Environmental Pollution 235 (2018) 30e38

Contents lists available at ScienceDirect

Environmental Pollution
journal homepage: www.elsevier.com/locate/envpol

In vitro effects of virgin microplastics on fish head-kidney leucocyte

activities*

bal Espinosa, Jose
Cristo
n, María Angeles Esteban, Alberto Cuesta*

María García Beltra
Fish Innate Immune System Group, Department of Cell Biology and Histology, Faculty of Biology, University of Murcia, 30100 Murcia, Spain

a r t i c l e i n f o a b s t r a c t

Article history: Microplastics are well-documented pollutants in the marine environment that result from production or
Received 26 July 2017 fragmentation of larger plastic items. The knowledge about the direct effects of microplastics on im-
Received in revised form munity, including fish, is still very limited. We investigated the in vitro effects of microplastics [poly-
15 December 2017
vinylchloride (PVC) and polyethylene (PE)] on gilthead seabream (Sparus aurata) and European sea bass
Accepted 15 December 2017
(Dicentrarchus labrax) head-kidney leucocytes (HKLs). After 1 and 24 h of exposure of HKLs with
0 (control), 1, 10 and 100 mg mL
1 MPs in a rotatory system, cell viability, innate immune parameters
(phagocytic, respiratory burst and peroxidase activities) and the expression of genes related to inflam-
Keywords:
Microplastic
mation (il1b), oxidative stress (nrf2, prdx3), metabolism of xenobiotics (cyp1a1, mta) and cell apoptosis
Immune system (casp3) were studied. Microplastics failed to affect the cell viability of HKLs. In addition, they provoke
Gilthead seabream (Sparus aurata) very few significant effects on the main cellular innate immune activities, as decrease on phagocytosis or
European sea bass (Dicentrarchus labrax) increase in the respiratory burst of HKLs with the highest dose of microplastics tested. Furthermore,
Leucocyte microplastics failed to affect the expression of the selected genes on sea bass or seabream, except the nrf2
which was up-regulated in seabream HKLs incubated with the highest doses. Present results seem to
suggest that continue exposure of fish to PVC or PE microplastics could impair fish immune parameters
probably due to the oxidative stress produced in the fish leucocytes.
© 2017 Elsevier Ltd. All rights reserved.

1. Introduction
The presence of microplastics (MPs) in the oceans is extremely
worrying due to their persistence, ubiquity and because they are
potential vectors for transferring persistent bioaccumulative and
toxic pollutants (Espinosa et al., 2017; Rochman et al., 2013; Teuten
et al., 2007). The term ‘microplastics’ has been differently defined
by various researchers as plastic particles with a size range <5 mm
(Betts, 2008; Moore, 2008). Microplastic particles may further
fragment into ‘nanoplastics’, a term that has not been defined
uniformly in the literature, and may refer to <100 mm particles of
plastic (Koelmans et al., 2015). These plastics are made of different
polymers being the most abundant polypropylene (PP), poly-
ethylene (PE), polystyrene (PS), polyethylene terephthalate (PET),
and polyvinylchloride (PVC) (Barnes et al., 2009). PE and PVC are
* organs, which decreases the absorption of nutrients and produces
This paper has been recommended for acceptance by Eddy Y. Zeng.
* Corresponding author. Department of Cell Biology and Histology, Faculty of
Biology, Campus Regional de Excelencia Internacional “Campus Mare Nostrum”,
University of Murcia. 30100 Murcia, Spain.
E-mail address: alcuesta@um.es (A. Cuesta).
the first and third-most widely produced synthetic plastic poly-
mers, along with the PP (Plastics Europe (PEMRG)/Consultic, 2016).
The accumulation of MP waste could affect the functioning of
marine ecosystems. However, the mechanisms by which these ef-
fects will be manifested have not been identified. On the contrary,
their impacts on biota and marine environmental quality are well
documented (Ivar Do Sul and Costa, 2014). The ingestion of the MPs
could affect marine animals in different ways because they might
interact, at least potentially, with the main systems altering their
homeostasis and physiology (Alomar et al., 2017; Battaglia et al.,
2016; Besseling et al., 2014; Bhattacharya et al., 2010; Brown
et al., 2001; Mattsson et al., 2015). One of the consequences of
MPs ingestion could be the alteration of the immune system with
an impact in animal health and defence. Concomitantly, the im-
mune system could be affected both chemically (due to the sub-
stances that MPs might contain, absorb or release, which may be
toxic) (Rochman et al., 2013), or physically blocking the digestive
impairment of energy allocation (Cole et al., 2013). Therefore,
ecology and behaviour could also be affected. In fact, in laboratory
experiments using high MPs concentrations, it has been reported

