Journal Pre-proofs

Establishment of a brain cell line (FuB-1) from mummichog (Fundulus heter-

oclitus) and its application to fish virology, immunity and nanoplastics toxicol-
ogy

María Ruiz, Mónica Almeida, Manuel A. Martins, Miguel Oliveira, María

Ángeles Esteban, Alberto Cuesta

PII: S0048-9697(19)34813-2
DOI: https://doi.org/10.1016/j.scitotenv.2019.134821
Reference: STOTEN 134821

To appear in: Science of the Total Environment

Received Date: 4 September 2019

Revised Date: 2 October 2019
Accepted Date: 3 October 2019

Please cite this article as: M. Ruiz, M. Almeida, M.A. Martins, M. Oliveira, M. Ángeles Esteban, A. Cuesta,
Establishment of a brain cell line (FuB-1) from mummichog (Fundulus heteroclitus) and its application to fish
virology, immunity and nanoplastics toxicology, Science of the Total Environment (2019), doi: https://doi.org/
10.1016/j.scitotenv.2019.134821

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover
page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will
undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing
this version to give early visibility of the article. Please note that, during the production process, errors may be
discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Elsevier B.V. All rights reserved.

 Establishment of a brain cell line (FuB-1) from mummichog (Fundulus

heteroclitus) and its application to fish virology, immunity and nanoplastics

toxicology

María Ruiz1, Mónica Almeida2, Manuel A. Martins2, Miguel Oliveira2, María

Ángeles Esteban1, Alberto Cuesta1*

1Fish Innate Immune System Group, Department of Cellular Biology and Histology,

Faculty of Biology, Campus Regional de Excelencia Internacional “Campus Mare

Nostrum”, University of Murcia, 30100 Murcia, Spain.

2Department of Biology & CESAM, University of Aveiro, 3810-193 Aveiro, Portugal.

*Corresponding author: Alberto Cuesta, Fish Innate Immune System Group, Department

of Cell Biology and Histology, Faculty of Biology, Campus Regional de Excelencia

Internacional “Campus Mare Nostrum”, University of Murcia, Murcia 30100, Spain.

Tel.: +34 868884536. Fax: +34 868883963. e-mail: alcuesta@um.es

1
Abstract

The marine fish mummichog (Fundulus heteroclitus), extensively used as research

model, including in ecotoxicology, for over a century has been surpassed by other fish

species. This fact may be associated with the lack of cell lines from this species,

excellent models for the comprehension of fish physiology, immunology, toxicology

and virology, that contribute to the reduction in the number of animals used in research.

We have generated, for the first time, a brain-derived cell line from mummichog, FuB-

1, and evaluated its application to the fields of fish virology, immunity and toxicology.

First, FuB-1 cells show epithelial morphology and neural stem/astroglial origin.

Secondly, FuB-1 cells effectively supports the replication of both spring viremia carp

(SVCV) and infectious pancreatic necrosis (IPNV) viruses, but not nodavirus (NNV),

indicating its potential use for fish virology. Related to this, FuB-1 cells infected with

NNV up-regulate the transcription of genes related to the antiviral immune response,

leading to cell resistance; while they are unaltered when infected with IPNV and SVCV,

facilitating viral replication. Finally, FuB-1 cells were used for toxicological purposes

and we demonstrated that exposure to either polystyrene nanoplastics (PS-100) or

several human-usage pharmaceuticals are cytotoxic. Additionally, PS-100 particles

increase the antioxidant catalase and glutathione S-transferase activities and decrease

the total non-protein thiols in FuB-1 cells. However, PS-100 particles are able to reduce

the cytotoxic effects induced by the pharmaceuticals. In conclusion, we have generated

a cell line from mummichog, which might represent a valuable model for fish studies in

the fields of virology, immunology and toxicology.

Keywords: FuB-1 cell line; Virology; Toxicology; Immunity; Nodavirus; Nanoplastics.

2
Introduction

Fundulus heteroclitus, killifish or mummichog, is a non-migratory estuarine teleost fish

that tolerates a wide range of extreme environmental conditions. This species is easy to

maintain in the laboratory and has been considered as a key vertebrate aquatic model to

study the environmental impact of contaminants (Burnett et al., 2007). In fact, since the

late 19th century up to the 80’s of the 20th century, it was the most used fish model in

research and teaching (Atz, 1986). After this period, it has been almost abandoned

afterwards in favour of other fish species such as medaka, fugu or zebrafish.

Unfortunately, most of those studies were conducted using wild-captured animals and

no in vitro models have been established.

In this sense, fish cell lines are very important tools in research and suitable models to

study fish physiology, immunology, virology, and toxicology (Bols et al., 2017;

Hightower and Renfro, 1988). The process of generation and establishment of cell lines,

recently renamed as invitromatics (Bols et al., 2017), represents the first step for in vitro

studies and firmly adheres to the 3Rs principles. According to the Cellosaurus cell line

database (Bairoch, 2018), available on the ExPASy server

(https://web.expasy.org/cellosaurus/), currently there are almost 600 fish cell lines.

Although the tissue-origin is diverse, most of the fish cell lines are derived from fins

and embryos. Interestingly, there are very few cell lines derived from the nervous

tissues (Ahmed et al., 2009; Bloch et al., 2016; Le et al., 2017; Morcillo et al., 2017;

Wang et al., 2018; Zheng et al., 2015), despite the fact that the fish brain shows very

high rates of neurogenesis and regeneration after injury (Servili et al., 2009).

Unfortunately, a single myogenic continuous cell line derived from mummichog

embryo has been developed, and only applied to understand muscle physiology (Gignac

3
et al., 2014), despite the great importance of this fish species in early studies of

environmental adaptation and toxicology.

Following the proposed nomenclature, virology invitroomics is the application of cell

lines to virology (Bols et al., 2017). This is probably the main application for fish cell

lines since viral diseases are responsible of high mortality rates in both freshwater and

marine fish, causing serious losses in aquaculture (Wolf, 1988). For this reason, fish cell

lines are crucial for viral isolation, propagation and identification, as well as to properly

understand viral pathogenesis and host immunity. Among fish viruses, we will focus on

three groups of RNA viruses, which cover most of the major viral pathogens for the

aquaculture sector: i) viral hemorrhagic septicemia (VHSV) and infectious pancreatic

virus (IPNV) viruses, which mainly affect salmonids (Wallace et al., 2017); ii) spring

viremia carp virus (SVCV) that affects cyprinids (Ashraf et al., 2016); and iii) nervous

necrosis virus (NNV), which is actually the most important marine virus affecting more

than 150 fish species, most of them of the Perciformes order (Doan et al., 2017).

Related to virology, fish cell lines represent excellent models for fish immunity studies,

namely the type I interferon (IFN) response, which is carried out by all nucleated cells

in an attempt to clear the virus.

The other main application of fish cell lines is in the field of toxicology, including

ecotoxicology or immunotoxicology. Apart from the easy culture and maintenance of

fish cell lines (Wolf and Quimby, 1976), their good reputation in environmental

toxicology comes from the demonstration that the effective concentrations (EC50)

determined in vitro using cell lines are comparable to those found in vivo using fish

(Castaño et al., 1996; Segner, 2004). In this sense, one of the recent problems and hot-

topics associated to aquatic toxicology is related to the presence and biological effects

4
of micro (MP, <5 mm) and nanoplastics (NP, <100 nm). Though mostly invisible to the

naked eye and less obvious to the public, MPs and NPs represent the plastic fraction

potentially inducing the most serious ecotoxicological problems since they are may be

incorporated by the biota, and cause negative impacts including mortality, impairment

of reproduction, growth, metabolism, neurotoxicity, oxidative stress, etc. (for reviews

see (Chae and An, 2017; de Sá et al., 2018; Prokić et al., 2019; Strungaru et al., 2019)).

The use of fish cell lines and primary cultures has shown that MPs or NPs produce none

to negligible cytotoxic effects but can alter the antioxidant status and produce oxidative

damage (Almeida et al., 2019; Espinosa et al., 2018; Heinrich and Braunbeck, 2019), as

demonstrated with mammalian cell lines (Schirinzi et al., 2017). However, it is known

that they may alter the toxicity of other pollutants when present at the same time, and/or

release sorbed pollutants (Almeida et al., 2019; Heinrich and Braunbeck, 2019;

Pannetier et al., 2019). Further studies are needed to ascertain whether, and how, MPs

or NPs affect fish, and cell lines would represent valuable models for this

ecotoxicological issue.

Considering this background, the aim of this study was the establishment and

characterization of a brain cell line from Fundulus heretociclus (FuB-1). In addition, we

tested its application to aquaculture virology by evaluating the viral susceptibility to

NNV, SVCV and IPNV, as well as the immune response. Lastly, we evaluated its

potential use in marine ecotoxicology by exposing them to 100 nm polystyrene

nanoplastic particles (PS-100), alone or in combination with several pharmaceutical

compounds. Our data will show that the generated cell line can be useful for studies of

fish virology, immunology and toxicology.

