Clin Chem Lab Med 2003; 41(6):787 – 791 © 2003 by Walter de Gruyter · Berlin · New York
Type-Specific Detection of Human Papillomaviruses in a Routine
Laboratory Setting – Improved Sensitivity and Specificity of PCR and
Sequence Analysis Compared to Direct Hybridisation
Siegfried Kösel*, Siegfried Burggraf, Jens Mommsen,
Werner Engelhardt and Bernhard Olgemöller
Labor Becker, Olgemöller und Kollegen, München, Germany
Human papillomaviruses (HPV) are known to cause
cervical dysplasia and cervical carcinoma. We used a 3-
step PCR protocol that allows rapid type-specific HPV
testing in a routine laboratory setting: HPV-16-positive
samples were determined using a specific LightCycler
PCR; HPV-16-negative samples were amplified by
nested PCR and typed by sequence analysis. During a
period of 7 months, 1275 PCR-based HPV tests were
performed. Of the 1275 samples, 829 samples tested
negative for HPV and 446 tested positive, including
124 positives found in the initial HPV-16-specific Light-
Cycler assay. Sequence analysis of 132 samples de-
tected 18 HPV types that are not included in the widely
used Hybrid Capture II assay. For comparison, the first
100 cervical specimens were tested in parallel using
PCR and direct hybridisation (Hybrid Capture II assay).
PCR detected HPV DNA in 23 samples that tested neg-
ative in the Hybrid Capture assay. Four out of 37 sam-
ples that tested positive for HPV in the Hybrid Capture
test may be false positives, because sequence analysis
detected HPV types not included in the probe mix-
tures. As rare and novel HPV types may also confer an
oncogenic risk, highly sensitive and specific PCR as-
says will help in understanding cervical HPV infection
and cervical cancer of unknown causes. Clin Chem Lab
Med 2003; 41(6):787 – 791
Key words: Cycle sequencing; Human papillomavirus:
HPV; PCR; Screening.
Abbreviations: ASCUS, atypical squamous cells of un-
determined significance; CIN, cervical intraepithelial
neoplasia; HPV, human papillomavirus.
Introduction
Human papillomaviruses (HPVs) are a major risk factor
for cervical dysplasia and cervical carcinoma. More
than 100 HPV types are known, at least 30 of which in-
fect the anogenital tract. HPVs are divided into high-risk
and low-risk types on the basis of epidemiological data
or homology to well-characterised types. Whereas low-
risk HPVs are found in condylomata, high-risk types
cause development and maintenance of cervical dys-
plasia. The continuous presence of high-risk HPV types
*E-mail of the corresponding author: koesel@labor-bo.de
Brought to you by | Tokyo Daigaku
Authenticated
Download Date | 5/21/15 10:03 AM
in cytologically abnormal smears is a strong indicator
for clinical progression to severe dysplasia or carci-
noma (1, 2).
Therefore, when combined with cervical cytology,
HPV testing may improve the detection rate of cervical
intraepithelial neoplasia and could be helpful in clarify-
ing equivocal cervical cytology results (3). Up to 10% of
women with atypical squamous cells of undetermined
significance (ASCUS) actually carry severe cervical
dysplasia. In these patients, a positive HPV test de-
tected severe cervical dysplasia more reliably than an
abnormal repeat cervical smear (4). Furthermore, in
cases of mild to moderate dysplasia, a second HPV test
more accurately predicted cervical intraepithelial neo-
plasia (CIN) III histology than a second cervical cytol-
ogy (1). These data strongly suggest that, in combina-
tion with cervical cytology, a highly sensitive and
specific HPV assay would be helpful for cervical cancer
screening.
A widely used commercial HPV analysis kit (Hybrid
Capture II) relies on direct hybridisation of RNA probes
to HPV DNA. However, rare and novel HPV types that
cannot be detected by hybridisation assays may confer
a higher oncogenic risk than previously assumed (5).
