Oncogene (2007) 26, 6386–6395
& 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00
www.nature.com/onc
ORIGINAL ARTICLE
KIT oncoprotein interactions in gastrointestinal stromal tumors:
therapeutic relevance
M-J Zhu1,2, W-B Ou1,2, CDM Fletcher1,2, PS Cohen3, GD Demetri2,4 and JA Fletcher1,2
1
Department of Pathology, Brigham & Women’s Hospital, Boston, MA, USA; 2Departments of Pathology, Pediatrics and Medicine,
Harvard Medical School, Boston, MA, USA; 3Novartis Oncology, Florham Park, NJ, USA and 4Ludwig Center at Dana-Farber
Cancer Institute, Boston, MA, USA
Most gastrointestinal stromal tumors (GISTs) express
oncogenic and constitutively active forms of the KIT or
platelet-derived growth factor receptor alpha (PDGFRA)
receptor tyrosine kinase proteins, and these kinase
oncoproteins serve as targets for effective therapies. Given
that mutant KIT oncoproteins serve crucial transforming
roles in GISTs, we evaluated interactions with the KIT
oncoproteins and determined signaling pathways that
are dependent on KIT oncogenic activation in GISTs.
Tyrosine-phosphorylated KIT oncoproteins interacted with
PDGFRA, PDGFRB, phosphatidylinositol 3-kinase (PI3-K)
and PKCh in GIST cells, and these interactions were
abolished by KIT inhibition with imatinib or PKC412 or
KIT RNAi. Notably, tyrosine-phosphorylated PDGFRA
was prominent in frozen GIST tumors expressing KIT
oncoproteins, suggesting that KIT-mediated PDGFRA
phosphorylation is an efficient and biologically conse-
quential mechanism in GISTs. Activated signaling inter-
mediates were identified by immunoaffinity purification of
tyrosine-phosphorylated proteins in GIST cells before and
after treatment with KIT inhibitors, and these analyses
show that GRB2, SHC, CBL and MAPK activation are
largely KIT dependent in GISTs, whereas PI3-K, STAT1
and STAT3 activation are partially KIT dependent. In
addition, we found that phosphorylation of several
tyrosine kinase proteins – including JAK1 and EPHA4
– did not depend on KIT activation. Likewise, paxillin
activation was independent of the KIT oncogenic signal.
These studies identify signaling pathways that can provide
both KIT-dependent and KIT-independent therapeutic
synergies in GIST, and thereby highlight clinical strate-
gies that might consolidate GIST therapeutic response to
KIT/PDGFRA inhibition.
Oncogene (2007) 26, 6386–6395; doi:10.1038/sj.onc.1210464;
published online 23 April 2007
Keywords: KIT; PDGFRA; kinase; interaction; signal
transduction
Correspondence: Dr M-J Zhu or Dr JA Fletcher, Department of
Pathology, Brigham and Women’s Hospital, 75 Francis Street, Boston,
MA 02115, USA.
E-mails: mzhu2@partners.org or jetcher@partners.org
Received 1 June 2006; revised 23 October 2006; accepted 9 March 2007;
published online 23 April 2007
Introduction
Gastrointestinal stromal tumors (GISTs) are the most
common mesenchymal tumors of the digestive tract.
GIST cells share morphological and immunophenotypic
features – including expression of the KIT receptor
tyrosine kinase (RTK) – with interstitial cells of Cajal
(ICC), which are the pacemaker cells responsible for
coordinating gastrointestinal peristaltic activity (Hein-
rich et al., 2002). Most GISTs (85%) contain gain-of-
function KIT oncogenic mutations, which are associated
with constitutive KIT tyrosine phosphorylation, and
activation of cell proliferation and survival signaling
pathways (Duensing et al., 2004b). Alternately, a small
subset of GISTs has oncogenic mutations in the gene
encoding platelet-derived growth factor receptor alpha
(PDGFRA) that confer constitutive activation (Hein-
rich et al., 2003; Hirota et al., 2003). Although KIT and
PDGFRA oncogenic mutations are mutually exclusive
in GISTs, approximately 30% of KIT-mutant GISTs
express PDGFRA strongly (Heinrich et al., 2003).
Notably, the oncogenic KIT and PDGFRA mutations
can be targeted effectively with imatinib mesylate
(Gleevec) in GIST cell culture models and in more than
80% of GIST patients (Tuveson et al., 2001; Demetri
et al., 2002; Verweij et al., 2004).
KIT is a member of the PDGFR subfamily of RTK
proteins, which feature extracellular Ig domains and a
split kinase domain (Heinrich et al., 2002). KIT under-
goes homodimerization and autophosphorylation when
bound by the ligand, stem cell factor, or when activated
by oncogenic mutations (Hirota et al., 1998; Rubin
et al., 2001). In addition, KIT can heterodimerize with
the PDGFR family members FLT3 (Otto et al., 2001)
and PDGFRA (Hirota et al., 2003), and presumably
with other RTKs. Therefore, the clinical success of KIT
inhibitors in patients with GIST might result from
inactivation of KIT downstream signaling pathways and
KIT heterodimerization partners.
Although most GIST patients have dramatic thera-
peutic responses to imatinib, some patients are resistant
to imatinib, and very few patients exhibit a complete
response to this drug (Demetri et al., 2002). The aim of
the studies reported herein was to evaluate cell signaling
pathways transmitting proliferation and survival signals
from KIT, and to determine which signaling intermedi-

