Clinical Nutrition 33 (2014) 973e981

Contents lists available at ScienceDirect

Clinical Nutrition
journal homepage: http://www.elsevier.com/locate/clnu

Randomized control trials

The effects of co-administration of probiotics with herbal medicine on

obesity, metabolic endotoxemia and dysbiosis: A randomized double-
blind controlled clinical trial
Sin Ji Lee a, Shambhunath Bose b, Jae-Gu Seo c, Won-Seok Chung c, Chi-Yeon Lim d,
Hojun Kim a, *
a
Department of Oriental Medicine, Dongguk University, Gyeongju, Republic of Korea
b
College of Pharmacy, Dongguk University e Seoul, Goyang, Republic of Korea
c
Cell Biotech Co., Ltd., Gimpo, Republic of Korea
d
Department of Medicine, Graduate School, Dongguk University e Seoul, Republic of Korea

a r t i c l e i n f o s u m m a r y

Article history: Background & aims: Probiotics help maintain balance in composition of the gut microbiota, and have
Received 24 June 2013 been considered as a potential treatment for obesity. This study was conducted in order to assess the
Accepted 18 December 2013 effects of probiotics when combined with herbal medicine in treatment of obesity. Probiotics were tested
for the ability to modulate gut microbiota, gut permeability, and endotoxin level, which may have cor-
Keywords: relation with factors involved in obesity.
Probiotics
Methods: A randomized, double-blind, placebo controlled study was conducted, in which patients with
Obesity
higher BMI (>25 kg/m2) and waist circumference (>85 cm) were enrolled and randomly assigned to
Gut microbiota
Endotoxin
receive Bofutsushosan with either probiotics or placebo capsules for a period of eight weeks. Assessment
Metabolic disorders of body composition parameters, metabolic biomarkers, endotoxin level, gut permeability, and fecal
bacteria in stool was performed at baseline and at week 8. The study was registered at the Clinical
Research Information Service, approved by the Korea National Institute of Health (KCT0000386).
Results: Although both groups showed a significant reduction in weight and waist circumference
(p ¼ 0.000), no significant differences in body composition and metabolic markers were observed. In
correlation analysis, change in body composition showed positive correlation with endotoxin level
(r ¼ 0.441, p < 0.05 for BW; and r ¼ 0.350, p < 0.05 for fat mass) and the population of gut Lactobacillus
plantarum (r ¼ 0.425, p < 0.05 for BW; and r ¼ 0.407, p < 0.05 for BMI). The Gram negative bacterial
population in gut also exhibited positive correlation with changes in body composition (WC) and total
cholesterol level (r ¼ 0.359, and 0.393, for the former and later parameters, respectively, p < 0.05 for
both). While, the profile of gut Bifidobacterium breve population showed negative correlation with
endotoxin level (r ¼ 0.350, p < 0.05).
Conclusions: Correlations between gut microbiota and change in body composition indicate that pro-
biotics may influence energy metabolism in obesity. Correlation between endotoxin level and weight
reduction indicates that probiotics may play an important role in prevention of endotoxin production,
which can lead to gut microbiota dysbiosis associated with obesity.
Ó 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

1. Introduction
Gut microbiota composition is regarded as one of the major
etiological factors involved in control of body weight and many
* Corresponding author. Department of Oriental Rehabilitation Medicine, Dong-
guk University, Ilsan Hospital, 814 Siksa, Goyang, Gyeonggi-do, Republic of Korea.
Tel.: þ82 31 961 9111; fax: þ82 31 961 9009.
E-mail address: kimklar@dongguk.ac.kr (H. Kim).
studies investigating its link to obesity have been conducted in the
past several years.1e3
Many reports have demonstrated participation of gut micro-
biota in development of obesity by several mechanisms involving
increased gut permeability and metabolic endotoxemia. This can be
explained by a fat-enriched diet inducing Gram negative bacteria-
derived lipopolysaccharide (LPS), which is closely correlated with
abdominal fat deposit and derangement in intestinal microbiota.4
Endotoxemia involves an inflammatory process, which is trig-
gered by disruption of tight gap junction proteins when exposed to

0261-5614/$ e see front matter Ó 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
http://dx.doi.org/10.1016/j.clnu.2013.12.006
974 S.J. Lee et al. / Clinical Nutrition 33 (2014) 973e981

LPS originating from the gut, thereby increasing intestinal perme-
ability.5 Therefore, alteration in gut barrier induces many metabolic
disorders preceded by endotoxemia and inflammation, such as
increased gut permeability (known as ‘leaky gut syndrome’)6 and
inflammatory bowel disease (IBD).7
Because probiotics help maintain balance in composition of gut
microbiota, they have been considered as a potential treatment for
obesity. Many studies supporting anti-obesity and lipid-lowering
effects of probiotics8 as well as anti-inflammatory and anti-
oxidative activity in pathogenic conditions such as non-alcoholic
fatty liver disease (NAFLD)9 and steatohepatitis (NASH) have been
reported.9 Probiotics also help to maintain integration of gut barrier
and reduce intestinal permeability, which subsequently decrease
endotoxin level.10
Bofutsushosan (BTS), an oriental herbal medicine containing 18
components, is widely used as an anti-obesity medication in East
Asia. Its effects on obesity, cardiovascular diseases, and insulin
resistance have been researched in various studies and the results
showed decreasing effects on triglyceride level and lipid meta-
bolism as well as correlation with obesity associated-genes.11
This study was conducted in order to assess the effects of pro-
biotics when combined with herbal medicine in treatment of
obesity. In order to investigate correlation of obesity-related factors
with alteration of gut microbiota, modulation of gut microbiota
composition, gut permeability, and endotoxin level by probiotics
was demonstrated.
2. Materials and methods
2.1. Subjects
The study protocol was approved by the Institutional Review
Board of Dongguk University Oriental medical hospital (approval
number 2011-SR21) and written informed consent was obtained
from each patient prior to conduct of the study. A total of 64 female
subjects aged 19e65 years meeting the criteria of BMI >25 kg/m2
and waist circumference >85 cm were recruited from advertise-
ment in a local newspaper between April and August 2011. Among
64 patients who underwent screening, 50 subjects fulfilled the
criterion of the study. All subjects underwent appropriate in-
vestigations in order to exclude any condition that might affect
weight gain. The exclusion criteria are shown in Table 1. Other than
these restrictions, subjects were encouraged to maintain their
usual dietary intake and lifestyle during conduct of the study.
2.2. Study design and intervention
This was a randomized, double-blinded, placebo controlled
study, which was conducted in order to determine whether there is
Table 1
Exclusion criteria of the recruitment of the subjects.
Exclusion criteria
an additional effect of co-administration of probiotics and BTS,
compared to BTS alone. The study was registered at the Clinical
Research Information Service, approved by the Korea National
Institute of Health (KCT0000386). Subjects were randomly assigned
to receive BTS and probiotics (n ¼ 25) or BTS and placebo (n ¼ 25).
The study medications were taken twice per day for a period of eight
weeks. Subjects were treated with BTS co-administered with either
probiotics or placebo twice per day for a period of eight weeks. BTS
was administered in the form of herbal extracts (Tsumura & Co,
Japan) 3g per administration. Probiotics (DUOLAC 7 which is a fourth
generation dual coated probiotics, Cell Biotech, Gimpo, Korea) or
placebo capsules were also given twice per day, co-administered
with BTS extracts. One capsule of Duolac 7 included 5 billion
viable cells of Streptococcus thermophiles (KCTC 11870BP), Lactoba-
cillus plantarum (KCTC 10782BP), Lactobacillus acidophilus (KCTC
11906BP), Lactobacillus rhamnosus (KCTC 12202BP), Bifidobacterium
lactis (KCTC 11904BP), Bifidobacterium longum (KCTC 12200BP), and
Bifidobacterium breve (KCTC 12201BP). Placebo capsules were
identical in appearance, except for the bacterial strains.
2.3. Dietary and exercise intervention
Subjects were informed of dietary guidelines of the study after
enrollment. At the beginning of the study, dietary intake was
assessed using 24-h dietary recall methods. The guidelines suggest
that subjects maintain a daily diet, limiting caloric intake to 20e
25 kcal/kg, according to subject’s weight. Participants were
instructed to record daily food intake in their diet diary provided to
them. From the second visit, food intake patterns and caloric values
were assessed by clinical research coordinator (CRC) every two
weeks until the end of the study. Amount of intake was calculated
in kcal unit. Participants were also instructed to maintain their
usual exercise program during the entire study. In the exercise di-
ary provided to them, participants recorded the degree of exercise
performed on each day (criteria of mild/moderate/severe exercise
were supplied to every volunteer) which were checked by CRC
every two weeks until the study completed.
2.4. Analytical measurements
The primary outcome measures were the difference in weight
and gut permeability between the two groups. The secondary
outcomes included change in blood lipid level, waist circumference,
blood pressure, BMI, main bacterial strains of intestinal microbiota,
endotoxin level, and KOQOL (The Korean version of obesity-related
quality of life). Progress of analytical measurements is shown in
Table 2.
Table 2
Progress of analysis in the course of study.
Blood Stool Gut BP BW WC BIA KOQOL
analysis analysis permeability test

