You are on page 1of 60

OUTLINE

Matters Arising From Last Class


Protein Synthesis
Cell Division
Cell Cycle
Heredity
Announcement
Matters Arising From Last Class
Presentation
Oral
Essay
Peer Evaluation
PROTEIN SYNTHESIS
Since proteins play very vital roles, involved in almost
every cellular activity, a lot of the cell’s machinery is
devoted to synthesizing proteins.

Proteome – the entire protein makeup of an organism


Humans – over 30,000 different types of proteins

The proteome is determined by the genes a particular


organism carries and thus only makes proteins specified
by genes it has
PROTEIN SYNTHESIS
Gene expression is the process whereby a gene’s DNAis
used to direct synthesis of a specific protein (or gene
product)

Gene expression involves the following processes:


1. Information encoded in DNA (gene) is transcribed
or copied to produce a specific molecule of RNA
2. The RNAattached to a ribosome, where the
information it contains is translated into a
corresponding sequence of amino acids to form a
new protein molecule
Central Dogma
Flow of genetic information

DNA

RNA

PROTEINS
PROTEIN SYNTHESIS
DNAor RNAstore genetic information as sets of 3
nucleotides
Asequence of 3 such nucleotides in DNAis called a
base triplet.
Abase triplet on a DNAstrand is transcribed to give
a complementary sequence of 3 RNAnucleotides
called a codon
Agiven codon specifies a particular amino acid
PROTEIN SYNTHESIS
Genetic Code:
The set of rules that relates the base triplet sequence of
DNAto corresponding codons of RNAand the amino
acids they specify
PROTEIN SYNTHESIS
Properties of Genetic Code:
1. Degenerate
Out of the 4 nucleotides, there can be 64 possible codons
(43 possibilities)
Possible for 2 or more codons to code for same amino acid
2. Not Ambiguous
No single codon codes for more than one amino acid
3. (Nearly) Universal
All living organisms use the same code
Exceptions: mitochondria; single cell eukaryotes (ciliated
protozoa)
Exercise
Determine the amino acid sequence of a polypeptide chain
formed from the following 36 base long mRNA chain given
the Genetic Code:

5’AUGUUUACGGCGUACUGGUACGGACGAUAAG

ACGAA3’

Compare the relative lengths of the RNAsequence and the


polypeptide (protein) sequence
THE GENETIC CODE
TRANSCRIPTION
This is the first step in protein synthesis
Occurs inside the nucleus of the cell
Involves the transfer of genetic information in DNA
to RNA
The DNAstrand from which the genetic information
is being copied is termed the (DNA) template
The RNAstrand synthesized from the DNAtemplate
is termed complementary strand
TRANSCRIPTION
Three (3) kinds of RNAare involved in protein
synthesis
1. Messenger RNA (mRNA):
2. Ribosomal RNA (rRNA):
3. Transfer RNA (tRNA):
Types of RNA
1. Messenger RNA (mRNA):
Strand of RNAsynthesized from the DNA
template which directs the synthesis of a protein
Synthesized in the nucleus and then exported
out into the cytoplasm for translation
Types of RNA
2. Ribosomal RNA (rRNA):
RNAthat joins with ribosomal proteins to make
ribosome
Serves a structural platform for synthesis
Types of RNA
3. Transfer RNA (tRNA):
Carries an amino acid (aa) to the ribosome and holds it
in place for transfer to a developing protein chain
One end carries aa and the opposite end consists of 3
complimentary nucleotides (anticodon) binds to the
mRNAcodon
Types of RNA
TRANSLATION
Translation is the process whereby the nucleotide
sequence in an mRNA molecule specifies the amino acid
sequence of a protein
Translation occurs in the cytoplasm on ribosomes
The mRNA first binds to the ribosome
The initiator tRNA carrying amino acid binds to a
special codon on the mRNA called the start codon
Translation then occurs sequentially and ends when a
stop codon is reached
TRANSCRIPTION & TRANSLATION
TRANSCRIPTION & TRANSLATION
THE GENETIC CODE
CELL DIVISION
Organisation of Genetic Material
Genetic material – DNA
In nucleus, it is highly organized and packaged with proteins
(histone proteins) to conserve space
DNA-Histone complex usually diffused or spread out in the
nucleus – Chromatin
When cell is ready to divide, chromatin condenses to form
denser bodies called chromosomes
Organisation of Genetic Material

