J Phytopathol

SHORT COMMUNICATION

Fig Viruses in Mainland Spain

ndez, Desamparados Herna
Ana Alfaro-Ferna
ndez-Llopis and Mar
ıa Isabel Font
Grupo de Virolog
ıa, Instituto Agroforestal Mediterr
aneo, Universidad Polit
ecnica de Valencia, Camino de Vera s/n, 46022 Valencia, Spain

Keywords
Ficus carica, fig leaf mottle-associated virus 1,
fig mild mottle-associated virus, fig mosaic
disease, fig mosaic virus, RT-PCR
Correspondence
A. Alfaro-Fern
andez, Grupo de Virolog
ıa,
Instituto Agroforestal Mediterr
aneo,

cnica de Valencia, Valencia,
Universidad Polite
Spain.
E-mail: analfer1@doctor.upv.es
Received: July 10, 2013; accepted: September
2, 2013.
doi: 10.1111/jph.12187
Abstract
A survey of fig viruses was conducted from 2010 to 2012 on individual fig
trees from outdoor gardens showing different symptoms associated with
fig mosaic disease. A total of 30 fig leaf samples were collected from eight
different provinces of mainland Spain and tested by reverse transcription
polymerase chain reaction (RT-PCR) to assess the presence of fig mosaic
virus (FMV), fig leaf mottle-associated virus 1 (FLMaV-1), fig leaf mottle-
associated virus 2 (FLMaV-2), fig mild mottle-associated virus (FMMaV),
fig latent virus 1 (FLV-1) and Fig fleck-associated virus (FFkaV). The
96.7% (29 samples of 30) of the analysed samples were infected with
FMV, 16.7% (5 of 30) with FLMaV-1 and 26.7% (8 of 30) with FMMaV,
whereas all samples were negative for FLMaV-2, FLV-1 and FFkaV. Mixed
infection was observed in 13 samples. Sequencing analyses results showed
that FMV, FMMaV and FLMaV-1 Spanish isolates shared 89–93% nt iden-
tity with other Mediterranean isolates of the same viruses. Phylogenetic
analyses of the amplified RdRp fragment from the FMV grouped the Span-
ish isolates into a subgroup together with Japanese, Canadian and some
Serbian and Turkish isolates. To our knowledge, this is the first report of
FMV, FMMaV and FLMaV-1 occurring in mainland Spain.

mite Aceria ficus with a semipersistent modality and

Introduction
The common fig (Ficus carica) is grown in Spain as
individual or scattered trees in outdoor gardens and
in commercial orchards. Spain is the eighth largest
fig producer in the world (11 339 tons) and the first
in the European Union (FAO 2013). In 2005, fig
mosaic disease (FMD) was reported in commercial
fields of two different Spanish provinces located on
the east coast, Lleida and Alicante, but no virus was
associated with the disease at that time. However,
the average incidence and the disease severity of
FMD were c. 95 and 13%, respectively. The maxi-
mum expression of the disease was observed during
spring, but there were differences in severity on dif-
ferent fig cultivars (Segarra et al. 2005). Symptoms
associated with FMD include chlorotic mottling and
blotching, banding, clearing and feathering of veins,
chlorotic and necrotic ring spots, and line patterns
and malformation of leaves (Elbeaino et al. 2007;
Martelli 2011). FMD is transmitted by the eriophyid
by grafting (Flock and Wallance 1955). This mite is
highly host specific and mainly restricted to species
of the genus Ficus, but the pathogen is not transmit-
ted through the egg (Oldfield 1970). The putative
causal agent of the disease was recently identified as
fig mosaic virus (FMV), a species in the family Bunya-
viridae, although the Koch′s postulates remain to be
fulfilled due to the difficulty of sap inoculation
(Elbeaino et al. 2009). However, other viruses have
been detected in fig symptomatic trees, such as fig
leaf mottle-associated virus 1 (FLMaV-1), fig leaf
mottle-associated virus 2 (FLMaV-2) and fig mild
mottle-associated virus (FMMaV), which belong to
the family Closteroviridae (Elbeaino et al. 2006, 2007,
2010), fig latent virus 1 (FLV-1, family Flexiviridae;
Gattoni et al. 2009) or fig fleck-associated virus
(FFkaV, family Tymoviridae) (Elbeaino et al. 2011a).
In the Canary Islands (Spain), FMV, FLMaV-1,
FLMaV-2, FMMaV and FLV-1 were recently
reported in trees from three different islands