Hypothyroidism Visit 1 O O O O O O O O
Cushing’s syndrome Week 0
Heart diseases Visit 2 O O O
Cancer Week 2
Lung diseases Visit 3 O O O O
Severe renal dysfunction (Cr > 2.0 mg/dl) Week 4
Liver dysfunction (ALT, AST  2.5 fold upper limit of normal) Visit 4 O O O
Non-insulin dependent diabetes mellitus with FBS > 140 mg/dL, Week 6
neuropsychiatric diseases Visit 5 O O O O O O O O
Eating disorder Week 8
Subjects who underwent anatomical change such as incision
BP: blood pressure, BW: body weight, WC: waist circumference, BIA: bioelectrical
Pregnancy, breast feeding, or planning of pregnancy
impedance analysis, KOQOL: Korean version of the obesity-related quality of life
Subjects who have lost 10% of body weight within six months of the study.
scale.
 S.J. Lee et al. / Clinical Nutrition 33 (2014) 973e981 975

2.5. Assessment of obesity parameters Table 3

Specific primers used in this study.

Subjects visited the hospital every two weeks, five times in total, Target group or species Primers Primer sequences (50 -30 )
during the course of eight weeks. Blood pressure, weight, and waist Total bacteria 341F CCTACGGGAGGCAGCAG
circumference were measured at every visit. Bioelectrical imped- 543R ATTACCGCGGTGCTGG
ance analysis (BIA) was performed at weeks 1, 3, and the last visit Bifidobacterium spp. F TCGCGTC(C/T)GGTGTGAAAG
using Inbody 3.0 (Biospace, Seoul, Korea), which measured body R CCACATCCAGC(A/G)TCCAC
Lactobacillus spp. F AGCAGTAGGGAATCTTCCA
composition parameters, including BMI, total fat mass, and fat
R CACCGCTACACATGGAG
percentage. Bifidobacterium longum BlonF CAGTTGATCGCATGGTCTT
Blood samples were taken from participants at baseline and BlonR TACCCGTCGAAGCCAC
week 8 for analysis of BST and blood lipid level, including triglyc- Bifidobacterium breve BiBRE-1 CCGGATGCTCCATCACAC
BiBRE-2 ACAAAGTGCCTTGCTCCCT
eride, total cholesterol, HDL, and LDL cholesterol. Blood samples for
Bifidobacterium lactis BlactF CCCTTTCCACGGGTCCC
BST and blood lipids were taken after 12-h fasting. BlactR AAGGGAAACCGTGTCTCCAC
In order to analyze quality of life (QOL) of the subjects, a survey Streptococcus thermophilus ST-F ACGGAATGTACTTGAGTTTC
using the Korean version of the Obesity-related Quality of Life scale ST-R TTTGGCCTTTCGACCTAAC
was administered at the first visit and at week 8. Lactobacillus rhamnosus LU-5 CTAGCGGGTGCGACTTTGTT
RhaII GCGATGCGAATTTCTATTAT
Lactobacillus plantarum Lpla-3 ATTCATAGTCTAGTTGGAGGT
2.6. Quantification of fecal bacteria Lpla-2 CCTGAACTGAGAGAATTTGA
Lactobacillus acidophilus F-acid-IS GAAAGAGCCCAAACCAAGTGATT
Stool samples were collected for analysis of gut microbiota R-acid-IS CTTCCCAGATAATTCAACTATCGCTTA
composition at the beginning of the study and at the eighth week. Bacteriodetes Bact934F GGA RCA TGT GGT TTA ATT CGA TGA T
Bact1060R AGC TGA CGA CAA CCA TGC AG
Fecal samples were stored and frozen at 20  C until analysis. Firmicutes Firm934F GGA GYA TGT GGT TTA ATT CGA AGC A
Firm1060R AGC TGA CGA CAA CCA TGC AC
2.7. Bacterial strains for analysis Gram positive DG74 AGG AGG TGA TCC AAC CGC A
143 GAY GAC GTC AAR TCM TCA TGC
Gram negative DG74 AGG AGG TGA TCC AAC CGC A
B. longum, B. breve, B. lactis, Streptococcus thermophilus,
68d AYG ACG TCA AGT CMT CAT GG
L. rhamnosus, L. plantarum, L. acidophilus, Gram positive, Gram
negative, Bacteroidetes, and Firmicutes were quantified using spe-
cies or group-specific PCR primer sets. 2.10.2. Measurement of gut permeability
Levels of lactulose and mannitol in urine were measured using
2.8. Preparation of genomic DNA from fecal samples K-Lactul and K-Manol kits, respectively, from Megazyme (Bray, Co,
Wiklow, Ireland). The analysis was performed according to the
Fecal samples were collected immediately after defecation, and manufacturer’s instructions.
stored at 20  C until analysis. For extraction of genomic DNA from
fecal samples, 200 mg of each sample were suspended in 9 ml of C- 2.11. Statistical analysis
buffer (0.6% KH2PO4, 0.45% Na2HPO4, 0.05% Tween 80, 0.05%
cysteine), vigorously vortexed for 20 min, and passed through a Results were presented as mean  standard deviation
disposable 10 ml syringe packed with glass wool. The effluent was (mean  SD). Baseline characteristics were compared between the
then centrifuged at 12,000 rpm, 4  C for 10 min (MICRO 17R, Hanil, groups using the Student’s t test for independent samples. Intra-
Gangneung, Korea). The pellet was washed three times with the C- group comparison of before and after treatment was performed,
buffer. Ten milligrams of the final pellet was resuspended in 200 ml using paired t-test and Wilcoxon’s signed-rank test. Correlations
of lysozyme solution (20 mM Tris-Cl, pH 8.0, 2 mM EDTA, 1.2% between parameters were assessed using Pearson’s correlation
Triton X-100, 20 mg/ml lysozyme) and incubated at 37  C for 1 h. analysis. p Value <0.05 was considered statistically significant. All
Subsequently, total fecal DNA was prepared using an AccuPrep analyses were performed on an intention to treat basis using SPSS
Genomic DNA extraction kit (Bioneer, Daejeon, Korea) according to version 15.0.0 for Windows (SPSS, Chicago, IL, USA). Data for cor-
the manufacturer’s instructions. relations were visualized using Heatmap plots generated using
HeatMap Builder software.
2.9. Real time quantitative PCR (qPCR)
3. Results
The primers used for quantitative PCR are listed in Table 3. Real
time PCR was performed in 20 ml of reaction volume on a 96-well 3.1. Baseline characteristics and participants
plate using a Light-cycler 480 (Roche, Germany). PCRs were per-
formed in one cycle of pre-incubation at 94  C for 4 min, 55 cycles Baseline characteristics of the probiotics and placebo group are
of amplification encompassing denaturation at 94  C for 15 s, at shown in Table 4. Out of 64 patients screened, 50 patients fulfilled
55  C for 15 s for annealing, and at 72  C for 20 s for extension. The the criteria and were enrolled, (randomly assigned to either the
melting curve was analyzed by heating at temperatures ranging probiotics (n ¼ 25) or placebo group (n ¼ 25)) and 36 Subjects
from 55  C to 90  C at a rate of 5  C/s. (probiotics n ¼ 17, placebo n ¼ 19) completed the study (Fig. 1).

