Physiological and Molecular Plant Pathology 109 (2020) 101454

Contents lists available at ScienceDirect

Physiological and Molecular Plant Pathology

journal homepage: www.elsevier.com/locate/pmpp

Investigating the effect of methyl jasmonate on the biocontrol activity of T

Meyerozyma guilliermondii against blue mold decay of apples and the possible
mechanisms involved
Fangtao Hea, Lina Zhaob, Xiangfeng Zhengc, Mandour H. Abdelhaib, Nana Serwah Boatengb,
Xuhua Zhangd, Hongyin Zhangb,∗
a
Institute of Life Sciences, Jiangsu University, Zhenjiang, 212013, Jiangsu, People's Republic of China
b
School of Food and Biological Engineering, Jiangsu University, Zhenjiang, 212013, Jiangsu, People's Republic of China
c
College of Tourism and Culinary Science • Food Science and Engineering, Yangzhou University, Yangzhou, 225127, Jiangsu, People's Republic of China
d
College of Life Science, Sichuan Agricultural University, Yaan, 625014, Sichuan, People's Republic of China

A R T I C LE I N FO A B S T R A C T

Keywords: Apple is one of the largely grown fruits in China, and it suffers great economic losses caused by Penicillium
Methyl jasmonate expansum infection every year. In the present study, we ascertained the efficacy of Meyerozyma guilliermondii
Penicillium expansum enhanced by 200 μmol/L methyl jasmonate (MeJA) in controlling the postharvest blue mold decay of apples and
Meyerozyma guilliermondii the possible mechanisms involved. The results demonstrated that the biological control ability of M. guillier-
Biocontrol
mondii induced by MeJA in restraining P. expansum infection in apples. The efficacy of M. guilliermondii induced
Mechanism
by MeJA significantly decreased the decay incidence and lesion diameter of apples. When treated with M.
guilliermondii induced by MeJA, the decay incidence of apples was only 21.6%, while apples treated with M.
guilliermondii was 42.4%. M. guilliermondii induced by MeJA also reduced the germ tube length, spore germi-
nation rate of P. expansum in PDB and colony diameter of P. expansum in PDA. The results also showed that
antagonistic yeast induced by MeJA proliferated better in apple wounds and surface at 4 °C or 20 °C. Meanwhile,
the activities of resistance-related peroxidase (POD), polyphenol oxidase (PPO), phenylalanine ammonia-lyase
(PAL), Catalase (CAT), and the antibacterial substances of flavonoid contents, total phenolic content were all
increased. The results manifested that M. guilliermondii induced by MeJA increased the expression levels of
defense-related enzymes in apples.

1. Introduction
China is one of the leading producers of apples worldwide.
However, in the process of storage, transportation and sale after har-
vesting, apples are susceptible to mechanical damage and infections by
fungal pathogens, causing rot, deterioration and subsequent economic
losses [1]. As we all know, Penicillium expansum is one of the most
important pathogenic fungi for apple decay [2]. This pathogen is able to
produce patulin that is a secondary metabolite and can cause terato-
genic and carcinogenicity, which gives rise to a serious threat to human
health [3,4]. Recently, the methods for controlling apple procurement
of diseases mainly include chemical methods and physical methods.
However, chemical methods are mainly employ chemical fungicides to
control post-harvest diseases, which produces a large amount of pesti-
cide residue that has a serious harmful impact on the environment and
human health [5,6]. On account of its high price, physical methods
cannot be universally applied. In recent years, researchers have sear-
ched the ways to replace chemical fungicides and physical sterilization,
and biological control has made breakthroughs in the prevention of
postharvest diseases of fruits [7]. Biocontrol with antagonistic yeast is
one of these methods and the control efficacy is particularly significant
[8]. However, the biological control effect of antagonistic yeast, though
it doesn't produce residues, is still not better than chemical fungicide.
Therefore, improving the biocontrol efficacy of antagonistic yeast has
become a serious issue that needs to be urgently solved [9–11]. Re-
cently, researchers have reported combining antagonist yeast with
chemical components such as trehalose can enhance Pichia caribbica
efficacy in controlling of gray mold diseases in strawberries [12]. Zhang
et al. found that phytic acid enhances biocontrol efficacy of Rhodotorula
mucilaginosa against postharvest gray mold spoilage and natural

∗
Corresponding author.
E-mail address: zhanghongyin126@126.com (H. Zhang).

https://doi.org/10.1016/j.pmpp.2019.101454
Received 7 August 2019; Received in revised form 18 October 2019; Accepted 8 December 2019
Available online 11 December 2019
0885-5765/ © 2019 Elsevier Ltd. All rights reserved.
F. He, et al. Physiological and Molecular Plant Pathology 109 (2020) 101454