332 J Phytopathol 162 (2014) 332–337 Ó 2013 Blackwell Verlag GmbH

A. Alfaro-Fern

andez, D. Hern
andez-Llopis and M. I. Font Fig viruses in Spain

(El Hierro, Gran Canaria and Tenerife) (Elbeaino

et al. 2011b).
To gather information on the possible presence of
these five fig-infecting viruses (FMV, FLMaV-1,
FLMAV-2, FMMaV, FLV-1 and FFkaV) in fig trees in
mainland Spain, a survey was conducted in scattered
symptomatic trees in different Spanish provinces.
Material and Methods
Thirty-two fig leaf samples were collected during
2010, 2011 and 2012 from trees that had different
symptoms associated with fig mosaic disease culti-
vated as individual trees or in outdoor gardens
(Table 1). Thirty were collected in eight different

Table 1 Results of RT-PCR of the fig samples collected in different provinces of Spain

RT-PCR resultsc
Sample Collection
codea date Location Province Symptomsb FMV FLMaV-1 FLMaV-2 FLV-1 FMMaV FFkaV

CAS-10.1 Jun-10 Altura
n

Castello m, vc, ns + (KC914280) +
CAS-10.2 Jun-10 Altura
n
Castello rs + +
VAL-11.1 Apr-11 Ribarroja del Valencia m +

ria
Tu
CAS-11.1 May-11 Montanejos
n
Castello vd, b + +
CAS-11.2 May-11 Montanejos
n
Castello m, ld +
CAS-11.3 May-11 Montanejos
n
Castello m + + + (KC914282)
CAS-11.4 May-11 Montanejos
n
Castello m, b + +
CAS-11.5 May-11 Puebla de
n
Castello m, vd, ld + +
Arenoso
VAL-11.2 May-11 Valencia Valencia m, ld +
VAL-11.3 May-11 Picassent Valencia m +
MAL-11.1 May-11 Ronda M
alaga m +
MAL-11.2 May-11 Ronda M
alaga m, ld, rs +
GRA-11.1 May-11 Diezmas Granada n, vd +d
GIP-11.1 Jun-11 San Sebasti

an Gipuzkoa m +d
GIP-11.2 Jun-11 San Sebasti

an Gipuzkoa m +
GIP-11.3 Jun-11 San Sebasti

an Gipuzkoa m +
CAS-11.6 Jul-11 Alcossebre
n
Castello rs +
VAL-11.4 Jul-11 Valencia Valencia m, rs +
CAS-11.7 Aug-11 Vall
n
Castello m + +
d’Almonacid
CAS-11.8 Aug-11 Vall
n
Castello b, m +
d’Almonacid
CAS-11.9 Aug-11 Vall
n
Castello m + +
d’Almonacid
d
VAL-11.5 Sep-11 Albal Valencia m
CAS-11.10 Sep-11 Algimia de
n
Castello mo +d
Almonacid
ZAR-11.1 Nov-11 Biel Zaragoza mm + (KC914279) + (KC914284)
ZAR-11.2 Nov-11 Biel Zaragoza mm +
BCN-12.1 May-12 Barcelona Barcelona mm +d
CAS-12.1 May-12 Cho
var
n
Castello mm +d
TEN-12.1 Jun-12 Icod Tenerife vc, y +d
TEN-12.2 Jun-12 Icod Tenerife m, rs + +
CAS-12.2 Jul-12 Segorbe
n
Castello n, rs + + (KC914283)
GRA-12.1 Aug-12 Fornes Granada mm + (KC914281)
BUR-12.1 Aug-12 Tobera Burgos mm + + (KC914285)

a

n; GIP, Gipuzkoa;
The fig samples were codified by a three-letter code indicative of geographical origin (BCN, Barcelona; BUR, Burgos; CAS, Castello
GRA, Granada; MAL, M
alaga; TEN, Tenerife; ZAR, Zaragoza) followed by the year of collection and the number of sample.
b
Symptoms observed were: b, bubbling; ld, leaf deformation; m, mosaic; mm, mild mosaic; mo, mottling; n, necrosis; ns, necrotic spots; rs, ring spot;
vc, vein clearing; vd, vein distorting; y, interveinal yellowing.
c
Accession numbers of the sequenced fragments are indicated in parenthesis.
d
Samples, which resulted negative with E5s/E5as, were analysed again with FMVNp-s/FMV Np-as primer pair. The result indicated in the table was
obtained with the second primer pair.

