Kaohsiung Journal of Medical Sciences (2018) 34, 79e88

Available online at www.sciencedirect.com

ScienceDirect

journal homepage: http://www.kjms-online.com

Original Article

Application of six multiplex PCR’s among 200

clinical isolates of Pseudomonas aeruginosa for
the detection of 20 drug resistance encoding
genes
Nandagopal Murugan a,b, Jambulingam Malathi a,*, K Lily Therese a,
Hajib NarahariRao Madhavan a

a
Dept of Microbiology, L & T Microbiology Research Centre, Vision Research Foundation,
Sankara Nethralaya, Chennai, Tamil Nadu, India
b
School of Chemical & Biotechnology, SASTRA University, Thanjavur, Tamil Nadu, India

Received 8 May 2017; accepted 21 September 2017

Available online 6 November 2017

KEYWORDS Abstract Pseudomonas aeruginosa (P. aeruginosa) is a menacing opportunistic, nosocomial

Pseudomonas pathogen; become a growing concern as conventional antimicrobial therapy is now futile
aeruginosa; against it. Multi-drug resistant P. aeruginosa (MDRPA) has distinctive resistance mechanisms
Multidrug resistant such as production of b-lactamases, repression of porin genes and over-expression of efflux
P. aeruginosa; pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR) to
Extended spectrum detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim,
betalactamases blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ,
(ESBL); Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested
Metallo for the presence of the above mentioned genes genotypically through mPCR and characterized
betalactamases by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5%) nfxB
(MBL); regulator gene, 102 (51%) MexA, 96 (48%) MexC, 93 (46.5%) MexB, 86 (43%) MexD, 81 (40.5%)
Efflux pump OprM, 74 (37%) OprJ, 72 (36%) OprD and MexR, 53 (26.5%) Mex X and OprN, 49 (24.5%) MexY
production gene. Betalactamase genes 145 (72.5%) bla Tem , 67 (33.5%) bla OXA, 35 (17.5%) blaVim,
25(12.50%), 23 (11.50%) blaVeb, 21 (11.5%) blaGes, 14 (7%) Ctx-m and 10 (5%) AmpC and 5
(2.5%) blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19%) and 29 (14.5%)
out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical
specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture

Conflicts of interest: All authors declare no conflicts of interest.

* Corresponding author. Dept of Microbiology, L & T Microbiology Research Centre, Old no 18, College Road, Vision Research Foundation,
Sankara Nethralaya, Chennai 600 006, Tamil Nadu, India.
E-mail addresses: muruganbiotec@gmail.com (N. Murugan), drjm@snmail.org (J. Malathi).