2.10. Biochemical analysis
2.10.1. Measurement of endotoxin
Endotoxin levels in serum were determined using an Endo-
Check TM analyzer (Diatech, Seoul, Korea), using a Limulus
Amebocyte Lysate (LAL)-based kit (Diatech, Seoul, Korea). The assay
was performed according to the manufacturer’s instructions.
3.2. Comparison between the probiotics group and the placebo
group
After the completion of study and subsequent scrutiny of all of
the diaries by CRC, it was observed that there was no marked dif-
ference in the diet and exercise pattern between the probiotics
group and placebo group.
976 S.J. Lee et al. / Clinical Nutrition 33 (2014) 973e981

Table 4 3.3. Regression analysis of weight change in quartile groups

Baseline characteristics of the probiotics and placebo groups. involving different amount of weight loss
Variables Probiotics Placebo p-Value

Mean  SD Mean  SD
In order to investigate the question of which factor might have
the greatest influence on weight loss, we divided participants into
BW 70.66  5.90 70.59  6.97 0.974
two groups; the “lowermost quartile group” showed the least
BMI 28.28  1.31 28.51  1.67 0.657
WC 94.45  5.52 95.38  5.50 0.616 change (Group 1), while “the uppermost quartile group” showed
PF 38.21  4.49 38.31  4.03 0.948 the largest weight loss after administration of herbal medicine with
FAT 27.04  3.91 27.08  4.21 0.974 or without probiotics (Group 2), as shown in Table 6. As a result,
QOL 38.88  9.58 37.32  9.74 0.630
total number of bacteria of patients in the uppermost quartile
ENDO 0.06  0.23 0.01  0.01 0.337
PERM 1.92  1.92 2.16  1.57 0.750 group showed a significant decrease, whereas in the lowermost
BST 97.53  5.81 100.68  11.27 0.293 quartile, the number increased.
TG 191.00  161.40 131.95  63.78 0.173 In the upper group, levels of both Gram positive bacteria and
HDL 54.24  14.61 54.79  11.79 0.902 Firmicutes were decreased, whereas an increase was observed in
TC 213.88  39.23 202.84  28.57 0.347
the lower group. Meanwhile, increased levels of Gram negative
BUN 11.99  3.23 13.49  3.63 0.197
CR 0.59  0.06 0.67  0.11 0.012 bacteria and Bacteroidetes were observed in both groups. In addi-
AST 19.71  4.55 21.58  8.71 0.419 tion, both groups showed a decrease in the Firmicutes/Bacter-
ALT 17.88  6.58 20.05  6.83 0.339 oidetes ratio, with a larger rate of decrease in the upper group.
TOTAL 11.15  0.56 11.25  0.42 0.539
B. longum 6.76  2.03 7.96  1.53 0.057
B. breve 4.44  0.60 4.36  1.19 0.093
3.4. Preepost comparison of probiotics co-administration
B. lactis 6.11  1.06 6.17  1.21 0.870
S. thermophilus 4.42  1.02 5.06  1.00 0.068 Changes in body composition parameters and metabolic bio-
L. rhamnosus 2.71  1.25 2.75  1.30 0.915 markers were demonstrated after co-administration of probiotics
L. plantarum 4.93  1.70 5.02  1.45 0.864
and herbal medicine. In both groups, body composition parameters,
L. acidophilus 3.23  0.88 3.02  0.34 0.359
G. positive 10.36  0.69 10.38  0.47 0.933 including weight, BMI, waist circumference, body fat percentage,
G. negative 8.44  0.79 8.49  0.68 0.830 and body fat mass decreased after administration of herbal medi-
Gr ratio 1.92  0.86 1.89  0.62 0.886 cine. However, no significant changes in endotoxin level and gut
Bacteroidetes 7.15  1.07 6.82  1.07 0.357
permeability were observed in either group after the intervention
Firmicutes 9.60  0.58 9.69  0.36 0.597
F/B ratio 2.45  0.95 2.87  0.94 0.191
(Table 7).
Changes in gut microbiota upon probiotic administration
*p < 0.05 (paired t-test).
increased certain strains of microbiota. B. breve (0.88  0.93,
BW: body weight, BMI: Body Mass Index, WC: waist circumference, PF: fat per-
centage, FAT: fat mass, QOL: quality of life, ENDO: endotoxin, PERM: gut perme- p < 0.05), B. lactis (2.21  1.60, p < 0.05), L. rhamnosus
ability, BST: blood sugar test, TG: triglyceride, HDL: HDL cholesterol, TC: total (2.08  1.67, p < 0.05), L. plantarum (0.90  1.54, p < 0.05), and
cholesterol, BUN: blood urea nitrogen, CR: creatinine, AST: aspartate aminotrans- Gram negative bacteria (0.53  0.92, p < 0.05) were increased
ferase, ALT: alanine aminotransferase, TOTAL: total bacteria, B. longum: Bifido-
after administration of probiotics (Table 8).
bacterium longum, B. breve: Bifidobacterium breve, B. lact: Bifidobacterium lactis,
S. thermophilus: Streptococcus thermophilus, L. rhamnosus: Lactobacillus rhamnosus,
L. plantarum: Lactobacillus plantarum, L. acidophilus: Lactobacillus acidophilus, G. 3.5. Correlation analysis
positive: Gram positive, G. negative: Gram negative, Gr ratio: Gram positive/Gram
negative ratio, F/B ratio: Firmicutes/Bacteroidetes ratio. Improved body composition parameters and metabolic bio-
markers showed correlation with change in gut microbiota after
Difference in body parameters, biomarkers, and microbiota administration of herbal medicine. Combining the results of both
composition were calculated between the two groups of probiotics groups showed correlation of gut microbiota with body composi-
(Table 5). tion parameters and metabolic biomarkers (Fig. 2).
Comparison of weight change between the probiotics group and Weight, BMI, and fat mass showed some positive correlation with
the placebo group showed weight reduction in both groups (pro- endotoxin level (r ¼ 0.441, r ¼ 0.408, r ¼ 0.255, p < 0.05) (Fig. 3).
biotics: 1.02  1.69, placebo: 1.87  1.28). However there was no Although L. plantarum also showed positive correlation with weight
statistically significant difference between the two groups in body and BMI (r ¼ 0.425, r ¼ 0.407, p < 0.05), no statistical significance was
composition after the intervention. observed in the probiotics group. B. breve showed some negative
The HDL cholesterol level of placebo group was found to be correlation with endotoxin level (r ¼ 0.350, p < 0.05), however, no
significantly depleted following the completion of the study statistical significance was observed in the probiotics group. Levels
(Table 7). Although HDL cholesterol level was increased insignifi- of Gram negative bacteria showed positive correlation with waist
cantly in response to the probiotics treatment (Table 7), a signifi- circumference and total cholesterol level (r ¼ 0.359, 0.393, p < 0.05).
cant difference in the change in HDL cholesterol level between the The Gram positive/negative ratio showed negative correlation with
probiotics and placebo groups was evident at the end of study total cholesterol level (r ¼ 0.463, p < 0.05).
period (probiotics: 1.00  9.23, placebo: 4.42  6.15, p < 0.05, Correlation between body composition parameters-metabolic
Table 5). biomarkers and gut microbiota at baseline was demonstrated.
Stool analysis showed that some modification in gut microbiota Negative correlations between B. longum vs weight, S. thermophilus
occurred after administration of probiotics as the levels of B. breve, vs fat mass and gut permeability, L. rhamnosus vs HDL cholesterol,
B. lactis, and L. rhamnosus in the probiotics were significantly L. plantarum vs BMI and fat mass, Gram negative bacteria vs weight
increased, compared to those in the placebo group (B. and fat mass and Firmicutes vs gut permeability are shown in Fig. 4.
breve: 0.88  0.93 vs 0.22  0.88, B. lactis: 2.21  1.60
vs 0.16  1.75, L. rhamnosus: 2.08  1.67 vs 0.23  2.24). 4. Discussion
No significant difference in the change of endotoxin and gut
permeability was observed between the two groups after co- This randomized double-blind controlled clinical trial study was
administration of probiotics and herbal medicine. conducted in order to assess the effects of a probiotic formulation
 S.J. Lee et al. / Clinical Nutrition 33 (2014) 973e981 977

Fig. 1. Disposition of subjects enrolled in the study.