J Phytopathol 162 (2014) 332–337 Ó 2013 Blackwell Verlag GmbH 333

Fig viruses in Spain A. Alfaro-Fern
andez, D. Hern
andez-Llopis and M. I. Font

provinces of mainland Spain and two in Tenerife
(Canary Islands; Table 1) Moreover, two asymptom-
atic trees were also surveyed and tested. Samples
consisted of two leaves of the same tree from 1-year-
old shoots, which were labelled and stored in plastic
bags at 4°C and transferred to the laboratory. Total
nucleic acids (TNAs) were extracted from 100 mg of
leaf vein tissues using the silica-capture protocol
(Foissac et al. 2001) and stored at 20°C until used.
One-step RT-PCR assays were carried out using the
SuperScript III One-Step RT-PCR system with the
Platinum Taq DNA polymerase kit (Invitrogen Life
Technologies, Barcelona, Spain) with specific primer
pairs for FMV, FFKaV, FLMaV-1, FLMaV-2, FLV-1
and FMMaV (Table 2). Two primer pairs of FMV were
used in this work, when a negative result in a symp-
tomatic sample was detected. Total nucleic extracts
were analysed in a reaction mix, which included
0.5 lM for the reverse and forward primers, 19 reac-
tion buffer (containing 0.4 mM dNTPs and 2.4 mM
MgSO4), 0.1 ll RNaseOUTTM (Invitrogen Life Technol-
ogies) and 0.4 ll of the RT/Taq polymerase enzyme
mix, in a final reaction volume of 10 ll.
The RT-PCR programme consisted of a reverse tran-
scription step at 50°C for 30 min, followed by 2 min
at 94°C and 40 cycles of 94°C for 15 s, an annealing
temperature appropriate for specific primers for 30 s
and 68°C for 1 min, plus final incubation at 68°C for
10 min to finish the incomplete PCR fragments.
The positive controls of all the viruses analysed
were kindly provided by Dr. Ebeaino T. (Istituto Agro-
nomico Mediterraneo di Bari, Italy).
The amplified PCR products were analysed on 1.2%
agarose gel in 19 TAE buffer, stained with ethidium
bromide and visualized under UV light. The amplified
fragments were purified using the High Pure PCR
Product Purification Kit (Roche Diagnostics) and were
directly sequenced and deposited in the GenBank
database (the accession numbers are shown in
Table 1). The phylogenetic analyses based on the
predicted amino acid (aa) sequences of the amplified
fragment of the RNA-dependent RNA polymerase
gene of FMV were performed by MEGA (Molecular
Evolutionary Genetics Analysis), version 5.0 (Tamura
et al. 2011). The statistical reliability of the
constructed tree was assessed by the bootstrap method
based on 10 000 pseudoreplicates. The comparative
analyses were performed using sequences available in
the GenBank database (http://www.ncbi.nlm.nih.
gov/).
Results and Discussion
The fig mosaic symptoms observed on leaves had dis-
coloration ranging from mild mosaics and interveinal
yellowing to ring spots and necrosis. Moreover, some
leaf and vein distortion was observed in several
surveyed samples (Table 1; Fig. 1).
The RT-PCR analyses revealed the presence of
FMV, FLMaV-1 and FMMaV. Of the 30 samples col-
lected in mainland Spain, 96.7% (29 samples of 30)
were infected with FMV, 16.7% (5 of 30) with
FLMaV-1 and 26.7% (8 of 30) with FMMaV. The
presence of FMV was detected in different locations in
all the provinces surveyed. FLMaV-1 and FMMaV
were always present in the trees coinfected with FMV.
Mixed infection was observed in 13 samples, double
infections of FMV with FLMaV-1 in four samples