5
2. Materials and methods

2.1. Establishment of the FuB-1 cell line

A fish specimen of mummichog (Fundulus heteroclitus) was obtained from the

C.P.I.F.P. Marítimo Zaporito (San Fernando, Cádiz, Spain). Fish was sacrificed by an

overdose of clove oil and bled. Animal handling and care was based on the Guidelines

of the European Union Council (2010/63/UE) and approved by the Bioethical

Committee of the University of Murcia (Permit Number: A13150104). The fish was

dissected in sterile conditions and brain sampled, fragmented with a scalpel and

disposed into flasks (Nunc) with L-15 Leibowitz medium (Thermo Fisher Scientific)

supplemented with 15% foetal bovine serum (FBS, Thermo Fisher Scientific), 2 mM L-

glutamine (Thermo Fisher Scientific), 100 µg/mL streptomycin (Thermo Fisher

Scientific), 100 U/mL penicillin (Thermo Fisher Scientific) and 10 mM HEPES

(Thermo Fisher Scientific). Brain explants were cultured at 25ºC in an incubator with an

atmosphere with 85% relative humidity, controlled daily under an inverted contrast

phase microscope (Nikon Eclipse TE 2000-U), and subcultured when confluent by

standard trypsinization methods using 0.25% trypsin solution containing 0.53 mM

ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich). When the culture was

confluent retrovirus (SnRV) (Family Retroviridae, genus Orthoretrovirinae) was added

to facilitate cell immortalization (Morcillo et al., 2017). Cells have now more than 100

passages. Established cell line is routinely cultured using 10% FBS, instead of 15%, and

weekly subcultured after trypsinization by diluting it from 1:4 to 1:6. Cells are frozen

with 10% dimethyl sulfoxide (DMSO) in liquid nitrogen and successfully recovered by

thawing. All the assays have been performed at passages 60-90. The presence of

6
mycoplasma was evaluated at different passages using the Hoechst 33258 DNA staining

method (Chen, 1977) and always resulted negative.

2.2. FuB-1 cells characterization

2.2.1. Retrovirus infection. First, we evaluated whether the cell line was infected by

SnRV. For this, total RNA from the cells was obtained using TRIzol Reagent (Thermo

Fisher Scientific) following the vendor’s protocol. Then, genomic DNA was removed

by DNase I (Promega) treatment and cDNA synthetized using the SuperScript IV

reverse transcriptase (Life Technologies) with random hexamers following the

manufacturer’s instructions. PCR was performed using Taq polymerase (Thermo Fisher

Scientific) and SnRV specific primers for the polymerase (pol) gene (Acc. number

SRU26458; Fw, 5’-TGGTACCCATGGATACAGGTACCTCA-3’ and Rev, 5’-

TGTCAGACATGGCCTGTACTTTAGCAGC-3’ primers) and the product, separated

by 1.5% agarose gel containing GelRed™ (Biotium), visualised.

2.2.2. Growth curve. For growth curves, 5-50×103 FuB-1 cells per well were seeded into

96 well-plates (Nunc) and incubated from 0 to 8 days, at 25ºC. The cell viability was

evaluated every day using the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-

diphenyltetrazolium bromide; Sigma-Aldrich) colorimetric assay, based on the

reduction of the yellow soluble tetrazolium salt into a purple, insoluble formazan

product by the mitochondrial succinate dehydrogenase (Mosmann, 1983). For this, FuB-

1 cells were washed and incubated with 200 µl/well of culture medium containing 1

mg/mL of MTT. After 4 h of incubation at 25ºC, the wells were washed, formazan

solubilized and the absorbance determined in a microplate reader (Fluostar Omega,

BMG Labtech) at 570 nm, using 690 nm as reference. Blanks consisted of wells without

cells. In order to extrapolate the absorbance with the number of FuB-1 cells, serial

7
dilutions (1-200×103 cells per well) of FuB-1 cells were also seeded, incubated for 4 h

to allow them to adhere and then the MTT test performed as described above. All

samples were done in triplicate.

Doubling time (Dt) was obtained by the formula (http://www.doubling-

time.com/compute.php): Dt = duration×log (2)/[log(final concentration)-log(initial

concentration)].

2.2.3. Detection of neural and glial markers. Cell cultures were fixed with ice-cold

methanol, washed and incubated for 1 h with 1:100 diluted commercial antibodies (all

from GeneTex): mouse anti-beta Tubulin 3 or rabbit anti-NeuN (neuronal nuclei

protein), anti-MAP2 (microtubule-associated protein 2), anti-GFAP (glial fibrillary

acidic protein) or anti-MBP (myelin basic protein). After washing, they were incubated

with anti-mouse IgG-FITC (BioTools) or anti-rabbit IgG-Alexa Fluor® 568

(Invitrogen). Samples were studied under an epifluorescence microscope (Nikon

Diaphot-TMD) and images acquired with a Leica DFC280 digital camera. Control

samples omitting the primary antibodies were also included.

2.2.4. Transfection with GFP reporter gene. Cultures over 60-80% confluence were

transfected with the vector pEGFP-N3 (Clontech) and the expression of the green

fluorescent protein (GFP) observed under a fluorescence microscope. Several standard

protocols or transfection reagents [calcium phosphate, Lipofectamine® 2000,

electroporation or polyethylenimine (PEI)] were used according to the supplier's

instructions. Transfection efficiency was visualized under an epifluorescence

microscope.

2.3 Susceptibility to fish viruses and immune response

8
Fish viruses were produced using the optimal host fish cell line and growing conditions

as elsewhere: NNV (It/411/96 strain of RGNNV) was produced at 25ºC in the E-11 cell

line (Iwamoto et al., 2000), IPNV (Sp strain) and SVCV (56/70 strain) were propagated

at 20ºC, and VHSV (0771 strain) at 14ºC, the three in the EPC cell line (Fijan et al.,

1983). Then, triplicate cultures of FuB-1 cells with a confluence of 60-80% were

incubated for 1 h with 104 TCID50/mL of NNV at 25ºC, IPNV and SVCV at 20ºC, and

VHSV at 14ºC. Samples without virus served as controls. Afterwards, medium was

replaced by culture medium containing only 2% FBS and the presence of cytopathic

effect (CPE) was monitored daily, up to 7 days, under a phase contrast microscope.

To evaluate the immune response of FuB-1 cells upon viral infection, cultures infected

for 8 h were also sampled and the total RNA isolated as described above. Cultures

incubated with 50 µg poly I:C/mL (pIC; Sigma-Aldrich) were used as positive controls.

cDNA was synthetized and used to analyse the gene expression by real-time PCR

(qPCR) in an ABI PRISM 7500 instrument (Applied Biosystems) using PowerUp

SYBR Green PCR Core Reagents (Applied Biosystems) as described elsewhere

(Chaves-Pozo et al., 2012). We evaluated the expression of the interferon-induced GTP-

binding protein Mx (mx) gene (Acc. number XM_012862187; Fw, 5’-

AGAAGGAGGTGGCCCTGTAT-3’ and Rev, 5’-TGTTTGATCTGCTCCTGCAC-3’

primers), heat-shock protein 70 (hsp70) gene (Acc. number XM_012856915; Fw, 5’-

CTGATCAAACGCAACACCAC -3’ and Rev, 5’- CTTTAGTCATGGCACGCTCA -

3’ primers), which was corrected by the elongation factor 1-alpha (ef1a) (Acc. number

XM_012859705; Fw, 5’-GCAAGAAGCTGGAGGACAAC-3’ and Rev, 5’-

AGGGGAGGGTAGTTGGAGAA-3’ primers) content in each sample, and expressed

as 2-ΔΔCt (Livak and Schmittgen, 2001).

9
2.4. Toxicological effects of nanoplastics and/or pharmaceutical agents

2.4.1. Nanoplastics synthesis and characterization

The plastic particles consisted in 100 nm polystyrene (PS) nanoparticles (PS-100)

prepared by mini-emulsion polymerization as previously described and tested (Almeida

et al., 2019). After polymerization, PS-NPs were extensively washed with ultrapure

water and their hydrodynamic size in ultrapure water and test conditions (in complete

culture media alone and in combination with the tested pharmaceuticals) was analysed

by dynamic light scattering (DLS) (Zetasizer Nano ZS, Malvern).

2.4.2. FuB-1 cells exposure and cytotoxicity

For cytotoxicity determinations, FuB-1 cells at a density of 2.5×104 per well were

seeded in 96-well plates (Nunc) and allowed to adhere overnight. Cells were then

exposed for 24 h to 10-7 up to 10 mg/L of PS-100 NPs to establish the lethal doses

(LD50, LD25 and LD10) as previously described (Almeida et al., 2019). Afterwards, FuB-

1 cells were exposed for 24 h to 2.5×10-3 up to 1 mg/L of pharmaceuticals [gemfibrozil,

furosemide, fluoxetine, metformin and nicotine (TCI chemicals) and paracetamol

(acetaminophen) (Sigma-Aldrich)] alone or in combination with 10 mg/L of PS-100

NPs. Pharmaceuticals were dissolved in DMSO, except metformin that was dissolved in

ultra-pure water. Treatments were done in triplicate. Cell viability was determined by

the MTT test as described above.