Table 5
containing seven species of lactic acid bacteria and Bifidobacteria
Comparison of the changes in parameters between probiotics and placebo groups at
the end of the study. when combined with herbal medicine in treatment of obesity. The
probiotic product was administered to obese patients in order to
Variables Probiotics Placebo p-Value
determine whether it has an impact on gut microbiota, body
Mean  SD Mean  SD composition, and metabolic markers. Study was also aimed at
BW 1.02  1.69 1.87  1.28 0.083 assessment of what kind of correlations these effects might have
BMI 0.38  0.67 0.75  0.52 0.061 with factors affecting obesity.
WC 1.56  1.43 1.21  2.00 0.521
PF 0.25  3.36 1.01  1.77 0.376
FAT 0.53  2.83 1.38  1.34 0.235 Table 6
QOL 2.40  6.81 0  4.60 0.199 Comparison of the two groups showing lowest and highest weight change in the
ENDO 0.05  0.21 0.01  0.02 0.270 lowermost and uppermost quartiles.
PERM 0.56  2.73 0.58  2.77 0.237
Microbial groups Group 1 Min ¼ 2.5, Group 2 Max ¼ 5.60 p Value
BST 2.10  6.74 6.05  12.01 0.210
Q1 ¼ 0.2 (n ¼ 6) Q3 ¼ 2.35 (n ¼ 9)
TG 19.95  82.89 5.53  50.79 0.519
HDL 1.00  9.23 4.42  6.15 0.038* TOTAL 0.35  0.51 0.03  0.29 0.012*
TC 8.35  25.68 13.58  21.32 0.495 B. longum 0.97  1.50 0.38  1.77 0.516
TOTAL 0.15  0.56 0.04  0.47 0.282 B. breve 0.63  0.71 0.15  1.15 0.385
B. longum 0.41  1.18 0.41  1.29 0.995 B. lactis 1.19  2.19 1.07  1.35 0.895
B. breve 0.88  0.93 0.22  0.88 0.001* S. thermophilus 0.44  1.22 0.39  1.67 0.315
B. lactis 2.21  1.60 0.16  1.75 0.001* L. rhamnosus 2.25  2.37 0.42  2.05 0.136
S. thermophilus 0.70  1.63 0.03  1.25 0.142 L. plantarum 0.82  1.32 0.51  1.71 0.132
L. rhamnosus 2.08  1.67 0.23  2.24 0.010* L. acidophilus 0.48  1.70 0.08  0.42 0.591
L. plantarum 0.90  1.54 0.28  1.97 0.058 G. positive 0.35  0.64 0.19  0.39 0.062
L. acidophilus 0.29  1.12 0.16  0.50 0.665 G. negative 0.69  0.73 0.03  0.89 0.152
G. positive 0.10  0.65 0.02  0.54 0.675 Gr ratio 0.34  0.97 0.22  0.82 0.799
G. negative 0.53  0.92 0.25  0.81 0.354 Bacteroidetes 0.99  1.46 0.14  0.90 0.185
Gr ratio 0.43  0.87 0.24  0.77 0.497 Firmicutes 0.22  0.51 0.18  0.27 0.064
Bacteroidetes 0.33  1.17 0.52  1.35 0.656 F/B ratio 0.76  1.12 0.32  0.89 0.409
Firmicutes 0.09  0.52 0.02  0.41 0.485
*Statistical significance of the difference between the two groups (p < 0.05) as
F/B ratio 0.24  1.07 0.54  1.13 0.419
analyzed by paired-t test.
*p < 0.05 (paired t-test). Data are presented as difference in values between pre- and post-administration of
Data are presented as difference in values between pre- and post-administration of probiotics.
probiotics. BW: body weight, BMI: body mass index, WC: waist circumference, PF: Group 1: “upper group” showing the largest weight change after administration of
fat percentage, FAT: fat mass, QOL: quality of life, ENDO: endotoxin, PERM: gut herbal medicine with or without probiotics.
permeability, BST: blood sugar test, TG: triglyceride, HDL: HDL cholesterol, TC: total Group 2: “lower group” showing the least weight change.
cholesterol, TOTAL: total bacteria, B. longum: Bifidobacterium longum, B. breve: Bifi- TOTAL: total bacteria, B. longum: Bifidobacterium longum, B. breve: Bifidobacterium
dobacterium breve, B. lactis: Bifidobacterium lactis, S. thermophilus: Streptococcus breve, B. lactis: Bifidobacterium lactis, S. thermophilus: Streptococcus thermophilus,