For detection of such types, PCR analysis has been
shown to be more specific and sensitive (6). PCR analy-
sis avoids cross-hybridisation, which is an intrinsic
problem of hybridisation techniques. Further, PCR de-
tects all HPV types, i.e., not just those that are included
in the hybridisation probe mixtures.
Unfortunately, at present, use of PCR combined with
sequence analysis is restricted mainly to research facil-
ities. Here we show the feasibility of a 3-step PCR/cycle
sequencing approach for efficient HPV testing in a rou-
tine diagnostic laboratory. For the first 100 samples,
PCR data were compared with results from the Hybrid
Capture II assay.
Materials and Methods
Patients
Over a period of 7 months (April 2002 –October 2002), 1275 HPV
tests were performed in our laboratory. Private gynaecologists
sent the samples for the confirmation and risk classification of
cervical dysplasia, for the determination of HPV persistence fol-
lowing conisation, or for HPV screening in the absence of clini-
cal signs of cervical dysplasia. The mean age of the women was
37 ± 11 years (range 15 – 85 years). Forty-six women were tested
twice. The interval between the two cervical samples was
3 – 6 months. The first 100 samples were tested in parallel using
PCR and direct hybridisation (Hybrid Capture II HPV DNA assay,
Digene Corporation, Gaithersburg, MD, USA).
788 Kösel et al.: Diagnosis of HPV infections by PCR and sequence analysis
DNA isolation
Cervical samples were taken using a cytobrush and collected
in a transport medium containing either the medium provided
for the direct hybridisation assay (Digene Specimen Transport
Medium) or a mixture of 0.1 M Tris/HCl pH 8.3, 1% Tween-20
and 0.05% “Micro-O-protect” stabilisation reagent (Roche
Molecular Biochemicals, Mannheim, Germany). A 200 µl
aliquot of each sample was used for DNA isolation with the
QIAamp DNA Mini Kit (QIAGEN GmbH, Hilden, Germany) ac-
cording to the manufacturer’s instructions. DNA was eluted
from the columns in a volume of 50 µl.
Type-specific HPV detection by PCR amplification and
sequence analysis
Step 1. HPV 16 LightCycler PCR
A rapid cycle, real-time PCR assay was used for specific HPV
16 detection (7). Primers and probes targeting the E6/E7 gene
were designed using the LightCycler probe design software
(version 1.0; Roche Molecular Biochemicals, Mannheim,
Germany). The sequences of the primers were 5´TCCATA-
ATATAAGGGGTCGG3´ and 5´CGGTTCTGCTTGTCCA3´. The
internal hybridisation probes had sequences of 5´CTGATCTC-
TACTGTTATGAGCAATTAAATGACA3´ (anchor probe, labeled
at the 3´ end with fluorescein ) and 5´TCAGAGGAGGAGGAT-
GAAATAGATGG3´ (detection probe, labeled at the 5´ end with
LightCycler Red 705 and at the 3´ end with phosphate). The re-
action mix consisted of 5 pmol of each primer, 2 pmol of each
probe, 1 µl of “LightCycler-Fast Start DNA Master Hybridiza-
tion Probes” mix (Roche Molecular Biochemicals, Mannheim,
Germany), 4 mM MgCl2 and 2.5 µl of template DNA in a total
volume of 10 µl. PCR amplification and real-time detection
were performed in glass capillaries using a LightCycler instru-
ment (Roche Molecular Biochemicals, Mannheim, Germany).
After an initial incubation (10 min at 95 °C to activate the DNA
polymerase), the samples were subjected to 45 thermal cycles
at 95 °C for 0 s, 55 °C for 10 s, and 72 °C for 20 s. Fluorescence
was measured at the end of the 55 °C step.