spoilage of strawberries [13]. β-glucan enhanced Cryptococcus podzo- Table 1

licus capacity that suppresses blue mold of apples [14]. Again, it is re- Nucleotide sequences primers used in this study.
ported that salicylic acid could enhance the biocontrol efficacy of an- Gene name Primer Primer Sequence (5’ → 3′)
tagonistic yeast in sweet cherry fruits [15]. Effects of pre-harvest
application of antagonistic yeast combined with chitosan on decay and PPO F-PPO- qRT ATGCCAAGTCCAAGAGCCAA
R-PPO- qRT CCAGTGCCGGATTGGTTGTA
quality of harvested table grape fruits were improved [16]. Methyl
POD F-POD- qRT AAGCCTATAGCCCCACCAGA
jasmonate is a natural plants hormone that is widely found in nature. It R-POD- qRT CTTGAAGCTACGTGGGTCGT
is a natural signal molecule of plants, which plays an extremely im- CAT F-CAT- qRT AGACACCTGTCATTGTGCGT
portant role in the growth and development of plants. Exogenous ap- R-CAT- qRT ACACGAGGGTCGGATAGGG
plications can stimulate the expression of defense related plant genes PAL F-PAL- qRT GGCATTTGGAGGAGAACTTG
R-PAL- qRT AGAACCTTGAGGGGTGAAGC
and induce chemical defense of plants.
ACTIN F-ACTIN- CCCAAAGGCTAATCGGGAGAAA
Plants treated with MeJA can induce protease inhibitors (PI) and qRT ACCACTGGCGTAGAGGGAAAGA
polyphenol oxidase (PPO), affecting nutrients in herbivores [17]. The R-ACTIN-
ability that absorbs nutrients also increases the activity levels of defense qRT
proteins such as peroxidase, chitosanase and lipoxygenase, leading to
the accumulation of alkaloids and phenolic secondary biomass, in-
creasing and altering the release of volatile signaling compounds.
Moreover, MeJA is safe and harmless, it can improve the storage and
preservation effect of fruits and vegetables, which has an extremely
high economic value [18].
The advantage of MeJA can reduce chilling injury and maintain
postharvest quality in peaches [19]. It is also beneficial for blueberry
storage and related resistance enzyme activities [20]. Furthermore, it
can reduce decay and enhance antioxidant capacity in Chinese bay-
berries [21]. Therefore, it is applied to control postharvest diseases of
fruits. These provide a theoretical basis for the application of MeJA.
Meyerozyma guilliermondii is a strain of yeast that our team screened
from orchards at Jiangsu University, China. As far as we know, there is
no report on the fact that MeJA induces the growth of M. guilliermondii
to improve its biocontrol efficacy, in inhibiting the blue mold disease
caused by P. expansum and reducing the damage and decay in apples.
The purpose of this study was to determine the effect of MeJA induced
M. guilliermondii in controlling postharvest blue mold decay in apples,
and to explore its possible physiological mechanisms.

2. Materials and methods

2.1. Fruits

Apples (Malus domestica Borkh, cv. Fuji) were selected randomly at

commercial maturity with no mechanical damage and decay, the uni-
form sizes and the same maturity. The surface of the fruits was fresh
and without treatment commercially (organic). It was transported to
the laboratory immediately after harvesting. Apples were thoroughly
rinsed evenly with tap water, then disinfected with 0.1% (w/v) NaClO
for 2 min. Then rinsed three times with tap water, arranged evenly in
the cleaned plastic basket, air dried and set aside.
2.2. Pathogen
P. expansum was obtained by screening from the decayed apple
previously by our research team, and the pathogen was stored at
−80 °C. Cultured on PDA medium prepared from (200 g extract of
boiled potatoes 20 g glucose, 20 g agar, and distilled water up to 1 L).
Spore suspension was collected from a 7 days old culture and then
adjusted to 1 × 105 spores/mL before using.
2.3. Yeast
The antagonist yeast M. guilliermondii was preserved in China Center
for Type Culture Collection (CCTCC M 2017270). M. guilliermondii were
collected in a cryoprobe at −80 °C. The preparation steps for activating
culture and yeast suspension in NYDB (5 g yeast extract, 8 g beef ex-
tract, 10 g glucose) are as follows: inoculate in NYDA medium in in-
cubator at 28 °C for 72 h. Seed solution: pick several rings of activated
yeast in cultured NYDB medium incubated for 24 h, at 28 °C, rotation
Fig. 1. Induction of different concentrations of MeJA in M. guilliermondii on the
decay incidence (a) and lesion diameter (b) of postharvest blue mold in apples.
Note: CK is the control group; A, B, C, D, respectively, represent different cul-
ture medium concentration of 1 × 108 cells/mL M. guilliermondii suspension, A:
NYDB, B: NYDB (addition 100 μmol/MeJA), C: NYDB (addition of 200 μmol/L
MeJA), D: NYDB (addition of 500 μmol/L of MeJA). The different letters re-
present the difference significance (p < 0.05).
speed 180 rpm. Take 1 mL of seed solution into 50 mL NYDB medium
and NYDB supplemented with MeJA. The medium was cultured at 28 °C
at 180 rpm for 24 h. Culture solution was centrifuged at 7000×g for
15 min, and the supernatant of the culture medium was discarded. The
yeast sludge was washed twice with sterile physiological saline, and
then sterilized. The yeast cell suspension was adjusted to a concentra-
tion of 1 × 108 cells/mL using a hemocytometer count.
2.4. Efficacy of M. guilliermondii amended with different concentrations of
MeJA on postharvest blue mold of apples
Three uniform wounds (5 mm in diameter and 4 mm in depth) were
made on the equator of the apple with a sterile corkborer. Two hours

