 cells
in the hematopoietic differentiation medium plus Y-27632
(10 mM), TPO (50 ng/mL), SCF (20 ng/mL), IL-3 (20 ng/mL), IL-6
(10 ng/mL), IL-9 (20 ng/mL), and IL-11 (20 ng/mL, Peprotech).
Fresh medium was used every 3 days.
Establishing MEIS1 Knockout hPSC Lines Using
CRISPR/CAS9 Technology
Lentivirus containing MEIS1-E3G1 was infected into H1 hESCs or
BC1 hiPSCs, which were subsequently selected with puromycin
(1 mg/mL, Sigma). After the genome editing efficacy was accessed
using Surveyor assay, the cells were dissociated into single cells
with Accutase (Gibco). Small colonies emerging from single cells
were picked and expanded. MEIS1 knockout hESC lines were iden-
tified using western blotting assays and gene-sequencing analysis.
RNA-Seq
RNA-seq analysis was performed by BGI Company (BGI, Shenz-
hen, China) as previously described. The mRNA expression levels
were visualized with a heatmap built based on the value of log10
(fragments per kilobase of transcript per million mapped reads + 1)
using MultiExperiment Viewer v.4.2. GO enrichment was per-
formed using Gene Ontology (http://geneontology.org/). The re-
sults are available at Gene Expression Omnibus (GEO: GSE92245).
Lentivirus Production and Infection
Lentiviruses for gene knockdown or overexpression were packaged
using the Viralpower Lentivirus Packaging System (Invitrogen)
according to the manufacturer’s instruction. For early hematopoie-
sis, lentivirus for MEIS1 or TAL1 was added into mTeSR1 medium
with small colonies of hPSCs and Polybrene (3 mg/mL) for 96 hr
before the hematopoietic differentiation of hPSCs. Then GFP+ cells
(4 3 104/mL) were sorted for further hematopoietic differentiation.
For megakaryopoiesis, lentivirus for MEIS1 or FLI1 was mixed
with hematopoietic differentiation medium with HPCs and
Polybrene (6 mg/mL) for 10 hr. Then the megakaryocytic medium
was changed to fresh and cells were replated onto mitotically inacti-
vated mAGM-S3 stromal cells for further differentiation. GFP+
events were gated to analyze the megakaryocytic potential every
3 days.
Statistical Analysis
At least three independent experiments were performed for each
analysis, and two-tailed Student’s t test was used to compare the
differences between two groups using the GraphPad Prism soft-
ware. All data are expressed as the mean ± SD. Differences were
considered statistically significant when p < 0.05.
ACCESSION NUMBERS
The accession number for the RNA-seq reported in this paper is
GEO: GSE92245.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Supplemental Experimental
Procedures, seven figures, five tables, and two movies and can be
found with this article online at https://doi.org/10.1016/j.stemcr.
2017.12.017.
AUTHOR CONTRIBUTIONS
H.T.W., C.C.L., X.L., F.M., and J.X.Z. coordinated and designed the
project; H.T.W., C.C.L., X.L, M.G.W., J.G., and P.S. performed the
experiments; H.T.W., C.C.L., X.L., D.W., and J.X.Z. analyzed
the data; T.N., W.Z., Y.F.X., and L.H.S. contributed new reagents/
analytic tools; H.T.W., C.C.L., and J.X.Z. wrote the manuscript.
ACKNOWLEDGMENTS
This work was supported by the National Basic Research Program of
China (2015CB964902), National Key Research and Development
Program of China Stem Cell and Translational Research
(2016YFA0102300, 2017YFA0103100 and 2017YFA0103102),
CAMS Initiative for Innovative Medicine (2016-I2M-1-018, 2016-
I2M-3-002, 2017-12M-1-015), the Chinese National Natural Science
Foundation (81530008, 31671541, 31500949), the Tianjin Natural
Science Foundation (16JCZDJC33100), PUMC Youth Fund and
Fundamental Research Funds for the Central Universities
(3332015128), and PUMC Graduate Innovation Fund (2016-0710-
09). We thank Dr. He Huang and Linzhao Cheng for providing mate-
rials for this study.
Received: June 6, 2017
Revised: December 19, 2017
Accepted: December 20, 2017
Published: January 18, 2018
REFERENCES
Ariki, R., Morikawa, S., Mabuchi, Y., Suzuki, S., Nakatake, M., Yosh-
ioka, K., Hidano, S., Nakauchi, H., Matsuzaki, Y., Nakamura, T.,
et al. (2014). Homeodomain transcription factor Meis1 is a critical
regulator of adult bone marrow hematopoiesis. PLoS One 9,
e87646.
Azcoitia, V., Aracil, M., Martinez, A.C., and Torres, M. (2005). The
homeodomain protein Meis1 is essential for definitive hematopoi-
esis and vascular patterning in the mouse embryo. Dev. Biol. 280,
307–320.
Cai, M., Langer, E.M., Gill, J.G., Satpathy, A.T., Albring, J.C., Kc, W.,
Murphy, T.L., and Murphy, K.M. (2012). Dual actions of Meis1
inhibit erythroid progenitor development and sustain general he-
matopoietic cell proliferation. Blood 120, 335–346.
Carramolino, L., Fuentes, J., Garcia-Andres, C., Azcoitia, V., Rieth-
macher, D., and Torres, M. (2010). Platelets play an essential role in
separating the blood and lymphatic vasculatures during embry-
onic angiogenesis. Circ. Res. 106, 1197–1201.
Chou, B.K., Mali, P., Huang, X., Ye, Z., Dowey, S.N., Resar, L.M.,
Zou, C., Zhang, Y.A., Tong, J., and Cheng, L. (2011). Efficient hu-
man iPS cell derivation by a non-integrating plasmid from blood
cells with unique epigenetic and gene expression signatures. Cell
Res. 21, 518–529.
Collins, C.T., and Hess, J.L. (2016). Deregulation of the HOXA9/
MEIS1 axis in acute leukemia. Curr. Opin. Hematol. 23, 354–361.
Copelan, E.A. (2006). Hematopoietic stem-cell transplantation.
N. Engl. J. Med. 354, 1813–1826.
Cvejic, A., Serbanovic-Canic, J., Stemple, D.L., and Ouwehand,
W.H. (2011). The role of meis1 in primitive and definitive hemato-
poiesis during zebrafish development. Haematologica 96, 190–
198.
Dou, D.R., Calvanese, V., Sierra, M.I., Nguyen, A.T., Minasian, A.,
Saarikoski, P., Sasidharan, R., Ramirez, C.M., Zack, J.A., Crooks,
G.M., et al. (2016). Medial HOXA genes demarcate haematopoietic
stem cell fate during human development. Nat. Cell Biol. 18, 595–
606.
Elcheva, I., Brok-Volchanskaya, V., Kumar, A., Liu, P., Lee, J.H.,
Tong, L., Vodyanik, M., Swanson, S., Stewart, R., Kyba, M., et al.
(2014). Direct induction of haematoendothelial programs in hu-
man pluripotent stem cells by transcriptional regulators. Nat.
Commun. 5, 4372.
Ferrell, P.I., Xi, J., Ma, C., Adlakha, M., and Kaufman, D.S. (2015).
The RUNX1+24 enhancer and P1 promoter identify a unique sub-
population of hematopoietic progenitor cells derived from human