https://doi.org/10.1016/j.envpol.2017.12.054
0269-7491/© 2017 Elsevier Ltd. All rights reserved.
 C. Espinosa et al. / Environmental Pollution 235 (2018) 30e38
Abbreviations
ARE Elements of antioxidant response
Casp3 Caspase 3
Cyp1a1 Aril-4-monooxigenasa
GPx Glutathione peroxidase
GR Glutathione reductase
GST Glutathione-S-transferase
HKLs Head-kidney leucocytes
Il1b Interleukin 1 beta
MP Microplastic
Mta Metallothionein A
Nrf2 Nuclear factor erythroid 2erelated factor 2
PE Polyethylene
PP Polypropylene
Prdx Peroxiredoxin
PS Polystyrene
PVC Polyvinylchloride
SOD Superoxide dismutase
that once ingested, particles can pass through the digestive tract
and be expelled from the body (H€ amer et al., 2014; Lee et al., 2013),
introduced into the organs (Brennecke et al., 2015) or be retained in
the gastrointestinal tract causing internal abrasion and inflamma-
tory responses (Batel et al., 2015; Lei et al., 2017; von Moos et al.,
2012). Unfortunately, very little is known about the MPs effects
on fish immunity.
Fish innate immunity is composed by anatomical barriers, hu-
moral factors, natural killer cells and phagocytes (monocyte-mac-
rophages and granulocytes), being these last essential to bridge and
mount an effective adaptive immune response (Bayne and Levy,
1991; Bhattacharya et al., 2010; Espinosa, 2016). Main phagocyte
functions include chemotaxis, phagocytosis, cytokine secretion,
antigen processing and presentation and clearance of bacterial
pathogens by several mechanisms [i.e. lysosomal enzymes, reactive
nitrogen (RNS) and oxygen (ROS) specimens and myeloperoxidase]
(Bhattacharya et al., 2010; Cole et al., 2013; Mazurais et al., 2015).
Our in vivo data about continuous feeding of seabream and sea bass
with PE or PVC supplemented diets resulted in no significant al-
terations of their innate immune responses (Espinosa et al., 2017)
but suggested some general stress. Interestingly, the interactions
between MPs or nanoplastics and neutrophils of fathead minnow
(Pimephales promelas) have been studied and, although they used
PE and polycarbonate (PC) nanoplastic aggregates, their results
suggested that they caused increases in degranulation of primary
granules and neutrophil extracellular trap release (Greven et al.,
2016). So, it could be suggested that MPs are able to affect the
immune system but, although the adverse effects of MPs on marine
organisms have been widely studied, their effects at the cellular and
molecular levels are poorly understood.
The toxicity of nanoparticles in cells mainly arises from oxida-
tive stress via the generation of ROS (AshaRani et al., 2009;
Mahmoudi et al., 2011; Schins and Knaapen, 2007). Accumulated
ROS subsequently elicits several biological responses such as
oxidative stress-induced signalling pathways, apoptosis, and
inflammation (AshaRani et al., 2009; Mahmoudi et al., 2011). The
cells present a wide range of mechanisms to protect from the toxic-
induced damage, as the heat-shock proteins (HSPs), metal-
lothioneins (MTs), peroxiredoxins and the antioxidant enzymes:
superoxide dismutase (SOD), catalase (CAT) and glutathione
peroxidase (GPx) (Morcillo et al., 2015). Unfortunately, nothing is
31
known about the MPs effects on fish at molecular levels. The use of
cell lines to test the toxicity of aquatic pollutants, including MPs, is a
valuable alternative to fish bioassays. Although fish cell lines might
not be as good models for toxicological studies as in vivo assays, the
use of explants or primary cultures may lead to a significant
advance in our knowledge of the toxicology and its mechanisms. In
the case of fish, there are few cell lines derived from immune tis-
sues and therefore available for immunotoxicological studies. In
addition, as far as we know, very few papers have evaluated the
effects of MPs using fish leucocytes in vitro (Greven et al., 2016;
Prietl et al., 2014).
Thus, the present study aimed to throw some light in the effects
caused by MPs in marine fish by evaluating the effects of PVC and
PE MPs on head-kidney leucocytes (HKLs) of European sea bass
(Dicentrarchus labrax L.) and gilthead seabream (Sparus aurata L.),
two of the most representative marine fish species in the Medi-
terranean area. Cell viability and the main innate phagocyte func-
tions (phagocytosis, respiratory burst and peroxidase activities)
were studied after the incubation with MPs. Concomitantly,
expression of genes related to inflammation (il1b), oxidative stress
(nrf2, prdx3), metabolism of xenobiotics (cyp1a1, mta) and cell
apoptosis (casp3) was also determined.
2. Material and methods
2.1. Animals
Thirty specimens of 10e20 g body weight of the seawater Eu-
ropean sea bass (D. labrax L.) and gilthead seabream (Sparus aurata
L.), obtained from a local farm (Murcia, Spain), were kept in
seawater aquaria (250 L) in the Marine Fish Facility at the University
of Murcia. The water was maintained at 20 ± 2  C, with a flow rate
of 900L h
1, and 28‰ salinity. The photoperiod was of 12 h light:
12 h dark and fish fed with a commercial pellet diet (Skretting) at a
rate of 2% body weight day
1. Fish were allowed to acclimatise for
15 days before the start of the experimental trial. All experimental
protocols were approved by the Ethical Committee of the Univer-
sity of Murcia.
2.2. HKLs isolation
Fish were anaesthetised with benzocaine (4% in acetone)
(Sigma-Aldrich) and bled from the caudal vein. HKLs were isolated
from each fish under sterile conditions. Briefly, head-kidney was
excised, cut into small fragments and transferred to 7 mL of sRPMI
[RPMI- 1640 culture medium (Life Technologies) supplemented
with 0.35% sodium chloride, 100 IU mL
1 penicillin (Life Technol-
ogies), 100 mg mL
1 streptomycin (Life Technologies) and 5% foetal
bovine serum (Life Technologies)] (Esteban et al., 1998). Cell sus-
pensions were obtained by forcing fragments of the organ through
a nylon mesh (mesh size 100 mm), washed twice with sRPMI
(400 g, 10 min), counted and adjusted to 107 cells mL
1 in sRPMI.
2.3. Microplastics exposure
Microparticles of virgin PVC and PE (gently provided by the
Centro Tecnolo
stico, Murcia, Spain) with a