2.4.3. Determination of biochemical parameters

For biochemical studies, 2×107 FuB-1 cells were plated in 6 cm Petri dishes, allowed to

adhere overnight and then exposed for 24 h to 10-7 up to 10 mg/L of PS-100 NPs. Cells

10
were collected in lysis buffer (20mM Tris-HCL, pH 7.5, 1mM phenylmethylsulfonyl

fluoride (PMSF)) through scrapping and homogenized in an ultrasonic homogenizer

(Branson Ultrasonics Sonifier S-250A). Homogenates were centrifuged at 10,000 g for

10 minutes at 4ºC, and supernatants collected and stored at -80ºC for further analysis.

Protein content was determined for all samples according to Bradford. The oxidative

stress markers catalase (CAT) and glutathione S-transferase (GST) activities, as well as

the levels of non-protein thiols (NPT), were determined. For CAT activity, changes in

the absorbance at 240  nm caused by the dismutation of hydrogen peroxide (H2O2) were

recorded and CAT activity calculated as μmol H2O2 consumed per min per mg of

protein (ε = 40 M−1.cm−1) (Claiborne, 1985). For GST activity, the conjugation of the

substrate 1-chloro-2, 4-dinitrobenzene (CDNB) with reduced glutathione was monitored

at 340 nm and the GST activity calculated as nmol of CDNB conjugate formed per min

per mg of protein (ε = 9.6 × 10−3 M−1.cm−1) (Habig et al., 1974). For NPT levels, protein

content in the homogenate was precipitated with trichloroacetic acid (TCA at 10%)

during 1 h followed by centrifugation at 13,400 g for 20 min (4°C). NPT levels were

spectrophotometrically determined in the resulting supernatant at 412 nm as elsewhere

(Parvez et al., 2003; Sedlak and Lindsay, 1968).

2.5. Statistical analysis

Growth and cytotoxicity curves were estimated using a nonlinear regression fitting

curve with variable slopes (4P). Lethal doses (LD) were interpolated from the

cytotoxicity curves. Data were analysed using GraphPad Prism 6 program and tested for

normality by Shapiro-Wilk test. Statistical differences between single and combined

treatments (nanoplastics and pharmaceuticals) were verified with a paired t-test

(p < 0.05). In gene expression and biochemical biomarker assays, differences between

11
treatments and controls were tested using one-way analysis of variance (ANOVA),

followed by Dunnett's test whenever applicable.

3. Results and Discussion

3.1. FuB-1 are epithelial-like cells expressing both neural and glial markers

Fish cell lines show several advantages when compared to mammalian ones such as the

wide range of temperatures that they support, their easiness to handle with relatively

high homogeneity, and their capacity to be standardized without difficulty (Bols et al.,

2005; Wolf and Quimby, 1976). Additionally, fish cell lines are valuable tools to

improve our knowledge about fish physiology, virology and toxicity, but also for

biotechnology and medicine, being the results extrapolated to mammals, and

consequently to other vertebrates (Bols et al., 2017; Collet et al., 2018; Hightower and

Renfro, 1988; Meena et al., 2018). Opposite to mammals, fish central nervous tissues,

including brain, show high rates of neurogenesis and regeneration after injury (Servili et

al., 2009; Zupanc and Clint, 2003), probably due to the presence of stem cells

(Chapouton et al., 2007; Kaslin et al., 2008). Thus, mummichog primary cell cultures of

brain were started due to the importance of this marine fish species in research (Atz,

1986; Burnett et al., 2007). Cells started to adhere and grow surrounding the explants in

the first days, rapidly achieving confluence. Cells, at the beginning, consisted of mixed

cell-types and morphologies but, after few passages, showed the final appearance of

epithelial-like cells (Fig. 1A-B), which is maintained for more than 100 passages so far.

This epithelial morphology is in concordance with other fish brain cell lines (Ku et al.,

2009; Servili et al., 2009; Wang et al., 2018; Zheng et al., 2015) but different to those

12
described by others such as glial-like (Morcillo et al., 2017; Wen et al., 2008b),

fibroblastic (Chen et al., 2010; Fu et al., 2015; Hasoon et al., 2011; Lai et al., 2001; Le

et al., 2017), endothelial (Bloch et al., 2016) and neuronal (Hinsch and Zupanc, 2006;

Wen et al., 2010, 2008a). Cells show a nucleus with several very prominent nucleolus

and cytosolic granulation when observed with a phase contrast microscope. In addition,

FuB-1 cell cultures resulted negative for mycoplasma contamination and transfection

(data not shown) but positive for SnRV transcription (Fig. 1C). Cells are also

successfully recovered after thawing.

In order to know the cell line origin, we evaluated the expression of certain molecular

markers. Thus, immunohistochemistry was performed to evaluate the origin of FuB-1

cells using antibodies to both neural (MAP2, NeuN, β-Tubulin) and glial (GFAP, MBP)

protein markers (Fig. 1D-G). FuB-1 cells showed strong staining for both NeuN and

GFAP proteins, and light for MBP, though the labelling for β-Tubulin and MAP2

resulted negative. This immunoreactivity for both neural and glial cell markers (NeuN,

GFAP, and weaker for MBP) suggests that FuB-1 cells are neural stem cells. More

specifically, and according to previous studies (Servili et al., 2009; Wen et al., 2008a),

their positivity for both GFAP and MBP strongly suggest an astroglial phenotype for

FuB-1 cells. As mentioned above, FuB-1 cells show epithelial morphology, and some

authors have shown a protoplasmic phenotype for some fish astroglial cells growing in

typical culture flasks (Fröjdö et al., 2002). The fact that FuB-1 cells express the NeuN

protein, a known marker of mature neurons, also suggests that these cells probably

generate neurons in vitro, highlighting the importance to establish fish brain stem-cell

lines to improve our knowledge about biochemical, physiological and development of

the neural system.

13
Regarding the growth curve, MTT assay was performed and data show a good

correlation between the cell number and the MTT absorbance, as well as the four

conventional phases of a cell line growth curve: Lag, exponential, stationary, and death

phases (Fig. 2). Depending on this growth curve, we determined the initial

concentration of 2.5-5×104 cells per well as the optimal cell density to perform future

experiments considering that this density cells show suitable MTT absorbance in the

exponential phase within two to four days. In addition, the Dt resulted of 37.3 ± 2.81 h,

quite similar to other brain cell lines (Fu et al., 2015; Hasoon et al., 2011; Morcillo et

al., 2017; Zheng et al., 2015), although other studies have shown slower kinetic in long

term cultures of European sea bass brain (SSB-W1) (Servili et al., 2009).

3.2. FuB-1 cells are susceptible to SVCV and IPNV but not to NNV

Nowadays, viral infections are responsible for high rates of mortality in both marine and

freshwater fish. For this reason, we analysed the susceptibility of FuB-1 cells to four

highly infectious and noticeable virus, which cause economic losses in modern

aquaculture and affects a wide range of host species: SVCV, which mainly affects carp

and other cyprinids (Ashraf et al., 2016); VHSV and IPNV, which mainly affects

salmonids (Wallace et al., 2017); and NNV, which affects more than 150 marine fish

species (Doan et al., 2017). First, when FuB-1 cells were incubated at 14ºC for VHSV

infection, cells detached and dyed in few days making unsuitable to study it (data not

shown). Furthermore, the CPE was absent and normal cultures were observed in

controls (Fig. 3A), as well as in those infected with NNV at 25ºC (Fig. 3D), with FuB-1

cells being resistant. However, most of the FuB-1 cells appeared detached and

vesiculated after 3 days of infection with SVCV (Fig.3B) with cultures being

completely destroyed after 7 days (Fig. 3E), demonstrating great susceptibility.

14
Regarding IPNV, cultures were normal after 3 days of infection (Fig. 3C) and, after 7

days, the CPE was evident but not complete (Fig. 3F). These data demonstrate that FuB-

1 cells support SVCV and IPNV infection and replication, but not NNV. Although

many studies have reported viral susceptibility in different cell lines, this is the first

report describing a mummichog cell line for virological purposes, even considering that

VHSV and IPNV have been isolated from this species in vivo (Ahne et al., 2003; Gagné

et al., 2007). Thus, FuB-1 cells represent a good in vitro model for the isolation,

characterization and propagation of IPNV and SVCV viruses, which have a real interest

for the aquaculture industry (Jarp et al., 1995; Zhang et al., 2009).