pluripotent stem cells. Stem Cells 33, 1130–1141.
Gonzalez-Lazaro, M., Rosello-Diez, A., Delgado, I., Carramolino, L.,
Sanguino, M.A., Giovinazzo, G., and Torres, M. (2014). Two new
targeted alleles for the comprehensive analysis of Meis1 functions
in the mouse. Genesis 52, 967–975.
Hisa, T., Spence, S.E., Rachel, R.A., Fujita, M., Nakamura, T., Ward,
J.M., Devor-Henneman, D.E., Saiki, Y., Kutsuna, H., Tessarollo, L.,
et al. (2004). Hematopoietic, angiogenic and eye defects in Meis1
mutant animals. EMBO J. 23, 450–459.
Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018 459
Huang, K., Du, J., Ma, N., Liu, J., Wu, P., Dong, X., Meng, M., Wang,
W., Chen, X., Shi, X., et al. (2015). GATA2(-/-) human ESCs un-
dergo attenuated endothelial to hematopoietic transition and
thereafter granulocyte commitment. Cell Regen. (Lond.) 4, 4.
Inoue, H., Nagata, N., Kurokawa, H., and Yamanaka, S. (2014). iPS
cells: a game changer for future medicine. EMBO J. 33, 409–417.
Kaufman, D.S. (2009). Toward clinical therapies using hematopoi-
etic cells derived from human pluripotent stem cells. Blood 114,
3513–3523.
Kocabas, F., Zheng, J., Thet, S., Copeland, N.G., Jenkins, N.A., De-
Berardinis, R.J., Zhang, C., and Sadek, H.A. (2012). Meis1 regulates
the metabolic phenotype and oxidant defense of hematopoietic
stem cells. Blood 120, 4963–4972.
Li, Y., Luo, H., Liu, T., Zacksenhaus, E., and Ben-David, Y. (2015).
The ets transcription factor Fli-1 in development, cancer and dis-
ease. Oncogene 34, 2022–2031.
Machlus, K.R., and Italiano, J.E., Jr. (2013). The incredible journey:
from megakaryocyte development to platelet formation. J. Cell
Biol. 201, 785–796.
Mao, B., Huang, S., Lu, X., Sun, W., Zhou, Y., Pan, X., Yu, J., Lai, M.,
Chen, B., Zhou, Q., et al. (2016). Early development of definitive
erythroblasts from human pluripotent stem cells defined by
expression of glycophorin A/CD235a, CD34, and CD36. Stem
Cell Reports 7, 869–883.
Mendjan, S., Mascetti, V.L., Ortmann, D., Ortiz, M., Karjosukarso,
D.W., Ng, Y., Moreau, T., and Pedersen, R.A. (2014). NANOG and
CDX2 pattern distinct subtypes of human mesoderm during exit
from pluripotency. Cell Stem Cell 15, 310–325.
Miller, M.E., Rosten, P., Lemieux, M.E., Lai, C., and Humphries,
R.K. (2016). Meis1 is required for adult mouse erythropoiesis, meg-
akaryopoiesis and hematopoietic stem cell expansion. PLoS One
11, e0151584.
Ng, E.S., Azzola, L., Bruveris, F.F., Calvanese, V., Phipson, B., Vla-
hos, K., Hirst, C., Jokubaitis, V.J., Yu, Q.C., Maksimovic, J., et al.
(2016). Differentiation of human embryonic stem cells to
HOXA+ hemogenic vasculature that resembles the aorta-gonad-
mesonephros. Nat. Biotechnol. 34, 1168–1179.
Pang, S., Wu, Q., Tian, S., Su, P., Bai, Y., Gao, J., Yang, Y., Liu, X.,
Zhu, Z., Xu, Y., et al. (2013). Establishment of a highly efficient he-
matopoietic differentiation model from human embryonic stem
cells for functional screening. Sci. China Life Sci. 56, 1147–1149.
Pineault, N., Helgason, C.D., Lawrence, H.J., and Humphries, R.K.
(2002). Differential expression of Hox, Meis1, and Pbx1 genes in
primitive cells throughout murine hematopoietic ontogeny. Exp.
Hematol. 30, 49–57.
Ramos-Mejia, V., Navarro-Montero, O., Ayllon, V., Bueno, C., Ro-
mero, T., Real, P.J., and Menendez, P. (2014). HOXA9 promotes he-
matopoietic commitment of human embryonic stem cells. Blood
124, 3065–3075.
460 Stem Cell Reports j Vol. 10 j 447–460 j February 13, 2018
Ran, D., Shia, W.J., Lo, M.C., Fan, J.B., Knorr, D.A., Ferrell, P.I., Ye,
Z., Yan, M., Cheng, L., Kaufman, D.S., et al. (2013). RUNX1a en-
hances hematopoietic lineage commitment from human embry-
onic stem cells and inducible pluripotent stem cells. Blood 121,
2882–2890.
Real, P.J., Ligero, G., Ayllon, V., Ramos-Mejia, V., Bueno, C., Gutier-
rez-Aranda, I., Navarro-Montero, O., Lako, M., and Menendez, P.
(2012). SCL/TAL1 regulates hematopoietic specification from hu-
man embryonic stem cells. Mol. Ther. 20, 1443–1453.
Sandler, V.M., Lis, R., Liu, Y., Kedem, A., James, D., Elemento, O.,
Butler, J.M., Scandura, J.M., and Rafii, S. (2014). Reprogramming
human endothelial cells to haematopoietic cells requires vascular
induction. Nature 511, 312–318.
Sim, X., Poncz, M., Gadue, P., and French, D.L. (2016). Understand-
ing platelet generation from megakaryocytes: implications for
in vitro-derived platelets. Blood 127, 1227–1233.
Slukvin, I.I. (2016). Generating human hematopoietic stem cells
in vitro -exploring endothelial to hematopoietic transition as a
portal for stemness acquisition. FEBS Lett. 590, 4126–4143.
Uenishi, G., Theisen, D., Lee, J.H., Kumar, A., Raymond, M., Vo-
dyanik, M., Swanson, S., Stewart, R., Thomson, J., and Slukvin, I.
(2014). Tenascin C promotes hematoendothelial development
and T lymphoid commitment from human pluripotent stem cells
in chemically defined conditions. Stem Cell Reports 3, 1073–1084.
Unnisa, Z., Clark, J.P., Roychoudhury, J., Thomas, E., Tessarollo, L.,
Copeland, N.G., Jenkins, N.A., Grimes, H.L., and Kumar, A.R.
(2012). Meis1 preserves hematopoietic stem cells in mice by
limiting oxidative stress. Blood 120, 4973–4981.
Vo, L.T., and Daley, G.Q. (2015). De novo generation of HSCs from
somatic and pluripotent stem cell sources. Blood 125, 2641–2648.
Wang, C., Tang, X., Sun, X., Miao, Z., Lv, Y., Yang, Y., Zhang, H.,
Zhang, P., Liu, Y., Du, L., et al. (2012). TGFbeta inhibition enhances
the generation of hematopoietic progenitors from human ES cell-
derived hemogenic endothelial cells using a stepwise strategy. Cell
Res. 22, 194–207.
Wu, Q., Zhang, L., Su, P., Lei, X., Liu, X., Wang, H., Lu, L., Bai, Y.,
Xiong, T., Li, D., et al. (2015). MSX2 mediates entry of human
pluripotent stem cells into mesendoderm by simultaneously sup-
pressing SOX2 and activating NODAL signaling. Cell Res. 25,
1314–1332.
Yu, Q.C., Hirst, C.E., Costa, M., Ng, E.S., Schiesser, J.V., Gertow, K.,
Stanley, E.G., and Elefanty, A.G. (2012). APELIN promotes hemato-
poiesis from human embryonic stem cells. Blood 119, 6243–6254.
Zeddies, S., Jansen, S.B., di Summa, F., Geerts, D., Zwaginga, J.J.,
van der Schoot, C.E., von Lindern, M., and Thijssen-Timmer,
D.C. (2014). MEIS1 regulates early erythroid and megakaryocytic
cell fate. Haematologica 99, 1555–1564.
Stem Cell Reports, Volume 10

