See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/233776240

Current Status of Fig Mosaic Disease in Iran

Article  in  Journal of Phytopathology · August 2012

DOI: 10.1111/j.1439-0434.2012.01908.x

CITATIONS READS

21 648

4 authors, including:

Morteza Shahmirzaie Farshad Rakhshandehroo

Shahid Beheshti University of Medical Sciences Islamic Azad University
15 PUBLICATIONS   22 CITATIONS    103 PUBLICATIONS   223 CITATIONS   

SEE PROFILE SEE PROFILE

Toufic Elbeaino
Mediterranean Agronomic Institute of Bari
133 PUBLICATIONS   1,138 CITATIONS   

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Minor constituents characterizing the olive oil and their nutritional healthy evaluation View project

nanovirus View project

All content following this page was uploaded by Morteza Shahmirzaie on 18 December 2017.

The user has requested enhancement of the downloaded file.

J Phytopathol 160:324–330 (2012) doi: 10.1111/j.1439-0434.2012.01908.x
 2012 Blackwell Verlag GmbH

Islamic Azad University, Tehran, Iran and Istituto Agronomico Mediterraneo di Bari, Valenzano, Italy

Current Status of Fig Mosaic Disease in Iran

Morteza hahmirzaie1, Farshad
orteza Shahmirzaie akhshandehroo1, Hamid
arshad Rakhshandehroo amid Reza amanizadeh1 and Toufic
eza Zamanizadeh lbeaino2
oufic Elbeaino
AuthorsÕ addresses: 1Department of Plant Pathology, College of Agriculture and Natural Resources, Science and Research
Branch, Islamic Azad University, P.O.Box.14515-775, Tehran, Iran; 2Istituto Agronomico Mediterraneo di Bari, Via Ceglie 9,
70010 Valenzano (BA), Italy (correspondence to F. Rakhshandehroo. E-mail: rakhshandehroo_fa@srbiau.ac.ir)
Received January 6, 2012; accepted March 9, 2012

Keywords: fig mosaic disease, fig viruses, reverse transcription-polymerase chain reaction, dot immunobinding assay,
virus prevalence, Iran

Abstract of the wide adaptability of varieties to the soil and cli-

During 2009–2010, a survey was conducted in gardens
and commercial fig orchards throughout Iran to
determine the prevalence of Fig leaf mottle-associated
virus 1 (FLMaV-1), Fig leaf mottle-associated virus
2 (FLMaV-2), Fig mild mottle-associated virus
(FMMaV), Fig latent virus 1 (FLV-1) and Fig mosaic
virus (FMV). Reverse transcription-polymerase chain
reaction and dot immunobinding assay (DIBA) were
conducted on 104 fig samples collected from seven
provinces. FLV-1, FLMaV-1 and FMV were found in
14.5, 11.5 and 8.6% of the samples, respectively, but
FLMaV-2 and FMMaV were absent. The overall aver-
age of infection reached 18.3%, with a peak of 42.9%
in Semnan Province, followed by Golestan (40%),
Tehran (32.3%), Lorestan (28.6%) and Mazandaran
(25%) provinces. No infection was found in Fars and
Gilan provinces. Fig samples from Varamin and Khor-
ramabad districts showed high levels of mixed infec-
tions, 35.7 and 28.6%, respectively. The presence of
FMV and FLV-1 in the sap of symptomatic fig leaves
was also ascertained by DIBA. Sequence analysis of
amplified DNA from the partial RNA-dependent
RNA polymerase gene of two FMV isolates from Iran
showed a low level of nucleotide variability (5%). The
Iranian isolates shared a common phylogeny with
other Mediterranean FMV isolates and in particular
with those originating from Turkey already reported in
GenBank. This is the first report on the presence of
FLMaV-1 and FLV-1 in Iran and offers a preliminary
insight into the unsatisfactory health status of fig in
this country.
Introduction
The common fig (Ficus carica L.) is a temperate spe-
cies native to south-west Asia and the Eastern Medi-
terranean region (Saddoud et al. 2005). It is considered
to be one of the oldest fruit trees in the Mediterranean
basin and is widely grown for its edible fruit. Because
matic conditions, fig trees are found in many parts of
Iran as individual trees in outdoor gardens as well as
in commercial orchards. Iran is amongst the five top
producers of fig in the world with a production of
c. 55 000 tons yearly (Anonymous 2009). To date,
there is no information available on the occurrence of
viruses infecting fig trees in Iran. However, different
patterns from chlorotic to yellowish mottling, discolor-
ation, deformations and mosaic on young and old
leaves are commonly observed in field-grown trees
throughout the provinces of the country, all symptoms
resembling those of fig mosaic disease (FMD).
Fig mosaic disease is undoubtedly the most widespread
disorder of this species and is a constraint for produc-
tion and germplasm exchange. The earliest evidence on
FMD was reported by Swingle (1928) and Condit and
Horne (1933), but only recently its causal agent, a
multipartite single-stranded negative-sense RNA virus
belonging the genus Emaravirus and named Fig mosaic
virus (FMV), was identified (Elbeaino et al. 2009a,b).
This virus is transmitted by grafting with difficulty
mechanically (Açikgöz and Döken 2003) and, in
nature by the eriophyid mite Aceria ficus (Flock and
Wallace 1955), but not by seed (Martelli et al. 1993;
Açikgöz and Döken 2003). Fig mosaic disease has
been reported to occur everywhere figs are grown
(Blodgett and Gomec 1967).
To date, 15 viruses have been identified in fig, and
the genomes of seven of which are classified as defini-
tive or tentative species of the genera Closterovirus,
Ampelovirus, Trichovirus, Emaravirus, Alphacryptovirus
and Marafivirus have been sequenced completely or in
part (Elbeaino et al. 2006, 2007, 2009a, 2010, 2011a,b;
Gattoni et al. 2009). The unknown health status of fig
crop in Iran prompted the need to gather information
on the viruses infecting FMD trees in the main
fig-growing areas in the country. For this aim, five
fig-infecting viruses were investigated, that is, Fig leaf
Current Status of Fig Mosaic Disease in Iran 325