Both susceptible and resistant cell lines are needed to understand the pathogenesis of

virus. Cellular resistance could be due to either limitations in the virus binding,

internalization and propagation into the host cell, or because the cell implements a

strong and effective immune response. In this sense, cell lines are valuable tools to

evaluate the antiviral response, namely the type I IFN response, which is carried out by

all the nucleated cells. Thus, amongst the different IFN-stimulated genes, mx encodes a

protein with direct antiviral activity against many RNA viruses, and represents the most

consistent and accepted hallmark of the antiviral immunity, and of type I IFN response

in particular. Our data show that transcription of mx gene was significantly up-regulated

in FuB-1 cells incubated for 8 h with poly I:C, a viral RNA analogue and agonist of the

IFN response, as well as in cells infected with NNV, but not with SVCV or IPNV (Fig.

3G). In addition, we also evaluated the mRNA levels of the hsp70 gene. Although

mainly related to the cellular stress and malformation of proteins, members of the HSP

family of proteins are necessary for, and directly related to, the virus-host binding and

entry (Pockley et al., 2008). This has been also documented for NNV in fish (Chang and

Chi, 2015; Kim et al., 2017; Liu et al., 2016), and in European sea bass DLB-1 cell line

15
upon NNV infection (Chaves-Pozo et al., 2019). Thus, our data show that only NNV

infection, and not SVCV or IPNV, significantly up-regulated hsp70 transcription in

FuB-1 cells (Fig. 3E). These findings suggest that NNV is able to enter the cells but that

the IFN-triggered response, measured as mx gene expression, is able to inhibit NNV

propagation and serves as an efficient mechanism to refract its infection, as also

demonstrated in several brain cell lines and in a zebrafish model (Lin et al., 2006; Lu et

al., 2008; Wu and Chi, 2006). In fact, this Mx protein reduces the titre of NNV from 10-

up to 100-fold, and inhibits virus propagation in GB3 cells from brain grouper (Lin et

al., 2006). Interestingly, several studies have documented, either in vivo or in vitro, low

or deficient mx transcription in host fish species susceptible to NNV, or their derived

cell lines, and important increments in resistant fish species (Chaves-Pozo et al., 2019,

2012; Chi et al., 2001; Tafalla et al., 2004; Wu et al., 2016). Taken together, these data

suggest that Mx protein plays a crucial role repressing NNV replication in FuB-1 cells,

although other mediators could be also involved in this response. In agreement with our

data, zebrafish susceptibility to SVCV was correlated with absent or low IFN and Mx

response (López-Muñoz et al., 2010). In the case of IPNV, the information is

controversial since several authors have documented increased or unaltered Mx

response in salmonids after IPNV infection (Collet et al., 2007; Kileng et al., 2007).

Therefore, FuB-1 cell line may represent a good in vitro model to elucidate the

molecular mechanisms leading to virus-induced type I IFN activation in the central

nervous system and the subsequent viral defence.

3.3. PS-100 NPs are cytotoxic to FuB-1 cells and produce oxidative stress

Micro and nanoplastic pollution has emerged as the greatest environmental challenge of

the decade. One of the major fears is the ability of plastic particles to adsorb

16
components from the environment, including pharmaceuticals, polychlorinated

biphenyls (PCBs) and polycyclic aromatic hydrocarbons (PAHs) (Oliveira and

Almeida, 2019). Besides the absorbance capacity, nanoparticles, in general, tend to

attract protein components, forming a biocorona (Dai et al., 2017), which is assembled

almost immediately upon contact with the biological fluid and may absorb-desorb,

establishing an equilibrium with the environment. To assess this, we firstly evaluated

the hydrodynamic size (DLS) of PS-100 NPs in the different solutions. The PS-100

particle size in water was 99.7 ± 8.3 nm assessed by transmission electron microscopy

(Almeida et al., 2019) and 125 ± 26.7 nm assessed by DLS (Supplementary Fig.S1,

Table S1). This size is increased in culture medium alone as previously demonstrated

(Almeida et al., 2019).

We then evaluated the viability and biochemical endpoints in FuB-1 cells exposed to

PS-100 NPs. Exposure of FuB-1 cells to PS-100 NPs revealed a cytotoxic effect

(measured by MTT) with a calculated LD50, LD25 and LD10 of 11.24 mg/L, 4.65 mg/L

and 1.59 mg/L, respectively (Fig. 4A). We have already published that the SAF-1 cell

(derived from gilthead seabream fins) viability is not significantly affected by PS-100

particles (Almeida et al., 2019). However, the DLB-1 cell line, also derived from the

brain, was a bit more sensitive reaching viabilities of 64% when incubated with 1 mg/L

of PS-100 particles, though no LD50 was calculated. Thus, FuB-1 cell line is the most

susceptible since LD10 values were obtained at 1.59 mg/L. There is still a lack of data

on the impact of micro and nanoplastics in cellular models. Recently, pristine

polystyrene failed to induce a cytotoxic response in the RTL-W1 cell line from rainbow

trout (Pannetier et al., 2019) while silver nanoparticles induced much higher LD50 in

fish cell lines (Vo et al., 2014), demonstrating the brain-derived cell lines to be the most

resistant.

17
The most accepted mechanism by which plastics alters cell biology is oxidative stress

(Almeida et al., 2019; Espinosa et al., 2018; Heinrich and Braunbeck, 2019; Morcillo et

al., 2017; Schirinzi et al., 2017), in which the production of reactive oxygen species

(ROS) and the antioxidant defences are imbalanced. Thus, we also evaluated this

hypothesis. Catalase and GST activities significantly increased in FuB-1 cells exposed

to the highest concentration of PS-100 NPs (10 mg/L), demonstrating a clear activation

of the antioxidant defences (Fig. 4B, C). Concerning GST, the intermediary

concentrations of 0.01, 0.001 and 0.0001 mg/L also induced an increased activity when

compared to the control, although only 0.01 mg/L concentration induced significant

differences (Fig. 4C). Unlike GST, catalase activity was significantly inhibited by PS-

100 NPs concentrations of 1 and 0.1 mg/L (Fig. 4B). In comparison, catalase activity

was not affected in DLB-1 cells exposed to PS-100 NPs but decreased in SAF-1 cells at

sub-lethal concentrations (Almeida et al., 2019), while lethal concentrations produced

an increase of this catalase activity in FuB-1 cells. GST activity was also increased in

DLB-1 cells exposed to PS-100 particles at all the concentrations, while in SAF-1 cells

this enzymatic activity was increased at 0.01 and 0.1 mg/L and decreased at 1 and 10

mg/L (Almeida et al., 2019). Catalase is considered one of the most responsive enzymes

to ROS and the first line of defence against H2O2, while GST is involved not only in the

antioxidant system but also in phase II of biotransformation of active electrophilic

metabolites, promoting the conjugation of reduced glutathione (GSH) with metabolites

to increase their hydrophilic properties. These data show that PS-100 NPs increase

enzymatic antioxidant defences in FuB-1 cells at lethal doses suggesting that they are

not effective enough in the elimination of ROS, leading to cell death.

Non-enzymatic antioxidant molecules are also important players in oxidative stress.

There is no record for the effects of micro and nanoplastics on NPT levels in cell lines

18
or animal models. Our data demonstrate a clear alteration of the non-enzymatic

antioxidant defences by all the tested concentrations of PS-100 NPs, with the levels

falling from 280 nmol/mg protein in control FuB-1 cells to less than 11 in cells exposed

to nanoplastics (Fig. 4D). Thiols, and more specifically GSH, are known to be

responsive to environmental factors, including ROS, directly and indirectly through

GST and glutathione peroxidase (GPx) activities, that use GSH as a co-factor

(Dickinson and Forman, 2002). Transport and depletion of GSH is considered a major

inducer of apoptosis and is shown to impair proliferation in cellular models (Franco and

Cidlowski, 2012; Markovic et al., 2009). Other potential factors responsible for this

response involves an impaired de novo synthesis of thiols by the PS-100 NPs or even a

combined effect, due to lower synthesis coupled with GSH depletion by the increase in

GST activity (Dickinson and Forman, 2002). Further studies are needed to ascertain the

cross-talk in the cellular viability and functions between ROS and both enzymatic and

non-enzymatic antioxidant responses in relation to nanoplastics.