Supplemental Information

MEIS1 Regulates Hemogenic Endothelial Generation, Megakaryopoie-

sis, and Thrombopoiesis in Human Pluripotent Stem Cells by Targeting
TAL1 and FLI1
Hongtao Wang, Cuicui Liu, Xin Liu, Mengge Wang, Dan Wu, Jie Gao, Pei Su, Tatsutoshi
Nakahata, Wen Zhou, Yuanfu Xu, Lihong Shi, Feng Ma, and Jiaxi Zhou
A hESCs PS LM HEPs bFGF+VEGF HPCs
BMP4+Activin A bFGF+VEGF +SB431542

D0 D1 D2 D4 D7
80.8 26.7 13.1 4.97

SSC
SSC

SSC

CD31
BRACH APLNR CD34 CD43
Chemical defined system
B
D7 D12 D7 D12
CD43 CD45 9.7 8.5
hESCs

SSC
SSC
100μm
mAGM-S3 CD43 CD45
Immunofluorescence Flow cytometry

C Chemical defined system D

Chemical defined system
10.6 35.6 53.2 82.2
CD45

D3 D6 D9 BFU-E CFU-E CFU-GM CFU-GEMM

CD43
mAGM-S3 coculture system
mAGM-S3 coculture system
11.4 5.40 27.2 50.2
CD45

BFU-E CFU-E CFU-GM CFU-GEMM

CD43 D3 D6 D9

E GATA2 GFI1 HOXA9 HOXA7 HOXA5

Relative mRNA level

3000 150 600 2000 9000

400 6000
2000 100 1000
200 3000
10 200 100
1000 50
5 100 50
0 0 0 0 0
CB CD34+ cells

CB CD34+ cells

CB CD34+ cells

CB CD34+ cells

CB CD34+ cells
CD43+ cells
CD45+ cells

CD43+ cells
CD45+ cells

CD43+ cells
CD45+ cells

CD43+ cells
CD45+ cells

CD43+ cells
CD45+ cells
H1 cells

H1 cells

H1 cells

H1 cells

H1 cells

Fig. S1
Fig. S1 hPSC hematopoietic differentiation in chemical defined system and mAGM-S3

co-culture system. Related to Fig. 1. (A) Top panel: scheme of hPSC hematopoietic

differentiation in chemical defined system. Bottom panel: representative flow cytometry dot plots

showing the sequential emergence of brachyury+ mesoderm cells, APLNR+ lateral mesoderm cells,

CD31+CD34+ HEPs, and CD43+ hematopoietic cells during hPSC hematopoietic differentiation.

(B) Left panel: scheme of hPSC hematopoietic differentiation in mAGM-S3 co-culture system.

Right panel: representative immunofluorescence and flow cytometry analysis displaying the

generation of CD43+ and CD45+ hematopoietic cells at day7 and day12 of differentiation. (C) The

CD43+CD45- cells derived from H1 hESCs in chemical defined system (top panel) and mAGM-S3

co-culture system (bottom panel) can further differentiated into CD45+ definitive hematopoietic

cells. (D) Haematopoietic colony-forming potential of CD43+ HPCs produced from H1 hESCs in

chemical defined system (top panel) and mAGM-S3 co-culture system (bottom panel).

Representative morphologies of CFU-GEMM, CFU-GM, CFU-E and BFU-E are shown. (E)

Real-time PCR analysis of GATA2, GFI1, HOXA9, HOXA7 and HOXA5 in CD34+ cells isolated

from human cord blood and the hematopoietic cells derived from H1 or BC1 cells under

chemically defined condition. Relative expression is normalized to the level (= 1) of mRNA in

undifferentiated H1 or BC1 cells. Results are shown as means ±SEM (n = 3).

A B

sgE7G1

sgE3G1
sgE2G5
sgE3G1
sgE6G1

sgE3G1
Control

Control
1000bp→ 1000bp→
1000bp→
700bp→ 700bp→ 700bp→
500bp→ 500bp→ 500bp→
400bp→ 400bp→
300bp→ 400bp→
300bp→ 300bp→
200bp→
200bp→ 200bp→

293T cells H1 cells BC1 cells

C H1 BC1
E
H1
WT MEIS1+/- MEIS1-/- WT MEIS1-/-
***
**
OCT4

positive cells
% of CD43
4
100μm
2
NANOG

D H1 BC1 BC1
**
WT MEIS1+/- MEIS1-/- WT MEIS1-/- 10
CD43 positive cells8
% of CD43
CDS

6
4
100μm
2
0
mAGM-S3

CD43
coculture

Chemical defined system

F H1 BC1
G H1 BC1
NS NS NS NS
% of Annexin Ⅴ positive

NS NS
% of KI-67 positive
cells in CD43+ cells

cells in CD43+ cells

100 80 8 10
80 60 6 8
60 6
40 4
40 4
20 20 2 2
0 0 0 0

Fig. S2
Fig. S2 Targeted deletion of MEIS1 in human HPCs. Related to Fig. 2 and Fig. 3. (A)

Surveyor assay of sgMEIS1 mediated cleavage at MEIS1 loci in 293T cells. (B) Surveyor assay of

sgMEIS1-E3G1 mediated cleavage at MEIS1 loci in H1 and BC1 cells. (C) Immunofluorescence

analysis of OCT4, SOX2 and NANOG in undifferentiated H1, H1 MEIS1+/- and H1 MEIS1-/- cells

or BC1 and BC1 MEIS1-/- cells. Nuclei were labeled with DAPI (blue). Scale bar, 100 μm. (D)

Immunofluorescence analysis of CD43 differentiated from WT and MEIS1-deleted hPSCs in

mAGM-S3 co-culture. Scale bar, 100 μm. Nuclei were labeled with DAPI (blue). (E) Flow

cytometry analysis of the percentage of CD43+ hematopoietic precursors at day 7 of

differentiation from WT and MEIS1 deleted hPSCs in chemical defined system. (F) The

proliferation rates analysis of hematopoietic cells by analyzing the percentages of Ki67+ cells in

CD43+ cells. (G) Apoptosis analysis of hematopoietic cells by determining the percentages of

Annexin V+ cells in CD43+ cells. Error bars represent mean ±SEM of the mean of samples from 3

independent experiments. NS, not significant.