gico del Calzado y del Pla
range size of 40e150 mm were used. Each MP was initially resus-
pended in sRPMI and dilutions for each concentration were daily
prepared. Prior to carrying out the assays, the osmolarity of these
solutions was measured in an osmometer (Wescor) to avoid effects
due to this parameter. The test solutions were sonicated for 30 min
immediately prior to use in each experiment. For HKLs exposure,
1 mL of freshly isolated European sea bass or gilthead seabream
HKLs from 6 specimens in separate were dispensed in different
32 C. Espinosa et al. / Environmental Pollution 235 (2018) 30e38
Eppendorf tubes containing 0 (control), 1, 10 and 100 mg mL
1 of
MPs in a rotatory system to allow the contact of the cells with the
MPs. We assayed maximum MP concentrations close to the 108.3 g
PVC L
1 (Graham and Thompson, 2009) used in a previous study.
Concentration of MPs and contact with the cells was confirmed by
light microscopy. All the samples were carried out in triplicate. Cells
were exposed for 1 or 24 h at 22  C. After exposure to MPs, HKLs
were filtered through a nylon mesh (mesh size 100 mm) to remove
most of the MPs. Collected leucocytes were then used for their
characterization.
2.4. MTT assay
To determine if MPs affect HKLs viability, aliquots of 100 mL of
HKLs (107 cells mL
1) exposed to MPs were deposited into each
well of a flat-bottomed 96-well microtiter plate (Nunc) and
centrifuged to remove the medium. After this, the MTT [3-(4,5-
dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide, Sigma-
Aldrich] viability test was applied (Mosmann, 1983). MTT was
dissolved in sRPMI culture medium (2 mg mL
1) and 100 ml were
added to the cells and incubated for 4 h at 22  C. The plates were
centrifuged and then 100 ml of the supernatant was poured out and
100 ml of dimethylsulphoxide added, in stirring to solubilise the
formazan. Optical density was measured at 570 and 690 nm, the
latter as reference, using a plate reader (FLUOstar Galaxy, BMG).
Samples containing only reactants with MPs (without cells) were
used as blanks.
2.5. Phagocytosis
The phagocytosis of Saccharomyces cerevisiae (strain S288C) by
European sea bass and gilthead seabream HKLs was also studied by
flow cytometry (Rodríguez et al., 2003). Heat-killed and lyophilized
yeast cells were labelled with fluorescein isothiocyanate (FITC;
Sigma-Aldrich), washed with phosphate buffered saline (PBS) and
adjusted to 5  107 cells mL
1 of sRPMI. After exposure to MPs,
aliquots of 100 mL of HKLs and 60 mL of labelled-yeast cells were
pipetted into cytometer tube, mixed, centrifuged (400 g, 5 min,
22  C), resuspended in the same medium and newly incubated at
22  C for 30 min. At the end of the incubation time, samples were
placed on ice to stop phagocytosis and 400 mL ice-cold PBS was
added to each sample. The fluorescence of the extracellular yeast
cells was quenched by adding 40 mL ice-cold trypan blue (0.4% in
PBS). Standard samples of FITC-labelled S. cerevisiae or HKLs were
included in each phagocytosis assay. All samples were analysed in a
flow cytometer (FACSCalibur, Becton Dickinson) set to analyse the
phagocytic cells, showing highest SSC and FSC values. Phagocytic
ability was defined as the percentage of cells with one or more
ingested yeast (green-FITC fluorescent cells) within the phagocytic
cell population whilst the phagocytic capacity was the mean fluo-
rescence intensity (Esteban et al., 1998).
2.6. Respiratory burst activity
After MPs exposure, the respiratory burst activity of European
sea bass and gilthead seabream HKLs was studied by a chem-
iluminescence method (Bayne and Levy, 1991). Briefly, HKL samples
were incubated with 100 mL of Hank's balanced salt solution (HBSS)
containing 1 mg mL
1 phorbol myristate acetate (PMA, Sigma-
Aldrich) and 10
4 M luminol (Sigma-Aldrich). The plate was
shaken and luminescence immediately read in a plate reader (BMG)
for 1 h at 2 min intervals. The kinetic of the reactions was analysed
and the maximum slope of each curve was calculated. Lumines-
cence backgrounds were calculated using reagent solutions con-
taining luminol but not PMA.
2.7. Peroxidase activity
Exposed sea bass or seabream HKLs were lysed with 0.002%
cetyltrimethylammonium bromide (CTAB, Sigma-Aldrich) and, af-
ter centrifugation (400 g, 10 min, 25  C), 150 mL of the supernatants
were transferred to a fresh 96-well plate containing 25 mL of 10 mM
3,3,5,5-tetramethyl benzidine hydrochloride (TMB, Sigma-Aldrich)
and 5 mM H2O2 (Quade and Roth). The colour change reaction was
stopped after 2 min by adding 50 mL of 2 M H2SO4 and the OD was
read at 450 nm in a plate reader. Standard samples without leu-
kocytes were used as blanks.
2.8. Expression of genes by real-time PCR (qPCR)
After 1 or 24 h of HKL exposure to the maximum concentration
of each MPs (100 mg mL
1) cells were obtained by centrifugation
(400 g, 10 min, 25  C) and TRIzol Reagent (Life Technologies) added
to the samples in order to extract the total RNA as indicated by the
manufacturer. It was then quantified and the purity assessed by
spectrophotometry; the 260:280 ratios were 1.8e2.0. The RNA was
then treated with DNase I (Promega) to remove genomic DNA
contamination. Complementary DNA (cDNA) was synthesized from
1 mg of total RNA using the SuperScript IV reverse transcriptase (Life
Technologies) with an oligo-dT18 primer. The expression of the
selected genes was analysed by real-time PCR (qPCR), which was
performed with an ABI PRISM 7500 instrument (Applied Bio-
systems) using SYBR Green PCR Core Reagents (Applied Bio-
systems). Reaction mixtures containing 10 ml of 2  SYBR Green
supermix, 5 mL of primers (0.6 mM each) and 5 mL of cDNA template
were incubated for 10 min at 95  C, followed by 40 cycles of 15 s at
95  C, 1 min at 60  C, and finally 15 s at 95  C, 1 min at 60  C and
15 s at 95  C. The relative expression of all genes was calculated by
the 2-DCT method (Livak and Schmittgen, 2001), using D. labrax and
S. aurata 18s and ef1a as the endogenous reference genes. Gene
names follow the accepted nomenclature for zebrafish (https://wi
ki.zfin.org/). The primers used in the present study are shown in
Table 1. In all cases, each PCR was performed with triplicate sam-
ples from four specimens.
2.9. Statistical analyses
Data are expressed as mean ± standard error mean, SEM (n ¼ 6).
All data were analysed by one-way ANOVA and a Bonferroni's post-
hoc test to determine differences between groups (P  .05). The
normality of the variables was confirmed by the ShapiroeWilk test
and homogeneity of variance by the Levene's test. A non-
parametric KruskaleWallis test was used when data did not meet
parametric assumptions. All the data were analysed by the com-
puter application SPSS for Windows® (SPSS Inc.).
3. Results
3.1. Leucocyte viability
According to the MTT test, the viability of European sea bass and
gilthead seabream HKLs exposed to 1, 10 and 100 mg mL
1 of PVC
or PE MPs for 1 or 24 h did not show any statistically significant
deviation (Fig. 1). Only a trend to decrease the viability with the
higher concentration of both MPs was observed in both species but
never reached significance.
3.2. Leucocyte innate immune activities
The phagocytosis and respiratory burst activities as well as the
peroxidase content were evaluated in head-kidney leucocytes from
 C. Espinosa et al. / Environmental Pollution 235 (2018) 30e38 33

Table 1
Primer sequences used for real-time PCR.