3.4. PS-100 NPs reduce the cytotoxicity of pharmaceuticals

In addition to nano and microplastics, pharmaceuticals pollution is also relevant and one

of the major threats to marine life (Gaw et al., 2014; Nannou et al., 2015). Therefore, it

is important to assess their combined effect in cellular models of species present in the

environment. In general, most pharmaceuticals induced some degree of cytotoxicity by

themselves. We obtained the cytotoxicity curves and LDs for 6 pharmaceuticals in the

FuB-1 cell line (Fig. 5, Table 1). Fluoxetine is the most damaging pharmaceutical with

the lowest LD50 (Table 1), inferior to the ones calculated for SAF-1, DLB-1 and RTG-2

cell lines (Almeida et al., 2019; Laville et al., 2004). For acetaminophen, the LD50

values of 0.324 mg/L for FuB-1 cells (Table 1) are much lower than the ones recorded

19
for SAF-1 and DLB-1 cells, but higher than for BF-2 cells (Almeida et al., 2019;

Henschel et al., 1997). Gemfibrozil exerts, in FuB-1 cells, effects similar (Table 1) to

those reported in DLB-1 and SAF-1 cells (Almeida et al., 2019). Nicotine and

metformin are the less toxic and LD50 values were not reached for FuB-1 cells (Table

1), under the tested concentrations. The induced effect was similar to DLB-1 and SAF-1

cells, but the latter was more sensitive than both brain derived cell lines (Almeida et al.,

2019).

Interestingly, the negative impact of pharmaceuticals in FuB-1 cell viability was

reduced by the co-exposure with PS-100 NPs (Fig. 5; Table 1). This effect was

maximum for furosemide, resulting in the inability to compute LD50 and LD25 values,

and with a calculated LD10 of 0.405 mg/L, close to the LD25 value for furosemide alone

(Table 1). When the cytotoxic curves of FuB-1 cells exposed to pharmaceuticals alone

or co-exposed with PS-100 NPs were statistically compared, acetaminophen,

gemfibrozil and fluoxetine showed significant differences whereas furosemide,

metformin and nicotine did not (Table 1). For DLB-1 and SAF-1 cells significant

differences between the cytotoxic curves of combined and individual exposures were

found for all tested pharmaceuticals except fluoxetine (Almeida et al., 2019). This

demonstrates that nanoplastics alter the toxicity of other pollutants.

However, whether and how these pharmaceuticals interact with nanoplastics remains to

be elucidated and could explain the observed effects. Aiming to throw some light on

this we also evaluated the DLS of PS-100 NPs in the presence of the pharmaceuticals

(Supplementary Fig. S1; Table S1). The DLS analysis of the nanoplastics in the

presence of fluoxetine demonstrated two populations of particles (Supplementary

Fig.S1B; Table S1): a similar peak to PS-100 particles in culture medium, but of lower

20
size, and a second population with a size of 1,259 nm, which shows that this compound

is capable of inducing particle aggregation. This finding suggests that fluoxetine alters

the properties of the particle surface/composition of biocorona formed in the presence of

FuB-1 cell culture medium. For acetaminophen, the overall size and PDI of PS-100 NPs

slightly decreased (Supplementary Fig.S1A; Table S1), demonstrating a direct effect on

the composition of the biocorona, probably by replacing/substituting some elements.

Gemfibrozil and nicotine induced consistent and time-dependent increases in the

calculated size of PS-100 NPs by DLS (Supplementary Fig.S1D, F; Table S1),

suggesting the possibility that this type of chemicals may be included in the hard corona

that surrounds the PS-100 NPs, and therefore unavailable to exert its toxicity towards

FuB-1 cells, since the combined treatment lead to an increase in the LD50 and LD25

values. Furosemide and metformin induced little changes to the PS-100 NPs particles

(Supplementary Fig.S1C, E; Table S1).

4. Conclusions

In this study we have established a continuous brain cell line (FuB-1) from F.

heteroclitus. FuB-1 cells show epithelial-like morphology, neural stem or astroglial

origin and fast growth. FuB-1 cells are susceptible to SVCV and IPNV infection, but

resistant to NNV, which was correlated with unaltered or up-regulated mx and hsp70

mRNA levels, respectively. Lastly, single exposure of FuB-1 cells to either 100 nm

polystyrene nanoplastic particles or pharmaceutical compounds resulted in cytotoxicity.

In addition, exposure to PS-100 NPs altered the cellular redox state and reduced the

cytotoxic effects of pharmaceutical compounds. This study establishes and characterizes

21
a new fish brain cell line and demonstrates its suitability as a model for fish virology,

immunology and toxicology.

Acknowledgements

University of Murcia researchers thank to Ministerio de Economía y Competitividad and

FEDER (grants AGL2013-43588-P and AGL2016-74866-C3-1-R) and Fundación

Séneca de la Región de Murcia (19883/GERM/15) for the financial support. University

of Aveiro researchers acknowledge to CESAM (UID/AMB/50017/2019) and

FCT/MCTES through national funds, and the cofounding by the FEDER, within the

PT2020 Partnership Agreement and Compete 2020. MO had financial support of the

program Investigador FCT (IF/00335/2015), co-funded by the Human Potential

Operational Program and European Social Fund. Viruses were kindly donated by Pilar

Fernández Somalo (Laboratorio Central de Veterinaria de Algete, Ministerio de Medio

Ambiente, Rural y Marino). Authors want to thank to staff of the Servicio de Cultivo de

Tejidos from the University of Murcia.

Conflict of interests

The authors declare that they have no conflict of interest.

References

Ahmed, V.P.I., Chandra, V., Sudhakaran, R., Kumar, S.R., Sarathi, M., Babu, V.S.,

Ramesh, B., Hameed, A.S.S., 2009. Development and characterization of cell lines

22
 derived from rohu, Labeo rohita (Hamilton), and catla, Catla catla (Hamilton). J.

Fish Dis. 32, 211–8. https://doi.org/10.1111/j.1365-2761.2008.00966.x

Ahne, W., Blake, S., Essbauer, S., Nicholson, B.L., 2003. Characterization of

aquabirnaviruses from flounder Pseudopleuronectes americanus and mummichog

Fundulus heteroclitus in the Chesapeake Bay, Virginia, USA. Dis. Aquat. Organ.

56, 201–206. https://doi.org/10.3354/dao056201

Almeida, M., Martins, M.A., Soares, A.M.V., Cuesta, A., Oliveira, M., 2019.

Polystyrene nanoplastics alter the cytotoxicity of human pharmaceuticals on

marine fish cell lines. Environ. Toxicol. Pharmacol. 69, 57–65.

https://doi.org/10.1016/J.ETAP.2019.03.019

Ashraf, U., Lu, Y., Lin, L., Yuan, J., Wang, M., Liu, X., 2016. Spring viraemia of carp

virus: Recent advances. J. Gen. Virol. 97, 1037–1051.

https://doi.org/10.1099/jgv.0.000436

Atz, J.W., 1986. Fundulus heteroclitus in the laboratory: A history. Integr. Comp. Biol.

26, 111–120. https://doi.org/10.1093/icb/26.1.111

Bairoch, A., 2018. The Cellosaurus, a cell-line knowledge resource. J. Biomol. Tech.

29, 25–38. https://doi.org/10.7171/jbt.18-2902-002

Bloch, S.R., Vo, N.T.K., Walsh, S.K., Chen, C., Lee, L.E.J., Hodson, P. V, Bols, N.C.,

2016. Development of a cell line from the American eel brain expressing

endothelial cell properties. In Vitro Cell. Dev. Biol. Anim. 52, 395–409.

https://doi.org/10.1007/s11626-015-9986-8

Bols, N.C., Dayeh, V.R., Lee, L.E.J., Schirmer, K., 2005. Use of fish cell lines in the

23
 toxicology and ecotoxicology of fish. Piscine cell lines in environmental

toxicology. Biochem. Mol. Biol. Fishes 6, 43–84. https://doi.org/10.1016/S1873-

0140(05)80005-0

Bols, N.C., Pham, P.H., Dayeh, V.R., Lee, L.E.J., 2017. Invitromatics, invitrome, and

invitroomics: introduction of three new terms for in vitro biology and illustration

of their use with the cell lines from rainbow trout. Vitr. Cell. Dev. Biol. - Anim.

53, 383–405. https://doi.org/10.1007/s11626-017-0142-5

Burnett, K.G., Bain, L.J., Baldwin, W.S., Callard, G. V, Cohen, S., Di Giulio, R.T.,

Evans, D.H., Gómez-Chiarri, M., Hahn, M.E., Hoover, C.A., Karchner, S.I.,

Katoh, F., Maclatchy, D.L., Marshall, W.S., Meyer, J.N., Nacci, D.E., Oleksiak,

M.F., Rees, B.B., Singer, T.D., Stegeman, J.J., Towle, D.W., Van Veld, P.A.,

Vogelbein, W.K., Whitehead, A., Winn, R.N., Crawford, D.L., 2007. Fundulus as

the premier teleost model in environmental biology: Opportunities for new insights

using genomics. Comp. Biochem. Physiol. Part D. Genomics Proteomics 2, 257–

86. https://doi.org/10.1016/j.cbd.2007.09.001

Castaño, A., Cantarino, M.J., Castillo, P., Tarazona, J.V., 1996. Correlations between

the RTG-2 cytotoxicity test EC50 and in vivo LC50 rainbow trout bioassay.