mottle-associated virus 1 (FLMaV-1), Fig leaf mottle-
associated virus 2 (FLMaV-2), Fig mild mottle-associ-
ated virus (FMMaV), Fig latent virus 1 (FLV-1) and
FMV, the prevalence and distribution of which in Iran
are reported here.
Materials and Methods
Surveys and sample collection
From March 2009 to October 2010, 104 fig samples
were collected from commercial fig orchards and out-
door fig gardens in the main seven fig-growing prov-
inces of Iran, that is, Gilan, Mazandaran and
Golestan (North), Tehran (Centre), Fars (South),
Lorestan (West) and Semnan (East) (Table 1), where
c. 65% of national fig production is concentrated.
Twenty-one different fig gardens were visited, most of
which were cultivated with cvs Zard, Sabz, Rono,
Izmir and ⁄ or San Pedro, but some had other unidenti-
fied cultivars. Samples consisted of young leaves gath-
ered from symptomatic and symptomless fig trees,
which were subjected to laboratory tests for the detec-
tion of FLMaV-1, FLMaV-2, FMMaV, FLV-1 and
FMV.
Biological tests
In attempts to isolate mechanically transmissible
viruses from fig samples, herbaceous plants including
species of Solanaceae (Nicotiana benthamiana, N. occi-
dentalis, N. tabacum cvs Samsun and Virginia), Cheno-
podiaceae (Chenopodium amaranticolor), Fabaceae
(Vigna unguiculata, Phaseolus vulgaris cv. La Victoire)
and Cucurbitaceae (Cucumis sativus) were inoculated
repeatedly, using extracts from young leaves of fig
mosaic diseased plants ground in 0.1 m phosphate buf-
fer pH 7.2 containing 2.5% nicotine and b-2-mercapto-
ethanol. Inoculated plants were kept in a glasshouse at
22–24C for 3 weeks for observation of symptom
expression.
Total nucleic acids (TNAs) and double-stranded RNA
(dsRNA) extraction
Total nucleic acids were extracted from leaf tissues of
figs using LiCl buffer, according to Channuntapipat
et al. (2001), whereas dsRNAs were extracted from 3 g
of leaf tissues and purified by chromatography through
the cellulose CF-11 column (Whatmann; Maidstone,
Kent, UK) in the presence of 17% ethanol (Valverde
et al. 1990). The recovered dsRNAs were subjected to
nuclease digestions using RNase-free DNase I
(60 lg ⁄ ml) and DNase-free RNase A (0.5 lg ⁄ ml) (Sal-
darelli et al. 1994), dissolved in TE buffer, electropho-
resed in 1.5% agarose gel and stained by ethidium
bromide.
Reverse transcription-polymerase chain reaction (RT-PCR)
and sequence analysis
Total nucleic acid extracts (10 ng) were reverse-tran-
scribed in a 20-ll solution containing 20 pmol of
reverse primers (Table 1), 50 mm m Tris–HCl pH 8.3,
50 mm m KCl, 10 mm m dNTP mix, 20 mm m DTT (dithio-
threithol), 20 U Ribonuclease inhibitor and 1 ll of
M-MuLV (200 U) reverse transcriptase enzyme (MBI;
Fermentas, Hannover, MD, USA). For the detection
of FLMaV-1, FLMaV-2, FMMaV, FMV and FLV-1,
five sets of virus-specific primers were used in RT-PCR
(Elbeaino et al. 2006, 2007, 2009a, 2010; Gattoni et al.
2009). The first four viruses were amplified using 2.5 ll
of the reverse transcription reaction, in a total volume
of 25 ll containing 1.5 mm m MgCl2, 0.2 mm m dNTPs,
0.3 lmm of each primer and 1 unit of Taq DNA poly-
merase (Cinnagene, Karaj, Iran). Amplifications were
carried out in a thermocycler (Eppendorf, Hamburg,
Germany) using an initial denaturation at 94C for
4 min, followed by 35 cycles at 94C for 30 s, 58C for
30 s, 72C elongation for 35 s and a final incubation
at 72C for 7 min. In the case of FLV-1, the PCR mix-
ture contained 2.5 ll cDNA, 2.4 mm m MgCl2, 0.2 mm m
dNTPs, 0.4 lm m of each primer, and 1 unit of Taq
DNA polymerase. Amplification cycles consisted of
95C for 2 min, 35 cycles at 95C for 45 s, 52C for
30 s, 72C for 1 min and one last elongation cycle at
72C for 10 min.
Two DNA fragments each of 302 bp resulting from
the amplification of the partial RNA-dependent RNA
polymerase (RdRp) gene of two FMV-positive samples
were extracted from agarose gel and purified according