DNA
(wraps around histone protein)
Nucleosome
(coils to form)
Chromatin
(loose, diffuse nature)
(supercoils &tightly packed to
form more compact,
condensed and characteristic
structures called)
Chromosomes
Organisation of Genetic Material
Other Terms
(Sister) Chromatid
When chromosome is replicated, each
copy is termed a chromatid
Two sister chromatids are connected at
region called centromere
Kinetochore is a protein complex located
at the outside of each centromere
Spindle fibres attach to centromere via
the kinetochore during cell division
Kinetochore is a protein complex located
at the outside of each centromere
Homologous Chromosomes &
Sister Chromatids
Sister chromatids
Identical pair (replication of one leads to other)
Homologous chromosomes
Non-identical pair
One from each parent
CELL DIVISION
Cell division allows organisms to develop and grow
from a single cell (fertilised egg)

It also allows organisms to replace damaged, diseased or


worn-out cells with new ones in order to maintain
normal cellular functions

Two types of cell divisions occur:


1. Somatic Cell Division
2. Reproductive Cell Division
CELL DIVISION
In somatic cell division, a cell undergoes a nuclear
division called mitosis and then a cytoplasmic
division called cytokinesis to produce 2 identical
daughter cells

Somatic cell division serves the following purposes:


Replacement
replaces dead, diseased or worn-out cells
Tissue Growth
adds new cells for tissue growth
CELL DIVISION
Reproductive cell division is the type of cell division that
produces gametes

This process consists of a special two-step division called


meiosis followed by cytokinesis
At the end, 4 daughter cells result, each with half the
number of chromosomes carried by parent cell

Purpose of reproductive cell division is to ensure to


perpetuity of the species
CELL CYCLE
The repeating sequence of growth and division
through which cells pass during each generation
The cell cycle consists of two major periods:
1. Interphase: Phase when cell is not dividing
2. Mitosis: Phase when cell is dividing
INTERPHASE
This is the phase where the cell prepares to divide
During interphase, the cell ensures that it has all the
needed materials for cell division to successfully
occur
In interphase:
Cell replicates its DNA
Produces additional organelles and cytosolic
components
INTERPHASE
Interphase is a state of high metabolic activity
It is during interphase that the cell does most of its
growing
Interphase consists of 3 phases:
1. G1 (Gap 1)
2. S(Synthesis)
3. G2 (Gap 2)

Go Phase
Resting phase
Cell stopped dividing. Leaves cycle
Cell still carry out all normal functions
CELL CYCLE

For a typical 24 hour


cycle approx. length
as follows:
G1: 8 – 10 hours
S: 6 – 8 hours
G2: 3 – 4 hours
M: 1 – 2hours
Mitotic Phase (M Phase)
The mitotic phase is the phase during which the cell
divides

It consists of two events:


1. Nuclear division or mitosis
2. Cytoplasmic division or cytokinesis
Nuclear Division/ Mitosis
Involves the distribution of the 2 sets of chromosomes,
one set into each of the 2 separate sections
Results in exact partition of genetic information

Divided into 4 stages


1. Prophase
2. Metaphase
3. Anaphase
4. Telophase
CYTOPLASMIC DIVISION
CYTOKINESIS
This the division of the parent
cell’s cytoplasm and organelles
into two daughter cells
This process begins in late
anaphase or early telophase with
the formation of cleavage
furrow (slight indentation of
plasma membrane)
Actin microfilaments that lie
just inside the plasma membrane
form a contractilering
CYTOPLASMIC DIVISION
CYTOKINESIS
The contractile ring pulls the plasma membrane
progressively inwards
The ring constricts the center of the cell, like tightening
a belt around the waist and ultimately pinches it into two
When cytokinesis is complete, interphase begins
HEREDITY
Introduction
Life is sustained because living organisms have the
ability to reproduce their kind to ensure the
continuation of their species
Humans produce humans, palm trees produce palm
trees
In addition to the ability to produce members of
their own species, offspring resemble parents
Heredity
Offspring resemble their parents more than they
resemble other individuals of their same species