thermophilus, L. rhamnosus: Lactobacillus rhamnosus, L. plantarum: Lactobacillus L. rhamnosus: Lactobacillus rhamnosus, L. plantarum: Lactobacillus plantarum,
plantarum, L. acidophilus: Lactobacillus acidophilus, G. positive: Gram positive, G. L. acidophilus: Lactobacillus acidophilus, G. positive: Gram positive, G. negative: Gram
negative: Gram negative, Gr ratio: Gram positive/Gram negative ratio, F/B ratio: negative, Gr ratio: Gram positive/Gram negative ratio, F/B ratio: Firmicutes/Bac-
Firmicutes/Bacteroidetes ratio. teroidetes ratio.
978 S.J. Lee et al. / Clinical Nutrition 33 (2014) 973e981

Table 7
Comparison of changes in the probiotics and placebo groups before and after herbal co-administration (body parameters and biomarkers).

Variables Probiotics (Mean  SD) Placebo (Mean  SD)

Before After p Value Before After p Value

BW 71.03  6.08 70.01  6.81 0.000* 70.44  6.81 68.58  6.42 0.000*
BMI 28.53  1.65 28.15  1.95 0.000* 28.40  1.69 27.66  1.72 0.000*
WC 95.24  6.01 93.68  6.00 0.000* 95.22  5.40 94.02  5.33 0.000*
PF 38.62  4.47 38.37  3.63 0.001* 38.21  3.95 37.20  4.28 0.000*
FAT 27.51  4.30 26.98  4.56 0.000* 26.96  4.14 25.58  4.16 0.000*
QOL 38.65  9.11 36.25  7.71 0.001* 37.00  9.59 37.00  8.04 0.000*
ENDO 0.05  0.21 0.01  0.01 0.087 0.01  0.01 0.01  0.02 0.710
PERM 2.74  1.95 2.18  1.52 0.391 2.83  1.98 3.49  2.53 0.555
BST 97.53  5.81 95.88  8.51 0.342 100.68  11.27 94.68  7.47 0.045*
TG 191  161.40 163.47  126.59 0.410 131.95  63.78 127.68  67.91 0.713
HDL 54.24  14.61 56.94  14.71 0.200 54.79  11.79 50.95  10.67 0.036*
TC 213.88  39.23 207.47  41.34 0.312 202.84  28.57 190.84  24.83 0.033*
BUN 11.99  3.23 12.25  3.74 0.731 13.49  3.63 12.06  3.30 0.059
Cr 0.60  0.11 0.64  0.08 0.063 0.66  0.08 0.67  0.09 0.562
AST 20.18  4.57 19.29  4.67 0.429 21.16  8.78 25.37  23.44 0.912
ALT 20.06  6.14 19.41  6.96 0.720 18.11  7.22 19.63  16.95 0.337

*p < 0.05 (paired t-test).

BW: body weight, BMI: Body Mass Index, WC: waist circumference, PF: fat percentage, FAT: fat mass, QOL: Quality Of Life, ENDO: endotoxin, PERM: gut permeability, BST:
Blood sugar test, TG: triglyceride, HDL: HDL cholesterol, TC: total cholesterol, BUN: blood urea nitrogen, CR: creatinine, AST: aspartate aminotransferase, ALT: alanine
aminotransferase.

Table 8
Comparison of changes in the probiotics and placebo groups before and after herbal co-administration (gut microbiota).

Variables Probiotics (Mean  SD) Placebo (Mean  SD)

Before After p Value Before After p Value

TOTAL 11.15  0.56 11.29  0.46 0.289 11.25  0.42 11.19  0.38 0.604
B. longum 6.76  2.03 7.17  1.51 0.169 7.96  1.53 8.32  0.92 0.441
B. breve 3.82  0.60 4.70  0.90 0.001* 4.36  1.19 4.15  0.94 0.289
B. lactis 6.11  1.06 8.32  1.22 <0.0001** 6.17  1.21 6.34  0.90 0.670
S. thermophilus 4.42  1.02 5.12  1.51 0.095 5.06  1.00 5.01  0.81 0.871
L. rhamnosus 2.71  1.25 4.78  1.16 <0.0001** 2.75  1.30 3.03  1.79 0.860
L. plantarum 4.93  1.70 5.83  1.27 0.028* 5.02  1.45 4.84  1.42 0.697
L. acidophilus 3.23  0.88 3.51  0.93 0.461 3.02  0.34 3.20  0.48 0.164
G. positive 10.36  0.69 10.46  0.57 0.927 10.38  0.47 10.39  0.43 0.962
G. negative 8.44  0.79 8.97  0.67 0.031* 8.49  0.68 8.71  0.68 0.263
Gr ratio 1.92  0.86 1.50  0.49 0.059 1.89  0.62 1.68  0.75 0.250
Bacteroidetes 7.15  1.07 7.49  1.32 0.258 6.82  1.06 7.28  1.10 0.154
Firmicutes 9.60  0.58 9.70  0.47 0.890 9.69  0.36 9.67  0.34 0.817
F/B ratio 2.45  0.95 2.21  1.04 0.373 2.87  0.94 2.39  0.85 0.082

*p < 0.05 (paired t-test).