2
F. He, et al.
Fig. 2. Growth dynamics of M. guilliermondii induced with 200 μmol/L MeJA at 20 °C (a), 4 °C (b) in wounds and at 20 °C (c), 4 °C (d) on surface in apples.
Y: M. guilliermondii cultured in NYDB; Y + MeJA: M. guilliermondii cultured in NYDB amended with 200 μmol/L MeJA.
later, each wound was treated with 30 μL of the cell suspension
(1 × 108 cells/mL) of M. guilliermondii treated with different MeJA
concentrations as follows: NYDB (100 μmol/L MeJA), NYDB
(200 μmol/L MeJA), NYDB (500 μmol/L MeJA) and sterile saline as
control. After 2 h, each wound was treated with 30 μL of the P. ex-
pansum spore suspension (1 × 105 spores/mL). After apples in plastic
baskets were naturally dried, they were wrapped with plastic wraps,
and incubated at 20 °C at a high humidity (95%) rate. Disease incidence
and lesions diameters were measured after three days, and the decay
rate was calculated according to the formula:
number of decay wounds 
decay rate  = × 100% . Each with 3 apples in parallel,
total wounds
and the entire experiment was repeated twice.
2.5. Population dynamic of M. guilliermondii in wounds and surface of
apples
Apples were prepared and wounded as described above. Each
wound was treated with 30 μL of M. guilliermondii at the concentration
of 1 × 108 cells/mL. The cell suspension of M. guilliermondii was also
derived from NYDB, NYDB in combination with MeJA (200 μmol/L),
and sterile saline as a control. The apples were placed in a constant
humidity incubator at 20 °C or 4 °C. One hour after incubation is taken
as 0 d. At 20 °C, samples were taken at 0, 1, 2, 3, 4, 5, 6, 7, 8 d, re-
spectively, whereas those stored at 4 °C, at 0, 3, 6, 9, 12, 15, 18, 21,
24 d. The apple wound was taken out with a sterile scalpel and put in a
sterile mortar containing 30 mL of sterile physiological saline, and ra-
pidly ground into a homogenate, which was further diluted. The po-
pulation dynamic of M. guilliermondii on apple surface that apples were
prepared as described above, population on the surface was conducted
according to the method described by Calvo et al. with slight
3
Physiological and Molecular Plant Pathology 109 (2020) 101454
modifications [22]. Three circles were evenly drawn at the equator of
the apples, and then 30 μL of 1 × 108 cells/mL of the cell suspension of
M. guilliermondii was added at the center of each circle. Different gra-
dients were then applied to 100 μL of different concentrations of yeast
suspension uniformly coated onto NYDA plates using a sterile coating
bar. After incubation at 28 °C for 48 h, the results were expressed as
log10 CFU/wound and log10 CFU/circle. Each treatment was performed
in three parallels, each with 3 apples in parallel, and the entire ex-
periment was repeated twice.
2.6. Effects of M. guilliermondii induced by MeJA on the inhibition of P.
expansum in vitro
2.6.1. Measurement of the spore germination rate and germ tube length of P.
expansum treated with M. guilliermondii
One milliliter of M. guilliermondii suspension from NYDB or NYDB
with 200 μmol/L MeJA, using sterile water as control, added into 50 mL
volumetric flask containing PDB, and then 1 mL of the spore suspension
of P. expansum (1 × 107 spores/mL) was added, and incubated at 28 °C
for 24 h at 75 rpm, then counted using light microscopy. The spore
germination rate and germinal tube length was measured. At least 100
spores of P. expansum were observed per treatment, each treatment was
carried out three times, and the entire experiment was performed twice.
2.6.2. Effects of M. guilliermondii induced by MeJA on the growth of P.
expansum in vitro
Configuring 1 × 108 cells/mL of the cell suspension of M. guillier-
mondii from NYDB or NYDB with 200 μmol/L MeJA and sterile saline as
control. The PDA medium was perforated by using a sterile puncher,
and treated with 70 μL of yeast suspension (1 × 108 cells/mL) and
sterile physiological saline as control. After 2 h, 70 μL of the spore
F. He, et al.
Fig. 3. Effect of MeJA-induced culture of M. guilliermondii on the spore ger-
mination rate (a) and germ tube length (b) of P. expansum in PDB. Effect of
MeJA-induced culture of M. guilliermondii on the colony diameter of P. ex-
pansum in PDA (c).
CK: sterile distilled water; Y: M. guilliermondii cultured in NYDB; Y + MeJA: M.
guilliermondii cultured in NYDB amended with 200 μmol/L MeJA. The different
letters represent the difference significance (p < 0.05).
suspension of P. expansum (1 × 105 spores/mL) was added. After 2 h,
they were wrapped with plastic wrap and placed in the incubator at
25 °C. The colony diameter was measured three days later, three times
in parallel for each treatment, and the whole experiment was repeated
twice.
2.7. Effects of M. guilliermondii induced by MeJA on the PPO, POD, PAL,
CAT activities, flavonoid content and total phenolic content of apples
Apples prepared as described above, and then cultured in a constant
temperature of 20 °C, at 95% constant humidity incubator for 7 days,
and the relevant resistance enzyme activity was measured periodically
4
Physiological and Molecular Plant Pathology 109 (2020) 101454
every day. The culture was sampled for 0 d at 2 h. The extraction of the
enzyme supernatant was carried out, with 12 apples per basket, three
times in parallel for each treatment, and the entire experiment was
repeated twice.
2 g of fresh apple tissue was ground with 10 mL of 4 °C pre-cooled
phosphate buffer of pH 7.8 containing polyvinyl pyrrolidone (PVPP)
and ETDA. A little quartz sand was added to aid grinding in a sterile,
frozen mortar, and then centrifuged at 10000 × g for 15 min at 4 °C to
obtain the supernatant. The supernatant was used as the crude enzyme
extract for enzyme activities.
2.7.1. Determination of polyphenol oxidase (PPO)