Table 2 Sequences of the fig viruses-specific primers used in the assay

Primer Fragment
name Sense Sequence (5′3′) Virus Family (bp) Amplified region Reference

N17s F CGTGGCTGATGCAAAGTTTA FLMaV-1 Closteroviridae 340 HSP70 Elbeaino et al. 2006;

N17a R GTTAACGCATGCTTCCATGA
F3s F GAACAGTGCCTATCAGTTTGATTTG FLMaV-2 Closteroviridae 360 HSP70 Elbeaino et al. 2007;
F3a R TCCCACCTCCTGCGAAGCTAGAGAA
CPtr1 F CCATCTTCACCACACAAATGTC FLV-1 Flexiviridae 389 CP Gattoni et al. 2009;
CPtr2 R CAATCTTCTTGGCCTCCATAAG
LM3s F AAGGGGAATCTACAAGGGTCG FMMaV Closteroviridae 308 HSP70 Elbeaino et al. 2010;
LM3a R TATTACGCGCTTGAGGATTGC
E5-S F CGGTAGCAAATGGAATGAAA FMV Bunyavirdae 302 RNA1-RdRp Elbeaino et al. 2009;
E5-AS R AACACTGTTTTTGCGATTG
FMV Np-s F CACGAGCAAGACAAAGAGAA FMV Bunyavirdae 298 RNA3- Nucleocapsid Elcßi et al. 2013;
FMV Np- as R CACACTTACACATCTTACATCATCT
CP-Fks F ATGACGACTGTCAACTCCCT FFkaV Tymovirdae 671 CP Elbeaino et al. 2011a
CP-Fkas R TTAAGCCAGGGTGGGAGTGTTG

334 J Phytopathol 162 (2014) 332–337 Ó 2013 Blackwell Verlag GmbH

A. Alfaro-Fern

andez, D. Hern
andez-Llopis and M. I. Font
collected in two different locations of the province of
Castell

on, and also in the provinces of Zaragoza and
Burgos. Coinfection of FMV and FMMaV was also
detected in seven samples collected in four different
locations of the province of Castell

on and in one sam-
ple from Tenerife. Furthermore, one triple infection
was detected on sample CAS-11.3, which was
collected in 2011 in the province of Castell

on (Table 1).
None of the collected samples was infected with
FLMaV-2, FLV-1 or FFkaV (Table 1). Surprisingly, six
samples which were negative for FMV with the
primer pair which amplify a fragment of the RNA-
dependent RNA polymerase (RdRp) were positive in
further RT-PCR analyses with primers specific to a
fragment of 298 bp of the nucleocapsid (Nc), which
Fig. 1 Symptoms on leaves of fig trees with
mosaic diseases showing bubbling (b), leaf
deformation (ld), mosaic (m), mild mosaic
(mm), mottling (mo), necrosis (n), necrotic
spots (ns), ring spots (rs), vein clearing (vc),
vein distorting (vd) and yellowing (y).
J Phytopathol 162 (2014) 332–337 Ó 2013 Blackwell Verlag GmbH
Fig viruses in Spain
could indicate putative sequence variations of the
Spanish isolates.
The symptoms observed in the fig samples differed,
and there was no correlation between symptom
expression and virus presence. Moreover, one symp-
tomatic sample was negative for all the tested viruses
(Table 2). FMV is reported to have an uneven accu-
mulation in individual trees (Ishikawa et al. 2012),
and the incidence of the disease varies depending on
the fig cultivar (Segarra et al. 2005). The feeding of
the mite A. ficus also causes symptoms commonly
associated with the disease (Ebeling and Pence 1950).
Moreover, another new virus could be implicated in
this symptom development. These results are similar
to those obtained in recent studies conducted in the
335
Fig viruses in Spain A. Alfaro-Fern
andez, D. Hern
andez-Llopis and M. I. Font