Gene Fish specie Acc. number F/R Primer sequence (50 e30 )

il1b Sea bass AJ269472 F- CAGGACTCCGGTTTGAACAT

R- GTCCATTCAAAAGGGGACAA
Seabream AJ277166 F- GGGCTGAACAACAGCACTCTC
R- TTAACACTCTCCACCCTCCA
prdx3 Sea bass AM987213 F- CAGGACTCCGGTTTGAACAT
R- GTCCATTCAAAAGGGGACAA
Seabream GQ252681 F- ATCAACACCCCACGCAAGACTG
R- ACCGTTTGGATCAATGAGGAACAGACC
casp3 Sea bass DQ345773 F- AATTCACCAGGCTTCAATGC
R- CTACGGCAGAGACGACATCA
Seabream EU722334 F- CTGATCTGGATGGAGGCATT
R- AGTAGTAGCCTGGGGCTGTG
cyp1a1 Sea bass AJ298290 F- CTGGAGCCACACAGACAAGA
R- AACTGAGGCCCTGCTGAGTA
Seabream AF011223 F- GCATCAACGACCGCTTC ACGC
R- CCTACAACCTTCTCATCCGACATCTGG
mt Sea bass AF199014 F- GCACCACCTGCAAGAAGACT
R- AGCTGGTGTCGCACGTCT
Seabream X97276 F- ACAAACTGCTCCTGCACCTC
R- CAGCTAGTGTCGCACGTCTT
nrf2 Sea bass DLAgn_00051120 F- AACTAAGCCTCCCCTCACAC
R- GTTGTGGTCCATCTCCTCCA
Seabream FP335773 F- GTTCAGTCGGTGCTTTGACA
R- CTCTGATGTGCGTCTCTCCA
ef1a Sea bass AJ866727 F- CGTTGGCTTCAACATCAAGA
R- GAAGTTGTCTGCTCCCTTGG
Seabream AF184170 F- CTTCAACGCTCAGGTCATCAT
R- GCACAGCGAAACGACCAAGGGGA
18S Sea bass AY831388 F- TTCCTTTGATCGCTCTTAACG
R- TCTGATAAATGCACGCATCC
Seabream AM490061 F- CTTCAACGCTCAGGTCATCAT
R- AGTTGGCACCGTTTATGGTC

sea bass and seabream exposed to MPs (Figs. 2e5). Regarding
phagocytosis, no significant differences were recorded in the
phagocytic ability after 1 or 24 h of incubation with PVC or PE MPs
respect to the values recorded for HKLs non-exposed to MPs (Fig. 2),
except its significant decrease (P ¼ .012) in the seabream HKLs
incubated with 100 mg mL
1 PVC MPs for 24 h (Fig. 2). Phagocytic
capacity of HKLs exposed to MPs also resulted unaltered compared
to the controls except those from sea bass exposed to PVC MPs to
either 1 (P < .036) or 24 (P < .024) h that resulted significantly
decreased (Fig. 3).
Regarding the respiratory burst activity (Fig. 4), it was signifi-
cantly increased in seabream HKLs exposed to PVC MPs (P ¼ .048)
and in sea bass exposed to PE MPs (P ¼ .040) respect to the controls,
in both cases this was achieved with the highest MP concentration
and incubation time of 24 h. Finally, no significant differences were
recorded for the peroxidase activity of HLKs exposed to MPs in any
fish species (Fig. 5).
3.3. Gene expression
We evaluated the transcription of selected genes related to
immunity (il1b), cellular protection to pollutants (cyp1a1, mta),
oxidative stress (prdx3, nrf2) and cell death (casp3) in HKLs exposed
to MPs (Fig. 6). In sea bass HKLs, none of the genes suffered alter-
ation in the expression by exposure to PE or PVC MPs. In the case of
seabream HKLs only the transcription of nrf2 was significantly up-
regulated after 1 h of exposure to PVC and PE MPs (P ¼ .014)
(Fig. 6B) or after 24 h of exposure to PVC MPs (P ¼ .049) (Fig. 6D).
4. Discussion
The use of cell lines to test the toxicity of aquatic pollutants,
including MPs, is a valuable alternative to fish bioassays. Although
fish cell lines might not be as good models for toxicological studies
as in vivo assays, the use of explants or primary cultures may lead to
a significant advance in our knowledge of the toxicology and its
mechanisms. In the case of fish, there are very few cell lines derived
from immune tissues and therefore available for immunotoxico-
logical studies. In addition, as far as we know, very few papers have
evaluated the effect of MPs using fish leucocytes in vitro (Greven
et al., 2016; Prietl et al., 2014). With the aim to bring some light
into this field, we evaluated the effect of MPs using freshly isolated
HKLs of European sea bass and gilthead seabream, used as marine
fish models important in the Mediterranean area.
To the best of our knowledge, very few studies have tested
in vitro the cytotoxicity effects of virgin microparticles of plastic.
Firstly, it is remarkable that the incubation with the virgin MPs
failed to be cytotoxic for seabream or sea bass HKLs after 1 or 24 h,
although the concentrations studied were superior than those
found in the nature, which varies from 0 to 81.43 mg kg
1 of sedi-
ment (Phuong et al., 2016; Reddy et al., 2006), depending on the
proximity to the contaminated areas, and also used in other in vivo
experiments such as 2.5 g PE L
1 in mussel (von Moos et al., 2012)
or 16 to 108.3 g PVC L
1 in sea cucumber (Echinodermata) fed
(Graham and Thompson, 2009). The unique study performed
in vitro in fish used PS and PVC nanoparticles up to 0.2 mg mL
1
although cell viability was not studied (Greven et al., 2016). Other
in vitro assays with human leucocytes and murine macrophages
showed a significant decrease of cells viability after 24 h of incu-
bation with up to 0.5 mg mL
1 of carboxyl-PS nanoparticles (Prietl
et al., 2014). However, in all the cells tested to, 20 nm but not
100 nm, carboxyl-PS nanoparticles showed decreased its viability
(Prietl et al., 2014). In our experiment, we failed to detect any effect
on HKLs viability after 1 or 24 h of incubation with very high PE or
34 C. Espinosa et al. / Environmental Pollution 235 (2018) 30e38

PVC European sea bass PVC Gilthead seabream

0.9 0.9
Cell viability (OD 570 nm)

Cell viability (OD 570 nm)

0.8 0.8
0.7 0.7
0.6 0.6
0.5 0.5
0.4 0.4
0.3 0.3
0.2 0.2
0.1 0.1
0 0
0 1 10 100 0 1 10 100
MP concentraƟon [mg mL-1] MP concentraƟon [mg mL-1]

PE PE
0.9 0.9

Cell viability (OD 570 nm)

Cell viability (OD 570 nm)

0.8 0.8
0.7 0.7
0.6 0.6
0.5 0.5
0.4 0.4
0.3 0.3
0.2 0.2
0.1 0.1
0 0
0 1 10 100 0 1 10 100
MP concentraƟon [mg mL-1] MP concentraƟon [mg mL-1]

1 24 hours

Fig. 1. Cell viability of European sea bass and gilthead seabream head-kidney leucocytes exposed to different concentrations of PVC and PE MPs for 1 (white bars) or 24 h (black
bars). Bars represent the mean ± SEM (n ¼ 6).