Step 2. PCR for β-globin DNA and universal HPV PCR
HPV-16-negative samples were next subjected to a control β-
globin PCR and a nested universal HPV PCR. To check for ade-
quate sampling (i.e., sufficient amounts of cellular material)
and for PCR inhibitors, β-globin DNA from a 5 µl aliquot of
each sample was amplified. For this control PCR, the se-
quences of the β-globin primers were 5´ACACAACTGT-
GTTCACTAGC3´ and 5´CAACTTCATCCACGTTCACC3´. To test
for other HPV strains, HPV DNA from a 5 µl aliquot of each
HPV-16-negative sample was amplified using L1 consensus
degenerate primers MY09 and MY11 (8); an aliquot (1 µl) of
the first PCR reaction was used in a nested PCR with primers
GP5 + and GP6 + (9). Each PCR was performed in a total vol-
ume of 50 µl containing 1 × PCR buffer (QIAGEN GmbH,
Hilden, Germany), 3.5 mM MgCl2, 20 pmol of each primer,
dGTP/dCTP/dATP (0.25 mM each), dUTP (0.75 mM), and 1.25 U
HotStarTaq DNA polymerase (QIAGEN GmbH, Hilden, Ger-
many). A negative and a positive control were included in
each run. The PCR reactions were incubated for 15 min at
95 °C for DNA denaturation and activation of the hot start Taq
polymerase. Cycling parameters for the β-globin and
MY09/MY11 PCRs (40 cycles) were 94 °C for 30 s, 55 °C for 30 s,
and 72 °C for 40 s. For the nested PCR (30 cycles), cycling con-
ditions were 94 °C for 30 s, 40 °C for 30 s, and 72 °C for 30 s.
Ten µl of each amplicon were separated on a 2% agarose gel.
After ethidium bromide staining, bands were visualised under
UV light. Samples that showed a 142 bp band in the nested
Brought to you by | Tokyo Daigaku
Authenticated
Download Date | 5/21/15 10:03 AM
PCR were considered HPV-positive. Only samples with a
strong band in the β-globin PCR and no band in the nested
PCR were scored HPV-negative. Samples exhibiting inhibition
of PCR (less than 1%) worked well after a new DNA extraction
from the same cell suspension.
Step 3. Purification of PCR products and sequence analysis
Nested PCR products were purified with the QIAquick PCR Pu-
rification Kit (QIAGEN GmbH, Hilden, Germany) according to
the manufacturer’s instructions. Cycle sequencing was per-
formed in a volume of 10 µl containing 10 pmol of GP5 +
primer, 1 µl BigDye Terminator RR mix (Applied Biosystems,
Forster City, CA, USA) and 1 µl of purified PCR product. The re-
actions were subjected to 25 thermal cycles of 96 °C for 10 s,
50 °C for 10 s, and 60 °C for 2 min. The sequencing reactions
were purified by ethanol precipitation and separated on an
ABI Prism 310 Genetic Analyzer (Applied Biosystems, Forster
City, CA, USA). The resulting sequences were analysed by a
BLAST search at the National Center for Biotechnology Infor-
mation, USA (10, 11). Sequences that were more than 90%
identical to a reference sequence were accepted as reliable.
Direct hybridisation assay
One hundred samples were tested for HPVs using the Hybrid
Capture II HPV DNA assay (HCI, Digene Corporation, Gaithers-
burg, MD, USA). The collection of the specimens and the Hy-
brid Capture assay, which detects HPV types 6, 11, 16, 18, 31,
33, 35, 39, 42, 43, 44, 45, 51, 52, 56, 58, 59, and 68 were per-
formed according to manufacturer’s recommendations. In
brief, DNA was extracted from the samples and was hy-
bridised with specific RNA probes for HPV from either high or
low risk groups. The complexes were fixed to the plate by spe-
cific antibodies against DNA-RNA complexes and detected by
enzyme immunoassay.
Statistical analysis
Differences in HPV detection rates between the Hybrid Cap-
ture assay and PCR-based sequence analysis were evaluated
with the χ2 test.