A CDS Endothelial cultures
FACS analysis
Sorting AcLDL uptake analysis
CD31+ CD34+ cells Tube formation analysis

Immunofluorescence
FACS analysis
mAGM-S3
co-culture OP9 co-culture

Endothelial cultures OP9 co-culture

13.4 62.3 7.85

CDS

CD43
CD31

19.1 3.10
co-culture
mAGM-S3

4.25

100μm 100μm 200μm 100μm 61.8

CD34 VEC VE-cadherin VE-cadherin CD144
AcLDL CD43 DAPI

B H1 BC1
C H1 BC1
NS NS
NS NS
% CD31+CD34+ cells

NS NS
% BRACH+ cells

80 60 15 40
60 30
40 10
40 20
20 20 5
10
0 0 0 0

mAGM-S3 coculture Chemical defined system

D WT
E APLNR+ cells
H1 BC1 MEIS1-/- CD31 + CD34+ cells

* NS * NS H1 BC1
% CD31+CD34+ cells

20 * 30 * *** ***
relative expression

5 4
15 4
20 3
MEIS1

10 3
10 2
5 2
1 1
0 0

mAGM-S3 coculture system

Fig. S3
Fig. S3 MEIS1 deletion impairs early hematopoietic differentiation of hPSCs through

suppressing HEPs specification. Related to Fig. 3. (A) Top panel: the schematic diagram

showing the experiment performed to detect the hematopoietic and endothelial potential of

HEPs.Bottom panel: analysis of the endothelial and hematoendothelial potential of CD31+CD34+

cells derived from H1 hESCs in chemical defined system (Top panel) or mAGM-S3 co-culture

system (Bottom panel). (B) Flow cytometry analysis of the percentage of brachyury+ mesoderm

cells at day 1 of differentiation from WT and MEIS1 deleted hPSCs in mAGM-S3 co-culture

system. (C) Flow cytometry analysis of the percentage of CD31+CD34+ HEPs at day 4 of

differentiation from WT and MEIS1 deleted hPSCs in chemical defined system. (D) Flow

cytometry analysis of the percentage of CD31+CD34+ HEPs differentiated from WT and MEIS1

deleted hPSCs without or with MEIS1 overexpression. GFP+ gated events are shown. (E)

Real-time PCR analysis of MEIS1 in APLNR+ lateral mesoderm cells and CD31+CD34+ HEPs

derived from H1 or BC1 in mAGM-S3 co-culture system. Error bars represent mean ±SEM of the

mean of samples from 3 independent experiments. NS, not significant, *P<0.05, ***P<0.001.
A B C
H1 cells BC1 cells
H1 WT APLNR+ cells APLNR+ cells
MEIS1-/- ** **
% CD31+CD34+ cells

Relative mRNA level

Relative mRNA level

25 ** 40 20
20 30
NS 20 15
15 10
10 NS 10 NS
10
5 5 5
0 0 0
MEIS1 TAL1 MEIS1 TAL1

D E
Relative TAL1 expression
H1 BC1 WT
* MEIS1-/-
30
TAL1 expression

8000 6000
6000 4000
4000
Relative

20
2000 2000
20 20
10
10 10
0 0 0
Dox - +

Fig. S4
Fig. S4 MEIS1 regulates the specification of HEP cells by regulating TAL1. Related to Fig. 4.

(A) Flow cytometry analysis of the percentage of CD31+CD34+ HEPs differentiated from WT and

MEIS1 deleted hPSCs without or with APLN addition from day 2 to day 4. GFP+ gated events are

shown. (B and C) Real-time PCR analysis of MEIS1 and TAL1 in APLNR+ lateral mesoderm cells

and CD31+CD34+ HEPs derived from H1 (B) or BC1 (C) in chemically defined medium. (D)

Real-time PCR analysis of TAL1 at day 3 of differentiation from H1 hESCs without doxycycline

(Dox -) or with 1 μg/ml doxycycline (Dox +), which induces MEIS1 expression in chemically

defined medium. (E) Real-time PCR analysis of MEIS1 and TAL1 in WT and MEIS1 deleted

hPSCs without or with TAL1 overexpression. GFP+ gated events are shown. Error bars represent

mean ± SEM of the mean of samples from 3 independent experiments. NS, not significant, *P<

0.05, **P< 0.01.

A NS
150 NS 120% CFU-GEMM

CFU per 10000 cells

100% CFU-GM
CFU-E
100 80% BFU-E
60%
50 40%
20%
0 0%

B TPO+SCF+IL-3+IL-6+IL-11
hPSC-MK hPSC-MK
20.2
Cell

CD41a
detachment

20μm

0 3 6 CD42b
Days of MK differentiation

C D E
hPSC-MK PB-PLT hPSC-PLP PB-PLT hPSC-PLP
CD41 F-actin 96.9 90.7 CD41 F-actin
Thrombin -

Thrombin -

DAPI DAPI
SSC

20μm 10μm
FSC
Thrombin +

Thrombin +
CD41a

85.4 40.2

CD42b

F G negative
H
inactive 6
PB-PLT hPSC-PLP PB-PLT hPSC-PLT active
MEIS1 relative
expression

2
Count

4μm F-actin 0
CalceinAM 0 3 6
CD62p Days of
MK differentiation

Fig. S5
Fig. S5 Functional megakaryocytes and platelets generated from HPCs derived from hPSCs

in mAGM-S3 co-culture system. Related to Fig. 5 and Fig. 6. The number of total colonies (left

panel) and the proportion of CFU-GEMM, CFU-GM, CFU-E and BFU-E (right panel). (B)

Schematic of the megakaryocytic differentiation of hPSCs(left panel). This differentiation

protocol is divided in two stages: Hematopoietic differentiation stage and megakaryocytic

differentiation stage (scale bar, 20μm). Large megakaryocytes were indicated by white arrows and

proplatelet-forming megakaryocytes were indicated by black arrows. CD41a and CD42b

expression of hPSC-derived megakaryocytes were identified by flow cytometry (middle panel).

Morphology of megakaryocytes were measured by May-Gr¨unwald-Giemsa staining (scale bar,

20μm). (C) Staining of F-actin (green) and CD41 (red) in megakaryocytes spread on collagen with

or without thrombin stimulation (scale bar, 20μm). (D) Flow cytometry analysis of hPSC-derived

platelets and peripheral blood platelets with identical gate. Peripheral blood platelets (left panel)

and representative histograms of CD41a and CD42b expression in hPSC-derived platelet-like

particles (hPSC-PLPs) (right panel) at day 6 identified by flow cytometry. (E) CD41 (red) and

F-actin (phalloidin A488; green) staining of blood platelets (left panel) or hPSC-PLPs (right panel)

bound to immobilized fibrinogen in the absence or presence of 1 U/ml thrombin (scale bar, 5μm).

(F) Aggregates of a mixture of 2×105 calcein-AM (green)-labeled blood (left panel) or cultured

platelets (right panel) and 2×107 blood platelets. In red, F-actin staining of both populations. Scale

bar = 4μm. (G) Representative histograms of P-selectin (CD62P) expression analyzed by flow

cytometry in each group. Blood platelets (left panel) were used as positive control. Red line

denotes negative control, and green and blue lines denote resting platelets and activated platelets,

respectively. (H) mRNA levels of MEIS1 was assessed by real-time PCR throughout

megakaryocytic differentiation. GAPDH was an internal control. All values were normalized to

the level (=1) of mRNA in the cells at day 0. Error bars represent mean ± SEM of the mean of

samples from 3 independent experiments. NS, not significant.