Table 1
List of primers used in RT-PCR for detection of fig viruses

Amplified Target gene

Viruses Primers Primer sequences (5¢–3¢) product (bp) region Reference

FMV E5-s CGGTAGCAAATGGAATGAAA 302 RdRp Elbeaino et al. (2009a)

E5-a AACACTGTTTTTGCGATTGG
FLV-1 CPtr-s CCATCTTCACCACACAAATGTC 389 CP Gattoni et al. (2009)
CPtr-a CAATCTTCTTGGCCTCCATAAG
FLMaV-1 N17-s CGTGGCTGATGCAAAGTTTA 350 HSP70 Elbeaino et al. (2006)
N17-a GTTAACGCATGCTTCCATGA
FLMaV-2 F3-s GAACAGTGCCTATCAGTTTGATTTG 360 HSP70 Elbeaino et al. (2007)
F3-a TCCCACCTCCTGCGAAGCTAGAGAA
FMMaV LM3s AAGGGGAATCTACAAGGGTCG 311 HSP70 Elbeaino et al. (2010)
LM3a TATTACGCGCTTGAGGATTGC

FMMaV; Fig mild mottle-associated virus; FLMaV-1; Fig leaf mottle-associated virus 1; RT-PCR; reverse transcription-polymerase chain
reaction; RdRp; RNA-dependent RNA polymerase; HSP70; Heat shock protein 70.
326
to the manufacturersÕ instruction (Gene JET TM Gel
Extraction Kit; Fermentas, St Leon-Rot, Germany) and
directly sequenced. Sequences were compared with their
homologues from GenBank using blast analysis (Altsc-
hul et al. 1997). Pairwise nucleotide alignment was per-
formed using clustalx 1.8 program (Pearson and
Lipman 1988). The phylogenetic tree was constructed
using the neighbour-joining algorithm (Saitou and Nei
1987), p-distance method (Nei and Kumar 2000) and
bootstrap consisting of 1200 pseudo-replicates, and
finally evaluated using the interior branch test method
ega 5 software (Tamura et al. 2007).
with Mega
Dot immunobinding assay (DIBA)
In addition to RT-PCR, the presence of FLV-1 and
FMV in the fig samples and inoculated herbaceous
plants was also monitored by DIBA (Hawkes et al.
1982). The polyclonal antiserum of FLV-1 was gently
provided by A. Minafra (Dipartimento di Protezione
delle Piante e Microbiologia Applicata, Università degli
Studi and Istituto di Virologia Vegetale del CNR, sezi-
one di Bari, Via Amendola 165 ⁄ A, 70126 Bari, Italy).
Proteins were extracted from 0.1 g of phloem tissues of
actively growing or dormant fig plants, ground to a fine
powder in liquid nitrogen and homogenized in 5 vol of
extraction buffer [Tris–HCl 0.5 mm m, pH 8.8, 4%
(wt ⁄ vol) SDS, 40% (wt ⁄ vol) glucose and 4% (wt ⁄ vol)
b-2-mercaptoethanol] as described by Berger et al.
(1989). Extracts were heated for 5 min at 100C, centri-
fuged at 5700 g for 3 min and spotted (30 ll) onto
PVDF (polyvinylidene fluoride) membrane. Blots were
(a) (b)
(c) (d)
Shahmirzaie et al.
then blocked with 5% nonfat dry milk and incubated
overnight at 4C. The anti-IgG were added at a dilution
of 1 : 300 for 1 h with slow agitation. After washing
with TBS 1· [1· Tris buffered saline (TBS): 50 mm m Tris-
HCl, pH 7.4; 150 mm m NaCl], blots were incubated for
30 min in anti-rabbit (Sigma-Aldrich, St. Louis, MO,
USA) antibodies conjugated with alkaline phosphatase
at a dilution of 1 : 2000 in TBS containing 5% dry milk.
For colorimetric detection, membranes were incubated
in alkaline phosphatase buffer pH 9.5 (100 mm m Tris–
HCl, 100 mm m NaCl, and 5 mm m MgCl2) containing
0.33 mg of nitro blue tetrazolium (Sigma-Aldrich) per
ml and 0.17 mg of 5-bromo-4-chloro-3-indolyl phos-
phate per ml (Sigma) in the dark for 5–15 min.
Results
Field observations
Fig mosaic symptoms were observed in most of the
monitored fields. Leaf symptoms ranged from light
chlorotic spotting to mottling, discoloration, mosaic
and deformation, according to the fig cultivar. The
margins of the chlorotic spots were surrounded by a
rust-coloured contour (Fig. 1). Premature fruit drop
was also observed in some mosaic-diseased fig trees.
Symptoms were mostly conspicuous in mid-spring and
autumn.
Surveys and detection of viruses associated with Fig Mosaic
All attempts to transmit fig-infecting viruses and puta-
tive unknown viruses possibly present in the Iranian fig
material to mechanically inoculated herbaceous hosts
Fig. 1 Leaves from affected fig
trees showing fig mosaic disease
symptoms. (a) Interveinal
chlorosis, (b) mosaic spots with
rust-coloured contour, (c) leaf
discoloration and (d) deformation
and chlorotic mottling
Current Status of Fig Mosaic Disease in Iran 327