The determination of PPO was made with reference to the method
described by Aquino-Bolaños et al. with slight modifications [23].
0.2 mL of crude enzyme extract was added to 2.8 mL of catechol so-
lution dissolved in phosphate buffer, and then enzyme activities was
measured at 398 nm for 3 min, once every 1 min. The enzyme activities
were calculated within 60 s with an increase in absorbance of 0.01 as an
enzyme unit, and the result was expressed by U/g FW.
2.7.2. Determination of peroxidase (POD) activity
The activity of POD was determined according to the method de-
scribed by Lamikanra et al. with slight modifications [24]. To a 0.2 mL
of the enzyme supernatant, add 2.2 mL of 0.3% guaiacol at 30 °C for
5 min, and then add 0.6 mL 0.3% H2O2 at 30 °C, absorbance was taken
at 470 nm, for 3 min, once every 1min. The enzyme activities were
calculated within 60 s with an increase in absorbance of 0.01 as an
enzyme unit, and the result was expressed by U/g FW.
2.7.3. Determination of phenylalanine ammonia-lyase (PAL) activity
The activity of PAL was determined according to method described
by Mishra et al. with some modifications [25]. 1 mL of the crude en-
zyme extract was added to 3 mL of boric acid buffer (in a 30 °C water
bath for 5 min), and the absorbance was measured at 290 nm for 3 min,
once every 1 min. The enzyme activities were calculated within 60 s
with an increase in absorbance of 0.01 as an enzyme unit, and the result
was expressed by U/g FW.
2.7.4. Determination of catalase (CAT) activity
The activity of CAT was determined described by Chan et al. with
slight modifications [26]. 0.2 mL of the crude enzyme extract was
added to 2.8 mL of 30 mM H2O2, and after 10 s, the absorbance was
measured at 240 nm for 3 min, once every 1 min, The enzyme activities
was calculated within 60 s with an increase in absorbance of 0.01 as an
enzyme unit, and the result was expressed by U/g FW.
2.7.5. Determination of flavonoid content
0.5 g of apple was weighed and placed in a sterilized, frozen mortar,
and then ground with 20 mL of HCl-methanol solution pre-cooled for
30 min, followed by centrifugation at 10000 × g, 4 °C for 15 min, then
measure the absorbance at 325 nm, and the result was expressed as U/g
FW.
2.7.6. Determination of total phenolic content
0.5 g of apple tissue was place in a sterilized, frozen mortar with
20 mL of HCl - methanol solution precooled for 30 min was added,
ground, and placed in the dark at 4 °C for 20 min. The mixture was
centrifuged at 10000 × g for 15 min at 4 °C, and the absorbance of the
supernatant was measured at 280 nm. The result was expressed as U/g
FW.
2.8. Effects of M. guilliermondii induced by MeJA on the expression levels of
apple-related resistance genes
Apples were prepared as described above. The tissues from 6
wounds of two apples were picked up with sterile knife around the
F. He, et al.
Fig. 4. Effect of MeJA induced M. guilliermondii on the PPO (a), POD (b), PAL (c), CAT (d), the content of flavonoids (e), total phenolic content (f) of apples at 20 °C.
CK: sterile distilled water; Y: M. guilliermondii cultured in NYDB; Y + MeJA: M. guilliermondii cultured in NYDB amended with 200 μmol/L MeJA.
removed wound tissues. RNA was extracted by using RNA kit (Sangon
Biotech, Shanghai, China) after grinding into powder with liquid ni-
trogen. The cDNA was qualified for use at −80 °C. The final amount of
RNA to reverse transcription to cDNA was not more than 1000 ng. The
specific primers of the genes were presented in Table 1.
RT-qPCR was performed by Biorad cfx-96 real-time fluorescence
quantitative PCR instrument (Biorad, USA). The melting curve was
95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s, and 62 °C for 15 s. The
expression level was calculated by using the method of 2 −ΔΔCT.
Analysis of relative expression levels of gene data used real-time
quantitative PCR, and normalized using the Ct value corresponding to
the ACTIN.
2.9. Statistical analysis
The data were subjected to the analysis of variance (ANOVA). Two
sets of independent experimental data were taken to calculate the
5
Physiological and Molecular Plant Pathology 109 (2020) 101454
standard error of the mean and mean, and separated according to the
Turkey test (P = 0.05) using SPSS 22.0 for Windows (SPSS Inc.,
Chicago, IL). And P < 0.05 was considered as significantly different.
3. Results
3.1. Efficacy of M. guilliermondii induced by MeJA in controlling
postharvest blue mold decay of apples
As shown in Fig. 1a, the treatment of MeJA induced yeast inhibits
blue mold greater than yeast alone. Among different concentration,
200 μmol/L MeJA showed great induction effect on yeast in controlling
postharvest decay of apples. After storage for 5 days, when treated with
M. guilliermondii added with 200 μmol/L MeJA and M. guilliermondii,
the decay incidence of apples was only 21.6%, 42.4%, while the control
group was 100%. These results indicated that 200 μmol/L MeJA in-
duced antagonistic yeast had the best control effect on postharvest blue
F. He, et al.
Fig. 5. Effect of MeJA induced M. guilliermondii on relative expression level of PPO (a), POD (b), PAL (c), CAT (d) of apples.
CK: sterile distilled water; Y: M. guilliermondii cultured in NYDB; Y + MeJA: M. guilliermondii cultured in NYDB amended with 200 μmol/L MeJA. The different letters
represent the difference significance (p < 0.05).
mold in apples. As shown in Fig. 1b, M. guilliermondii induced by MeJA
and M. guilliermondii alone reduced the diameters of the lesion diameter
in of apples, with 6.866 mm, 8.943 mm, lower than the control group of
10.595 mm. From the above, 200 μmol/L MeJA induced M. guillier-
mondii was found to be the best.
3.2. The growth dynamics of M. guilliermondii in apple wounds and surface
As shown in Fig. 2, M. guilliermondii and M. guilliermondii induced by