ates are dependent on KIT activation in GIST. These
studies, performed in human GIST cell lines before and
after treatment with KIT inhibitors, interrogated
signaling proteins that play key roles in tyrosine
kinase-mediated cell proliferation, survival and adhe-
sion. Mechanisms of oncogenic signaling pathway
activation were evaluated further by determining KIT
interactions with various kinase and adaptor proteins.
These studies show that certain signaling intermediates
are largely KIT dependent in GISTs, whereas others are
not. These insights will be helpful in designing rational
combination-targeted therapy strategies in GIST.
Results
KIT oncoprotein interactions in GIST
M-J Zhu et al
6387
structurally similar RTKs, the possibility of a spurious
coimmunoprecipitation, resulting from direct binding
of KIT by the PDGFRA antiserum, was evaluated. This
possibility was excluded using a KIT-mutant GIST
that expressed KIT strongly but lacked PDGFRA
expression: KIT was not detected in the PDGFRA
immunoprecipitations from this GIST (data not shown).
ABL was not demonstrably phosphorylated, and was
not complexed with KIT, in GIST3 or GIST4 (Figure 1).
In sum, these findings demonstrate interactions between
KIT, PDGFRA and PI3-K p85, and suggest that
ABL – despite the precedent for interaction with KIT
in human leukemias (Hallek et al., 1996) – neither
complexes substantially with KIT nor is demonstrably
activated in GIST.

KIT interactions in primary GISTs
Kinase protein interactions with oncogenic KIT were
evaluated in two untreated GIST specimens with hetero-
zygous KIT exon 11 (GIST3) or exon 9 (GIST4) mutations
(Figure 1). GIST3 and GIST4 lacked PDGFRA gene
mutations (data not shown), but expressed phosphorylated
PDGFRA in addition to constitutively phosphorylated
KIT (Figure 1). Phosphatidylinositol 3-kinase (PI3-K)
p85 immunoprecipitates revealed a dominant 170/
160 kD tyrosine-phosphorylated doublet in both GISTs
(Figure 1), consistent in size with the transmembrane
forms of PDGFRA (170 kD) and KIT (160 kD). PI3-K
p85 interactions with KIT and PDGFRA were
confirmed by immunostaining (Figure 1). These findings
suggest that KIT and PDGFRA were the predominant
activated RTKs in GIST3 and GIST4. In addition,
interaction between PDGFRA and the mature form of
KIT was evident in the PDGFRA immunoprecipita-
tions (Figure 1). Because KIT and PDGFRA are
Kinase expression varies in GIST cell lines
Variability of key kinase expression was evaluated by
immunoblotting in the GIST882, GIST48 and GIST430
cell lines. KIT, PI3-K p85 and PKCy were expressed at
similar levels in each of these lines, whereas PDGFRA,
PDGFRB and ABL expression varied considerably,
being strongest in GIST882, GIST48 and GIST430,
respectively (Figure 2).
Kinase interactions in imatinib-sensitive and imatinib-
resistant GIST cell lines
Kinase activation and interactions were evaluated in the
GIST882 and GIST48 cell lines. Kinase interactions in
these cell lines were evaluated before and after
pharmacologic inhibition of KIT/PDGFR by imatinib
in GIST882 (Figure 3) and PKC412 in the imatinib-
resistant GIST48 (Figure 4). Wild-type PDGFRA and
PDGFRB were phosphorylated and coprecipitated with
oncogenic KIT (Figures 3a and 4a), suggesting that

Figure 1 KIT-dependent kinase interactions in primary, frozen, GISTs. Internal standards are frozen GISTs, GIST1 (KIT mutant)
and GIST2 (PDGFRA mutant), which express high levels of KIT and PDGFRA, respectively. GIST3 (a) and GIST4 (b) each contain
KIT mutations: the first three lanes in each panel are total cell lysates, whereas the remaining four lanes are immunoprecipitates of KIT
(Santa Cruz, sc-168), PDGFRA (Santa Cruz, sc-338), ABL (Santa Cruz, sc-131) and PI3-K p85 (Upstate, Lake Placid, NY, USA, 06-
497), evaluating kinase activation and interactions. The PY99 immunostain shows KIT and PDGFRA activation, and suggests that
activated KIT and PDGFRA are complexed with PI3-K p85. KIT complexing with PDGFRA and PI3-K p85 is confirmed by the KIT
immunostains of PDGFRA and PI3-K p85 immunoprecipitates, respectively. PI3-K p85 complexing with KIT and PDGFRA, but not
ABL, is also shown by the PI3-K immunostains of KIT, PDGFRA and ABL immunoprecipitates, respectively.