failed. No symptoms were observed in the inoculated
herbaceous hosts or by subinoculation to new sets of
herbaceous plants. All inoculated plants were negative
in PCR for the presence of FLMaV-1, FLMaV-2,
FMMaV, FLV-1 and FMV.
PCR results indicated that FMV, FLV-1 and
FLMaV-1 were all detected in fig samples to different
extents, whereas FMMaV and FLMaV-2 were absent.
In particular, of 104 fig samples tested, FMV, FLV-1
and FLMaV-1 were detected in 19 samples, with an
average infection level of 18.3%. The prevalence of
these viruses in fig plants varied according to provinces
and even to districts of the same province. Both
Tehran and Varamin districts had the highest preva-
lence of infection (50%), followed by Semnan (42.9%),
Gorgan (40%), Khorramabad (28.6%) and Noshahr
(25%) districts. Conversely, no virus infection was
detected in the districts of Estahban (Fars province),
Lahijan (Mazandaran), Karaj (Tehran) and Siahkal
(Gilan). FLV-1, FLMaV-1 and FMV were detected in
14.5, 11.5 and 8.6% of the samples, respectively
(Table 2). High levels of mixed infections by all these
three viruses were found in Varamin (35.7%) and
Khorramabad (28.6%), whereas mixed infection with
FLV-1 and FLMaV-1 were detected in Gorgan (20%),
Tehran (25%) and Noshahr (25%).
Fig mosaic virus was present only in Tehran and
Lorestan provinces, whereas FLV-1 was detected in all
provinces, except Fars and Gilan. Infection by FLV-1
ranged from 14.2% in Khorramabad region to 42.9%
in Semnan. Infection by FLMaV-1 in the tested sam-
ples was detected in Tehran, Golestan, Mazandaran
and Lorestan, but not in Semnan, Gilan and Fars
provinces. Accordingly, samples from Semnan Prov-
ince showed to be highly infected (42.9%), when com-
pared to Golestan (40%), Tehran (32.3%), Lorestan
(28.6%) and Mazandaran (25%) provinces.
The results of DIBA, conducted on protein extracts
from symptomatic leaf samples using anti-IgG for
FLV-1 and FMV, confirmed the results of RT-PCR
assays (Fig. 2a and b). These two viruses were readily
detectable by DIBA from symptomatic and fresh
leaves of infected fig plants, but not from asymptom-
atic leaves and ⁄ or dormant fig cuttings. Reverse tran-
scription-polymerase chain reaction was more sensitive
to detect both viruses at any period of the year using
any kind of fig material.
dsRNA extraction
Electrophoretic analysis of dsRNA extracts recovered
from symptomatic fig leaf tissues yielded multiple
bands with sizes ranging from 0.6 to c. 7 kbp
(Fig. 3d). An additional faint band (c. 8 kbp), located
above the 7 kbp band, was also observed in few sam-
ples (Fig. 3d). The sizes of these dsRNA segments
recalled those recovered from fig mosaic-diseased
plants infected by FMV.
Phylogenetic analysis
Sequence blast analysis of the two FMV isolates
from Iran (Accession numbers: HQ732253.1 and
HQ732254.1) disclosed 89–93 and 88–92% identities at
the nucleotides (nt) and amino acids (aa) levels, respec-
tively, with FMV sequences from GenBank.
Pairwise nucleotides comparison of both Iranian iso-
lates showed low levels of divergence (5%) amongst
them and accordingly, the phylogenetic tree clustered
them in one separate clade, close to those deriving
from Turkey, but distant from the USA and Italian
ones (Fig. 4).
Discussion
Undoubtedly, FMD is an economically important
disease of fig trees because of its drastic impact on