Results
Cervical samples of 1275 women were tested for HPV
using PCR and sequence analysis; 65% (829/1275)
tested negative for HPVs, 35% (446/1275) tested posi-
tive. The type-specific HPV analysis involved a 3-step
protocol. In the first step, which used a HPV-16-specific
LightCycler PCR, 124 HPV-16-positives were found
among 1275 samples. In the second step, all HPV-16-
negative DNA specimens were amplified using a PCR
for β-globin DNA and a universal nested HPV PCR; 72%
(829/1151) of these samples tested HPV-negative and
28% (322/1151) tested HPV-positive. In step 3, the prod-
ucts of the nested HPV PCR were sequenced. HPV types
detected and their frequencies are shown in Figure 1.
Multiple HPV sequences, i.e., duplicate peaks at single
bases, were present in 5% (23/446) of the HPV-positive
samples.
Forty-six women were tested twice. Twenty-nine pa-
tients carried the same HPV types in both tests, six
tested negative both times. Of six women who initially
tested HPV-16-positive, five were HPV-negative follow-
 Kösel et al.: Diagnosis of HPV infections by PCR and sequence analysis 789

fied as high-risk HPV, three as low-risk HPV. Sequence

analysis confirmed the hybridisation result in 26 of
these cases. However, in four of the 37 positive sam-
ples, sequence analysis detected HPV types that are
not included in the Hybrid Capture probe mixtures.
Compared with the PCR/sequencing method, the Hy-
brid Capture test had a significantly lower sensitivity
(p = 0.002, χ2 test). PCR detected HPV DNA in 23 of
63 samples that the Hybrid Capture assay scored nega-
tive for HPV. Significantly, 11 of these patients carried
HPV types that were included in the Hybrid Capture
test. Multiple sequences were detected by PCR in 10
cases; six of these carried high-risk HPV, one low-risk
HPV in the Hybrid Capture test. The results are sum-
marised in Table 1.
Figure 1 Type-specific HPV analysis of cervical specimens
using PCR and sequence analysis. Out of 1275 samples, 446
tested positive. All HPV types with a known risk for cervical Discussion
dysplasia and carcinoma (HPV 16, HPV 18, HPV 31, HPV 33,
HPV 35, HPV 39, HPV 45, HPV 51, HPV 52, HPV 56, HPV 58)
A type-specific HPV test that is highly sensitive will be
were found. HPV types marked by an asterisk are included in
the Hybrid Capture test. MS, multiple HPV sequences.
helpful in routine cervical cancer screening (12): The
type-specific differentiation of HPVs is important since
individual HPV types, even among high-risk HPV types,
Table 1 Comparison of HPV testing by cycle sequencing and have different oncogenic potentials (13). A high sensi-
Hybrid Capture analysis. tivity is necessary because women who have normal
smears but repeatedly test positive for high-risk HPVs,
HPV type Sequence Hybrid Capture II assay even with low copy numbers, have been shown to de-
analysis velop low- and high-grade cervical lesions (1, 14); such
High- Low- Negative women may be up to 116 times more likely to develop
risk risk
severe dysplasia and carcinoma in situ and may require
HPV HPV
a closer follow-up (15). In addition, a very sensitive HPV
HPV 6 a 3 – 1 2 test may also have a greater potential for the diagnosis
HPV 16 b 24 17 – 7 of lesions that recur in patients after treatment.