Canary Islands, which demonstrated the presence of
all these five viruses on the islands, where FMV,
FLMaV-1 and FMMaV were detected more
frequently. Other Mediterranean or West Asian coun-
tries where the incidence of fig viruses has also been
studied present different situations. In Turkey, only
FMV and FLMaV-2 were detected (Caglar et al.
2011), and in Iran, FLV-1, FLMaV-1 and FMV were
found, but FLMaV-2 and FMMaV were absent
(Shahmirzaie et al. 2012). This variation on the
viruses detected in diseased fig trees indicates the
complex nature of FMD where FMV plays a signifi-
cant, but not exclusive role (Elbeaino et al. 2011b).
Sequences of three FMV isolates (CAS-10.1, ZAR-
11.1 and GRA-12.1) showed 90–93% nt identity with
the sequences from the FMV isolate SB1 collected in
Serbia (accession number AB697827). Two FMMaV
isolates (CAS-11.3 and CAS-12.2) were sequenced
and showed 91% nt identity with isolate Cal1 from
Italy (accession number FJ611959). Two isolates of
FLMaV-1 (ZAR-11.1 and BUR-12.1) were also
sequenced and presented 89% nt identity with an
isolate from Italy (accession number AM113547). The
studied sequences presented a nucleotide variation of
more than 7%, a similar level was also reported from
isolates from different Mediterranean countries
(Caglar et al. 2011; Ishikawa et al. 2012). The phylo-
genetic analyses of the amplified RdRp fragment from
the FMV Spanish isolates grouped them into two
different subclades, isolates CAS-10.1 and GRA 12.1
in the subgroup together with Japanese (JS1 and
JTT-Vi) and Turkish isolates (ESA) and ZAR-11.1 in
another subgroup with Serbian (SB2-2), Japanese
(JF1) and Canadian (CAN01) isolates, all of which
were closely related. Another subgroup with Turkish
(UH) and Serbian (SB2-6) was observed in the tree.
Iranian FMV isolates clearly grouped separately from
the rest (Fig. 2).
To our knowledge, this is the first report of three
fig-infecting viruses (FMV, FMMaV and FLMaV-1) in
scattered fig trees in mainland Spain. Further
surveys in commercial fig orchards are required to
better evaluate the sanitary status of this crop in
Spain. In this work, the presence of FMV was highly
associated with the fig mosaic disease, but not
completely so if we consider that not all symptomatic
trees were FMV positive, which occurred in the
surveys conducted in the Canary Islands (Elbeaino

CAS-10.1 (KC914280)
GRA-12.1 (KC914281)
JS1 (AB697826- Japan) Sub-group 1.1

JTT-Vi (AB697836- Japan)

ESA (FN666274- Turkey)
GROUP 1
ZAR-11.1 (KC914279)
CAN01 (HQ703343- Canada) Sub-group 1.2

JF1 (AB697830- Japan)

91 SB2-2 (AB697838- Serbia)
Sub-group 1.3
SB2-6 (AB697842- Serbia)
UH (FN666276- Turkey)
GROUP 2
E5a (HQ732254-Iran) (Iranian)
91 E5a-1 (HQ732253- Iran)
OUT-GROUP
EMARaV (AY563040)

0.1

Fig. 2 Phylogenetic tree constructed with predicted aa sequences of the partial RdRp gene of the fig mosaic isolates (FMV) of three isolates from
mainland Spain together with the homologue gene of those from other countries retrieved from the GenBank database. The statistical reliability of
the constructed trees was assessed by the bootstrap method based on 10 000 pseudoreplicates. The numbers above the nodes indicate the percent-
ages of bootstrap replicates, which supported branching. The tree was rooted with the RdRp of European mountain ash ring spot-associated virus
(EMARaV, accession number AY563040), the member type of the genus Emaravirus, used as outgroup. Scale bars represent genetic distances.