MeJA were able to rapidly grow and proliferate at the wounds of apples
at 20 °C or 4 °C. Fig. 2a showed the population of M. guilliermondii
induced with MeJA and M. guilliermondii gradually increased and
peaked on the fifth day, then remained at a higher level in apple
wounds at 20 °C. Fig. 2b showed the population of M. guilliermondii
induced with MeJA and M. guilliermondii gradually increased and
peaked on the twelfth day, then remained at a higher level in apple
wounds at 4 °C. Fig. 2c showed the population of M. guilliermondii in-
duced with MeJA and M. guilliermondii gradually increased and peaked
on the fifth day, then remained at a higher level on surface of apples at
20 °C. Fig. 2d showed the population of M. guilliermondii induced with
MeJA and M. guilliermondii gradually increased and peaked on the fif-
teenth day, then remained at a higher level on surface of apples at 4 °C.
The results showed that MeJA induced M. guilliermondii increased the
population of M. guilliermondii in wounds and surface of apples at 20 °C
or 4 °C.
3.3. Effects of M. guilliermondii induced by MeJA on the inhibition of P.
expansum in vitro
Fig. 3a showed M. guilliermondii and MeJA-induced M. guilliermondii
significantly inhibited the germination rate of P. expansum spores in
PDB medium. After incubation at 28 °C for 14 h, compared with the
6
Physiological and Molecular Plant Pathology 109 (2020) 101454
control group, the spore germination rate of P. expansum was decreased
by M. guilliermondii or MeJA-induced M. guilliermondii, it was only
50.3% and 31.5%, while the control was 85%. From this finding, MeJA
induction was said to effectively increase the inhibition rate of spore
germination of M. guilliermondii against P. expansum. As shown in
Fig. 3b, M. guilliermondii and MeJA-induced M. guilliermondii sig-
nificantly inhibited the germ tube length of P. expansum in PDB
medium. After incubation at 28 °C for 14 h, compared with the control
group, M. guilliermondii, and MeJA-induced M. guilliermondii reduced
the germ tube length of P. expansum by 30 μm and 50 μm. From this
finding, MeJA induction effectively increased the inhibitory effect of M.
guilliermondii on the germ tube length of P. expansum. As shown in
Fig. 3c, both M. guilliermondii and MeJA-induced M. guilliermondii have
significant inhibitory effect on the colony diameter of P. expansum,
though MeJA-induced M. guilliermondii also has a better inhibitory ef-
fect on the diameter of P. expansum colonies.
3.4. Effects of M. guilliermondii induced by MeJA on PPO, POD, PAL, CAT
activities, flavonoid content and total phenolic content of apples
As shown in Fig. 4a, the PPO activity of the apples from the three
treatments increased first, then decreased, reaching its peak on the 2nd
day. The PPO activity of the apples treated with M. guilliermondii and
the MeJA-induced was higher than the control. As shown in Fig. 4b, the
activity of apple's POD in the three treatments increased first, then
decreased and then increased again, peaking on 2nd day and 6th day.
The POD activity of the apples treated with M. guilliermondii induced by
MeJA was higher than the control. As shown in Fig. 4c, the PAL activity
of the apples from the three treatments increased first, then decreased,
then increased again till it peaked on 5th day. The PAL activity of ap-
ples treated with M. guilliermondii induced by the MeJA was higher than
the control. As shown in Fig. 4d, the CAT activity of the apples from the
F. He, et al.
three treatments increased first and then decreased, then became static,
though it reached the peak on the 2nd day. The CAT activity of apples
treated with M. guilliermondii that was induced by the MeJA was higher
than the control.
As shown in Fig. 4e, the content of apple flavonoids in the three
treatments increased first and then decreased, and increased subse-
quently till it peaked on the 6th day. The flavonoid content of apples
treated with M. guilliermondii induced by the MeJA was higher than the
control. As shown in Fig. 4f, the total phenolic content of apples in the
three treatments increased first, then decreased, then shot up till it fi-
nally reached a peak on the 3rd day, total phenolic content of apples
treated with M. guilliermondii induced by the MeJA was higher than the
control.
3.5. Effects of M. guilliermondii induced by MeJA on the expression levels of
apple-related resistance genes
As shown in Fig. 5a, the relative gene expression level of PPO in
apples treated with M. guilliermondii induced by MeJA, increased first
and then decreased, but peaked on the 2nd day, and then remained at a
higher level. As shown in Fig. 5b, the relative gene expression level of
POD in apples treated with M. guilliermondii induced by MeJA increased
first and then decreased, peaked on the 2nd day and the 6th day, and
then remained at a higher level. As shown in Fig. 5c, the relative gene
expression level of PAL in apples treated with M. guilliermondii induced
by MeJA, increased and then decreased gradually, till it peaked on the
2nd day, and then stabilized at a higher level. As shown in Fig. 5d, the
relative gene expression level of CAT in apples treated with M. guil-
liermondii induced by MeJA, increased, dropped gradually, and peaked
on the 2nd day, after which it remained at a higher level. In summary,
the expression levels of these four genes of apples were significantly up-
regulated induced by M. guilliermondii induced with MeJA. It is con-
sistent with the trend of resistant enzyme activities.
4. Discussion
In recent years, studies have demonstrated that antagonistic yeast
can effectively control the diseases caused by mold infection during
storage and transportation of fruits and vegetables. For example, re-