Table 2
Prevalence of fig-infecting viruses in seven fig-growing provinces of Iran as assessed by RT-PCR

FLMaV-
Tested trees Infected trees FMV FLV-1 FMMaV FLMaV-1 2

Province District No No % No % No % No % No % No %
a a
Tehran Tehran 8 4 50 0 0 3 37.5 0 0 3 37.5 0 0
Karaj 12 0 0 0 0 0 0 0 0 0 0 0 0
Varamin 14 7 50 (32.3)b 7c 50 5c 35.7 0 0 5c 35.7 0 0
Fars Estahban 20 0 0 0 0 0 0 0 0 0 0 0 0
Golestan Gorgan 5 2 40 0 0 2d 40 0 0 1d 20 0 0
Mazandaran Noshahr 4 1 25 0 0 1d 25 0 0 1d 25 0 0
Gilan Lahijan 18 0 0 0 0 0 0 0 0 0 0 0 0
Siahkal 9 0 0 0 0 0 0 0 0 0 0 0 0
(0)b
Semnan Semnan 7 3 42.9 0 0 3 42.9 0 0 0 0 0 0
Lorestan Khorramabad 7 2 28.6 2a 28.6 1 14.2 0 0 2a 28.6 0 0
Total infection 104 19 9 15 12
Mean infection 18.3 8.6 14.5 11.5

FMV, Fig mosaic virus; FLV-1, Fig latent virus 1; FMMaV, Fig mild mottle-associated virus; FLMaV-1, Fig leaf mottle-associated virus 1;
FLMaV-2, Fig leaf mottle- mottle-associated virus 2; RT-PCR, reverse transcription-polymerase chain reaction.
a
Two mixed-infected samples;
b
Mean infection in each province;
c
Five mixed-infected samples;
d
One mixed-infected sample.
328 Shahmirzaie et al.

(a)

(b) Fig. 4 Phylogram generated from the alignment of nucleotide

sequences of partial RdRp gene (302 nt) of two Fig mosaic virus
(FMV) isolates from Iran, together with the homologue gene of
those from Turkey, Italy and USA. GenBank accession numbers of
nucleotides sequence used are reported between brackets. Bootstrap
percentages of clades are shown along internal branches of trees
derived from bootstrap-resampled data sets. Branch lengths represent
bootstrap values. The tree was rooted with the RdRp of Tomato
spotted wilt virus (TSWV), a member of the genus Tospovirus (family
Bunyaviridae), which was used as an out-group species

Fig. 2 PVDF membrane showing the detection of FLV-1 (A) and

Fig mosaic virus (FMV) (B) by dot immunobinding assay conducted
on total leaf protein extracted from fig plants and probed with
FLV-1 and FMV antisera, respectively. Infected samples and ⁄ or
positive reactions are represented by dots. No reactions are obtained
from healthy fig material (2c, 4c), which was previously checked by
reverse transcription-polymerase chain reaction for the two viruses.
Lanes e1–e3, e4 and e5 represent FLV-1- and FMV-infected fig
plants used as positive controls
production worldwide. Its ubiquitous presence in all
parts of the world, that is, Spain, England, Albania,
Cyprus, Greece, Turkey, Israel, Yemen, Egypt,
Tunisia, Algeria, Morocco, Mexico, Australia, South
Africa, Italy and America (Martelli et al. 1993; Ahn
et al. 1996; Castellano et al. 2007; Elbeaino et al.
2009a), and now in Iran also, makes this disease a
challenge for germplasm exchange between the coun-
tries. In our study, we aimed to determine the preva-
lence and distribution of five known fig-infecting
viruses in the main fig-growing areas of Iran, and in
particular, in seven provinces where approximately
65% of the national fig production is concentrated.
Our survey showed the presence of FLV-1, FLMaV-1