PVC European sea bass PVC Gilthead seabream

60 90
A A A
80
PhagocyƟc ability (%)
PhagocyƟc ability (%)

50 a
70 A a
40 60
a
50 b
30
40
20 30
20
10
10
0 0
0 1 10 100 0 1 10 100
MP concentraƟon [mg mL-1] MP concentraƟon [mg mL-1]

PE PE
60 90
80
PhagocyƟc ability (%)
PhagocyƟc ability (%)

50
70
40 60
50
30
40
20 30
20
10
10
0 0
0 1 10 100 0 1 10 100
MP concentraƟon [mg mL-1] MP concentraƟon [mg mL-1]

1 24 hours

Fig. 2. Phagocytic ability of European sea bass and gilthead seabream head-kidney leucocytes exposed to different concentrations of PVC and PE MPs for 1 h (white bars) or 24 h
(black bars). Bars represent the mean ± SEM (n ¼ 6). Statistically significant differences (ANOVA; P  .05) between groups after 1 h (capital letters) or 24 h (lowercase letters) were
denoted using different letters.
 C. Espinosa et al. / Environmental Pollution 235 (2018) 30e38 35

300
PVC European sea bass 1200
PVC Gilthead seabream
A

PhagocyƟc capacity (a.u.)

PhagocyƟc capacity (a.u.)

250 1000
a
200 800
B B
150 B
600
b b b
100 400

50 200

0 0
0 1 10 100 0 1 10 100
MP concentraƟon [mg mL-1] MP concentraƟon [mg mL-1]

PE 1200
PE
250
PhagocyƟc capacity (a.u.)

PhagocyƟc capacity (a.u.)

1000
200
800
150
600
100
400
50 200

0 0
0 1 10 100 0 1 10 100
MP concentraƟon [mg mL-1] MP concentraƟon [mg mL-1]

1 24 hours

Fig. 3. Phagocytic capacity of European sea bass and gilthead seabream head-kidney leucocytes exposed to different concentrations of PVC and PE MPs for 1 h (white bars) or 24 h
(black bars). Bars represent the mean ± SEM (n ¼ 6). Statistically significant differences (ANOVA; P  .05) between groups after 1 h (capital letters) or 24 h (lowercase letters) were
denoted using different letters.

European sea bass Gilthead seabream

PVC PVC
600 900 b
Respiratory burst acƟvity
Respiratory burst acƟvity

800
500
700 a
(Slope min-1)
(Slope min-1)

400 600 a A
A A a
500 A
300
400
200 300
200
100
100
0 0
0 1 10 100 0 1 10 100
MP concentraƟon [mg mL-1]
MP concentraƟon [mg mL-1]

600
PE 900
PE
Respiratory burst acƟvity

800
Respiratory burst acƟvity

500 b
700
(Slope min-1)

400 600
(Slope min-1)

a 500
300 a
400
A
200 a A A 300
A
200
100
100
0 0
0 1 10 100 0 1 10 100
MP concentraƟon [mg mL-1] MP concentraƟon [mg mL-1]

1 24 hours

Fig. 4. Respiratory burst activity of European sea bass and gilthead seabream head-kidney leucocytes exposed to different concentrations of PVC and PE MPs for 1 h (white bars) or
24 h (black bars). Bars represent the mean ± SEM (n ¼ 6). Statistically significant differences (ANOVA; P  .05) between groups after 1 h (capital letters) or 24 h (lowercase letters)
were denoted using different letters.
36 C. Espinosa et al. / Environmental Pollution 235 (2018) 30e38

PVC European sea bass PVC Gilthead seabream

Peroxidase acƟvity (Units ml-1)

40

Peroxidase acƟvity (Units ml-1)

120
35
100
30
25 80
20 60
15
40
10
5 20

0 0
0 1 10 100 0 1 10 100
MP concentraƟon [mg mL-1] MP concentraƟon [mg mL-1]

PE PE
40 140
Peroxidase acƟvity (Units ml-1)

Peroxidase acƟvity (Units ml-1)

35 120
30 100
25
80
20
60
15
40
10
5 20

0 0
0 1 10 100 0 1 10 100
MP concentraƟon [mg mL-1] MP concentraƟon [mg mL-1]

1 24 hours

Fig. 5. Peroxidase activity of European sea bass and gilthead seabream head-kidney leucocytes exposed to different concentrations of PVC and PE MPs for 1 h (white bars) or 24 h
(black bars). Bars represent the mean ± SEM (n ¼ 6).

European sea bass Gilthead seabream

1h A B
14 14
b
RelaƟve gene expression

RelaƟve gene expression

12 12
b
10 10
8 8
a
6 6
4 4
2 2
0 0
il1b prdx3 casp3 cyp1a1 mta nrf2 il1b prdx3 casp3 cyp1a1 mta nrf2