searchers discovered that the antagonistic yeasts had a good effect on
the banana postharvest anthracnose pathogen [27]. Yan et al. found
that M. guilliermondii can inhibit P. expansum in pears [28]. Biocontrol
efficacy of the antagonistic yeast alone has its drawbacks relative to
chemical fungicide residues, therefore, researchers have considered to
combine antagonistic yeast with chemicals to increase the inhibitory
effect of antagonistic yeast on mold [29,30]. Qin et al. found that
chitosan combined with Cryptococcus laurentii can effectively control
grape's postharvest diseases [31]. MeJA can inhibit post-harvest dis-
eases of peaches [32,33]. Our results showed that M. guilliermondii in-
duced by MeJA improved the inhibitory effect of M. guilliermondii on
postharvest blue mold in apples.
In this study, the addition of 200 μmol/L MeJA to the yeast culture
medium was found to improve the biocontrol efficacy of M. guillier-
mondii. 200 μmol/L MeJA induced M. guilliermondii reduced the dis-
eases caused by P. expansum in both the decay incidence and lesion
diameter of apples. It indicated that MeJA directly or indirectly inhibits
the infection of P. expansum, which may be related to the competition of
mold for nutrition and living space [34]. In order to further prove the
above conclusions, the growth dynamics of MeJA-inducing antagonistic
yeast and antagonist yeast in apple wounds and surface were also stu-
died. MeJA improved the growth of yeast in apple wounds and surface,
so MeJA may provide nutrition for yeast growth. Experimental results
showed that MeJA-induced yeast improved the effect of controlling P.
expansum in vitro, reduced the spore germination rate and the germ
tube length of P. expansum in PDB medium. Furthermore, the colony
diameter of P. expansum in PDA was reduced. It indicated that MeJA
7
Physiological and Molecular Plant Pathology 109 (2020) 101454
improved yeast growing, increased its effectiveness in inhibiting P.
expansum, like competing with mold for nutrients, competition for
survival space.
A large number of studies have shown that the related resistance
enzymes of PPO, POD, PAL, CAT, are closely related to the ability of
fruits and vegetables to resist mold, as well as the content of flavonoids
and total phenols [35]. PPO and POD are important catalytic enzymes
for fruits, which can participate in the synthesis of certain hormones,
improve the mechanism of defense, thereby enhancing the disease re-
sistance in apple. Also, POD can regulate fruit aging, some physiological
processes, directly act on pathogenic bacteria, playing an important
role in plant protection. Therefore, MeJA's improvement of the PPO and
POD production by M. guilliermondii in fruits enhances the defense
mechanism of apples. PAL is a key enzyme in the metabolic pathway of
phenylpropanoids in apples. It is a key class of resistance-related en-
zymes that help to produce lignin, alkaloid and other resistant sub-
stances and improve apple self-resistance [36]. Moreover, CAT can
clear reactive oxygen species (ROS) and block the ROS synthesis
pathway. ROS can induce apoptosis, so the increase in CAT can increase
the related resistance in apples. The total phenolic and flavonoid con-
tent is related to the metabolism of L-phenylalanine, which can improve
the disease resistance of fruits and thus reduce the decay of fruits [37].
The results showed that the expression levels of these four genes of
apples were significantly up-regulated induced by M. guilliermondii
added with MeJA. The expression levels of defense-related gene were
consistent with the resistant enzyme activities of PPO, POD, PAL and
CAT, and they were very significant to strengthen the resistance of the
fruits to pathogens. Maurice et al. also found that trehalose induced
Hanseniaspora uvarum could enhance the activities of PPO, PAL and
CAT and the expression levels of PPO, PAL and CAT of grapes [38].
Moreover, the level of enzyme activity may be related to the level of
gene expression, and the specific up-regulation of gene expression play
an important role in managing the disease-resistant mechanism in the
grapes [39].
The experimental results showed that M. guilliermondii treated with
MeJA enhance the resistance of enzyme activities and the expression
levels of these genes in apples. It indicated that M. guilliermondii treated
with MeJA enhanced the expression of resistance related genes of ap-
ples, thereby increasing apple's resistance to pathogens. The result de-
monstrated that MeJA induced M. guilliermondii had a good inhibitory
effect on P. expansum decay and spoilage in apples from physiological
levels.
5. Conclusion
Our results showed that 200 μmol/L MeJA was added to the
medium to improve the biocontrol efficacy of M. guilliermondii, which
significantly reduced the decay incidence and lesion diameter in apple
wounds caused by P. expansum, inhibited the spore germination rate
and the germ tube length of P. expansum in PDB as well as the diameter
of colonies in PDA. MeJA also increased the growth dynamics of M.
guilliermondii in apple wounds and surface. MeJA induced M. guillier-
mondii improved the effectiveness of related enzyme activities (PPO,
POD, PAL, CAT), total phenolic content and flavonoid contents of ap-
ples, at the physiological level. The expression levels of these four genes
of apples were significantly up-regulated induced by M. guilliermondii
added with MeJA. It is consistent with the trend of resistant enzyme
activity of PPO, POD, PAL and CAT. Further studies are needed to
analysis the mechanism of MeJA induced M. guilliermondii against P.
expansum of apples in molecular level.
Declaration of competing interest
The authors declare that there are no conflicts of interest.
F. He, et al. Physiological and Molecular Plant Pathology 109 (2020) 101454