A H1 BC1 C
WT MEIS1+/- MEIS1-/- WT MEIS1-/-
CD41 H1 WT

G
Mt
20μm DMS N
10μm

B H1 BC1 H1 MEIS1-/-
WT MEIS1+/- MEIS1-/- WT MEIS1-/-
Mt
N

20μm

D H1 BC1

WT MEIS1+/- MEIS1-/- WT MEIS1-/-

2N 23.9% 2N 50.7% 2N 67.6 % 2N 15.4% 2N 66.9%
4N 37.2% 4N 26.6% 4N 31.0 % 4N 40.2% 4N 29.8%
≥8N 38.9% ≥8N 22.7% ≥8N 1.4% ≥8N 44.4% ≥8N 3.3%
Count

PI

E F
Scramble shRNA-651 shRNA-1088
Relative MEIS1 expression

**
30
**

20
20μm

10
G
WT MEIS1-/- WT MEIS1-/-
0
Scramble

shMEIS1-651

shMEIS1-1088

FLAG-MEIS1 - + - + - + - +

FLAG

TUBULIN

H1 BC1

Fig. S6
Fig. S6 MEIS1 deletion impaired megakaryopoiesis and thrombopoiesis. Related to Fig. 5

and Fig. 6. (A) Morphology analysis of megakaryocytes at day6 by CD41 staining (scale bar,

20μm). (B) Representative cell morphology at day 3 of megakaryocytic differentiation from WT

and MEIS1 deleted hPSCs (scale bar, 20μm). Large cells were indicated by black arrows. (C) Thin

section electron micrographs of WT and MEIS1-/--HPCs-derived megakaryocytes (Scale bar,

10μm). Mt, mitochondria; G, granules; DMS, demarcation membrane system; N, nuclei. (D)

Ploidy distribution of megakaryocytes at day 6 of megakaryocytic differentiation was analyzed by

flow cytometry. (E) Real-time PCR analysis of HPCs transduced with a random shRNA sequence

(Scramble) or two different specific shRNA sequences for MEIS1 (shMEIS1-651 or

shMEIS1-1088) before megakaryocytic induction. All values are normalized to the level (= 1) of

mRNA in the cells infected with scramble shRNA lentivirus. (F) Images of proplatelet-formation

from HPCs without or with MEIS1 knockdown. Cells were cultured on plates precoated with 100

mg/ml fibrinogen for convenient observation (scale bar, 20 μm). (G) Expression of FLAG-MEIS1

protein in hPSCs infected with a lentivirus carrying the MEIS1-2A-GFP cassette. Vector carrying

only GFP was used as a control. After 48 h of infection, GFP + cells were sorted for analysis. Error

bars represent mean ±SEM of the mean of samples from 3 independent experiments. **P< 0.01.
A
RAGHAVACHARI PLATELET REACTOME PLATELET ACTIVATION
SPECIFIC GENES SIGNALING AND AGGREGATION

Enrichment score (ES)

Enrichment score (ES)
0.7 0.6
0.6
NES=2.1608624 NES=1.9718912
0.5
0.5 P=0.0 P=0.0
0.4
0.4 0.3
0.3
0.2
0.2
0.1 0.1

WT MEIS1-/- WT MEIS1-/-

B
D0 D10 (+D0) +D3 +D6

Stage I Stage II

hPSCs HPCs MK-PLT MK-PLT

FACS FACS

mAGM-S3
co-culture
lentivirus

C D
WT
Relative FLI1 expression

H1 BC1 WT MEIS1-/- WT MEIS1-/-

MEIS1-/-
40 80
FLAG-FLI1 - + - + - + - +
30 60
20 40 FLAG
10 20
TUBULIN
0 0
H1 BC1

E F
WT WT MEIS1-/- MEIS1-/- + FLI1
MEIS1-/-
MEIS1-/- + FLI1
H1
H1

20μm

WT
MEIS1-/-
MEIS1-/- + FLI1
BC1 BC1
Count

FSC

Fig. S7
Fig. S7 MEIS1 regulates the megakaryocytopoiesis by regulating FLI1. Related to Fig. 7. (A)

GSEA comparison of cells derived from WT and MEIS1 deleted H1 hESCs: the up-regulation of

platelet specific genes (left panel) and platelet activation signaling and aggregation-associated

gene expression (right panel). The normalized enrichment scores (NES) and P values are indicated

in each plot. (B) The schematic diagram showing the experiment performed to determine whether

FLI1 ectopic expression could rescue the defects caused by MEIS1 deletion. GFP+ events were

gated to analyze the megakaryocytic potential every 3 days. (C and D) Real-time PCR analysis

and Western blot analysis of FLI1 in hPSCs infected with a lentivirus carrying GFP or

FLI1-2A-GFP cassette. (E) Size distribution of celsl with or without FLI1 overexpression was

measured by flow cytometry. (F) Representative morphology of proplatelets derived from

megakaryocytes with or without FLI1 overexpression (scale bar, 20μm). Error bars represent

mean ±SEM of the mean of samples from 3 independent experiments.