24h C D
14 14
RNAm relaƟve expression
RelaƟve gene expression

12 12
10 10
8 8

6 6 ab
b
4 4

2 2 a

0 0
il1b prdx3 casp3 cyp1a1 mta nrf2 il1b prdx3 casp3 cyp1a1 mta nrf2

Control PVC-MPs
PVC MPs PE-MPs
PE MPs

Fig. 6. Expression of selected genes related to immunity (il1b), cellular protection to pollutants (cyp1a1, mt), oxidative stress (prdx3, nrf2) or cell death (casp3) in European sea bass
and gilthead seabream head-kidney leucocytes exposed to none (Control, white bars) or to 100 mg mL
1 of PVC (grey bars) or PE (black bars) MPs for 1 h (A, B) or 24 h (C, D). Bars
represent the mean ± SEM (n ¼ 4). Statistically significant differences (ANOVA; P  .05) between groups are denoted with different letters.
 C. Espinosa et al. / Environmental Pollution 235 (2018) 30e38
PVC MPs concentrations. This fact could be due to the size of the
MPs we used (40-150 mm), as reported earlier, which could suggest
the size of plastic particles as another critical factor in order to
cause cytotoxic effects on immune cells. By contrast, Lo and Chan
(2018) failed to find any effect of MPs on Crepidula onyx using
particles with a size between 2.0 and 2.4 mm. Ha€mer et al. (2014)
did not find any effect in the copepod Idotea emarginata using
10 mm microbeads during 6 weeks while Imhof and Laforsch (2016)
failed to show significant changes on Potampoyrgus antipodarum
morphology after exposition to <20 mm PS microbeads. Although
these studies were performed on marine species, not on cells, their
results suggested that more parameters than size of MPs (such as
material, specie, time of exposure, etc) could be critical in the ef-
fects in the viability of the organisms and this could also be
important in in vitro assays using cells. Indeed, more research is
needed into this issue.
Among the potential immunotoxicological effects on fish leu-
cocytes, we investigated the impact of PE and PVC MPs on in vitro
European sea bass and gilthead seabream HKL's phagocytosis,
respiratory burst and peroxidase activities, which are the main
phagocyte functions. Thus, our results showed that PVC and/or PE
decreased phagocytosis, increased respiratory burst and unaltered
peroxidase activities. The process of phagocytosis can be divided
into two distinct steps, attachment and internalization. Regarding
to the internalization, other authors reported that, in mammals, the
rate of phagocytosis of PS particles between 0.9 and 9 mm was
highest for particles possessing diameters between 1.7 mm and
3 mm (Champion et al., 2008; Tabata and Ikada, 1988). Mainly, HKLs
from seabream or sea bass consist on two cell types with phago-
cytic activity (Rodríguez et al., 2003): acidophilic granulocytes and
monocyte-macrophages, which diameter rounds 5.39 ± 0.77 mm
and 6.06 ± 0.96 mm, respectively (Esteban et al., 2000), while
acidophilic granulocytes from seabream are around 6-8 mm
(Sepulcre et al., 2002). So, seabream and sea bass HKLs are unable to
phagocytose these higher PVC and PE MPs (40-150 mm). However,
they alter the phagocytosis of the yeast cells used in the assay,
which have a smaller diameter than the HKLs and are readily
phagocyted (Rodríguez et al., 2003). Thus, the phagocytosis of yeast
cells by HKLs exposed to MPs resulted sometimes decreased and
this could be just due to interference in the yeast attachment and
internalization though this has never been evaluated in fish.
Interestingly, dietary intake of PVC MPs failed to affect the phago-
cytic activity in gilthead seabream (Espinosa et al., 2017). By
contrast, murine macrophages (13.8 ± 2.3 mm of diameter) (Cannon
and Swanson, 1992) phagocytosis of bacteria was increased when
incubated with carboxy-PS nanoparticles of 0.5 or 1 mm (Prietl et al.,
2014). After the little effects observed in the HKLs phagocytosis, we
found that the respiratory burst was increased in seabream HKLs
exposed to PVC MPs and in sea bass HKLs exposed to PE MPs.
Although the sensibility to the kind of MP was different between
species, the respiratory burst was increased by the MPs presence
suggesting some interaction with the fish leucocytes. Our findings
agree with other in vitro studies which reported that immune cells
including human neutrophils, macrophages, and monocytes (Prietl
et al., 2014) and neutrophils from Pimephales promelas (Greven
et al., 2016) exposed to nanoplastics induced their myeloperox-
idase, respiratory burst and degranulation. In addition, these re-
sults agree with the in vivo study in seabream in which the dietary
intake of PVC MPs significantly increased the respiratory burst ac-
tivity of HKLs (Espinosa et al., 2017). These results demonstrate that
MPs are able to affect to the immune cells of fish to some extent.
At molecular level, the MPs failed to produce any effect on the
expression of selected genes in European sea bass. Although the
toxicity of nanoparticles in cells mainly arises from oxidative stress
via the generation of ROS, and these radicals subsequently elicits
37
several biological responses such as inflammation and apoptosis
(AshaRani et al., 2009; Mahmoudi et al., 2011), MPs incubation
failed to affect the expression of il1b or casp3 on HKLs from Euro-
pean sea bass and gilthead seabream, markers of inflammation and
apoptosis, respectively. Our results agree with previous observa-
tions demonstrating a lack of il1b regulation on European sea bass
larvae after intake of PE MPs (Mazurais et al., 2015). In addition,
nano- and micro-carboxyl-PS particles deprived the release of IL-6
and IL-8 in the THP-1 human cell line suggesting that they do not
produce inflammation (Prietl et al., 2014). Thus, our data suggest
MPs are not able to produce this inflammation and resulting
apoptosis of HKLs. Besides, since apoptosis is a form of physiological
cell death mediated by caspases (Kaufmann and Vaux, 2003), the
fact that the viability was not affected by MPs agrees with the casp3
expression on HKLs from sea bass and seabream. Regarding the ROS
metabolism, it has been reported that in vivo exposure to MPs,
smaller that the MPs used in our study, increases the level of ROS in
a size-dependent manner and the activation of antioxidant-related
enzymes including SOD, GST, GR, and GPx is directly related to a
defence mechanism against MPs induced oxidative stress (Jeong
et al., 2016). Interestingly, the incubation for 1 or 24 h with
higher dose of PE or PVC MPs showed an up-regulation of nrf2 on
seabream, denoting more susceptibility of the seabream to the MPs
exposure. This transcription factor is activated in response to a wide
range of oxidative and electrophilic stimulation, including ROS and
some chemical agents (Giudice et al., 2010), which in turns bind to
antioxidant response elements (ARE) in the DNA to generate anti-
oxidant enzymes (Giudice et al., 2010). Then, our data suggest that
MPs induced this NRF2/ARE pathway in HKLs from seabream in
order to neutralize the oxidative damage produced by MPs expo-
sure, a hypothesis that merits more and deeper studies.
As a conclusion, the results of this study show that European sea
bass and gilthead seabream HKLs exposed in vitro to virgin PVC or
PE MPs of 40e150 mm size for 1 or 24 h were only mildly affected. In
general, MPs exposure did not affect to the HKLs viability though
modulated some innate immune parameters as phagocytosis and
respiratory burst, resulting the seabream HKLs more sensitive to
the PVC MPs exposure and the sea bass HKLs to PE MPs, what was
evidenced at gene level too. MPs exposure probably produces
limited oxidative stress through the NRF2 activation on seabream.
Additional studies are still required to understand the mechanisms
involved for the immunotoxicological effects of different MPs and
their implications in fish biology.
Acknowledgments
The authors thank Salva
A.I. for her technical support. The re-
sults from the present work were developed under the EPHEMARE
Project (JPI Oceans) and funded by the Spanish Ministry of Econ-
omy and Competitiveness (MINECO) (project code: PCIN-2015-187-
C03-02) and Fundacio
n S