Oncogene
 KIT oncoprotein interactions in GIST
M-J Zhu et al
6388
Figure 2 Kinase expression in GIST cell lines with KIT oncogenic
mutations. KIT, PI3-K p85 and PKCy were expressed at similar
levels in each of these lines, whereas PDGFRA, PDGFRB and
ABL expression varied considerably, being strongest in GIST882,
GIST48 and GIST430, respectively.
PDGFRs heterodimerize with, and are cross-phos-
phorylated by, the constitutively activated KIT mutants
in GIST882 and GIST48. KIT inactivation inhibited the
complexing between KIT and PDGFR (Figures 3b and
4b). PI3-K p85 and p110a, and PKCy also complexed
with oncogenic KIT, as shown best in the KIT and
PKCy immunoprecipitates, respectively, and as for
PDGFR, these interactions were partially inhibited by
imatinib (Figures 3 and 4). Likewise, PI3-K p85
interactions with PKCy were inhibited by imatinib
(Figures 3b and 4b). The interaction between KIT and
PKCy appeared to be relatively weak, being most
convincing in the GIST882 cells. Interestingly, ABL
phosphorylation and interactions between KIT and
ABL were not detectable in either GIST882 or GIST48
(Figures 3 and 4).
KIT-dependent signaling in GIST cell lines
Expression of activated signaling intermediates was
evaluated by immunoblotting in phosphotyrosine
immunopurifications from confluent GIST882 and
GIST48 cell lines. The rationale for evaluating signaling
intermediates in confluent cells was to highlight activa-
tion events that might be strictly dependent on the KIT
oncogenic signal, irrespective of whether the cells were
actively proliferating. KIT dependence was determined
by comparing expression of each protein before and
after KIT/PDGFR inhibition by imatinib (in GIST882
cells) and PKC412 (in GIST48 cells). Phosphorylation
Oncogene
patterns differed between GIST882 and GIST48, as can
be seen by comparing protein expression ratios in the
input (total protein) and phosphotyrosine eluate (acti-
vated protein) lanes (Figure 5). For example, GRB2,
FAK and PDGFRA were more strongly phosphory-
lated – on a per molecule basis – in GIST882 than in
GIST48 (Figure 5). However, KIT, PI3-K p85, PI3-K
p110a and SHC were strongly tyrosine phosphorylated
in both cell lines (Figure 5). In addition, there were
substantial similarities between GIST882 and GIST48
with respect to which of the protein activation events
were KIT/PDGFR dependent. PI3-K p85, PI3-K p110a,
GRB2 and SHC tyrosine phosphorylation were sub-
stantially KIT/PDGFR dependent in both cell lines,
whereas SRC-family kinases and FAK were minimally
KIT/PDGFR dependent in GIST882, and KIT/
PDGFR independent in GIST48 (Figure 5). Weak,
partially KIT dependent, tyrosine phosphorylation was
demonstrated for STAT1 (GIST48 only), STAT3,
JAK2, ABL (GIST48 only), MAPK (GIST882 only),
PKCy, CBL (GIST882 only) and HSP90. Weak, KIT
independent, tyrosine phosphorylation was demon-
strated for EPHA4, JAK1 and paxillin. However, the
SRC-family kinase data do not exclude the possibility
of functional alterations, in that shifts from SFK
c-terminal inhibitory tyrosine phosphorylation to inter-
nal activating tyrosine phosphorylation can occur with-
out substantially changing the net phosphorylation
levels. The weakly activated wild-type PDGFRB in
GIST48 was inhibited by PKC412, and the strongly
activated PDGFRA in GIST882 was inhibited by
imatinib (Figure 5). These findings are in keeping with
the immunoprecipitation studies (Figure 3), and suggest
that PKC412 or imatinib-mediated PDGFR inhibition
results both from direct effects and inactivation of
heterodimerized KIT oncoproteins. It is particularly
notable that PKCy tyrosine phosphorylation was inhibi-
ted by imatinib (GIST882) and PKC412 (GIST48),
which is in keeping with KIT-dependent activation
of this characteristic GIST kinase (Duensing et al.,
2004a).
Density-dependent effects on signaling protein activation
The density (% confluence) of cancer cell lines, when
grown as monolayers in vitro, has been shown to impact
phosphorylation of STATs and other signaling proteins
(Vultur et al., 2004). In order to determine whether
GIST cell density impacts KIT-dependent signaling, we
compared phosphoprotein expression, with and without
KIT inhibitor treatment, in 100% confluent (‘confluent’)
vs 75% confluent (‘subconfluent’) GIST48 cells. These
studies were performed in phosphotyrosine immunoaf-
finity-purified fractions from the GIST cells, and showed
that PI3-K p85, FAK and paxillin phosphorylation were
substantially increased in 75% confluent cells, compared
to 100% confluent cells (Figure 6a and b). Indeed, FAK
phosphorylation was tenfold higher in the 75% con-
fluent cells than in 100% confluent cells (Figure 6b). The
FAK cell density effects were independent of KIT
activation, in that FAK remained strongly phosphorylated
 KIT oncoprotein interactions in GIST
M-J Zhu et al
6389

Figure 3 Kinase activation and interactions in untreated (a) and imatinib-treated (b) GIST882 cells. Lanes 1 and 2 contain GIST882
total cell lysates, with and without imatinib treatment, respectively. Lanes 3–10 contain GIST882 lysates immunoprecipitated with
normal rabbit serum (lane 3) or antibodies to KIT (Santa Cruz, sc-168; lane 4), PDGFRA (Santa Cruz, sc-338; lane 5), ABL (Santa
Cruz, sc-131; lane 6), PI3-K p85 (Upstate, 06-497; lane 7), PDGFRB (Santa Cruz, sc-432; lane 8), PKCy (Santa Cruz, sc-1875; lane 9)
and PI3-K p110a (Cell Signaling #4254; lane 10). The PY99 and KIT immunostains show activation-dependent complexing of KIT
with PDGFRA, PDGFRB, PKCy and PI3-K. Complexing between PI3-K p85 and p110a, as expected, is not KIT dependent.