Heredity is the term referring to the transmission of


traits from one generation to the next

Heredity is also called inheritance


Heredity
Offspring are like parents because they acquire genes
directly from parents

Human inherit tens of thousands of genes from our


parents which constitute our genome
The human genome has over 20,000 protein coding
genes
Genes are just segments of DNA
Heredity
DNA replication ensures that copies of genes are
produced which are passed along from parents to
offspring
The DNAof a eukaryotic cell is subdivided into
chromosomes within the nucleus
Packet of coiled up DNA(complexed with proteins)
Every living species has a characteristic number of
chromosomes (humans=46)
One chromosome includes thousands of genes
Gene Locus
Agene’s locus is the specific location along the
length of a chromosome where the gene is found.
Gregor Mendel
Experiments 1856 – 1863
Work with garden peas
Alleles – versions of each
gene

Trait characteristics
Complete dominance
Incomplete dominance
Co-dominance
Types of Inheritance
Complete dominance
Pattern of gene expression in which one allele (dominant)
completely masks the expression of the other
(recessive) in the phenotype of the heterozygote
Incomplete dominance
Pattern of gene expression in which phenotype of the
heterozygote is an intermediate between those of the
parents
Co-dominance
Pattern of gene expression in which phenotype of the
heterozygote is a composite with both phenotypes of the
parents are clearly expressed and equally present. (Result is
a little of each parent shown in offspring)
Types of Inheritance
The Human Life Cycle
Alife cycle is the generation to generation sequenceof
stages in the reproductive history of an organism
from conception to production of its own offspring

In humans, each somatic cell has 46 chromosomes

Chromosomes differ in their sizes and positions of


their centromeres
The Human Life Cycle
The 46 human chromosomes are actually made up of 23
pairs of similar chromosomes

There are 2 of each type making 23 types of chromosomes

The term karyotype describes the appearance and


characteristics of the chromosomes of a cell, especially size,
number, and form
The Human Karyotype
Chromosomes
Chromosomes that make up a pair (have the same length, same
genes &loci, centromere position &staining pattern) are called
homologous chromosomes or homologues

The X andY chromosomes are the exceptions to the rule of


homologous chromosomes

Homologues carry genes controlling the same inherited characters


Chromosomes
The X andY chromosomes determine the sex of an individual and
are thus called sex chromosomes

The other chromosomes are called autosomes

We inherit one chromosome of each pair from each parent

The 46 chromosomes in somatic cells are actually 2 sets of 23


chromosomes – a maternal set and a paternal set
Chromosomes
Acell with a single chromosome set is called a haploidcell
Haploid number is designated as n
Human’s n=23

The zygote and all other cells having two sets of


chromosomes are called diploid cells
Diploid number is designated as 2n
For humans, 2n = 46
Genetic Variations
The process of inheritance comes along with variation

Variation refers to the differences that occur which


makes each individual unique from other individuals

In species that reproduce sexually, the behaviour of


chromosomes during meiosis and fertilization is
responsible for most of the variation that occurs
Genetic Variations
Anumber of mechanisms contribute to genetic
variations

3 of such mechanisms are:


1. Independent assortment of chromosomes
2. Crossing over
3. Random fertilisation
Independent assortment of
chromosomes
Stems from random orientation of homologous pairs relative
to the poles of the cell

Thus for each pair of chromosome, there is a 50-50 chance


that a daughter cell will get either a maternal chromosome
or apaternal chromosome of ahomologous pair

During meiosis there is independent assortment of maternal


&paternal chromosomes into daughter cells
Independent assortment of
chromosomes
The number of combinations possible when chromosomes
assort independently into gametes during meiosis is 2n,
where n is the haploid number of the organism

For humans where n=23,


the number of possible combinations is
223 = 8 million

Thus each gamete that a human produces contains one of


8million possible assortments of inherited chromosomes
Crossing Over
Happens during Prophase 1 of meiosis

Crossing over is the exchange of genetic material


between homologous chromosomes

In this process, homologous portions of two (sister or


non-sister) chromatids trade places

Crossing over gives rise to mixtures in genetic


composition of chromosomes
Crossing Over

You might also like