eneca de la Regio
n de Murcia (Grupo de
Excelencia grant number: 19883/GERM/15).
References
Alomar, C., Sureda, A., Capo
, X., Guijarro, B., Tejada, S., Deudero, S., 2017. Micro-
plastic ingestion by Mullus surmuletus Linnaeus, 1758 fish and its potential for
causing oxidative stress. Environ. Res. 159, 135e142.
AshaRani, P.V., Low Kah Mun, G., Hande, M.P., Valiyaveettil, S., 2009. Cytotoxicity
and genotoxicity of silver nanoparticles in human cells. ACS Nano 3, 279e290.
Batel, A., Linti, F., Scherer, M., Erdinger, L., Braunbeck, T., Sherer, M., Erdinger, L.,
Brauncheck, T., 2015. The transfer of Benzo[A]pyerene from microplastics to
artemia nauplii further to zebrafish via trophic food web experiment-
CYP1Ainduction and visual tracking of persistent organic pollutant. Environ.
Toxicol. Chem. 35, 1656e1666.
Battaglia, P., Peda, C., Musolino, S., Esposito, V., Andaloro, F., Romeo, T., 2016. Diet
and first documented data on plastic ingestion of Trachinotus ovatus L. 1758
(Pisces: Carangidae) from the strait of messina (central mediterranean sea). Ital.
38 C. Espinosa et al. / Environmental Pollution 235 (2018) 30e38
J. Zool. 83, 121e129.
Barnes, D.K.A., Galgani, F., Thompson, R.C., Barlaz, M., 2009. Accumulation and
fragmentation of plastic debris in global environments. Philos. Trans. R. Soc.
Lond. B. Biol. Sci. 364, 1985e1998.
Bayne, C.J., Levy, S., 1991. Modulation of the oxidative burst in trout myeloid cells by
adrenocorticotropic hormone and catecholamines: mechanisms of action.
J. Leukoc. Biol. 50, 554e560.
Besseling, E., Wang, B., Lürling, M., Koelmans, A.A., 2014. Nanoplastic affects growth
of S. obliquus and reproduction of D. magna. Environ. Sci. Technol. 48,
12336e12343.
Betts, K., 2008. Why small plastic particles may pose a big problem in the oceans.
Environ. Sci. Technol. 42, 8995.
Bhattacharya, P., Lin, S., Turner, J., Ke, P., 2010. Physical adsorption of charged plastic
nanoparticles affects algal photosynthesis. J. Phys. Chem. 114, 16556e16561.
Brennecke, D., Ferreira, E.C., Costa, T.M.M., Appel, D., Bernardo, A.P., Lenz, M., 2015.
Ingested microplastics (> 100 mm) are translocated to organs of the tropical
fiddler crab Uca rapax. Mar. Pollut. Bull. 96, 491e495.
Brown, D.M., Wilson, M.R., MacNee, W., Stone, V., Donaldson, K., 2001. Size-
dependent proinflammatory effects of ultrafine polystyrene particles: a role for
surface area and oxidative stress in the enhanced activity of ultrafines. Toxicol.
Appl. Pharmacol. 175, 191e199. https://doi.org/10.1006/taap.2001.9240.
Cannon, G.J., Swanson, J.A., 1992. The macrophage capacity for phagocytosis. J. Cell
Sci. 101 (4), 907e913.
Champion, J.A., Walker, A., Mitragotri, S., 2008. Role of particle size in phagocytosis
of polymeric microspheres. Pharm. Res. 25, 1815e1821.
Cole, M., Lindeque, P., Fileman, E., Halsband, C., Goodhead, R., Moger, J.,
Galloway, T.S., 2013. Microplastic ingestion by zooplankton. Environ. Sci.
Technol. 47, 6646e6655.
Espinosa, C., Cuesta, A., Esteban, M.A.,
2017. Effects of dietary polyvinylchloride
microparticles on general health, immune status and expression of several
genes related to stress in gilthead seabream (Sparus aurata L.). Fish Shellfish
Immunol. 68, 251e259.
Espinosa, C., Esteban, M.A.,
Cuesta, A., 2016. Microplastics in aquatic environments
and their toxicological implications for fish. In: Soloneski, S., Larramendy, M.L.
(Eds.), Toxicology - New Aspects to This Scientific Conundrum. InTech,
pp. 113e145. Croatia.
Esteban, M.A., Mulero, V., Mun ~ oz, J., Meseguer, J., 1998. Methodological aspects of
assessing phagocytosis of Vibrio anguillarum by leucocytes of gilthead seabream
(Sparus aurata L.) by flow cytometry and electron microscopy. Cell Tissue Res.
293, 133e141.
Esteban, M.A., Mun ~ oz, J., Meseguer, J., 2000. Blood cells of sea bass (Dicentrarchus
labrax L.). Flow cytometric and microscopic studies. Anat. Rec. 258, 80e89.
Giudice, A., Arra, C., Turco, M.C., 2010. Review of molecular mechanisms involved in
the activation of the Nrf2-ARE signaling pathway by chemopreventive agents.
Meth. Mol. Biol. 647, 37e74.
Graham, E.R., Thompson, J.T., 2009. Deposit- and suspension-feeding sea cucumbers
(Echinodermata) ingest plastic fragments. J. Exp. Mar. Biol. Ecol. 368, 22e29.
Greven, A.C., Merk, T., Karago € z, F., Mohr, K., Klapper, M., Jovanovi