in subconfluent GIST48 after PKC412 treatment. By
contrast, the accentuated PI3-K p85 and paxillin
phosphorylation in 75% confluent GIST48 was KIT
dependent, as shown after PKC412-mediated KIT
inactivation, which reduced the phosphoprotein expres-
sion to levels found in the 100% confluent GIST48
(Figure 6a and b). These studies were corroborated, in
total cell lysates of GIST48 at four different cell
densities, showing stronger FAK Y397 and paxillin
Y118 phosphorylation at lower cell density (Figure 6c).
CBL and PKCy were also more strongly phosphory-
lated – and in a KIT-dependent manner – at 75%
confluence, whereas PI3-K p110a and JAK1 were more
strongly phosphorylated in 100% confluent cells (Figure
6a and b). STAT, JAK2 and HSP90 tyrosine phosphory-
lation were unaffected by GIST48 cell density (Figure 6a
and b).
Preferential interactions with the mature form of KIT
Interactions with the two major KIT forms (migrating,
in relationship to the molecular size markers in this
study, at 160 and 145 kD, but also described tradition-
ally as migrating at 145 and 125 kD) were evaluated in
immunoprecipitations with KIT antibody recognizing
only the smaller, immature, cytoplasmic, KIT form
(KIT N-terminal polyclonal rabbit antibody, Santa
Cruz, Santa Cruz, CA, USA, sc-5535) or both KIT
forms (mouse monoclonal antibody, Santa Cruz, sc-
13508). These studies show that PDGFRA, PI3-K and
GRB2 complex preferentially with mature KIT (Figure 7).
Interestingly, both immature and mature KIT coimmu-
noprecipitated with PI3-K and PKCy, whereas only the
mature forms of KIT and PDGFRA coimmunoprecipi-
tated (Figures 1, 3a and 7). These findings suggest that
the cytoplasmic PI3-K and PKCy proteins might
modulate all forms of KIT signaling, whereas PDGFRA
primarily modulates mature KIT signaling.
KIT RNAi corroboration of small molecule KIT-inhibitor
assays
Because imatinib and PKC412 are multikinase inhibi-
tors, and therefore not specific for KIT, we used KIT
RNAi methods to confirm key findings from the studies
(described above) on KIT-dependent GIST cell signal-
ing mechanisms. KIT knockdown was accomplished by
infecting GIST882 cells with lentiviral shRNA vectors,
and corroborated that PI3-K p85 and CBL activa-
tion were KIT dependent (Figure 8a). KIT-mediated
Oncogene
 KIT oncoprotein interactions in GIST
M-J Zhu et al
6390

Figure 4 Kinase activation and interactions in untreated (a) and PKC412-treated (b) GIST48 cells. Lanes 1 and 2 contain GIST48
total cell lysates, with and without PKC412 treatment, respectively. Lanes 3–10 contain GIST48 lysates immunoprecipitated with
normal rabbit serum (lane 3) or antibodies to KIT (Santa Cruz, sc-168; lane 4), PDGFRA (Santa Cruz, sc-338; lane 5), ABL (Santa
Cruz, sc-131; lane 6), PI3-K p85 (Upstate, 06-497; lane 7), PDGFRB (Santa Cruz, sc-432; lane 8), PKCy (Santa Cruz, sc-1875; lane 9)
and PI3-K p110a (Cell Signaling, Danvers, MA, USA, #4254; lane 10). The PY99 and KIT immunostains show activation-dependent
complexing of KIT with PKCy and PI3-K. Complexing between PI3-K p85 and p110a, as expected, is not KIT dependent.