Supplemental Experimental Procedures
Cell culture
H1 hESC lines (WiCell Research Institute, Madison, WI) and BC1 hiPSC lines were maintained on
Matrigel (BD Biosciences)-coated plates in mTeSR1 medium (Stem Cell Technologies). For
maintenance of self-renewal, cells were fed daily and passaged using 2 U/ml dispase (Stem Cell
Technologies) at a dilution of 1:6 every 3-5 days. mAGM-S3 stromal cells were kindly provided by
professor Ma Feng (Institute of Blood Transfusion, Chinese Academy of Medical Sciences and Peking
Union Medical College, Chengdu, China) and cultured in α-MEM containing 5% fetal bovine serum
(FBS) (Hyclone) in gelatin-coated culture dish. Cells were passaged every three days using 0.05%
Trypsin/EDTA. The 293T cells were cultured in DMEM (Invitrogen) supplemented with 10% FBS
(Hyclone).
Real-time PCR
Total mRNAs were extracted using TRIzol (Invitrogen, Carlsbad, CA) following the manufacturer’s
instructions and complementary DNA was synthesized using a reverse transcription system from
Promega. Real-time PCR was performed using Quanti-Tech SYBR Green PCR kit (Qiagen) according
to the manufacturer’s protocol on the ABI 7000 real-time PCR machine (Applied Biosystems). Primer
sequences are shown in Supplementary Table S2. Quantification of gene expression was analyzed using
the comparative CT method and normalized to ACTB gene levels.
Flow cytometry
Differentiated cells in chemically defined hematopoietic differentiation system were dissociated into
single cells using 1mg/ml Accutase and resuspended in cold PBS containing 2% FBS. For cell surface
staining, the cells were labeled with the indicated antibodies listed in Supplementary Table S1 for 30
min at room temperature in dark. For intracellular staining of BRACHYURY, cells were fixed and
permeabilized using Fix&Perm reagents (Invitrogen) according to manufacturer’s instructions. After
three washes in PBS, the cells were suspended in 0.4 ml PBS for analysis. Flow cytometric analysis
was performed using a FACSCantoTMⅡ flow cytometer (BD Biosciences) and cell sorting was
performed using a FACS Aria Ⅲcell sorter (BD Biosciences). Data were analyzed with FlowJo
software (Tree Star, Ashland, OR). For the differentiated cells in mAGM-S3 coculture system, the cells
were dissociated with 0.25% Trypsin/EDTA and filtered through a 70 mm strainer to obtain single-cell
suspensions. Dead cells were excluded using 7AAD staining. TRA-1-85 Abs were used for the gating
of human cells.
Immunofluorescence
Cells were washed once with cold phosphate-buffered saline (PBS), fixed in 4% paraformaldehyde in
PBS, permeabilized with 0.2% Triton X-100 in PBS, blocked in PBS containing 0.5% BSA and then
incubated with primary antibodies overnight at 4ºC. After three washes in PBS, samples were incubated
with Alexa-conjugated secondary antibody for 2 h in dark at room temperature. The cells were washed
three times in PBS and were stained with DAPI (Sigma) for 15 min at room temperature. Images were
collected with Leica SP2 microscope. Dilutions for various antibodies are shown in Supplementary
Table S1.
Colony-forming unit assays
Colony-forming unit (CFU) assay was performed by plating 1x10 4 CD43+ cells enriched from
hPSC/mAGM-S3 coculture into methylcellulose H4435 (Stem Cell Technologies). The cells were
incubated in a humidified atmosphere at 37 °C in 5% CO2 for 14 days. Colonies were counted and
scored on the basis of standard morphological criteria.
Construction of Cas9/gRNAExpressing Vectors and assessment for the genome editing efficacy
Single-guide RNA (sgRNA) targeting different exons of the human MEIS1 gene were designed using
the CRISPR Design Tool (http://tools.genome-engineering.org)(Ran et al., 2013). The corresponding
oligonucleotide was cloned into the CRISPR-Cas9-Lenti-V2 vector (Addgene), which can express both
Cas9 and sgRNAs. Sequence-verified plasmids were annotated as Lenti-V2-MEIS1-E2G5,
Lenti-V2-MEIS1-E3G1, Lenti-V2-MEIS1-E6G1 and Lenti-V2-MEIS1-E7G1, respectively. The four
plasmids were transfected into 293T cells to detect the genome editing efficacy using Surveyor assay,
and the most effective vector was used for the generation of MEIS1-deleted hPSC lines. After
verification, Lenti-V2-MEIS1-E3G1 plasmid was chosen for lentivirus packging. Lentivirus was
produced as described previously(Wu et al., 2015). The sgRNA sequences and the primers used for
Surveyor assay were shown in Supplementary Table S3.
Establishing GFP-MEIS1 inducible over-expression stable hESC lines
Lenti-X™ Tet-On® Advanced Inducible Expression System (Clontech) was used to establish
GFP-MEIS1 inducible overexpression stable hESC lines. The MEIS1B complementary DNA (cDNA)
was into pLVX-Tight-Puro vector. GFP was fused to the N-terminal of MEIS1 gene to monitor MEIS1
expression. Primers used were shown in Supplementary Table S4. Lentivirus was produced as
described previously (Wu et al., 2015). TetR-H1 was first generated by infecting lentivirus containing
TetR into H1 cells, followed by G418 (400 μg/ml, Sigma) selection. After the establishment of
TetR-H1, Lentivirus containing GFP-MEIS1 was infected into TetR-H1 and selected with puromycin (1
μg/ml, Sigma) before being dissociated into single cells with Accutase (Gibco). Small colonies
emerged from single cells were picked and then selected through adding doxycycline (2 μg/ml, Sigma).
After couple rounds of selection, the cell lines homogenously expressing GFP in the presence of
doxycycline were harvested. The positive stable lines were analyzed using fluorescence microscopy
and flow cytometry and identified with Real-time PCR and Western blotting assays.
Western blotting
Cells were lysed directly in laemmli sample buffer (BioRad). The cell lysates were resolved on 10%
SDS-PAGE gel and transferred onto nitrocellulose membranes. The membranes were blocked with 5%
nonfat milk in PBS containing 0.1% Tween 20 for 1 h at room temperature and then incubated with
primary antibodies overnight at 4°C. After the incubation with HRP-coupled secondary antibodies for 2
h at room temperature, proteins were detected using the ECL Detection Reagent. Anti-β-Tubulin
antibody detection was used as a loading control. Dilutions for various antibodies are shown in
Supplementary Table S1.
Cell proliferation rates assay and apoptosis analysis
The differentiated cells were harvested and washed with cold PBS twice. For cell proliferation rates
assay, the cells were stained using the indicated surface antibodies and an anti-human Ki67 antibody,
followed by a FITC-conjugated mouse anti-rabbit secondary antibody. For cell apoptosis analysis, the
cells were first incubated with the indicated surface antibodies for 30 mins. After washing with PBS,
the cells were stained with Annexin-V-PE and 7-AAD according to the instructions of Annexin-V
apoptosis detection kit (BD Biosciences). Flow cytometry analysis was performed using using a
FACSCantoTMⅡ flow cytometer (BD Biosciences). Data were analyzed with FlowJo software (Tree
Star, Ashland, OR).
Endothelial culture assays
Endothelial potential analysis of HEPs was performed as previously described (Bai et al., 2017).
Briefly, isolated CD31+CD34+ cells were plated on collagen-coated 6-well plates (1×105 cells per well)
in EBM-2 (Lonza) supplemented with 15% KnockOut Serum Replacement (KOSR; Thermo Fisher), 5
ng/ml EGF, 5 ng/ml FGF-2, 10 ng/ml IGF-1, 10 ng/ml VEGF, 1 mg/ml hydrocortisone, 1 U/ml heparin,