c, B., Pali

c, D., 2016.
Polycarbonate and polystyrene nanoplastic particles act as stressors to the
innate immune system of fathead minnow (Pimephales promelas). Environ.
Toxicol. Chem. 35, 3093e3100.
Ha€mer, J., Gutow, L., Ko €hler, A., Saborowski, R., 2014. Fate of microplastics in the
marine isopod Idotea emarginata. Environ. Sci. Technol. 48, 13451e13458.
Imhof, H.K., Laforsch, C., 2016. Hazardous or not e are adult and juvenile individuals
of Potamopyrgus antipodarum affected by non-buoyant microplastic particles?
Environ. Pollut. 218, 383e391.
Ivar Do Sul, J.A., Costa, M.F., 2014. The present and future of microplastic pollution
in the marine environment. Environ. Pollut. 185, 352e364.
Jeong, C.-B., Won, E.-J., Kang, H.-M., Lee, M.-C., Hwang, D.-S., Hwang, U.-K., Zhou, B.,
Souissi, S., Lee, S.-J., Lee, J.-S., 2016. Microplastic size-dependent Toxicity,
oxidative stress induction, and p-JNK and p-p38 activation in the monogonont
rotifer (Brachionus koreanus). Environ. Sci. Technol. 50, 8849e8857.
Kaufmann, S.H., Vaux, D.L., 2003. Alterations in the apoptotic machinery and their
potential role in anticancer drug resistance. Oncogene 22, 7414e7430.
Koelmans, A.A., Besseling, E., Shim, W., 2015. Nanoplastics in the aquatic environ-
ment. critical review. In: Bergmann, M., Gutow, L., Klages, M. (Eds.), Marine
Anthropogenic Litter. Springer International Publishing AG, Switzerland,
pp. 326e342.
Lee, K.-W., Shim, W.J., Kwon, O.Y., Kang, J.-H., 2013. Size-dependent effects of micro
polystyrene particles in the marine copepod Tigriopus japonicus. Environ. Sci.
Technol. 47, 11278e11283.
Lei, L., Wu, S., Lu, S., Liu, M., Song, Y., Fu, Z., Shi, H., Raley-Susman, K.M., He, D., 2017.
Microplastic particles cause intestinal damage and other adverse effects in
zebrafish Danio rerio and nematode Caenorhabditis elegans. Sci. Total Environ.
619e620, 1e8.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25,
402e408.
Lo, H.K.A., Chan, K.Y.K., 2018. Negative effects of microplastic exposure on growth
and development of Crepidula onyx. Environ. Pollut. 233, 588e595.
Mahmoudi, M., Azadmanesh, K., Shokrgozar, M.A., Journeay, W.S., Laurent, S., 2011.
Effect of nanoparticles on the cell life cycle. Chem. Rev. 111, 3407e3432.
Mattsson, K., Ekvall, M.T., Hansson, L.-A., Linse, S., Malmendal, A., Cedervall, T., 2015.
Altered behavior, physiology, and metabolism in fish exposed to polystyrene
nanoparticles. Environ. Sci. Technol. 49, 553e561.
Mazurais, D., Ernande, B., Quazuguel, P., Severe, A., Huelvan, C., Madec, L.,
Mouchel, O., Soudant, P., Robbens, J., Huvet, A., Zambonino-Infante, J., 2015.
Evaluation of the impact of polyethylene microbeads ingestion in European sea
bass (Dicentrarchus labrax) larvae. Mar. Environ. Res. 112, 78e85.
Moore, C.J., 2008. Synthetic polymers in the marine environment: a rapidly
increasing, long-term threat. Environ. Res. 108, 131e139.
Morcillo, P., Cordero, H., Meseguer, J., Esteban, M.A.,
Cuesta, A., 2015. In vitro
immunotoxicological effects of heavy metals on European sea bass (Dicen-
trarchus labrax L.) head-kidney leucocytes. Fish Shellfish Immunol. 47, 245e254.
Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival:
application to proliferation and cytotoxicity assays. J. Immunol. Meth. 65,
55e63.
Phuong, N.N., Zalouk-Vergnoux, A., Poirier, L., Kamari, A., Ch^ atel, A., Mouneyrac, C.,
Lagarde, F., 2016. Is there any consistency between the microplastics found in
the field and those used in laboratory experiments? Environ. Pollut. 211,
111e123.
Plastics Europe (PEMRG)/Consultic, 2016. Plastics: the Facts 2016: an analysis of
European latest plastics production, demand and waste data. Plast. Bruss 1e38.
Prietl, B., Meindl, C., Roblegg, E., Pieber, T.R., Lanzer, G., Fro €hlich, E., 2014. Nano-sized
and micro-sized polystyrene particles affect phagocyte function. Cell Biol.
Toxicol. 30, 1e16.
Rochman, C.M., Hoh, E., Hentschel, B.T., Kaye, S., 2013. Long-term field measure-
ment of sorption of organic contaminants to five types of plastic pellets: im-
plications for plastic marine debris. Environ. Sci. Technol. 47, 1646e1654.
Reddy, M.S., Shaik, Basha, Adimurthy, S., Ramachandraiah, G., 2006. Description of
the small plastics fragments in marine sediments along the Alang-Sosiya ship-
breaking yard, India. Estuar. Coast Shelf Sci. 68, 656e660.
Rodríguez, A., Esteban, M.A., Meseguer, J., 2003. Phagocytosis and peroxidase
release by seabream (Sparus aurata L.) leucocytes in response to yeast cells.
Anat. Rec. A. Discov. Mol. Cell. Evol. Biol. 272, 415e423.
Schins, R.P.F., Knaapen, A.M., 2007. Genotoxicity of poorly soluble particles. Inhal.
Toxicol. 19 (1), 189e198.
Sepulcre, M., Pelegrín, P., Mulero, V., Meseguer, J., 2002. Characterisation of gilthead
seabream acidophilic granulocytes by a monoclonal antibody unequivocally
points to their involvement in fish phagocytic response. Cell Tissue Res. 308,
97e102.
Tabata, Y., Ikada, Y., 1988. Effect of the size and surface charge of polymer micro-
spheres on their phagocytosis by macrophage. Biomaterials 9, 356e362.
Teuten, E.L., Rowland, S.J., Galloway, T.S., Thompson, R.C., 2007. Potential for plastics
to transport hydrophobic contaminants. Environ. Sci. Technol. 41, 7759e7764.
von Moos, N., Burkhardt-Holm, P., Ko €hler, A., 2012. Uptake and effects of micro-
plastics on cells and tissue of the blue mussel Mytilus edulis L. after an exper-
imental exposure. Environ. Sci. Technol. 46, 11327e11335.