HPV 18 b 1 1 – – The comparison of the widely used Hybrid Capture
HPV 31 b 3 2 – 1 assay and the PCR-based test showed that the latter
HPV 39 b 1 – – 1 technique detects HPVs in cytological specimens with
HPV 52 b 3 3 – – significantly higher sensitivity. Of the samples that
HPV 53 4 – 1 3 tested negative for HPV by hybridisation, 36% carried
HPV 58 b 2 2 – – HPV DNA. PCR-based, type-specific HPV tests have not
HPV 61 1 – – 1
been used in routine diagnosis because the sequence
HPV 66 4 2 – 2
analysis step is both time- and cost-intensive. Using a
HPV 70 1 – – 1
HPV 72 2 1 – 1 3-step PCR protocol we demonstrate that effective
HPV 84 1 – – 1 type-specific HPV testing is possible in a routine labo-
Multiple 10 6 1 3 ratory. This approach required DNA sequencing (step
Negative 40 – – 40 3) for only 26% of the total samples. The majority of
Total 100 34 3 63 HPV-16-positive women, i.e., approximately 30% of all
HPV-positive samples, were detected in the HPV-16-
a HPV type detected by the low-risk HPV Hybrid Capture II specific LightCycler PCR (step 1). All HPV-negative pa-
probe mixture. b HPV type detected by the high-risk HPV Hy- tients could be diagnosed in the universal HPV test
brid Capture II probe mixture. HPV types HPV 11, HPV 35, HPV
(step 2, a nested PCR). Thus, of approximately 45 HPV
42, HPV 43, HPV 44, HPV45, HPV 51, and HPV 56, which are de-
tests performed each week, only 12 required sequenc-
tected by the Hybrid Capture II assay, were not present in the
samples tested. ing of the DNA samples. In cases that did require se-
quencing of PCR products, the time from the arrival of
the sample at the laboratory to transmission of the di-
ing conisation, while one women was positive for agnostic report was at most 1 week.
CP6108 in the second test. A change of the HPV type PCR-based HPV genotyping using consensus
was observed in five patients. primers has been shown to be highly reproducible (16).
For comparison, the first 100 cervical specimens In the present study, when 46 women were tested
were tested in parallel using PCR and the hybridisation twice, 40 of the 46 either carried identical HPV types in
assay. The Hybrid Capture test detected HPV DNA in 37 both samples or were negative for HPV following coni-
cervical samples; 34 HPV-positive samples were classi- sation. Only six patients carried different HPV types.

Brought to you by | Tokyo Daigaku

Authenticated
Download Date | 5/21/15 10:03 AM
790 Kösel et al.: Diagnosis of HPV infections by PCR and sequence analysis
There are three possible explanations for these find-
ings: (i) the second sample may have been free of the
virus type that was initially detected; (ii) the samples
may have been taken from different parts of the cervix;
(iii) PCR amplification may be biased by different am-
plification efficiencies (17).
A limitation of our approach to HPV testing is the
presence of mixed HPV infections, which lead to un-
readable DNA sequences that cannot be assigned to
specific HPV types. In order to eliminate the risk of
missing the most frequent HPV type with a high risk of
cervical carcinoma, i.e., HPV 16, in mixed infections, we
included the HPV-16-specific LightCycler PCR in our
protocol. Different HPV types in mixed infections can
be detected by hybridisation of PCR products to se-
quence-specific probes bound on membranes (line
blot assays) (18). However, line blot assays are cur-
rently very expensive and the number of HPV types
they can detect is limited. In our study, the number of
mixed HPV infections was low (5%). This does not
agree with other studies, which report mixed infections
in up to 22% of HPV-positive samples (19). The nested
PCR may be more selective for certain HPV types pre-
sent in the mixture, either because there is a higher
amount of this virus present or because this virus has
better amplification efficiency. On the other hand, the
number of mixed infections detected by line probe as-
says may be an overestimate caused by non-specific
hybridisation, which is an intrinsic problem of all hy-
bridisation assays. Four out of 37 samples tested HPV-
positive by the Hybrid Capture test, which also uses the
hybridisation technique, may be false positives due to
cross-hybridisation. In these samples, we detected
HPV types that are not included in the Hybrid Capture
probe mixtures (Table 1). Such cross-hybridisations
may be caused by sequence homologies between dif-
ferent HPV types. However, we cannot exclude the pos-
sibility that these patients were infected with two or
more different papillomaviruses and that some of
these may not have been sufficiently amplified by PCR.