and 20 mg/ml L-ascorbic acid. 6 days later, the cells were used for Flow cytometer analysis, the
acetylated low-density lipoprotein (AcLDL) uptake assay, and tube formation assay. For AcLDL uptake
assay, cells were incubated with 10 ng/ml of Alexa488-conjugated AcLDL (Invitrogen) for 6 hours at
37 °C in 5% CO2 and then stained with VE-cadherin. The results were examined by a fluorescence
microscope. For tube formation assay, cells were plated onto growth factor-reduced Matrigel (BD
Biosciences) coated 24-well plates (5×104 cells per well) and incubating for 16 hours in endothelial
culture medium at 37°C in 5% CO2. The results were photographed using a phase-contrast microscopy.
Assessment of the hematoendothelial potential of CD31+CD34+ cells
Hematoendothelial potential of CD31+CD34+ cells derived from hPSCs were determined as previously
described(Uenishi et al., 2014). CD31+CD34+ cells were sorted and plated on cultured on a confluent
layer of OP9 cells in aMEM supplemented with 10% FBS, 50 ng/ml TPO, 50 ng/ml SCF, 10 ng/ml
IL-3, and 20 ng/ml IL-6 (20 ng/ml) at a density of 10,000 cells/well of 6-well plate. After 5 days of
culture, cells were harvested for immunofluorescence and flow cytometry analysis.
Cell size measurement
About 100 cultured cells were observed under light microscope and the cell size was measured using
an in-house image processing program (NIS-Elements BR). The size of more than 1×105 cells in
different groups were statically analyzed by flow cytometry (FACS Canto II, BD Biosciences).
MGG staining
1 to 2×104 cells were collected and suspended in 40 μL PBS and subsequently cytospun onto
polylysine-coated slides using cytospin (Thermo Shandon). The drying slides were stained with
May-Grünwald-Giemsa (MGG) staining solution (Beyotime) for 10 min according to the instructions.
Images were captured using a Nikon microscope.
Electron microscopy
At least 5×105 cells derived from hPSCs were collected and washed in PBS. The sediment was fixed
with 2.5% glutaraldehyde in PBS before submission. Sample was treated and observed by transmission
electron microscopy as previously described(Yang et al., 2016).
DNA content analysis
To measure the ploidy of cultured megakaryocytes, 5×10 5 cells were suspended with 0.1% BSA
(Invitrogen) and labeled with APC-CD41a for 30min. Cells were washed with PBS prior to fixation in
4% paraformaldehyde (PFA) for 20 min. Cells were subsequently permeabilized with 0.2% Triton-X
100 (Sigma-aldrich) for 15 min and treated with 100μg/mL RNase A for 30 min at 37℃. Finally, the
cells were incubated with PBS containing 40 μg/mL propidium iodide (PI, Sigma-aldrich) for 10 min.
CD41a+ cells were gated and analyzed for ploidy on a FACS Canto II (BD Biosciences).
Megakaryocyte spreading
Coverslips were coated with fibrinogen (100 μg/mL) for 1 hour at room temperature, blocked with
denatured BSA (5 mg/mL) for 1 hour, and washed with PBS before use. Megakaryocytes were plated
on a fibrinogen or collagen-coated surface for 1 hour at 37°C with or without thrombin stimulation.
Adherent megakaryocytes were fixed with 4% formalin and permeabilized with 0.1% Triton X-100.
Actin filaments were stained with FITC 488-conjugated phalloidin. Cells were counterstained with
DAPI, and fluorescent images were visualized using a confocal microscopy (LSM710, Zeiss).
Time-lapse microscopy
Proplatelet formation of mature megakaryocytes was observed under inverted fluorescent microscope
(Nikon Ti). Cultured cells at day 4 of megakaryocytic induction were plated onto fibrinogenb
(100μg/mL)-coated 24 well-plates at 37℃ for at least 1 h. Megakaryocytes were cultured on the
medium for megakaryocytic differentiation for 3 days until proplatelets were formed. Time lapse
images were captured at 15 min intervals using Nikon Eclipse Ti-E configured with an motorized stage
(Nikon Instruments Inc. Melville, NY), and Tokai-Hit Stage Top Incubator (Tokai Hit CO., Ltd.,
Shizuoka-ken, Japan) at 37℃and 5% CO2. The time-lapse serial images were converted to Quick-time
movies (.mov) and analyzed using ImageJ software (NIMH, Bethesda, MD).
Platelet isolation and analysis
Human platelet-rich plasma obtained from healthy donors was prepared by centrifugation at 200×g.
The supernatant was collected and centrifuged at 800×g for 10 min and the pellet was resuspended with
HEPES-Tyrode buffer. The cultured platelet-like particles were collected by centrifugation at 800×g
from culture supernatant (1mL) and resuspended with 0.1% BSA. Next, both the human blood and
hPSC-derived platelets were stained with APC-CD41a and PE-CD42b antibodies (BD) for at least 30
min before detection. To exclude the interference of cell debris in the culture, platelets from human
peripheral blood were used to establish proper gating.
Platelet characterization
Human platelet-rich plasma obtained from healthy donors was prepared by centrifugation at 200×g.
The supernatant was collected and centrifuged at 800×g for 10 min, and the pellet was resuspended in
HEPES-Tyrode buffer. The cultured platelet-like particles were collected by centrifugation at 800×g
from culture supernatant (1mL) and resuspended in 0.1% BSA. Next, both the human blood and
hPSC-derived platelets were stained with APC-CD41a and PE-CD42b antibodies (BD) for at least 30
min before detection. To exclude the interference of cell debris in the culture, platelets from human
peripheral blood were used to establish proper gating.
Platelet function characterization was conducted as described in previously [10]
. For α-granule release
analysis, platelets were treated with 2 U/mL of thrombin (Sigma) for 20 min at 37℃ before incubation
with APC-CD41a and PE-CD62P antibodies. Platelets were plated onto 100 μg/mL fibrinogen-coated
coverslips in the absence or presence of 2 U/mL thrombin at 37℃ for 30 min, and the ability of
adhesion and spreading was measured. Platelets were stained with mouse anti-CD41a and Alexa flour
594-conjugated goat anti-mouse IgG and actin filaments were stained with FITC 488-conjugated
phalloidin. For platelet aggregation, human blood platelets (2×10 7) were mixed with 2 mg/mL calcein
AM (Invitrogen). Labelled blood platelets or PLPs (2×10 5) were plated onto fibrinogen-coated
coverslips in 24-well plates and were centrifuged for 5 min at 80xg. The plates were incubated with
thrombin (0.5 U/mL) at 37°C for 15 min with vortex, and aggregates were stained with Alex Fluor 568-
phalloidin. Fluorescent images were visualized under a confocal laser scanning microscope.
Plasmid construction
For experiments involving genes overexpression, we amplified our interested gene from H1 genomic
DNA, and added a FLAG-epitope at the N-terminal of those genes by polymerase chain reaction (PCR).
The FLAG-TAL1, FLAG-MEIS1 and FLAG-FLI1 gene fragments were directionally cloned into the
intermediate vector pGEM-T Easy (Promega). Finally, the full cassette FLAG-TAL1, FLAG-MEIS1
and FLAG-FLI1 were inserted into the lentivirus-based pSin-EF1α-puro (Addgene) vector, using Spe
Ⅰand Hind Ⅲ sites. To better monitor the gene expression, GFP gene fragment was fused to the
C-terminal of interesting genes by SpeⅠand EcoRⅠsites, with the addition of a P2A linker between
the two ORFs. Similarly, pLKO.1 vectors containing scramble or MEIS1-specific sequences (shMEIS1)
were used in experiments involving genes depletion. Primer sequences are described in Supplementary
Table S4.
Supplementary Table S1. Antibodies used in this study.