Chemosphere 32, 2141–2157. https://doi.org/10.1016/0045-6535(96)00126-9

Chae, Y., An, Y.-J., 2017. Effects of micro- and nanoplastics on aquatic ecosystems:

Current research trends and perspectives. Mar. Pollut. Bull. 124, 624–632.

https://doi.org/10.1016/j.marpolbul.2017.01.070

Chang, J.-S., Chi, S.-C., 2015. GHSC70 is involved in the cellular entry of nervous

necrosis virus. J. Virol. 89, 61–70. https://doi.org/10.1128/JVI.02523-14

24
Chapouton, P., Jagasia, R., Bally-Cuif, L., 2007. Adult neurogenesis in non-mammalian

vertebrates. Bioessays 29, 745–57. https://doi.org/10.1002/bies.20615

Chaves-Pozo, E., Bandín, I., Olveira, J.G., Esteve-Codina, A., Gómez-Garrido, J.,

Dabad, M., Alioto, T., Esteban, M.Á., Cuesta, A., 2019. European sea bass brain

DLB-1 cell line is susceptible to nodavirus: A transcriptomic study. Fish Shellfish

Immunol. 86, 14–24. https://doi.org/10.1016/j.fsi.2018.11.024

Chaves-Pozo, E., Guardiola, F.A., Meseguer, J., Esteban, M.A., Cuesta, A., 2012.

Nodavirus infection induces a great innate cell-mediated cytotoxic activity in

resistant, gilthead seabream, and susceptible, European sea bass, teleost fish. Fish

Shellfish Immunol. 33, 1159–1166. https://doi.org/10.1016/j.fsi.2012.09.002

Chen, M.J., Chiou, P.P., Liao, Y.-H., Lin, C.-M., Chen, T.T., 2010. Development and

characterization of five rainbow trout pituitary single-cell clone lines capable of

producing pituitary hormones. J. Endocrinol. 205, 69–78.

https://doi.org/10.1677/JOE-09-0315

Chen, T.R., 1977. In situ detection of mycoplasma contamination in cell cultures by

fluorescent Hoechst 33258 stain. Exp. Cell Res. 104, 255–262.

https://doi.org/10.1016/0014-4827(77)90089-1

Chi, C.S., Hu, W.W., Lo, B.J., 2001. Establishment and characterization of a continuous

cell line (GF-1) derived from grouper, Epinephelus coioides (Hamilton): a cell line

susceptible to grouper nervous necrosis virus (GNNV). J. Fish Dis. 22, 173–182.

https://doi.org/10.1046/j.1365-2761.1999.00152.x

Claiborne, A., 1985. Catalase activity, in: Robert A. Greenwald (Ed.), Handbook of

Methods for Oxygen Radical Research. CRC Press Inc, Boca Raton, pp. 283–284.

25
Collet, B., Collins, C., Lester, K., 2018. Engineered cell lines for fish health research.

Dev. Comp. Immunol. 80, 34–40. https://doi.org/10.1016/j.dci.2017.01.013

Collet, B., Munro, E.S., Gahlawat, S., Acosta, F., Garcia, J., Roemelt, C., Zou, J.,

Secombes, C.J., Ellis, A.E., 2007. Infectious pancreatic necrosis virus suppresses

type I interferon signalling in rainbow trout gonad cell line but not in Atlantic

salmon macrophages. Fish Shellfish Immunol. 22, 44–56.

https://doi.org/10.1016/j.fsi.2006.03.011

Dai, Q., Guo, J., Yan, Y., Ang, C.-S., Bertleff-Zieschang, N., Caruso, F., 2017. Cell-

conditioned protein coronas on engineered particles influence immune responses.

Biomacromolecules 18, 431–439. https://doi.org/10.1021/acs.biomac.6b01545

de Sá, L.C., Oliveira, M., Ribeiro, F., Rocha, T.L., Futter, M.N., 2018. Studies of the

effects of microplastics on aquatic organisms: What do we know and where should

we focus our efforts in the future? Sci. Total Environ. 645, 1029–1039.

https://doi.org/10.1016/J.SCITOTENV.2018.07.207

Dickinson, D.A., Forman, H.J., 2002. Cellular glutathione and thiols metabolism.

Biochem. Pharmacol. 64, 1019–1026. https://doi.org/10.1016/S0006-

2952(02)01172-3

Doan, Q.K., Vandeputte, M., Chatain, B., Morin, T., Allal, F., 2017. Viral

encephalopathy and retinopathy in aquaculture: a review. J. Fish Dis. 40, 717–742.

https://doi.org/10.1111/jfd.12541

Espinosa, C., García Beltrán, J.M., Esteban, M.A., Cuesta, A., 2018. In vitro effects of

virgin microplastics on fish head-kidney leucocyte activities. Environ. Pollut. 235,

30–38. https://doi.org/10.1016/j.envpol.2017.12.054

26
Fijan, N., Sulimanović, D., Bearzotti, M., Muzinić, D., Zwillenberg, L.O.,

Chilmonczyk, S., Vautherot, J.F., de Kinkelin, P., 1983. Some properties of the

Epithelioma papulosum cyprini (EPC) cell line from carp Cyprinus carpio. Ann.

l’Institut Pasteur / Virol. 134, 207–220. https://doi.org/10.1016/S0769-

2617(83)80060-4

Franco, R., Cidlowski, J.A., 2012. Glutathione efflux and cell death. Antioxid. Redox

Signal. 17, 1694–1713. https://doi.org/10.1089/ars.2012.4553

Fröjdö, E.-M., Westerlund, J., Isomaa, B., 2002. Culturing and characterization of

astrocytes isolated from juvenile rainbow trout (Oncorhynchus mykiss). Comp.

Biochem. Physiol. A. Mol. Integr. Physiol. 133, 17–28.

Fu, X., Li, N., Lai, Y., Luo, X., Wang, Y., Shi, C., Huang, Z., Wu, S., Su, J., 2015. A

novel fish cell line derived from the brain of Chinese perch Siniperca chuatsi:

Development and characterization. J. Fish Biol. 86, 32–45.

https://doi.org/10.1111/jfb.12540

Gagné, N., MacKinnon, A.M., Boston, L., Souter, B., Cook-Versloot, M., Griffiths, S.,

Olivier, G., 2007. Isolation of viral haemorrhagic septicaemia virus from

mummichog, stickleback, striped bass and brown trout in eastern Canada. J. Fish

Dis. 30, 213–223. https://doi.org/10.1111/j.1365-2761.2007.00802.x

Gaw, S., Thomas, K. V., Hutchinson, T.H., 2014. Sources, impacts and trends of

pharmaceuticals in the marine and coastal environment. Philos. Trans. R. Soc. B

Biol. Sci. 369, 20130572. https://doi.org/10.1098/rstb.2013.0572

Gignac, S.J., Vo, N.T.K., Mikhaeil, M.S., Alexander, J.A.N., MacLatchy, D.L., Schulte,

P.M., Lee, L.E.J., 2014. Derivation of a continuous myogenic cell culture from an

27
 embryo of common killifish, Fundulus heteroclitus. Comp. Biochem. Physiol. -

Part A Mol. Integr. Physiol. 175, 15–27.

https://doi.org/10.1016/j.cbpa.2014.05.002

Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione S-transferases. The first

enzymatic step in mercapturic acid formation. J. Biol. Chem. 249, 7130–9.

Hasoon, M.F., Daud, H.M., Abdullah, A.A., Arshad, S.S., Bejo, H.M., 2011.

Development and partial characterization of new marine cell line from brain of

Asian sea bass Lates calcarifer for virus isolation. Vitr. Cell. Dev. Biol. - Anim.

47, 16–25. https://doi.org/10.1007/s11626-010-9348-5

Heinrich, P., Braunbeck, T., 2019. Bioavailability of microplastic-bound pollutants in

vitro: The role of adsorbate lipophilicity and surfactants. Comp. Biochem. Physiol.