activation of PDGFRA was evaluated by PDGFRA
immunostaining of anti-phosphotyrosine immunopreci-
pitates (Figure 8a) and by phosphotyrosine immunos-
taining of PDGFRA immunoprecipitates (Figure 8b),
and both of these studies showed decreased PDGFRA
activation after shRNA KIT knockdown. Thus, these
findings are consistent with oncogenic KIT-mediated
PDGFRA cross-activation in GIST cells.
Discussion
KIT and PDGFRA mutational activation events are
mutually exclusive in GISTs, but these alternate
oncogenic tyrosine kinase mechanisms have similar
biologic and transforming consequences (Heinrich
et al., 2003). Although KIT expression is a diagnostic
hallmark of the majority of GIST cells, the small subset
of GISTs with PDGFRA oncoproteins feature uncha-
racteristically low – and even undetectable – KIT
expression (Heinrich et al., 2003; Medeiros et al.,
2004). On the other hand, approximately 30% of KIT-
mutant GISTs express wild-type PDGFRA at high
Oncogene
levels, comparable to those in PDGFRA-mutant GISTs
(Heinrich et al., 2003). Previous studies demonstrate
that PDGFRA oncoproteins expressed by transfected
PDGFRA mutants in vitro can bind with and cross-
activate wild-type KIT (Hirota et al., 2003). Herein, we
demonstrate interactions and evidence for cross-activa-
tion between oncogenic KIT and wild-type PDGFRA
proteins in human GIST tissues. Complexing between
KIT and PDGFRA was shown in frozen samples of
primary human GISTs as well as in the GIST882
cell line (Figures 1 and 3). The KIT and PDGFRA
complexes were dependent on activation of the KIT
oncoproteins, as evidenced by disruption of the com-
plexes after GIST882 exposure to imatinib (Figure 3). In
addition, the studies in frozen primary GISTs shed light
on the nature of KIT oncogenic signaling complexes in
untreated GISTs, and reveal that another known
imatinib target – PDGFRA – complexes with and is
likely coactivated by KIT oncoproteins in GIST. These
findings were confirmed by KIT RNAi knockdown
assays, in which KIT shRNA-mediated inhibition
resulted in decreased PDGFRA activation (Figure 8),
underscoring that PDGFRA cross-activation can be
mediated by KIT oncoproteins in GISTs. These studies
 KIT oncoprotein interactions in GIST
M-J Zhu et al
6391

Figure 5 (a–d) KIT/PDGFR-dependent activation of kinase signaling proteins in GIST882 (with and without KIT/PDGFR
inhibition by imatinib) and GIST48 (with and without KIT/PDGFR inhibition by PKC412). Total cell lysates (lanes 1 and 4 in each
blot) and tyrosine-phosphorylated proteins immunoaffinity purified from the cell lysates (lanes 2 and 3 in each blot) were
immunostained with antibodies (specified in Materials and methods) to evaluate KIT-dependent activation of various signaling
proteins. KIT activation (large arrows in PY99 stains) was substantially suppressed after inhibitor treatment in both cell lines, as was
PDGFR activation. Treatment-mediated KIT/PDGFR inhibition was accompanied by dephosphorylation of PI3-K p85, PI3-K
p110a, GRB2, SHC, PKCy, STATs, MAPK, CBL and HSP90.

show how the KIT oncogenic signal can be amplified to
involve other RTKs in GIST, and suggest that imatinib
therapeutic efficacy might be based, in part, on
inhibition of both the KIT oncoprotein and hetero-
dimerization (PDGFRA) partners.
Interestingly, the interactions between KIT and
PDGFRA involved predominantly the mature, trans-
membrane forms of these kinases (Figures 1 and 7).
Therefore, KIT:PDGFRA interactions, in GIST, likely
result from heterodimerization – or other complexing –
at the cell surface, with resultant activation of canonical
RTK signaling cascades. The GIST882 kinase interaction
studies, performed in confluent cultures, demonstrate
KIT:PDGFRA interactions under basal unstimulated
conditions in GIST. Similarly, our studies revealed weak
associations between KIT and PDGFRB in GIST
(Figures 3 and 4). However, our studies do not show
interactions between ABL and KIT, and nor was ABL
demonstrably activated in the GIST frozen tumors and
cell lines (Figures 1, 3 and 5). These findings suggest that
ABL, although a classical imatinib target and
a KIT-interacting protein in hematological models
(Hallek et al., 1996), does not modulate or enhance
the KIT oncogenic signal in GISTs.
PI3-K pathways play crucial roles in transmitting
survival and proliferation signals from various RTK
oncoproteins (Herbst et al., 1995; Sordella et al., 2004).
In addition, multiprotein complexes involving KIT,
PI3-K and PDGFRB have been demonstrated after
transfection of KIT and PDGFRB constructs in 293
Oncogene
 KIT oncoprotein interactions in GIST
M-J Zhu et al
6392

Figure 6 (a–c) Cell density effects on KIT/PDGFR-dependent activation of kinase signaling proteins in GIST48, with and without
KIT/PDGFR inhibition by PKC412. As in Figure 5, total cell lysates (lanes 1 and 4 in a and b) and immunoaffinity-purified tyrosine-
phosphorylated proteins (lanes 2 and 3 in a and b) were immunostained to evaluate KIT-dependent activation of various signaling
proteins. Tyrosine phosphorylation was evaluated in cells harvested from 100% confluent (images from Figure 5) vs 75% confluent
cultures (a and b). PI3-K p85, FAK and Paxillin were more strongly phosphorylated in 75% confluent cultures, PI3-K p110a and
JAK1 were more strongly phosphorylated in 100% confluent cultures. In the 75% confluent cultures, the accentuated phosphorylation
of PI3-K p85 and paxillin, but not FAK, is KIT dependent. STAT, JAK2 and HSP90 phosphorylation were unaffected by culture
confluence. Increased FAK and paxillin phosphorylation, in subconfluent cultures, was confirmed in GIST48 total cell lysates
immunostained with antibodies to phospho-FAK and phospho-paxillin (c). These studies showed that FAK and paxillin tyrosine
phosphorylation were reduced in 100% confluent cultures, compared to the subconfluent cultures.