**p < 0.05 (Wilcoxon’s signed rank test).
TOTAL: total bacteria, B. longum: Bifidobacterium longum, B. breve: Bifidobacterium breve, B. lactis: Bifidobacterium lactis, S. thermophilus: Streptococcus thermophilus,
L. rhamnosus: Lactobacillus rhamnosus, L. plantarum: Lactobacillus plantarum, L. acidophilus: Lactobacillus acidophilus, G. positive: Gram positive, G. negative: Gram negative, Gr
ratio: Gram positive/Gram negative ratio, F/B ratio: Firmicutes/Bacteroidetes ratio.

Following the completion of study, no significant differences in
the changes in most of the metabolic or body compositional
markers between the probiotics and placebo groups were observed.
However, the probiotics group showed a significant difference in
the change in HDL cholesterol level compared to that in the placebo
group. This in relation to a previous study demonstrating probiotic
effects in the modulation of hypercholesterolemia where probiotics
were reported to increase HDL cholesterol level.12 Dyslipidemia
consists of elevated triglyceride, high LDL cholesterol, and low HDL
cholesterol concentration and this is known to show an association
with increased visceral fat found in abdominal obesity.13 Hypo-
cholesterolemic effect of probiotics can improve abnormal lipid
metabolism as it reduces hypertriglyceridemia induced by insulin
resistance.14 In a study investigating the question of whether intra-
abdominal fat and HDL cholesterol have correlation with hepatic-
triglyceride lipase activity, it was concluded that low HDL choles-
terol level plays an important role as it can affect triglyceride ac-
tivity disturbing plasma lipoprotein transport, which can be found
in abdominal obesity.15 When metabolic disorders involving
dyslipidemia and insulin resistance become a therapeutic target,
probiotics can be applied in treatment of obesity. Accordingly, it is
conceivable that a significant change in HDL cholesterol level be-
tween the two groups in our study may provide a positive outlook
in effective treatment of obesity dealing with metabolic disorders
such as dyslipidemia and insulin resistance.
Dysbiosis of the gut microbiota has been suggested to be an
important factor in obesity, meaning that alterations in the compo-
sition of gut microbiota show disturbed balance of beneficial and
detrimental bacteria.16 This unbalanced state promotes intestinal
inflammation-induced metabolic disorders (insulin resistance, dia-
betes, and obesity)17 and administration of probiotics was considered
as an important therapeutic manipulation in many studies.8 In this
study, B. breve, B. lactis, and L. rhamnosus were increased in the pro-
biotics group, compared to the placebo group, indicating that
administration of herbal medicine with probiotics might result in
effective modification of composition of gut microbiota.
A preepost comparison of probiotics administration showed
some changes in the body composition parameters. Weight, BMI,
 S.J. Lee et al. / Clinical Nutrition 33 (2014) 973e981
Fig. 2. Correlations between gut microbiota and body parameters in both groups are
represented graphically in a heatmap format. Figure + indicates statistical significance
of p < 0.05. BW: body weight, BMI: body mass index, WC: waist circumference, FAT: fat
mass, ENDO: endotoxin, TC: total cholesterol, TOTAL: total bacteria, B. breve: Bifido-
bacterium breve, L. plantarum: Lactobacillus plantarum, G. negative, Gram negative, Gr
ratio: Gram positive/Gram negative ratio.
waist circumference, body fat percentage, and body fat mass
showed a decrease after administration of Duolac 7; this result
provides more value for the anti-obesity effect of probiotics already
discovered.8 Correlation that might exist between gut microbiota
and change in body composition as well as metabolic biomarkers
required detailed inspection which might provide clues to deter-
minate effects that probiotics might have on obesity.
In many studies, probiotics were tested for restoration of gut
barrier when gut permeability is increased due to intestinal
inflammation leading to metabolic endotoxemia.5 A preepost
comparison of BTS administration with probiotics showed some
specific increases in certain strains of microbiota, whereas, in the
placebo, there was no significant modification in gut microbiota
composition. B. breve, B. lactis, L. rhamnosus, and L. plantarum in
Fig. 3. Correlations between gut microbiota and body parameters in the probiotics
group are represented graphically in a heatmap format. Figure + indicates statistical
significance of p < 0.05. BW: body weight, BMI: body mass index, WC: waist
circumference, ENDO: endotoxin, G. negative, Gram negative, Gr ratio: Gram positive/
Gram negative ratio.
979
Fig. 4. Correlations between gut microbiota and body parameters at baseline are
represented graphically in a heatmap format. Figure + indicates statistical significance
of p < 0.05. BW: body weight, BMI: body mass index, FAT: fat mass, PERM: gut
permeability, HDL: HDL cholesterol, B. longum: Bifidobacterium longum,
S. thermophilus: Staphilococcus thermophilus, L. rhamnosus: Lactobacillus rhamnosus,
L. plantarum: Lactobacillus plantarum, G. negative: Gram negative.
Duolac 7 and Gram negative bacteria were increased after admin-
istration of probiotics. This supports previous findings that meta-
bolic endotoxemia is induced by lipopolysaccharide (LPS), a
component of the gram negative cell, which promotes change of
gut microbiota.17 From our study, modulation of gut microbiota was
proved to be achieved by probiotic administration, which might
increase the level of gram negative bacteria in the intestine of obese
subjects by preventing absorption of LPS into blood circulation,
reducing endotoxemia, thereby improving metabolic disorders.
Based on the hypothesis that modulation of gut microbiota can
affect metabolic disorders and obesity, multiple-correlation ana-
lyses on body parameters and metabolic biomarkers with gut
microbiota after administration of probiotics have been performed
in order to investigate effects they might have on obesity.
L. plantarum showed positive correlation with weight and BMI,
contrary to previous studies hypothesizing its anti-dyslipidemic
effects. However, no correlation between L. plantarum with these
parameters was observed in the probiotics group. B. breve showed
some negative correlation with endotoxin level, which corresponds
with anti-obesity and anti-inflammatory effects of B. breve previ-
ously proven by many studies.18,19 Then again, no statistical sig-
nificance was observed in the probiotics group.
Weight, BMI, and fat mass showed some positive correlation
with endotoxin level, which is in agreement with previous findings
indicating that increased endotoxemia promotes development of
metabolic disorders, including obesity and insulin resistance.20
Gram negative bacteria also showed positive correlation with