All HPV types with a known risk of cervical dysplasia
and carcinoma were found in our study and their fre-
quencies are in line with published data on cervical dys-
plasia and carcinoma (Figure 1) (13, 20 – 22). Although
the majority of cervical carcinomas are associated with
high-risk HPV, rare and new HPV types that are not de-
tected by hybridisation assays like the Hybrid Capture
test, e.g., HPV 53, HPV 66, HPV 73, HPV 82, CP6108, and
CP8304 (Figure 1), are found in severe cervical dyspla-
sia and carcinomas, and could confer risk to infected
women (5, 13, 23, 24). A combination of cytology and
routine HPV screening by sequence analysis will pro-
vide such data and produce a more reliable and effec-
tive cervical cancer screening program in the future.
Acknowledgements
The authors would like to thank Kathrin Appel, Verena Krö-
nauer, Naeem Malik, Edith Schuhmacher, and Massoud Shay-
gan for excellent technical assistance.
Brought to you by | Tokyo Daigaku
Authenticated
Download Date | 5/21/15 10:03 AM
References
1. Nobbenhuis MA, Walboomers JM, Helmerhorst TJ,
Rozendaal L, Remmink AJ, Risse EK, et al. Relation of hu-
man papillomavirus status to cervical lesions and conse-
quences for cervical-cancer screening: a prospective
study. Lancet 1999; 354:20 – 5.
2. Remmink AJ, Walboomers JM, Helmerhorst TJ, Voorhorst
FJ, Rozendaal L, Risse EK, et al. The presence of persistent
high-risk HPV genotypes in dysplastic cervical lesions is
associated with progressive disease: natural history up to
36 months. Int J Cancer 1995; 61:306 – 11.
3. Cuzick J, Beverley E, Ho L, Terry G, Sapper H, Mielzynska I,
et al. HPV testing in primary screening of older women. Br
J Cancer 1999; 81:554 – 8.
4. Manos MM, Kinney WK, Hurley LB, Sherman ME, Shieh-
Ngai J, Kurman RJ, et al. Identifying women with cervical
neoplasia: using human papillomavirus DNA testing for
equivocal Papanicolaou results. J Am Med Assoc 1999;
281:1605 – 10.
5. Meyer T, Arndt R, Christophers E, Beckmann ER, Schroder
S, Gissmann L, et al. Association of rare human papillo-
mavirus types with genital premalignant and malignant le-
sions. J Infect Dis 1998; 178:252 – 5.
6. Nindl I, Zahm DM, Meijer CJ, Walboomers JM, Schneider
A. Human papillomavirus detection in high-grade squa-
mous intraepithelial lesions. Comparison of hybrid cap-
ture assay with a polymerase chain reaction system. Diagn
Microbiol Infect Dis 1995; 23:161 – 4.
7. Wittwer CT, Garling DJ. Rapid cycle DNA amplification:
time and temperature optimization. Biotechniques 1991;
10:76 – 83.
8. Manos MM, Ting Y, Wright DK, Lewis AJ, Broker TR, Wolin-
sky SM. Use of polymerase chain reaction amplification
for the detection of genital human papillomavirus. Cancer
Cells 1989; 7:209 – 14.
9. de Roda Husman AM, Walboomers JM, van den Brule AJ,
Meijer CJ, Snijders PJ. The use of general primers GP5 and
GP6 elongated at their 3’ ends with adjacent highly con-
served sequences improves human papillomavirus detec-
tion by PCR. J Gen Virol 1995; 76:1057 – 62.
10. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic
local alignment search tool. J Mol Biol 1990; 215:403 – 10.
11. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z,
Miller W, et al. Gapped BLAST and PSI-BLAST: a new gen-
eration of protein database search programs. Nucleic
Acids Res 1997; 25:3389 – 402.