cells (Herbst et al., 1995). In the present studies, the p85
regulatory and p110 catalytic PI3-K subunits were
constitutively associated with activated KIT and PDG-
FRA in GIST frozen tumors and cell lines (Figures 1, 3
and 7). These associations were largely abrogated after
KIT inhibition by imatinib or PKC412 (Figures 3b and
4b). PI3-K activation was partially KIT dependent
(Figures 5 and 6) and was regulated by cell density
(Figure 6).
To characterize KIT/PDGFR-dependent signaling
pathways in GISTs, we used an efficient phosphoty-
rosine eluate approach combining phosphotyrosine
affinity purification with KIT kinase inhibition in cell
lines GIST882 and GIST48. This approach enabled
efficient immunoblot evaluations of KIT/PDGFR-
dependent tyrosine phosphorylation in a panel of
signaling intermediates, in a single immunoblotting
experiment. KIT was inhibited by imatinib treatment
in GIST882, and by PKC412 treatment in the imatinib-
resistant GIST48 cell line. The staurosporine derivative
PKC412 was originally identified as an inhibitor of
Oncogene
protein kinase C (PKC) and subsequently shown to
inhibit other kinases including VEGFR2, PDGFR and
KIT (Fabbro et al., 2000), with activity in some
imatinib-resistant GIST mutations (Debiec-Rychter
et al., 2005). The phosphotyrosine eluate studies
confirmed the immunoprecipitation assays (Figures 1
and 3), showing imatinib/PKC412 inhibition of KIT,
PDGFRA and PI3-K (Figure 5). Comparisons between
total cell lysates and phosphotyrosine purifications
(Figure 5) showed that KIT, PI3-K (regulatory and
catalytic subunits), SHC and GRB2 were strongly
tyrosine phosphorylated in a KIT-dependent manner
in both GIST882 and GIST48 cell lines. These findings
are consistent with KIT oncogenic activation of the
RAS/RAF/MAPK and PI3-K/AKT pathways, which
are regulated by activation of GRB2/SHC and PI3-K,
respectively (Tauchi et al., 1994; Blume-Jensen et al.,
1998). Recruitment of GRB2 and SHC adaptor proteins
to RTK-derived oncogenes has been shown to be
sufficient for morphological cell transformation and
experimental metastases (Saucier et al., 2002), whereas

PI3-K appears to play a particularly crucial role in
tyrosine kinase oncoprotein signaling (Sordella et al.,
2004). Therefore, our findings suggest that PI3-K,
Figure 7 PDGFRA, PI3-K p85 and GRB2 interactions with
mature vs immature KIT oncoproteins. GIST882 lysates were
immunoprecipitated with antibodies recognizing immature KIT
only (Santa Cruz, sc-5535) vs both immature and mature KIT
(Santa Cruz, sc-13508). The immunostains show that PDGFRA,
PI3-K p85 and GRB2 interact predominantly with the mature KIT
oncoprotein.
KIT oncoprotein interactions in GIST
M-J Zhu et al
6393
GRB2 and SHC might serve as alternate therapeutic
targets, whose inhibition could be beneficial in GIST
patients resistant to imatinib.
Our present studies corroborate previous reports that
STAT activation, in GISTs, is relatively weak and only
partially dependent on the activated KIT oncoprotein
(Duensing et al., 2004b). This situation differs from
the KIT kinase-domain mutants in mast cell disease,
where STAT is activated strongly and crucial to KIT
transforming activity (Ning et al., 2001). In addition,
whereas STAT activation is regulated by cell density in a
carcinoma model (Vultur et al., 2004), being more
strongly activated in subconfluent cultures than in
confluent cultures, we did not observe marked increase
in STAT activation in subconfluent GIST cultures.
The involvement of cell adhesion proteins has not
been evaluated previously in GISTs, and our studies
show that the FAK and paxillin adhesion-related
proteins are activated in a cell density-dependent
manner. That is, activation of both FAK and paxillin
activation was strongest in subconfluent, actively pro-
liferating, cultures. FAK activation was KIT indepen-
dent in both confluent and subconfluent cultures
(Figures 5 and 6), whereas paxillin activation was KIT
independent in confluent cultures and partially KIT
dependent in subconfluent cultures. These findings
suggest that imatinib impact on adhesion proteins, in
clinical GISTs, might vary in different parts of the same
tumor, depending on the local architecture and cell
density. Notably, the KIT-independent nature of FAK
activation, in these GIST models, suggests that FAK
therapeutic inhibition might provide clinical synergies
for KIT inhibition by imatinib.
The novel PKC family member, PKCy, is an
intriguing biomarker in GIST, given its narrow range
of expression in normal cells, and preliminary evidence

Figure 8 Kinase activation in GIST882 cells after infection with lentiviral empty vector (lanes 1 and 3) vs KIT shRNA (lanes 2 and 4).
In each panel, lanes 1 and 2 are total cell lysates, whereas lanes 3 and 4 are immunoprecipitates evaluating kinase activation.
Immunostains of the PY99 (Santa Cruz, sc-7020) immunoprecipitates (a) showed that KIT shRNA infections reduced the expression
of total and phospho-KIT to 50% of control levels, resulting in 35, 51 and 52% reductions in tyrosine-phosphorylated PI3-K p85, CBL
and PDGFRA, respectively. Protein expression quantitation was performed using a FUJI LAS1000 þ digital capture system.
Similarly, phosphotyrosine immunostaining of PDGFRA immunoprecipitates (b) demonstrated 60% reduction in PDGFRA
phosphorylation, after KIT shRNA knockdown.