The sources of flow antibodies.

Antigen Fluorochrome conjugated Clone Source Cat#
Brachyury PE O15178 R&D systems IC2085P
APLNR APC 72133 R&D systems FAB856A
CD31 PE WM29 BD bioscience 555446
CD34 APC 8G12 BD bioscience 555824
CD43 PE 1G10 BD bioscience 560199
CD45 PE HI30 BD bioscience 560975
CD41a APC HIP8 BD bioscience 555751
CD42b PE HIP1 BD bioscience 555473

The sources of the antibodies used for immunofluorescence or western blotting analysis.
(I: immunofluorescence; W: western blotting)
Antibody Source Cat# Dilution

OCT3/4 Santa Cruz SC-9081 1:500(I)/1:200(W)

SOX2 Millipore AB5603 1:200(I)/1:1,000(W)

TUBULIN Abcam AB11304 1:10,000(W)

CD43 Santa Cruz sc-51727 1:200(I)

FLAG SIGMA F1804 1:1000(W)

MEIS1 Abcam Ab19867 1:1000(W)

Supplementary Table S2. The primers used for real-time PCR.
Primer Sequence 5’-3’

hACTIN-F CTCTTCCAGCCTTCCTTCCT

hACTIN-R AGCACTGTGTGTTGGCGTACAG

hMEIS1-F AATCCCTTAACGTCTCCAGCAAC

hMEIS1-R TCTTGGAAACGGAGCGCTTTTAT

hPOU5F1-F CTTGAATCCCGAATGGAAAGGG

hPOU5F1-R GTGTATATCCCAGGGTGATCCTC

hSOX2-F GCCGAGTGGAAACTTTTGTCG

hSOX2-R GGCAGCGTGTACTTATCCTTCT

hNANOG-F TTTGTGGGCCTGAAGAAAACT

hNANOG-R AGGGCTGTCCTGAATAAGCAG

hTAL1-F CAGCCTAGTGGCTTGTCCTC

hTAL1-R GGAGCCTGAAATTGAATGGA

hFLI1-F GGCCTGAACAGTAGAGGCG

hFLI1-R CACCGGAGACTCCCTGGAT

hAPLN-F GTCTCCTCCATAGATTGGTCTGC

hAPLN-R GGAATCATCCAAACTACAGCCAG

hMYB-F GAAAGCGTCACTTGGGGAAAA

hMYB-R TGTTCGATTCGGGAGATAATTGG
Supplementary Table S3. The primers used for CRISPR sgRNA guide sequences and the
genotyping.
Primer Sequence 5’-3’

E2g5F CACCGCGGGTCCCCATACATCGTGG

E2g5 R AAACCCACGATGTATGGGGACCCGC

E3g1 F CACCGTACTTGTACCCCCCGCGAGC

E3g1 R AAACGCTCGCGGGGGGTACAAGTAC

E6g1 F CACCGTCGTCTATCACCAAATCGAT

E6g1 R AAACATCGATTTGGTGATAGACGAC

E7g1 F CACCGGACACGGCATCTACTCGTTC

E7g1 R AAACGAACGAGTAGATGCCGTGTCC

E2g5 Genotyping F CCCGTTTCACCTTCTACCCTC

E2g5 Genotyping R TGCTGCCCATTGTACCTACC

E3g1 Genotyping F AACGCTTGGGTTTTATTCGTAGC

E3g1 Genotyping R CTTAAGGCCGACTACGTGCTG

E6g1 Genotyping F AATGTCACCTACGCAGGTCAC

E6g1 Genotyping R AGCCTTAATGAAGCAATAATAG

E7g1 Genotyping F TTTCCAGAGTAGCAGACTGTTG

E7g1 Genotyping R TAGCACAGAAGAGCAGGGTCAGAG

Supplementary Table S4. The primers used for amplifying genes.
Primer Sequence 5’-3’

hMEIS1B-F CGGGATCCGCCACCATGGACTACAAGGACGACGATGACAAG
TM
(Lenti-X Tet-On) GCGCAAACCTACGACGA

hMEIS1B-R
CGGCATCCTTACATGTAGTGCCACTGCCCCTCC
(Lenti-XTM Tet-On)

hTAL1-F GCACTAGTGCCACCATGGACTACAAGGACGACGATGACAAG
(pSIN-EF1α-P2A-GFP) ACCGAGCGGCCGCCGAGC

hTAL1-R
CGGCTAGCCCGAGGGCCGGCTCCATCGGCGGCAGGC
(pSIN-EF1α-P2A-GFP)

hMEIS1B-F GCACTAGT GCCACC ATGGACTACAAGGACGACGATGACAA

(pSIN-EF1α-P2A-GFP) G GCGCAAAGGTACGACGA

hMEIS1B-R
CGGCTAGCCATGTAGTGCCACTGCCCCT
(pSIN-EF1α-P2A-GFP)

hFLI1-F GCACTAGTGCCACCATGGACTACAAGGACGACGATGACAAG
(pSIN-EF1α-P2A-GFP) ACTGCCTCGGGGAGT

hFLI1-R
CGGCTAGCGTAGTAGCTGCCTAAGTGTGAA
(pSIN-EF1α-P2A-GFP)
References
Bai, H., Gao, Y., Hoyle, D.L., Cheng, T., and Wang, Z.Z. (2017). Suppression of Transforming Growth
Factor-beta Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells
Derived from Human Pluripotent Stem Cells. Stem Cells Transl. Med. 6, 589-600.
Ditadi, A., Sturgeon, C.M., Tober, J., Awong, G., Kennedy, M., Yzaguirre, A.D., Azzola, L., Ng, E.S.,
Stanley, E.G., French, D.L., et al. (2015). Human definitive haemogenic endothelium and arterial
vascular endothelium represent distinct lineages. Nat Cell Biol. 17, 580-591.
Mao, B., Huang, S., Lu, X., Sun, W., Zhou, Y., Pan, X., Yu, J., Lai, M., Chen, B., Zhou, Q., et al.
(2016). Early Development of Definitive Erythroblasts from Human Pluripotent Stem Cells Defined by
Expression of Glycophorin A/CD235a, CD34, and CD36. Stem Cell Reports 7, 869-883.
Pang, S., Wu, Q., Tian, S., Su, P., Bai, Y., Gao, J., Yang, Y., Liu, X., Zhu, Z., Xu, Y., et al. (2013).
Establishment of a highly efficient hematopoietic differentiation model from human embryonic stem
cells for functional screening. Sci. China Life Sci. 56, 1147-1149.
Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., and Zhang, F. (2013). Genome engineering
using the CRISPR-Cas9 system. Nat. Protoc., 8, 2281-2308.
Sakurai, M., Kunimoto, H., Watanabe, N., Fukuchi, Y., Yuasa, S., Yamazaki, S., Nishimura, T.,
Sadahira, K., Fukuda, K., Okano, H., et al. (2014). Impaired hematopoietic differentiation of
RUNX1-mutated induced pluripotent stem cells derived from FPD/AML patients. Leukemia 28,
2344-2354.
Uenishi, G., Theisen, D., Lee, J.H., Kumar, A., Raymond, M., Vodyanik, M., Swanson, S., Stewart, R.,
Thomson, J., and Slukvin, I. (2014). Tenascin C promotes hematoendothelial development and T
lymphoid commitment from human pluripotent stem cells in chemically defined conditions. Stem Cell
Reports 3, 1073-1084.
Wang, C., Tang, X., Sun, X., Miao, Z., Lv, Y., Yang, Y., Zhang, H., Zhang, P., Liu, Y., Du, L., et al.
(2012). TGFbeta inhibition enhances the generation of hematopoietic progenitors from human ES
cell-derived hemogenic endothelial cells using a stepwise strategy. Cell Res. 22, 194-207.
Wu, Q., Zhang, L., Su, P., Lei, X., Liu, X., Wang, H., Lu, L., Bai, Y., Xiong, T., Li, D., et al. (2015).
MSX2 mediates entry of human pluripotent stem cells into mesendoderm by simultaneously
suppressing SOX2 and activating NODAL signaling. Cell Res. 25, 1314-1332.
Yang, Y., Liu, C., Lei, X., Wang, H., Su, P., Ru, Y., Ruan, X., Duan, E., Feng, S., Han, M., et al. (2016).
Integrated Biophysical and Biochemical Signals Augment Megakaryopoiesis and Thrombopoiesis in a
Three-Dimensional Rotary Culture System. Stem Cells Transl .Med. 5, 175-185.