(a) (b)

Fig. 3 Reverse transcription-poly-

merase chain reaction (RT-PCR)
products amplified from total
nucleic acids and ⁄ or dsRNA
extracts obtained from leaf tissues
of field-grown symptomatic fig
trees. (a) Fig mosaic virus (FMV),
(b) Fig latent virus 1 (FLV-1) and
(c) Fig leaf mottle-associated virus
1 (FLMaV-1). Lanes 1–4 (a), 1–2
(b) and 1–3 (c) represent RT-
PCR-positive fig samples. Electro-
phoretic pattern of dsRNA
extracted from young leaves of
(c) (d) symptomatic fig trees (lanes 1, 2)
(d). The profile shows several
dsRNA bands ranging from
approximately 0.6–7 kbp. No
dsRNA bands were recovered
from symptomless fig trees (lanes
H). N and NC = negative
controls (cDNA and PCR
conducted on healthy fig mate-
rial). L = 100 bp DNA ladder
(Fermentas, Germany).
PC = infected fig material used
as a positive control for FMV,
FLV-1 and FMV amplifications in
RT-PCR
Current Status of Fig Mosaic Disease in Iran
and FMV in the visited orchards and in private gar-
dens with different extent of infections. Based on PCR
results, FLV-1 was the commonest virus in Iran
(14.5%), and its significant prevalence may be related
to the activity of potential vectors in infected fig culti-
vations (i.e. eriophyid mites and ⁄ or pseudococcid
mealybugs) that are known to be efficient in the trans-
mission of other species of genus Trichovirus and fam-
ily Flexiviridae (Martelli et al. 1994; Adams et al.
2004) and the presence of which has already been
reported in Iran (Williams and Moghaddam 1999; Xue
et al. 2009). However, no natural vector for FLV-1 is
known, although in nature, it is seed-transmitted
(Castellano et al. 2009), but this mode of virus spread
is of minor importance as most of the fig nurseries
propagate fig plants by cuttings. Considering that this
virus remains latent in infected plants, its impact on
fig production in Iran as well as elsewhere is of a
minor importance.
Infection by FLMaV-1 was not equally distributed
in Iran, as it ranged from a total absence to in some
provinces to peaks of 37.5% in other ones. Moreover,
this prevalence can be considered low if compared with
that of other countries (Lebanon, Tunisia, Egypt,
Saudi Arabia, Albania, Mexico, South Africa and
Italy) where it ranged from 20 to 60% (Elbeaino et al.
2006, 2007, 2009c; Nahdi et al. 2006; Castellano et al.
2007; Elbeshehy and Elbeaino 2011). Comforting was
the absence in the surveyed Iranian fig orchards of
FLMaV-2 and FMMaV, contrary to their occurrence
in other Mediterranean countries (Elbeaino et al.
2009c, 2010; Caglar et al. 2011; Elbeshehy and Elbeaino
2011).
The symptoms of leaf mottling and deformation, dis-
coloration and light chlorotic spotting on young leaves
observed in the surveyed fig orchards all recall those
previously reported from FMD plants worldwide
(Elbeaino et al. 2009c, 2010; Gattoni et al. 2009; Caglar
et al. 2011), and in particular those infected by FMV.
Indeed, in the Iranian fig trees, the presence of FMV
was also ascertained by the electrophoretic analysis of
dsRNA extracts from leaf tissues obtained from symp-
tomatic plants. The multipartite pattern observed for
these samples was similar to that described in previous
reports in FMV-infected fig trees (Elbeaino et al.
2009a,b), except for the presence in some samples of a
faint fifth dsRNA band of c. 8 kbp (Fig. 3), which
could be the result of a co-infection with FLV-1 or of
an unknown virus to be determined. However, FMV
was detected in 8.6% of the tested samples and only in
fig trees collected from two provinces neighbouring the
northern part of Turkey, whilst it was absent in the
other five provinces surveyed. This result is consistent
with that of Caglar et al. (2011), who reported a similar
infection rate (7.6%) in Turkish areas bordering Iran.
The phylogeny of FMV isolates from Turkey and
Iran seems consistent with the geographical origin,
and indeed, the identification of these isolates has a
common evolutionary origin. Interesting was the
observation of mosaic-like symptoms in 20 PCR-nega-
329
tive samples to FMV in fig trees of Estahban district.