Acknowledgements diseases of peach fruit and the possible mechanisms involved, J. Appl. Microbiol. 98
(4) (2005) 941–950.
[20] G. Cocetta, M. Rossoni, C. Gardana, I. Mignani, A. Ferrante, A. Spinardi, Methyl
This research was supported by the National Natural Science jasmonate affects phenolic metabolism and gene expression in blueberry
Foundation of China (31772369, 31701971) and 333 High-Level (Vaccinium corymbosum), Physiol. Plant. 153 (2) (2015) 269–283.
Personnel Training Project of Jiangsu Province (BRA2017442). [21] K. Wang, P. Jin, S. Cao, H. Shang, Z. Yang, Y. Zheng, Methyl jasmonate reduces
decay and enhances antioxidant capacity in Chinese bayberries, J. Agric. Food
Chem. 57 (13) (2009) 5809–5815.
References [22] J. Calvo, V. Calvente, M.E. De Orellano, D. Benuzzi, M.I.S. De Tosetti, Improvement
in the biocontrol of postharvest diseases of apples with the use of yeast mixtures,
Biocontrol 48 (5) (2003) 579–593.
[1] B.R. Gramisci, M.C. Lutz, C.A. Lopes, M.P. Sangorrín, Enhancing the efficacy of
[23] E.N. Aquino-Bolaños, E. Mercado-Silva, Effects of polyphenol oxidase and perox-
yeast biocontrol agents against postharvest pathogens through nutrient profiling
idase activity, phenolics and lignin content on the browning of cut jicama,
and the use of other additives, Biol. Control 121 (2018) 151–158.
Postharvest Biol. Technol. 33 (3) (2004) 275–283.
[2] K. Baert, F. Devlieghere, H. Flyps, M. Oosterlinck, M.M. Ahmed, A. Rajković,
[24] O. Lamikanra, M.A. Watson, Effects of ascorbic acid on peroxidase and poly-
B. Verlinden, B. Nicolaï, J. Debevere, B. De Meulenaer, Influence of storage con-
phenoloxidase activities in fresh cut cantaloupe melon, J. Food Sci. 66 (9) (2001)
ditions of apples on growth and patulin production by Penicillium expansum, Int. J.
1283–1286.
Food Microbiol. 119 (3) (2007) 170–181.
[25] B.B. Mishra, S. Kumar, S. Wadhawan, S.N. Hajare, S. Saxena, V. More, S. Gautam,
[3] E. Fallik, S. Grinberg, M. Gambourg, J. Klein, S. Lurie, Prestorage heat treatment
A. Sharma, Browning of litchi fruit pericarp: role of polyphenol oxidase, peroxidase,
reduces pathogenicity of Penicillium expansum in apple fruit, Plant Pathol. 45 (1)
phenylalanine ammonia lyase and effect of gamma radiation, J. Food Biochem. 36
(1996) 92–97.
(5) (2012) 604–612.
[4] J. Calvo, V. Calvente, M.E. de Orellano, D. Benuzzi, M.I.S. De Tosetti, Biological
[26] Z. Chan, S.P. Tian, Induction of H2O2 metabolizing enzymes and total protein
control of postharvest spoilage caused by Penicillium expansum and Botrytis ci-
synthesis by antagonistic yeast and salicylic acid in harvested sweet cherry fruit,
nerea in apple by using the bacterium Rahnella aquatilis, Int. J. Food Microbiol. 113
Postharvest Biol. Technol. 39 (3) (2006) 314–320.
(3) (2007) 251–257.
[27] V.Y. Zhimo, D. Dilip, J. Sten, V.K. Ravat, D.D. Bhutia, B. Panja, J. Saha, Antagonistic
[5] I. Vinas, J. Usall, N. Teixidó, V. Sanchis, Biological control of major postharvest
Yeasts for Biocontrol of the banana postharvest anthracnose pathogen
pathogens on apple with Candida sake, Int. J. Food Microbiol. 40 (1–2) (1998)
Colletotrichum musae, J. Phytopathol. 165 (1) (2017) 35–43.
9–16.
[28] Y. Yan, X. Zhang, X. Zheng, M.T. Apaliya, Q. Yang, L. Zhao, X. Gu, H. Zhang,
[6] W.S. Conway, W.J. Janisiewicz, J.D. Klein, C.E. Sams, Strategy for combining heat
Control of postharvest blue mold decay in pears by Meyerozyma guilliermondii and
treatment, calcium infiltration, and biological control to reduce postharvest decay
it's effects on the protein expression profile of pears, Postharvest Biol. Technol. 136
ofGala'Apples, Hortscience 34 (4) (1999) 700–704.
(2018) 124–131.
[7] C. Zhang, Z. Li, G. Kang, L. Zhang, P. Cong, Y. Tian, Advance in research on bio-
[29] H. Zhang, L. Ma, L. Wang, S. Jiang, Y. Dong, X. Zheng, Biocontrol of gray mold
logical control of postharvest diseases of fruits by Bacillus subtilis, J. Fruit Sci. 26
decay in peach fruit by integration of antagonistic yeast with salicylic acid and their
(5) (2009) 699–703.
effects on postharvest quality parameters, Biol. Control 47 (1) (2008) 60–65.
[8] R.L. Wallace, D.L. Hirkala, L.M. Nelson, Postharvest biological control of blue mold
[30] K.S. Boyd-Wilson, R.C. Butler, P.A. Alspach, K.R. Everett, I.S. Pushparajah,
of apple by Pseudomonas fluorescens during commercial storage and potential
M. Walter, Compounds alone and in combination with yeasts to control
modes of action, Postharvest Biol. Technol. 133 (2017) 1–11.