Part C Toxicol. Pharmacol. 221, 59–67.

https://doi.org/10.1016/J.CBPC.2019.03.012

Henschel, K.-P., Wenzel, A., Diedrich, M., Fliedner, A., 1997. Environmental hazard

assessment of pharmaceuticals. Regul. Toxicol. Pharmacol. 25, 220–225.

https://doi.org/10.1006/rtph.1997.1102

Hightower, L.E., Renfro, J.L., 1988. Recent applications of fish cell culture to

biomedical research. J. Exp. Zool. 248, 290–302.

https://doi.org/10.1002/jez.1402480307

Hinsch, K., Zupanc, G.K.H., 2006. Isolation, cultivation, and differentiation of neural

stem cells from adult fish brain. J. Neurosci. Methods 158, 75–88.

https://doi.org/10.1016/J.JNEUMETH.2006.05.020

28
Iwamoto, T., Nakai, T., Mori, K., Arimoto, M., Furusawa, I., 2000. Cloning of the fish

cell line SSN-1 for piscine nodaviruses. Dis. Aquat. Organ. 43, 81–89.

https://doi.org/10.3354/dao043081

Jarp, J., Gjevre, A.G., Olsen, A.B., Bruheim, T., 1995. Risk factors for furunculosis,

infectious pancreatic necrosis and mortality in post‐smolt of Atlantic salmon,

Salmo solar L. J. Fish Dis. 18, 67–78. https://doi.org/10.1111/j.1365-

2761.1995.tb01267.x

Kaslin, J., Ganz, J., Brand, M., 2008. Proliferation, neurogenesis and regeneration in the

non-mammalian vertebrate brain. Philos. Trans. R. Soc. B Biol. Sci. 363, 101–122.

https://doi.org/10.1098/rstb.2006.2015

Kileng, Ø., Brundtland, M.I., Robertsen, B., 2007. Infectious salmon anemia virus is a

powerful inducer of key genes of the type I interferon system of Atlantic salmon,

but is not inhibited by interferon. Fish Shellfish Immunol. 23, 378–389.

https://doi.org/10.1016/j.fsi.2006.11.011

Kim, Jong-Oh, Kim, Jae-Ok, Kim, W.-S., Oh, M.-J., Kim, Jong-Oh, Kim, Jae-Ok, Kim,

W.-S., Oh, M.-J., 2017. Characterization of the transcriptome and gene expression

of brain tissue in sevenband grouper (Hyporthodus septemfasciatus) in response to

NNV infection. Genes (Basel). 8, 31. https://doi.org/10.3390/genes8010031

Ku, C., Teng, Y.-C., Wang, C.-S., Lu, C., 2009. Establishment and characterization of

three cell lines derived from the rockfish grouper Epinephelus quoyanus: Use for

transgenic studies and cytotoxicity testing. Aquaculture 294, 147–151.

https://doi.org/10.1016/J.AQUACULTURE.2009.05.010

Lai, Y.-S., Murali, S., Chiu, H.-C., Ju, H.-Y., Lin, Y.-S., Chen, S.-C., Guo, I.-C., Fang,

29
 K., Chang, C.-Y., 2001. Propagation of yellow grouper nervous necrosis virus

(YGNNV) in a new nodavirus-susceptible cell line from yellow grouper,

Epinephelus awoara (Temminck &amp; Schlegel), brain tissue. J. Fish Dis. 24,

299–309. https://doi.org/10.1046/j.1365-2761.2001.00303.x

Laville, N., Aı̈t-Aı̈ssa, S., Gomez, E., Casellas, C., Porcher, J.., 2004. Effects of human

pharmaceuticals on cytotoxicity, EROD activity and ROS production in fish

hepatocytes. Toxicology 196, 41–55. https://doi.org/10.1016/j.tox.2003.11.002

Le, Y., Li, Y., Jin, Y., Jia, P., Jia, K., Yi, M., 2017. Establishment and characterization

of a brain cell line from sea perch, Lateolabrax japonicus. In Vitro Cell. Dev. Biol.

Anim. 53, 834–840. https://doi.org/10.1007/s11626-017-0185-7

Lin, Chih Hung, Christopher John, J.A., Lin, Cheng Hui, Chang, C.Y., 2006. Inhibition

of nervous necrosis virus propagation by fish Mx proteins. Biochem. Biophys. Res.

Commun. 351, 534–539. https://doi.org/10.1016/j.bbrc.2006.10.063

Liu, P., Wang, L., Kwang, J., Yue, G.H., Wong, S.-M., 2016. Transcriptome analysis of

genes responding to NNV infection in Asian seabass epithelial cells. Fish Shellfish

Immunol. 54, 342–352. https://doi.org/10.1016/J.FSI.2016.04.029

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using

real-time quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408.

https://doi.org/10.1006/meth.2001.1262

López-Muñoz, A., Roca, F.J., Sepulcre, M.P., Meseguer, J., Mulero, V., 2010. Zebrafish

larvae are unable to mount a protective antiviral response against waterborne

infection by spring viremia of carp virus. Dev. Comp. Immunol. 34, 546–552.

https://doi.org/10.1016/j.dci.2009.12.015

30
Lu, M.W., Chao, Y.M., Guo, T.C., Santi, N., Evensen, Ø., Kasani, S.K., Hong, J.R.,

Wu, J.L., 2008. The interferon response is involved in nervous necrosis virus acute

and persistent infection in zebrafish infection model. Mol. Immunol. 45, 1146–

1152. https://doi.org/10.1016/j.molimm.2007.07.018

Markovic, J., Mora, N.J., Broseta, A.M., Gimeno, A., De-la-Concepción, N., Viña, J.,

Pallardó, F. V., 2009. The depletion of nuclear glutathione impairs cell

proliferation in 3t3 fibroblasts. PLoS One 4, e6413.

https://doi.org/10.1371/journal.pone.0006413

Meena, L.L., Haldar, C., Ram, R., Kumar, M., 2018. Current scenario and advances in

fish cell lines development and characterization in India 5, 127–130.

Morcillo, P., Chaves-Pozo, E., Meseguer, J., Esteban, M.Á., Cuesta, A., 2017.

Establishment of a new teleost brain cell line (DLB-1) from the European sea bass

and its use to study metal toxicology. Toxicol. Vitr. 38, 91–100.

https://doi.org/10.1016/j.tiv.2016.10.005

Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival:

Application to proliferation and cytotoxicity assays. J. Immunol. Methods 65, 55–

63. https://doi.org/10.1016/0022-1759(83)90303-4

Nannou, C.I., Kosma, C.I., Albanis, T.A., 2015. Occurrence of pharmaceuticals in

surface waters: analytical method development and environmental risk assessment.

Int. J. Environ. Anal. Chem. 95, 1242–1262.

https://doi.org/10.1080/03067319.2015.1085520

Oliveira, M., Almeida, M., 2019. The why and how of micro(nano)plastic research.

TrAC Trends Anal. Chem. 114, 196–201.

31
 https://doi.org/10.1016/J.TRAC.2019.02.023

Pannetier, P., Cachot, J., Clérandeau, C., Faure, F., Van Arkel, K., de Alencastro, L.F.,

Levasseur, C., Sciacca, F., Bourgeois, J.-P., Morin, B., 2019. Toxicity assessment

of pollutants sorbed on environmental sample microplastics collected on beaches:

Part I-adverse effects on fish cell line. Environ. Pollut. 248, 1088–1097.

https://doi.org/10.1016/j.envpol.2018.12.091

Parvez, S., Sayeed, I., Pandey, S., Ahmad, A., Bin-Hafeez, B., Haque, R., Ahmad, I.,

Raisuddin, S., 2003. Modulatory effect of copper on nonenzymatic antioxidants in

freshwater fish Channa punctatus (Bloch.). Biol. Trace Elem. Res. 93, 237–248.

https://doi.org/10.1385/BTER:93:1-3:237

Pockley, A.G., Muthana, M., Calderwood, S.K., 2008. The dual immunoregulatory

roles of stress proteins. Trends Biochem. Sci. 33, 71–9.

https://doi.org/10.1016/j.tibs.2007.10.005

Prokić, M.D., Radovanović, T.B., Gavrić, J.P., Faggio, C., 2019. Ecotoxicological

effects of microplastics: Examination of biomarkers, current state and future

perspectives. TrAC Trends Anal. Chem. 111, 37–46.

https://doi.org/10.1016/J.TRAC.2018.12.001

Schirinzi, G.F., Pérez-Pomeda, I., Sanchís, J., Rossini, C., Farré, M., Barceló, D., 2017.

Cytotoxic effects of commonly used nanomaterials and microplastics on cerebral

and epithelial human cells. Environ. Res. 159, 579–587.

https://doi.org/10.1016/J.ENVRES.2017.08.043

Sedlak, J., Lindsay, R.H., 1968. Estimation of total, protein-bound, and nonprotein

sulfhydryl groups in tissue with Ellman’s reagent. Anal. Biochem. 25, 192–205.

32
 https://doi.org/10.1016/0003-2697(68)90092-4

Segner, H., 2004. Cytotoxicity assays with fish cells as an alternative to the acute

lethality test with fish. Altern. to Lab. Anim. 32, 375–382.

https://doi.org/10.1177/026119290403200409

Servili, A., Bufalino, M.R., Nishikawa, R., de Melo, I.S., Muñoz-Cueto, J.A., Lee,

L.E.J., 2009. Establishment of long term cultures of neural stem cells from adult

sea bass, Dicentrarchus labrax. Comp. Biochem. Physiol. - A Mol. Integr. Physiol.