This finding further supports the complex nature of
FMD, for which FMV is responsible but, probably,
does not play an exclusive role (Martelli 2011).
Reverse transcription-polymerase chain reaction is
now used as a tool of choice to detect FMV and
FLV-1, independently from the period and the type of
fig tissue used. In our survey, DIBA was used as an
alternative, but it showed to be sufficiently sensitive to
detect both viruses exclusively in spring ⁄ summer time
and on fresh fig tissues. Accordingly, taking into
account the previous requirements, the application of
DIBA could be especially useful in clean-stock pro-
grammes and for large-scale detection of both viruses.
A discrepancy from our work was the failure to trans-
mit mechanically FLV-1 to herbaceous plants (Gattoni
et al. 2009). This result is not exceptional if we con-
sider that the fig sap contains high concentration
of polyphenols, which could interfere or inhibit the
multiplication and ⁄ or transmission of mechanically
transmissible viruses, that is, closteroviruses (FLMaV-
1 and FMMaV) and FLV-1. Whether unsuccessful
transmission was owing to these difficulties or to the
presence of different strains of FLV-1 in Iran needs to
be verified.
In conclusion, we report here for the first time the
presence of viruses naturally infecting fig trees in Iran
and give an insight of their impact on fig production
in the country. Further investigations on other fig-
infecting viruses are needed to better evaluate the sani-
tary status of this culture and to start a programme
for the sanitary and clonal selection of local fig varie-
ties to be used as ÔhealthyÕ mother plants for multipli-
cation and distribution to the growers.
Acknowledgements
This work was supported by the Plant Pathology Department of
Islamic Azad University (Tehran). Many thanks are due to Prof.
G.P. Martelli for his invaluable advice during this study. We are
grateful to Dr. A. Minafra who kindly provided antisera and positive
controls used.
References
Açikgöz S, Döken MT. (2003) Determination of sampling time for
dsRNA isolation of the agent of fig mosaic disease prevalence in
Aegean region-Turkey. Acta Hortic 605:307–310.
Adams MJ, Antoniw JF, Bar-Joseph M, Brunt AA, Candresse T,
Foster GD, Martelli GP, Milne RG, Fauquet CM. (2004) The
new plant virus family Flexiviridae and assessment of molecular
criteria for species demarcation. Arch Virol 149:1045–1060.
Ahn KK, Kim KS, Gergerich RC, Jensen SG, Anderson EJ. (1996)
Comparative ultrastructure of double membrane-bound particles
and inclusions associated with eriophyid mite-borne plant disease
of unknown etiology: a potentially new group of plant viruses.
J Submicrosc Cytol Pathol 28:345–355.
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller
W, Lipman DJ. (1997) Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids Res
25:3389–3402.
Anonymous. (2009) FAOSTAT. Preliminary 2009 Production Data.
Statistical Data. http://www.faostat.fao.org (verified Dec 25,
2011).
Berger HP, Hunt AG, Domier LL, Hellmann GM, Stram Y, Thorn-
bury DW. (1989) Expression in transgenic plants of a viral gene
330
product that mediates insect transmission of potyviruses. Proc Nat
Acad Sci USA 86:8402–8406.
Blodgett EC, Gomec B. (1967) Fig mosaic. Plant Dis Rep 46:693.
Caglar BK, Fidan H, Guldur ME, Elbeaino T. (2011) The prevalence
of three viruses infecting fig in southern Turkey. J Phytopathol
159:181–183.
Castellano MA, Gattoni G, Minafra A, Conti M, Martelli GP.
(2007) Fig mosaic in Mexico and South Africa. J Plant Pathol
89:441–444.
Castellano MA, Stradis AD, Minafra A, Boscia D, Martelli GP.
(2009) Seed transmission of Fig latent virus 1. J Plant Pathol
91:697–700.
Channuntapipat C, Sedgley M, Collins G. (2001) Sequences of the
cDNAs and genomic DNAs encoding the S1, S7, S8, and Sf alleles
from almond, Prunus dulcis. Theor Appl Genet 103:1115–1122.
Condit IJ, Horne WT. (1933) A mosaic of the fig in California.
Phytopathology 23:887–896.
Elbeaino T, Digiaro M, De Stradis A, Martelli GP. (2006) Partial
characterization of a closterovirus associated with a chlorotic