waist circumference and total cholesterol level. As LPS is a major
component of the outer membrane in Gram negative bacteria5 and
a major stimulator of inflammation, it would be reasonable to
speculate that an increase in LPS level in endotoxemia inducing
metabolic disorder can increase body fat mass and other metabolic
parameters accompanied in obese patients. It has been suggested
that gram negative bacteria can be reduced by probiotics such as
Lactobacillus GG or Bifidobacteria through preservation of gut
permeability, which reduces the level of entotoxin.21
Therefore, this finding shows that modification of gut micro-
biota composition can provide effective treatment for obesity.
980 S.J. Lee et al. / Clinical Nutrition 33 (2014) 973e981
Another finding in this study was that Gram positive/negative ratio
showed negative correlation with total cholesterol level. Experi-
ments involving high fat diet showed that increased endotoxemia
can change the composition of gut microbiota, reducing the levels
of both gram negative and gram positive bacteria in intestine,
which leads to an increase in the gram negative to positive ratio.22
This also supports the anti-obesity effect of probiotics according to
the hypothesis that in a high fat diet, gram negative level showed
correlation with changes in gut microbiota, resulting in increased
gram positive/negative ratio.23
Further investigation was conducted in order to assess correla-
tion with gut microbiota and obesity affecting factors as stool and
blood samples along with body parameter data were analyzed at
baseline. Among the findings, B. longum showed negative correla-
tion with body weight, which has already been proven in studies
investigating its anti-lipidemic and anti-obesity effects.8 According
to another result, negative correlation was observed between
S. thermophilus vs fat mass and gut permeability. This probiotic
strain was also mentioned in studies reporting on the effects of
probiotics on decreased hepatic steatosis, which can be achieved by
regulation of TNF-a.24 L. rhamnosus showed negative correlation
with HDL cholesterol, meaning that increased level of HDL
cholesterol in obesity can be considered to be lowered by admin-
istration of L. rhamnosus. Its anti-obesity effects have already been
investigated previous studies.25 Unlike in the analysis of data
collected after probiotics administration, L. plantarum showed
negative correlation with BMI and fat mass at baseline. Anti-obesity
effects of L. plantarum were previously proven by the mechanism of
inhibiting adipogenesis and enhancement of lipolysis.26 More
thorough investigation of the negative correlation between gram
negative vs weight and fat mass, Firmicutes vs gut permeability
regarding their relation to obesity is needed.
Firmicutes and Bacteroidetes are known to be main bacterial
phyla related to alteration of gut microbiota.27 As alteration in
composition of gut microbiota is associated with development of
obesity, some studies have reported lower Bacteroidetes and more
Firmicutes in obese subjects, compared to lean subjects.28 More
recently, some studies have reported proportions opposite to those
of a previous hypothesis29 or even stating that there is no evidence
that proportions of Bacteroidetes and Firmicutes have function in
obesity.30 Despite controversies over the connection between
obesity and proportion of the two phyla, it is meaningful, as the
results of our study also indicated a connection between bacteria
and obesity-related factors. In order to speculate on the phyla in
detail, participants were divided into two groups according to
amount of weight reduction. In the upper group, both Gram posi-
tive and Firmicutes showed a decrease, whereas the lower group
showed an increase. In both groups, Gram negative and Bacter-
oidetes were increased, respectively. In addition, both groups
showed a decrease in Firmicutes/Bacteroidetes ratio, the upper
group showing a higher rate of change. This is in relevance with the
hypothesis that obesity is associated with a larger proportion of
Firmicutes and lower Bacteroidetes.28 This composition of micro-
biota remains controversial and additional scientific evidence is
needed in order to prove it. However, changes in gut microbiota in a
specific phylum or genus according to compositional and metabolic
changes show that probiotics may have positive effects on energy
metabolism in obese patients.
There were some limitations in this study that need to be
acknowledged regarding the effects of probiotics on weight
reduction. Seven strains of bacteria were administered concur-
rently in the form of a capsule, meaning that no specificity was
shown in use of bacterial strains. In the future, specific bacterial
strains should be used in order to modulate the composition of gut
microbiota according to type of disease, so that personalized
medicine can be developed in treatment of obesity. In addition, the
number of subjects participating in the study, as well as the study
period, was limited. Although the participants were asked to
maintain dietary rules, it would also have been better if they were
controlled in order to limit their diet pattern more strictly, which
could have influenced various parameters and biomarkers of the
patients.
In conclusion, in this preliminary and explorative study of co-
administration of probiotics and BTS, the results showed anti-
obesity effects by improving obesity-related parameters.
Following the completion of our study, HDL cholesterol level
exhibited a significant difference in the changes between the pro-
biotics and placebo group (p < 0.05), indicating a positive outlook
on the anti-obesity effect of probiotics which provided more
benefit on energy metabolism compared to solo administration of
herbal medicine. Changes in gut microbiota of certain phylum or
genus such as L. plantarum and Gram negative bacteria showed
positive correlation with many body composition parameters and
metabolic biomarkers implicating the impact of probiotics on
obesity-related energy metabolism. Modulation of gut microbiota
composition showed close association with both endotoxin and
obesity-related parameters. B. breve was the only strain showing a
significant tendency of declination of endotoxin level, which could
be suggested as a promising probiotic strain specified for obesity
treatment. However, results for L. plantarum were contrary to those
reported in previous studies hypothesizing its lipid-lowering effect.
Strains in the probiotic product used in this study demonstrated a
significant increase in the probiotics group, which proved to have a
distinct effect on gut microbiota adjustment. From this study, new
correlations between parameters affecting endotoxin and gut
permeability suggest promising strategies for treatment of obesity