Oncogene
 KIT oncoprotein interactions in GIST
M-J Zhu et al
6394
for a positive regulatory role in KIT oncogenic signaling
in GIST (Duensing et al., 2004a). We show, for the first
time, that PKCy associates with KIT oncoproteins in
GIST cell lines (Figure 3), and is tyrosine phosphory-
lated in a KIT-dependent manner, particularly in
subconfluent cells (Figures 5 and 6). Strong PKCy
expression has been reported – in adult tissues – only in
T cells and ICC, and in the leukemias and GISTs that
derive, respectively, from these cell lineages. Therefore,
it is possible that PKCy inhibition might be a minimally
toxic and highly effective therapy for GIST. Our
preliminary studies with PKCy inactivation or RNAi
knockdown (Hubert, Ou and Fletcher, unpublished) do
indeed suggest that PKCy expression and activation are
crucial to GIST cell survival and proliferation.
Materials and methods
Reagents
Antibodies for immunoprecipitation and immunoblotting are
described in the Supplementary methods.
Tissue specimens and cell lines
GIST tissue specimens and cell lines are described in the
Supplementary methods.
Functional studies
Biochemical correlates for KIT inhibition were evaluated in
GIST882 and GIST48 cells after incubation for 4 h in serum-
free media with 2 mM imatinib and 1 mM PKC412 (provided by
Novartis Pharma, Basel, Switzerland), respectively.
KIT shRNA studies
A KIT lentiviral shRNA (short hairpin RNA) was obtained
from Dr William Hahn (Dana-Farber Cancer Institute and
Broad Institute RNAi consortium). This shRNA was as-
sembled by ligating KIT forward [50 -CCGGCCATAAGGTTT
CGTTTCTGTACTCGAGTACAGAAACGAAACCTTATGG
TTTTTG-30 ] and reverse [50 -AATTCAAAAACCATAAGGTTT
CGTTTCTGTACTCGAGTACAGAAACGAAACCTTATGG
-30 ] oligomers into the AgeI and EcoRI sites of a pLKO.1puro
lentiviral vector. Lentivirus was produced by cotransfecting
pLKO.1puro empty vector or pLKO.1puro-KIT (shRNA),
References
Blume-Jensen P, Janknecht R, Hunter T. (1998). The kit
receptor promotes cell survival via activation of PI 3-kinase
and subsequent Akt-mediated phosphorylation of Bad on
Ser136. Curr Biol 8: 779–782.
Debiec-Rychter M, Cools J, Dumez H, Sciot R, Stul M,
Mentens N et al. (2005). Mechanisms of resistance to
imatinib mesylate in gastrointestinal stromal tumors and
activity of the PKC412 inhibitor against imatinib-resistant
mutants. Gastroenterology 128: 270–279.
Demetri GD, von Mehren M, Blanke CD, Van den Abbeele
AD, Eisenberg B, Roberts PJ et al. (2002). Efficacy and
safety of imatinib mesylate in advanced gastrointestinal
stromal tumors. N Engl J Med 347: 472–480.
Duensing A, Joseph NE, Medeiros F, Smith F, Hornick JL,
Heinrich MC et al. (2004a). Protein Kinase C theta
(PKCtheta) expression and constitutive activation in
Oncogene
pCMVDR8.91 and pMD.G helper virus packaging plasmids
(at a 10:10:1 ratio) into 293T cells. These transfections were
performed using lipofectamine and PLUS reagent, and
lentivirus supernatants were harvested at 24, 36, 48 and 60 h.
Viral titers were determined in GIST882 cells, according to a
protocol from Invitrogen (Carlsbad, CA, USA). GIST882 cells
were infected, in the presence of 8 mg/ml of polybrene, and
were then lysed for immunoprecipitation and western blot
analysis after 20 days of selection with 2.5 mg/ml puromycin.
Immunoprecipitation and western blot analysis
Immunoprecipitation and immunoblotting methods were
essentially as described, and are detailed in the Supplementary
methods. The chemiluminescence signals were captured and
quantified using a FUJI LAS1000plus system with Science Lab
2001 ImageGauge 4.0 software (Fujifilm Medical Systems,
Stamford, CT, USA).
Phosphotyrosine affinity purification
The phosphotyrosine fraction was isolated from GIST cells
using a minicolumn loaded with 1 ml of anti-phosphotyrosine-
sepharose beads (Zymed, South San Francisco, CA, USA).
The anti-phosphotyrosine affinity columns were first washed
ten times with phosphate-buffered saline containing 0.02%
sodium azide followed by ten washes with cell lysis buffer. The
columns were then incubated at 41C overnight with 10 mg of
GIST protein lysate, washed seven times with lysis buffer, and
the bound tyrosine-phosphorylated proteins were then eluted
by loading the column ten times with 1 ml of 100 mM
phenylphosphate. The phosphotyrosine protein eluates were
dialysed to remove the phenylphosphate, then evaluated by
immunoblotting, using 10% of the eluates per gel lane.
Acknowledgements
We thank Yongchun Zhou for critical review of the article and
valuable discussions, Chang-Jie Chen, Anette Duensing and
Maureen Thyne for useful discussions and technical assistance.
This work was supported by grants from an anonymous
donor, the Life Raft Group, Cesarini Team for the Pan-
Massachusetts Challenge, the Virginia and Daniel K Ludwig
Trust for Cancer Research, the Ronald O Perelman Fund for
Cancer Research, the Stutman GIST Cancer Research Fund,
the Rubenstein Foundation and Leslie’s Links.
gastrointestinal stromal tumors (GISTs). Cancer Res 64:
5127–5131.
Duensing A, Medeiros F, McConarty B, Joseph NE,
Panigrahy D, Singer S et al. (2004b). Mechanisms of
oncogenic KIT signal transduction in primary gastrointes-
tinal stromal tumors (GISTs). Oncogene 23: 3999–4006.
Fabbro D, Ruetz S, Bodis S, Pruschy M, Csermak K, Man A
et al. (2000). PKC412 – a protein kinase inhibitor with a
broad therapeutic potential. Anticancer Drug Des 15: 17–28.
Hallek M, nhauser-Riedl S, Herbst R, Warmuth M, Winkler
A, Kolb HJ et al. (1996). Interaction of the receptor tyrosine
kinase p145c-kit with the p210bcr/abl kinase in myeloid
cells. Br J Haematol 94: 5–16.
Heinrich MC, Corless CL, Duensing A, McGreevey L, Chen CJ,
Joseph N et al. (2003). PDGFRA activating mutations
in gastrointestinal stromal tumors. Science 299: 708–710.