mottling of fig. J Plant Pathol 88:187–192.
Elbeaino T, Choueiri E, Hobeika C, Digiaro M. (2007) Presence of
fig leaf mottle-associated virus 1 and 2 in Lebanese fig orchards.
J Plant Pathol 89:409–411.
Elbeaino T, Digiaro M, Alabdullah AK, De Stradis A, Minafra A,
Mielke N, Castellano MA, Martelli GP. (2009a) A multipartite
negative-sense single-stranded RNA virus is the putative agent of
fig mosaic disease. J Gen Virol 90:1281–1288.
Elbeaino T, Digiaro M, Martelli GP. (2009b) Complete nucleotides
sequence of four viral RNAs segments of fig mosaic virus. Arch
Virol 154:1719–1727.
Elbeaino T, Nahdi S, Digiaro M, Alabdullah A, Martelli GP.
(2009c) Detection of Fig leaf mottle-associated virus 1 and Fig leaf
mottle-associated virus 2 in the Mediterranean region and study
on sequence variation of the hsp70 gene. J Plant Pathol 91:425–
431.
Elbeaino T, Digiaro M, Heinoun K, Stradis AD, Martelli GP.
(2010) Fig mild mottle- associated virus, a novel closterovirus
infecting fig. J Plant Pathol 92:165–172.
Elbeaino T, Digiaro M, Martelli GP. (2011a) The complete sequence
of Fig fleck-associated virus, a novel Tymoviridae member infect-
ing fig. Virus Res 161:198–202.
Elbeaino T, Abou Kubaa R, Digiaro M, Minafra A, Martelli GP.
(2011b) The complete nucleotide sequence and genome organisa-
tion of fig cryptic virus, a novel bipartite dsRNA virus infecting
fig, widely distributed in the Mediterranean basin. Virus Genes
42:415–421.
Elbeshehy EKF, Elbeaino T. (2011) Viruses infecting figs in Egypt.
Phytopathol Mediterr 50:327–332.
View publication stats
Shahmirzaie et al.
Flock RA, Wallace JM. (1955) Transmission of fig mosaic by the
eriophyid mite Aceria ficus. Phytopathology 45:52–54.
Gattoni G, Minafra A, De Stradis A, Castellano MA, Boscia D,
Elbeaino T, Digiaro M, Martelli GP. (2009) Some properties of
Fig latent virus 1, a new member of the family Flexiviridae.
J Plant Pathol 91:555–564.
Hawkes R, Niday E, Gordon J. (1982) A dot-immunobinding assay
for monoclonal and other antibodies. Anal Biochem 119:142–147.
Martelli GP. (2011) Fig mosaic disease and associated pathogens. In:
Hadidi A, Barba M, Candresse T, Jelkmann W. (eds) Virus and
Virus Like Diseases of Pome and Stone Fruits. St. Paul, MN,
USA, APS Press, pp 281–287.
Martelli GP, Castellano MA, Lafortezza R. (1993) An ultrastructur-
al study of fig mosaic. Phytopathol Medit 32:33–43.
Martelli GP, Candresse T, Namba S. (1994) Trichovirus, a new genus
of plant viruses. Arch Virol 134:451–455.
Nahdi S, Elbeaino T, Digiaro M, Martelli GP. (2006) First record of
Fig leaf mottle virus 1 in Tunisia. J Plant Pathol 89:70.
Nei M, Kumar S. (2000) Molecular Evolution and Phylogenetics.
New York, Oxford University Press, pp 333.
Pearson WR, Lipman DJ. (1988) Improved tools for biological
sequence comparison. Proc Nat Acad Sci USA 85:2444–2448.
Saddoud O, Salhi-Hannachi A, Chatti K, Mars M, Rhouma A,
Marrakchi M, Trifi M. (2005) Tunisian fig (Ficus carica L.) genetic
diversity and cultivar characterization using microsatellite markers.
Fruits 60:143–153.
Saitou N, Nei M. (1987) The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol Biol Evol 4:
406–425.
Saldarelli P, Minafra A, Martelli GP, Walter B. (1994) Detection of
grapevine leafroll-associated closterovirus III by molecular hybrid-
ization. Plant Pathol 43:91–96.
Swingle EWT. (1928) New crops for Arizona and improvement of
old ones. Assoc Ariz Producer 7:3; 5; 10–11; 13.
Tamura K, Dudley J, Nei M, Kumar S. (2007) MEGA4: Molecular
Evolutionary Genetics Analysis (MEGA) software version 4.0.
Mol Biol Evol 24:1596–1599.
Valverde RA, Nameth ST, Jordan RL. (1990) Analysis of double-
stranded RNA for plant virus diagnosis. Plant Dis 74:255–258.
Williams DJ, Moghaddam M. (1999) Mealybug species of the genus
Planococcus Ferris in Iran (Homoptera: Coccoidae, Pseudococci-
dae) with a discussion of Planococcus vovae (Nasonov). J Entomol
Soc Iran 18:32–40.
Xue XF, Sadeghi H, Hong XY. (2009) Eriophyoid mites (Acari:
Eriophyoidea) from Iran, with descriptions of three new species,
one new record and a checklist. Int J Acarology 35:461–483.