12. Cuzick J. Human papillomavirus testing for primary cervi-
cal cancer screening. J Am Med Assoc 2000; 283:108 – 9.
13. Munoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague
X, Shah KV, et al. Epidemiologic classification of human
papillomavirus types associated with cervical cancer. N
Engl J Med 2003; 348:518 – 27.
14. Zielinski GD, Snijders PJ, Rozendaal L, Voorhorst FJ, van
der Linden HC, Runsink AP, et al. HPV presence precedes
abnormal cytology in women developing cervical cancer
and signals false negative smears. Br J Cancer 2001; 85:
398 – 404.
15. Clavel C, Masure M, Bory JP, Putaud I, Mangeonjean C,
Lorenzato M, et al. Hybrid Capture II-based human papillo-
mavirus detection, a sensitive test to detect in routine
high-grade cervical lesions: a preliminary study on 1518
women. Br J Cancer 1999; 80:1306 – 11.
16. Jacobs MV, Snijders PJ, Voorhorst FJ, Dillner J, Forslund
O, Johansson B, et al. Reliable high risk HPV DNA testing
by polymerase chain reaction: an intermethod and intram-
ethod comparison. J Clin Pathol 1999; 52:498 – 503.
 Kösel et al.: Diagnosis of HPV infections by PCR and sequence analysis 791

17. Kado S, Kawamata Y, Shino Y, Kasai T, Kubota K, Iwasaki H,
et al. Detection of human papillomaviruses in cervical neo-
plasias using multiple sets of generic polymerase chain re-
action primers. Gynecol Oncol 2001; 81:47 – 52.
18. Vernon SD, Unger ER, Williams D. Comparison of human
papillomavirus detection and typing by cycle sequencing,
line blotting, and hybrid capture. J Clin Microbiol 2000;
38:651 – 5.
19. van den Brule AJ, Pol R, Fransen-Daalmeijer N, Schouls
LM, Meijer CJ, Snijders PJ. GP5 +/6 + PCR followed by re-
verse line blot analysis enables rapid and high-throughput
identification of human papillomavirus genotypes. J Clin
Microbiol 2002; 40:779 – 87.
20. Bosch FX, Manos MM, Munoz N, Sherman M, Jansen AM,
Peto J, et al. Prevalence of human papillomavirus in cervi-
cal cancer: a worldwide perspective. International biologi-
cal study on cervical cancer (IBSCC) Study Group. J Natl
Cancer Inst 1995; 87:796 – 802.
21. Van Ranst M, Kaplan JB, Burk RD. Phylogenetic classifica-
tion of human papillomaviruses: correlation with clinical
manifestations. J Gen Virol 1992; 73:2653 – 60.
22. Feoli-Fonseca JC, Oligny LL, Brochu P, Simard P, Falconi S,
Yotov WV. Human papillomavirus (HPV) study of 691
pathological specimens from Quebec by PCR-direct se-
quencing approach. J Med Virol 2001; 63:284 – 92.
23. Matsukura T, Sugase M. Relationships between 80 human
papillomavirus genotypes and different grades of cervical
intraepithelial neoplasia: association and causality. Virol-
ogy 2001; 283:139 – 47.
24. Meyer T, Arndt R, Beckmann ER, Padberg B, Christophers
E, Stockfleth E. Distribution of HPV 53, HPV 73 and CP8304
in genital epithelial lesions with different grades of dyspla-
sia. Int J Gynecol Cancer 2001; 11:198 – 204.
Received 5 December 2002, revised 3 March 2003,
accepted 13 March 2003
Corresponding author: Dr. Siegfried Kösel, Labor Becker,
Olgemöller und Kollegen, Führichstrasse 70, 81671 Munich,
Germany
Phone: + 49 89 450 917 460, Fax: + 49 89 450 917 300,
E-mail: koesel@labor-bo.de

Brought to you by | Tokyo Daigaku

Authenticated
Download Date | 5/21/15 10:03 AM