Heinrich MC, Rubin BP, Longley BJ, Fletcher JA. (2002).
Biology and genetic aspects of gastrointestinal stromal
tumors: KIT activation and cytogenetic alterations. Hum
Pathol 33: 484–495.
Herbst R, Shearman MS, Jallal B, Schlessinger J, Ullrich A.
(1995). Formation of signal transfer complexes between stem
cell and platelet-derived growth factor receptors and SH2
domain proteins in vitro. Biochemistry 34: 5971–5979.
Hirota S, Isozaki K, Moriyama Y, Hashimoto K, Nishida T,
Ishiguro S et al. (1998). Gain-of-function mutations of c-kit in
human gastrointestinal stromal tumors. Science 279: 577–580.
Hirota S, Ohashi A, Nishida T, Isozaki K, Kinoshita K,
Shinomura Y et al. (2003). Gain-of-function mutations of
platelet-derived growth factor receptor alpha gene in gastro-
intestinal stromal tumors. Gastroenterology 125: 660–667.
Medeiros F, Corless CL, Duensing A, Hornick JL, Oliveira
AM, Heinrich MC et al. (2004). KIT-negative gastrointest-
inal stromal tumors: proof of concept and therapeutic
implications. Am J Surg Pathol 28: 889–894.
Ning ZQ, Li J, Arceci RJ. (2001). Signal transducer and
activator of transcription 3 activation is required for
Asp(816) mutant c-Kit-mediated cytokine-independent sur-
vival and proliferation in human leukemia cells. Blood 97:
3559–3567.
Otto KG, Jin L, Spencer DM, Blau CA. (2001). Cell
proliferation through forced engagement of c-Kit and
Flt-3. Blood 97: 3662–3664.
Supplementary Information accompanies the paper on the Oncogene website (http://www.nature.com/onc).
KIT oncoprotein interactions in GIST
M-J Zhu et al
6395
Rubin BP, Singer S, Tsao C, Duensing A, Lux ML, Ruiz R
et al. (2001). KIT activation is a ubiquitous feature of
gastrointestinal stromal tumors. Cancer Res 61: 8118–8121.
Saucier C, Papavasiliou V, Palazzo A, Naujokas MA, Kremer
R, Park M. (2002). Use of signal specific receptor tyrosine
kinase oncoproteins reveals that pathways downstream from
Grb2 or Shc are sufficient for cell transformation and
metastasis. Oncogene 21: 1800–1811.
Sordella R, Bell DW, Haber DA, Settleman J. (2004).
Gefitinib-sensitizing EGFR mutations in lung cancer acti-
vate anti-apoptotic pathways. Science 305: 1163–1167.
Tauchi T, Feng GS, Marshall MS, Shen R, Mantel C, Pawson
T et al. (1994). The ubiquitously expressed Syp phosphatase
interacts with c-kit and Grb2 in hematopoietic cells. J Biol
Chem 269: 25206–25211.
Tuveson DA, Willis NA, Jacks T, Griffin JD, Singer S,
Fletcher CD et al. (2001). STI571 inactivation of the
gastrointestinal stromal tumor c-KIT oncoprotein: biologi-
cal and clinical implications. Oncogene 20: 5054–5058.
Verweij J, Casali PG, Zalcberg J, LeCesne A, Reichardt P,
Blay JY et al. (2004). Progression-free survival in gastro-
intestinal stromal tumours with high-dose imatinib: rando-
mised trial. Lancet 364: 1127–1134.
Vultur A, Cao J, Arulanandam R, Turkson J, Jove R,
Greer P et al. (2004). Cell-to-cell adhesion modulates Stat3
activity in normal and breast carcinoma cells. Oncogene 23:
2600–2616.
Oncogene