Colletotrichum acutatum in apples, Australas. Plant Pathol. 43 (6) (2014) 703–714.
[9] B. Li, Z. Zhou, S. Tian, Combined effects of endo-and exogenous trehalose on stress
[31] X.H. Meng, G.Z. Qin, S.P. Tian, Influences of preharvest spraying Cryptococcus
tolerance and biocontrol efficacy of two antagonistic yeasts, Biol. Control 46 (2)
laurentii combined with postharvest chitosan coating on postharvest diseases and
(2008) 187–193.
quality of table grapes in storage, LWT-Food Sci. Technol. 43 (4) (2010) 596–601.
[10] T. Yu, X.D. Zheng, Salicylic acid enhances biocontrol efficacy of the antagonist
[32] P. Jin, Y. Zheng, S.P. Tang, H. Rui, C.Y. Wang, Enhancing disease resistance in
Cryptococcus laurentii in apple fruit, J. Plant Growth Regul. 25 (2) (2006) 166–174.
peach fruit with methyl jasmonate, J. Sci. Food Agric. 89 (5) (2009) 802–808.
[11] J. Liu, M. Wisniewski, S. Droby, S. Vero, P.S. Tian, V. Hershkovitz, Glycine betaine
[33] J. Zhang, J. Xie, Y. Zhou, L. Deng, S. Yao, K. Zeng, Inhibitory effect of Pichia
improves oxidative stress tolerance and biocontrol efficacy of the antagonistic yeast
membranaefaciens and Kloeckera apiculata against Monilinia fructicola and their
Cystofilobasidium infirmominiatum, Int. J. Food Microbiol. 146 (1) (2011) 76–83.
biocontrol ability of brown rot in postharvest plum, Biol. Control 114 (2017) 51–58.
[12] L. Zhao, H. Zhang, J. Li, J. Cui, X. Zhang, X. Ren, Enhancement of biocontrol ef-
[34] M.H. Abdelhai, H.E. Tahir, Q. Zhang, Q. Yang, J. Ahima, X. Zhang, H. Zhang, Effects
ficacy of Pichia carribbica to postharvest diseases of strawberries by addition of
of the combination of Baobab (Adansonia digitata L.) and Sporidiobolus pararoseus
trehalose to the growth medium, Int. J. Mol. Sci. 13 (3) (2012) 3916–3932.
Y16 on blue mold of apples caused by Penicillium expansum, Biol. Control 134
[13] H. Zhang, Q. Yang, H. Lin, X. Ren, L. Zhao, J. Hou, Phytic acid enhances biocontrol
(2019) 87–94.
efficacy of Rhodotorula mucilaginosa against postharvest gray mold spoilage and
[35] Q. Li, C. Li, P. Li, H. Zhang, X. Zhang, X. Zheng, Q. Yang, M.T. Apaliya,
natural spoilage of strawberries, LWT-Food Sci. Technol. 52 (2) (2013) 110–115.
N.A.S. Boateng, Y. Sun, The biocontrol effect of Sporidiobolus pararoseus Y16
[14] Y. Wang, Y. Li, W. Xu, X. Zheng, X. Zhang, M.H. Abdelhai, L. Zhao, H. Li, J. Diao,
against postharvest diseases in table grapes caused by Aspergillus Niger and the
H. Zhang, Exploring the effect of β-glucan on the biocontrol activity of
possible mechanisms involved, Biol. Control 113 (2017) 18–25.
Cryptococcus podzolicus against postharvest decay of apples and the possible me-
[36] Y.Y. Zong, J. Liu, B.Q. Li, G.Z. Qin, P.S. Tian, Effects of yeast antagonists in com-
chanisms involved, Biol. Control 121 (2018) 14–22.
bination with hot water treatment on postharvest diseases of tomato fruit, Biol.
[15] G.Z. Qin, S.P. Tian, Y. Xu, Y.K. Wan, Enhancement of biocontrol efficacy of an-
Control 54 (3) (2010) 316–321.
tagonistic yeasts by salicylic acid in sweet cherry fruit, Physiol. Mol. Plant Pathol.
[37] Q.C. Zhang, Y.C. Li, B. Yang, The inhibiting effect of postharvest citric acid treat-
62 (3) (2003) 147–154.
ment on dry rot of wounded-inoculated potato and the activity of defense enzymes,
[16] X.H. Meng, S.P. Tian, Effects of preharvest application of antagonistic yeast com-
J. Gansu Agric. Univ. 44 (3) (2009) 146–150.
bined with chitosan on decay and quality of harvested table grape fruit, J. Sci. Food
[38] M.T. Apaliya, H. Zhang, Q. Yang, X. Zheng, L. Zhao, E. Kwaw, G.K. Mahunu,
Agric. 89 (11) (2009) 1838–1842.
Hanseniaspora uvarum enhanced with trehalose induced defense-related enzyme
[17] C.W. Tan, S.Y. Chiang, K.T. Ravuiwasa, J. Yadav, S.Y. Hwang, Jasmonate-induced
activities and relative genes expression levels against Aspergillus tubingensis in table
defenses in tomato against Helicoverpa armigera depend in part on nutrient
grapes, Postharvest Biol. Technol. 132 (2017) 162–170.
availability, but artificial induction via methyl jasmonate does not, Arthropod-Plant
[39] C. Li, H. Zhang, Q. Yang, M.G. Komla, X. Zhang, S. Zhu, Ascorbic acid enhances
Interact. 6 (4) (2012) 531–541.
oxidative stress tolerance and biological control efficacy of Pichia caribbica against
[18] J.J. Cheong, Y. Do Choi, Methyl jasmonate as a vital substance in plants, Trends
postharvest blue mold decay of apples, J. Agric. Food Chem. 62 (30) (2014)
Genet. 19 (7) (2003) 409–413.
7612–7621.
[19] H. Yao, P.S. Tian, Effects of a biocontrol agent and methyl jasmonate on postharvest