by setting a target for gut microbiota modification.
Conflict of interest
None declared.
Statement of authorship
SJL carried out the studies and participated in data interpreta-
tion and drafted the manuscript. HJK participated in the conception
and design of the experiments, helped to draft the manuscript and
obtained funding. SB helped to draft the manuscript and revised it
thoroughly. JGS and WSC carried out the studies and provided gut
microbiota analysis and data interpretation. CYL performed statis-
tical analysis. All authors read and approved the final manuscript.
Acknowledgments
This study was supported financially by Cell Biotech.
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.clnu.2013.12.006.
References
1. Angelakis E, Armougom F, Million M, Raoult D. The relationship between gut
microbiota and weight gain in humans. Future Microbiol 2012;7(1):91e109.
2. Cani PD, Osto M, Geurts L, Everard A. Involvement of gut microbiota in the
development of low-grade inflammation and type 2 diabetes associated with
obesity. Gut Microbes 2012;3(4):279e88.
3. Harris K, Kassis A, Major G, Chou CJ. Is the gut microbiota a new factor
contributing to obesity and its metabolic disorders? J Obes 2012;2012.
 S.J. Lee et al. / Clinical Nutrition 33 (2014) 973e981
4. Manco M, Putignani L, Bottazzo GF. Gut microbiota, lipopolysaccharides, and
innate immunity in the pathogenesis of obesity and cardiovascular risk. Endocr
Rev 2010;31(6):817e44.
5. Cani PD, Bibiloni R, Knauf C, Waget A, Neyrinck AM, Delzenne NM, et al.
Changes in gut microbiota control metabolic endotoxemia-induced inflam-
mation in high-fat diet-induced obesity and diabetes in mice. Diabetes
2008;57(6):1470e81.
6. Maes M, Coucke F, Leunis J-C. Normalization of the increased translocation of
endotoxin from gram negative enterobacteria (leaky gut) is accompanied by a
remission of chronic fatigue syndrome. Neuro Endocrinol Lett 2007;28(6):739.
7. Caradonna L, Amati L, Lella P, Jirillo E, Caccavo D. Phagocytosis, killing,
lymphocyte-mediated antibacterial activity, serum autoantibodies, and plasma
endotoxins in inflammatory bowel disease. Am J Gastroenterol 2000;95(6):
1495e502.
8. An HM, Park SY, Lee DK, Kim JR, Cha MK, Lee SW, et al. Antiobesity and lipid-
lowering effects of Bifidobacterium spp. in high fat diet-induced obese rats.
Lipids Health Dis 2011;10:116.
9. Velayudham A, Dolganiuc A, Ellis M, Petrasek J, Kodys K, Mandrekar P, et al.
VSL# 3 probiotic treatment attenuates fibrosis without changes in steatohe-
patitis in a diet-induced nonalcoholic steatohepatitis model in mice. Hepatology
2009;49(3):989e97.
10. Esposito E, Iacono A, Bianco G, Autore G, Cuzzocrea S, Vajro P, et al. Probiotics
reduce the inflammatory response induced by a high-fat diet in the liver of
young rats. J Nutr 2009;139(5):905e11.
11. Shimada T, Kudo T, Akase T, Aburada M. Preventive effects of Bofutsushosan on
obesity and various metabolic disorders. Biol Pharm Bull 2008 Jul;31(7):1362e
7. PubMed PMID: 18591775.
12. Lye H-S, Kuan C-Y, Ewe J-A, Fung W-Y, Liong M-T. The improvement of hy-
pertension by probiotics: effects on cholesterol, diabetes, renin, and phytoes-
trogens. Int J Mol Sci 2009;10(9):3755e75.
13. Carr MC, Brunzell JD. Abdominal obesity and dyslipidemia in the metabolic
syndrome: importance of type 2 diabetes and familial combined hyperlip-
idemia in coronary artery disease risk. J Clin Endocrinol Metab 2004;89(6):
2601e7.
14. Olefsky J, Reaven GM, Farquhar JW. Effects of weight reduction on obesity
studies of lipid and carbohydrate metabolism in normal and hyper-
lipoproteinemic subjects. J Clin Invest 1974;53(1):64.
15. Després J-P, Ferland M, Moorjani S, Nadeau A, Tremblay A, Lupien PJ, et al. Role
of hepatic-triglyceride lipase activity in the association between intra-
abdominal fat and plasma HDL cholesterol in obese women. Arterioscler
Thromb Vasc Biol 1989;9(4):485e92.
16. Sartor RB. Therapeutic correction of bacterial dysbiosis discovered by molec-
ular techniques. Proc Natl Acad Sci 2008;105(43):16413e4.
981
17. Cani PD, Delzenne NM. Interplay between obesity and associated metabolic
disorders: new insights into the gut microbiota. Curr Opin Pharmacol
2009;9(6):737e43.
18. Kondo S, Xiao J-Z, Satoh T, Odamaki T, Takahashi S, Sugahara H, et al. Anti-
obesity effects of Bifidobacterium breve strain B-3 supplementation in a mouse
model with high-fat diet-induced obesity. Biosci Biotechnol Biochem
2010;74(8):1656e61.
19. Hoarau C, Lagaraine C, Martin L, Velge-Roussel F, Lebranchu Y. Supernatant of Bifi-
dobacterium breve induces dendritic cell maturation, activation, and survival
through a toll-like receptor 2 pathway. J Allergy Clin Immunol 2006;117(3):696e702.
20. Cani P, Neyrinck A, Fava F, Knauf C, Burcelin R, Tuohy K, et al. Selective in-
creases of bifidobacteria in gut microflora improve high-fat-diet-induced dia-
betes in mice through a mechanism associated with endotoxaemia.
Diabetologia 2007;50(11):2374e83.
21. Purohit V, Bode JC, Bode C, Brenner DA, Choudhry MA, Hamilton F, et al.
Alcohol, intestinal bacterial growth, intestinal permeability to endotoxin, and
medical consequences: summary of a symposium. Alcohol 2008;42(5):349e61.
22. DiBaise JK, Zhang H, Crowell MD, Krajmalnik-Brown R, Decker GA,
Rittmann BE, editors. Gut microbiota and its possible relationship with obesity.
Mayo clinic proceedings. Elsevier; 2008.
23. Cani PD, Amar J, Iglesias MA, Poggi M, Knauf C, Bastelica D, et al. Metabolic
endotoxemia initiates obesity and insulin resistance. Diabetes 2007;56(7):
1761e72.
24. Li Z, Yang S, Lin H, Huang J, Watkins PA, Moser AB, et al. Probiotics and anti-
bodies to TNF inhibit inflammatory activity and improve nonalcoholic fatty
liver disease. Hepatology 2003;37(2):343e50.
25. Ilmonen J, Isolauri E, Poussa T, Laitinen K. Impact of dietary counselling and pro-
biotic intervention on maternal anthropometric measurements during and after
pregnancy: a randomized placebo-controlled trial. Clin Nutr 2011;30(2):156e64.
26. Park D-Y, Ahn Y-T, Huh C-S, Jeon S-M, Choi M-S. The inhibitory effect of
Lactobacillus plantarum KY1032 cell extract on the adipogenesis of 3T3-L1
Cells. J Med Food 2011;14(6):670e5.
27. Armougom F, Raoult D. Use of pyrosequencing and DNA barcodes to monitor
variations in Firmicutes and Bacteroidetes communities in the gut microbiota
of obese humans. BMC Genomics 2008;9(1):576.
28. Ley RE, Turnbaugh PJ, Klein S, Gordon JI. Microbial ecology: human gut mi-
crobes associated with obesity. Nature 2006;444(7122):1022e3.
29. Zhang H, DiBaise JK, Zuccolo A, Kudrna D, Braidotti M, Yu Y, et al. Human gut
microbiota in obesity and after gastric bypass. Proc Natl Acad Sci 2009;106(7):
2365e70.
30. Duncan S, Lobley G, Holtrop G, Ince J, Johnstone A, Louis P, et al. Human colonic
microbiota associated with diet, obesity and weight loss. Int J Obes
2008;32(11):1720e4.