https://doi.org/10.1016/j.kjms.2017.09.010
1607-551X/Copyright ª 2017, Kaohsiung Medical University. Published by Elsevier Taiwan LLC. This is an open access article under the
CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
80
negative Eubacterial PCR positive cases for an early molecular detection of drug resistance
mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.
Copyright ª 2017, Kaohsiung Medical University. Published by Elsevier Taiwan LLC. This is an
open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/
by-nc-nd/4.0/).
Introduction
Pseudomonas aeruginosa (P. aeruginosa) is the most com-
mon human bacterial pathogens and remains as one of
leading causative agent of nosocomial infections. Compe-
tence nature of P aeruginosa tailors the challenges of an-
tibiotics and brings out increased population of pan
resistant bacteria that threaten us into “post antibiotic
era” for diseases caused by pathogens [1]. Acquisition of
resistance gene on plasmids or alteration of chromosomal
gene expression and/or function through mutation serves
dominant strategies for developing drug resistance mech-
anisms. The steep failure rate occurring in the current
scenario even at the usage of either single or combination
of aminoglycosides and betalactams or fluoroquinolones
increases the length of hospitalization and overall cost of
patient care and in most cases results in high morbidity and
mortality rates [2].
Extended-Spectrum Beta Lactamases (ESBL) enzymes
encoded by the class A group of ESBLs prevalent among
P. aeruginosa are those encoded by TEM, SHV, CTX-M, PER,
VEB, GES, and IBC families. Class D, OXA-type ESBL enzymes
are also reported in P. aeruginosa [3]. Whereas, Metallo
betalactamases (MBL) common among P. aeruginosa iso-
lates reported from nearly all regions of the globe includes
(IMP, VIM, SPM, GIM and recently reported DIM families) [4].
Ten efflux systems have been characterized in P. aeru-
ginosa, the main efflux pumps belong to the Resistance-
Nodulation- Division (RND) super family among which
MexAB-OprM and MeXY-OprM are constitutively expressed
at a basal level in wild-type strains (expression of MexXY-
OprM being however much lower than that of MexAB-
OprM). Both systems are inducible when exposed to anti-
biotic substrates. The other systems MexCD-OprJ, MexEF-
OprN, MexJK, MexGHI-OpmD, MexVW, MexPQ-OpmE,
MexMN, and TriABC are not expressed in wild type strains
but may contribute to antibiotic or biocide resistance when
expressed in resistant strains. Resistance to aminoglycoside
were mainly mediated by efflux pump MexXY-OprM and
production of aminoglycoside modifying enzymes (AME) [5].
Identification of P aeruginosa targeting 16S rDNA, gyrB,
oprL and ETA gene was reported in many literatures [6e11].
Whereas, susceptibility pattern of P aeruginosa/any gram
negative bacteria which is culture negative and Eubacterial
PCR positive is not addressed as per our knowledge. Since
antibiogram susceptibility pattern/results is required for
treating the patients with appropriate therapeutic man-
agement of serious illness like endophthalmitis, Central
Nervous system and other infectious conditions occurs.
Delayed or inappropriate drug used for treatment of these
kind of infections leads to mortality or morbidity which
could be avoided by the administration of appropriate
N. Murugan et al.
antibiotic in a short time of diagnosis. Further, microbio-
logical results usually takes minimum of 48 h for the iden-
tification and susceptibility test performance as per CLSI
guidelines. From our experience, emergence of culture
negative intraocular specimens is steadily increasing, which
leads to unwanted avoidable blindness. Hence, the current
study designed to target most common betalactamase and
efflux pump genes among P aeruginosa reported in litera-
ture and our own study experiences [3e5,12e17]. In addi-
tion, the current study will assess the coexistence of ESBL,
MBL and efflux pump genes among P. aeruginosa isolates
obtained from variety of clinical specimens (ocular tissues,
blood, urine, pus and etc) using multiplex PCR and the same
were compared with Phenotypic methods [18]. Further,
Multiplex PCR assay has higher sensitivity which could
detect from the samples with lower bacterial load. The test
was evaluated using respective controls. The PCR data were
compared with conventional microscopy and culture
technique.
Materials and methods
A total of 200 P. aeruginosa was collected during 3 years (36
months) period from July 2012 to June 2015 specimens
received for microbial culture at L & T Microbiology
Research Centre, and SN (VRF) Referral Laboratory a unit of
Sankara Nethralaya, a tertiary eye care center at Chennai,
India. Clinical isolates were mainly from ocular specimens
such as corneal scraping, corneal button, conjunctival
swab, conjunctival scraping, vitreous humor, aqueous
chamber tap, contact lens, infective suture, Intraocular
lens (IOL), Iris tissue, lacrimal sac, eviscerated material,
canalicular pus, cassette of vitrectomy, scleral scraping,
Donor Cornel rim (DCR), Donor conjunctival swab and other
samples such as wound swab, blood, urine, rectal swab,
lung tissue fluid. Further identification and antibiotic sus-
ceptibility tests, phenotypic detection of ESBL, MBL and
efflux pump were carried out as per our previous reports
[15,16,19]. DNA extracted from pure culture were stored at

20  c for short storage and kept at
80  c for long storage.
Primer designing and gene targets against P
aeruginosa
We designed primers for the selected genes found to be
most prevalent among clinical studies as well as our own
observation from NGS based study and other reports
[12e21]. Multiplex PCR Primer designed against drug
resistance gene include Group-1; (ESBL-MBL) blaTem,
blaOXA, blaCTX-M-15, blaVim) Group-2, (blaGes, blaVeb
and DIM and AmpC) Efflux pump genes- Group-3
P. aeruginosa Drug resistance detection by mPCR 81