152, 245–254. https://doi.org/10.1016/j.cbpa.2008.10.018

Strungaru, S.-A., Jijie, R., Nicoara, M., Plavan, G., Faggio, C., 2019. Micro- (nano)

plastics in freshwater ecosystems: Abundance, toxicological impact and

quantification methodology. TrAC Trends Anal. Chem. 110, 116–128.

https://doi.org/10.1016/J.TRAC.2018.10.025

Tafalla, C., Aranguren, R., Secombes, C.J., Figueras, A., Novoa, B., 2004. Cloning and

analysis of expression of a gilthead sea bream (Sparus aurata) Mx cDNA. Fish

Shellfish Immunol. 16, 11–24. https://doi.org/10.1016/S1050-4648(03)00010-X

Vo, N.T.K., Bufalino, M.R., Hartlen, K.D., Kitaev, V., Lee, L.E.J., 2014. Cytotoxicity

evaluation of silica nanoparticles using fish cell lines. Vitr. Cell. Dev. Biol. -

Anim. 50, 427–438. https://doi.org/10.1007/s11626-013-9720-3

Wallace, I.S., McKay, P., Murray, A.G., 2017. A historical review of the key bacterial

and viral pathogens of Scottish wild fish. J. Fish Dis. 40, 1741–1756.

https://doi.org/10.1111/jfd.12654

Wang, Y., Zeng, W., Wang, Q., Li, Y., Bergmann, S.M., Zheng, S., Ren, Y., Liu, C.,

33
 Chang, O., Lee, P., 2018. Establishment and characterization of a new cell line

from koi brain (Cyprinus carpio L.). J. Fish Dis. 41, 357–364.

https://doi.org/10.1111/jfd.12738

Wen, C.M., Cheng, Y.H., Huang, Y.F., Wang, C.S., 2008a. Isolation and

characterization of a neural progenitor cell line from tilapia brain. Comp. Biochem.

Physiol. - A Mol. Integr. Physiol. 149, 167–180.

https://doi.org/10.1016/j.cbpa.2007.11.005

Wen, C.M., Lee, C.W., Wang, C.S., Cheng, Y.H., Huang, H.Y., 2008b. Development of

two cell lines from Epinephelus coioides brain tissue for characterization of

betanodavirus and megalocytivirus infectivity and propagation. Aquaculture 278,

14–21. https://doi.org/10.1016/J.AQUACULTURE.2008.03.020

Wen, C.M., Wang, C.S., Chin, T.C., Cheng, S.T., Nan, F.H., 2010. Immunochemical

and molecular characterization of a novel cell line derived from the brain of

Trachinotus blochii (Teleostei, Perciformes): A fish cell line with oligodendrocyte

progenitor cell and tanycyte characteristics. Comp. Biochem. Physiol. Part A Mol.

Integr. Physiol. 156, 224–231. https://doi.org/10.1016/J.CBPA.2010.02.003

Wolf, K., 1988. Fish viruses and fish viral diseases. Cornell University Press, Ithaca,

New York.

Wolf, K., Quimby, M.C., 1976. Primary monolayer culture of fish cells initiated from

trypsinized tissues. Tissue Cult. Assoc. Man. 2, 453–456.

https://doi.org/10.1007/BF00918340

Wu, Y.C., Chi, S.C., 2006. Persistence of betanodavirus in Barramundi brain (BB) cell

line involves the induction of Interferon response. Fish Shellfish Immunol. 21,

34
 540–547. https://doi.org/10.1016/j.fsi.2006.03.002

Wu, Y.C., Tsai, P.Y., Chan, J.C., Chi, S.C., 2016. Endogenous grouper and barramundi

Mx proteins facilitated the clearance of betanodavirus RNA-dependent RNA

polymerase. Dev. Comp. Immunol. 59, 110–120.

https://doi.org/10.1016/j.dci.2016.01.012

Zhang, N.Z., Zhang, L.F., Jiang, Y.N., Zhang, T., Xia, C., 2009. Molecular analysis of

spring viraemia of carp virus in china: A fatal aquatic viral disease that might

spread in East Asian. PLoS One 4. https://doi.org/10.1371/journal.pone.0006337

Zheng, Y., Peng, L.M., You, F., Zou, Y.X., Zhang, P.J., Chen, S.L., 2015.

Establishment and characterization of a fish-cell line from the brain of Japanese

flounder Paralichthys olivaceus. J. Fish Biol. 87, 115–122.

https://doi.org/10.1111/jfb.12700

Zupanc, G.K.H., Clint, S.C., 2003. Potential role of radial glia in adult neurogenesis of

teleost fish. Glia 43, 77–86. https://doi.org/10.1002/glia.10236

35
Figure legends

Figure 1: FuB-1 are epithelioid-like cells expressing both glial and neuron

markers. A-B. Phase contrast microscopy of FuB-1 cells. C. Detection of the SnRV pol

gene expression in FuB-1 cells by conventional PCR. C+, positive control for SnRV;

NT, no template or negative control. D-G. Immunohistochemistry detection of MBP

(E), NeuN (F) and GFAP (G). Control samples without antibody (D). Bars = 100 µm.

Figure 2: Growth curve of FuB-1 cells. Cells were plated at 1-5×104 and cell viability

was determined by the MTT assay up to 8 days. Data were adjusted to a 4 parameters

equation and R2 value presented. Data, expressed as the mean ± SEM of triplicates, are

representative of two independent experiments.

Figure 3: FuB-1 cells are susceptible to SVCV and IPNV. A-F. Cell cultures at 60-

80% confluence were untreated (A) or infected with SVCV (B, E), IPNV (C, F) or

NNV (D) and daily observed under a phase contrast microscope. Representative images

of cultures at 3 or 7 days (d) of infection. G. Transcription of mx and hsp70 genes was

evaluated in FuB-1 cells after 8 h of infection with NNV, SVCV or IPNV. Samples

incubated with poly I:C (pIC) served as positive control. Gene expression was

normalized to the house-keeping gene expression (ef1a). Fold change respect to the

control is presented as mean ± SEM (n=3) and significant differences to control denoted

(Dunnett's test, * p<0.05).

Figure 4: Polystyrene nanoplastic particles are cytotoxic to FuB-1 cells and

produce oxidative stress. FuB-1 cells were exposed to ranging concentrations of 100

nm polystyrene nanoplastics (PS-100) for 24 h. A. Viability of FuB-1 determined by the

36
MTT assay. Fitted curve (4P) to the viability data is presented. B. Catalase activity. C.

Glutathione S-transferase (GST) activity. D. Non-protein thiols (NPT). In B-C, results

are expressed as mean ± standard error (n=3) and significant differences to control

denoted (Dunnett's test, * p<0.05; ** p<0.01; *** p<0.0001). PS, polystyrene.

Figure 5. Polystyrene nanoplastic particles decrease the cytotoxicity of

pharmaceuticals in FuB-1 cells. FuB-1 cells were exposed to ranging concentrations

of different pharmaceuticals alone or in combination with 10 mg/L of 100 nm

polystyrene nanoplastics (PS-100) for 24 h. A. Acetaminophen. B. Fluoxetine. C.

Furosemide. D. Gemfibrozil. E. Metformin. F. Nicotine. Fitted curves (4P) to the

viability data are presented. PS, polystyrene.

37
 Supplementary Figure S1. Size characterization of polystyrene (PS) particles by

dynamic light scattering (DLS) in the cell culture media used in combination with tested

pharmaceuticals at maximum concentration (PS-100, 10 mg/L; Pharmaceuticals, 1g/L)

and different time-points. A. Acetaminophen. B. Fluoxetine. C. Furosemide. D.

Gemfibrozil. E. Metformin. F. Nicotine.

Conflict of interests

Cytotoxicity data p-value

Pharmaceutical alone Pharmaceutical + PS-100 Pharmaceutical + PS-100

LD50 LD25 LD10 LD50 LD25 LD10 vs Pharmaceutical

Acetaminophen 0.324 0.084 0.031 0.505 0.107 0.043 0.0414

Gemfibrozil 0.300 0.150 0.082 0.380 0.165 0.072 0.0156

Fluoxetine 0.012 0.009 0.007 0.011 0.009 0.007 0.0368

Furosemide - 0.421 0.167 - - 0.405 0.1123

Metformin - 0.349 0.110 - 0.701 0.338 0.6759

The authors declare no conflict of interests.

Table 1. Lethal doses (LD50, LD25 and LD10) for FuB-1 cells exposed for 24 h to

pharmaceuticals (alone or combined with 10 mg/mL of 100 nm polystyrene particles).

LDs were calculated through interpolation of a nonlinear regression with a four-

parameter dose-response curve. Values missing indicate that LDs were out of the curve

range. Statistical differences of the viability curves between FuB-1 cells exposed to

pharmaceutical alone or with PS-100 nanoplastics was determined by paired t-test. PS-

100, polystyrene nanoplastic. LD, lethal dose.

38
Nicotine 0.852 0.207 0.065 - 0.387 0.148 0.1783

Highlights

FuB-1 cell line from the marine fish Fundulus heteroclitus has been generated.

FuB-1 cells are susceptible to SVCV and IPNV but refractory to NNV.

PS-100 and pharmaceuticals produce cytotoxicity in the cell line.

PS-100 produce oxidative stress and reduce the toxicity of the pollutants.

FuB-1 cell line is useful for fish virology, immunology and aquatic toxicology.

39