336 J Phytopathol 162 (2014) 332–337 Ó 2013 Blackwell Verlag GmbH

A. Alfaro-Fern

andez, D. Hern
andez-Llopis and M. I. Font
et al. 2011b). The aetiology of this mosaic disease
and the role of the associated fig-infecting viruses
need to be clarified.
Acknowledgements
We thank Dr. Toufic Elbeaino from the Instituto
Agronomic di Bari (Valenzano, Italy) for providing
positive controls of different fig-infecting viruses and
Dr. Maria del Carmen C
ordoba for collecting
fig-infected tree samples from Altura (Castell
on).
References
Caglar BK, Fidan H, Guldur ME, Elbeaino T. (2011) The
prevalence of three viruses infecting fig in Southern
Turkey. J Phytopathol 159:181–183.
Ebeling W, Pence RA. (1950) A severe case of an uncom-
mon type of injury by the fig mite. Bull Calif Dep Agric
39:47–48.
Elbeaino T, Digiaro M, De Stradis A, Martelli GP.
(2006) Partial characterization of a closterovirus asso-
ciated with a chlorotic mottling of fig. J Plant Pathol
88:187–192.
Elbeaino T, Choueiri E, Hobeika C, Digiaro M. (2007) Pres-
ence if fig leaf mottle-associated virus 1 and 2 in Leba-
nese fig orchards. J Plant Pathol 89:409–411.
Elbeaino T, Digiaro M, Alabdullah A, De Stradis A, Minafra
A, Mielke N, Castellano MA, Martelli GP. (2009) A mul-
tipartite single-stranded negative-sense RNA virus is the
putative agent of fig mosaic disease. J Gen Virol
90:1281–1288.
Elbeaino T, Heinoun K, Digiaro M, Martelli GP. (2010) Fig
mild mottle associated virus, a novel closterovirus infect-
ing fig. J Plant Pathol 92:165–172.
Elbeaino T, Digiaro M, Martelli GP. (2011a) The complete
sequence of Fig fleck-associated virus, a novel Tymoviri-
dae member infecting fig. Virus Res 161:198–202.
Elbeaino T, Gonz
alez Rodr
ıguez AM, Grajal-Mart
ın MJ,
Digiaro M. (2011b) Survey of fig viruses in the Canary
Islands. J Plant Pathol 93:737–739.
J Phytopathol 162 (2014) 332–337 Ó 2013 Blackwell Verlag GmbH
Fig viruses in Spain
Elcßi E, Srcße CU, Caglayan K. (2013) Phylogenetic analysis
of partial sequences from fig mosaic virus isolates in
Turkey. Phytoparasitica 41:263–270.
FAO. (2013) FAOSTAT database. Rome, Food and Agricul-
ture Organization of the United Nations. Internet
Resource: http://faostat.fao.org (verified Mar 15, 2013).
Flock RA, Wallance JM. (1955) Transmission of fig mosaic
by the eryophid mite Aceria ficus. Phytopathol 45:52–54.
Foissac X, Svanella-Dumas L, Gentit P, Dulucq MJ,
Candresse T. (2001) Polyvalent detection of fruit tree
Tricho, Capillo and Foveavirus by nested RT-PCR using
degenerate and inosine containing primers (DOP
RT-PCR). Acta Hortic 550:37–43.
Gattoni G, Minafra A, Castellano MA, De Stradis A,
Boscia D, Elbeaino T, Digiaro M, Martelli GP.
(2009) Some properties of Fig latent virus 1, a new
member of the family Flexiviridae. J Plant Pathol
91:555–564.
Ishikawa K, Maejima K, Nagashima S, Sawamura N,
Takinami Y, Komatsu K, Hashimoto M, Yamaji Y, Ya-
mamoto J, Namba S. (2012) First report of fig mosaic virus
infecting common fig (Ficus carica) in Japan. J Gen Plant
Pathol 78:136–139.
Martelli GP. (2011) Fig mosaic and associated pathogens.
In: Hadidi A, Barba M, Candresse T, Jelkman W. (eds)
Virus and Virus Like Diseases of Pome and Stone Fruits.
St. Paul, MN, USA, APS Press, pp 281–287.
Oldfield GN. (1970) Mite transmission of plant viruses.
Annu Rev Entomol 15:343–380.
Segarra J, Ju
arez M, Castellvell D, Ach
on MA, Medina
V. (2005) Incidencia del mosaico de la higuera en
dos zonas del este de Espa~ na. Bol San Veg Plagas
31:407–415.
Shahmirzaie M, Rakhshandehroo F, Zamanizadeh HR,
Elbeaino T. (2012) Current status of fig mosaic disease in
Iran. J Phytopathol 160:324–330.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M,
Kumar S. (2011) MEGA5: molecular evolutionary
genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony
methods. Mol Biol Evol 28:2731–2739.
337