(MexA,B-oprM); Group-4 (MexC,D-oprJ); Group-5 (Mex X,Y- Lahey database (http://www.lahey.org/studies/) we

oprN) Group-6 (oprD, nfxB, MexR) primers were purchased
from Eurofins Genomics India Pvt Ltd, Bangalore, India.
Twenty pairs of primers were designed to amplify in-
ternal fragments with sizes from 264 to 971 bp (Table 1).
While designing primers, multiple parameters were
considered for the essential to have an easy interpretation
(avoiding similar-in-size amplicons for one given PCR tube/
group of genes) for drug resistant genes commonly involved
in multi drug resistant strains [22]. Though multiple variants
were prevalent in all kinds of drug resistant genes; for
example Tem1-Tem210 variants has been observed as per
designed primers in such a way to detect all the variants
by downloading all the sequences available for variants
from lahey.org/esbl database and processed for multiple
sequence alignment using Multalin tool. The conserved
sequence/commonality region were used as template for
designing primers for detection of drug resistant genes,
further additional care was taken to avoid primer dimer
formation while multiplex PCR containing 3 to 4 set of
primers were present in a single tube. Special attention
was given for the annealing temperature to be optimal or
identical to the given set of multiplex PCR assays. In

Table 1 List of In-house designed Primers targeting Betalactamases and Efflux pump genes used for Multiplex PCR- Group A to
Group F.
Gene target Drug group Primer name Sequence 50 —————30 Annealing Amplicon
temp  C size
Multiplex group A Betalactamase TEM F TCAACATTTTCGTGTCGCCC 766
TEM R AACTACGATACGGGAGGGCT
OXA F AGATCCTTGACCCGCAGTTG 928
OXA R CGCCGTCCCATCGAAAAATC
56
CTXM F AGACTGGGTGTGGCATTGAT 676
CTXM R TTAGGTTGAGGCTGGGTGAAGT
Vim F TGTCCGTGATGGTGATGAGT 456
Vim R GTGCTTCCGGGTAGTGTTGT
Multiplex group B Betalactamase GES F TCACTCTGCATATGCGTCGG 692
GES R ACTTGACCGACAGAGGCAAC
VEB F CCCGATGCAAAGCGTTATGA 184
VEB R ACCCCAACATCATTAGTGGC
58
DIM F TAACGACGAGGTACCTGAGC 410
DIM R ACCACACCACTACGTTGTCT
AmpC F GATGAAGGCCAATGACATTCCG 576
AmpC R CATGTCGCCGACCTTGTAGTAA
Multiplex group C Efflux pump Mex A F CTACGAGGCCGACTACCAGA 772
Mex A R TGCAGGCCTTCGGTAATGAT
Mex B F CCGTGAATCCCGACCTGATG 255
59
Mex B R TGACATGATGGCTTCCGCAT
Opr M F TACCAGAAGAGTTTCGACCTGAC 812
Opr M R CATGTGTCAAAACAGTCACCTCC
Multiplex group D Efflux pump MEX C F GAAATGGTGTTGCCGGTGGAG 188
MEX C R GTCTGGGTGAAATCCGCATAGA
MEX D F AGGTGATCAACGACTTCACCAA 951
56
MEX D R CAGCCAGACGAAACAGATAGGT
Opr J F CACGCTGGATTGGAAGAGTTTC 845
Opr J R CATCGAACAGGCCGGACATT
Multiplex group E Efflux pump Mex X F CTATCGGCATCACCAGCGAG 1164
Mex X R CTTTGGGTTGACCACCTTGACC
Mex Y F ATCGTTACCCTTACCTCCTCCA 734
60
Mex Y R GACGTTCTCCACCACGATGAT
oprN F CTGAACCAGTTGGTCGAACAGT 236
oprN R AAGGCATTCGCCGATTCTTCCA
Multiplex group F Outer membrane Opr D F CTGCTCCGCAACTACTATTTCAAC 788
and regulators Opr D R CCGATATAATCAAACGGCTGATCG
nfxB F TGACCCTGATTTCCCATGACG 194
55
nfxB R GTAGACCAGGGTGATGAACAGT
Mex R_F CCGTGAATCCCGACCTGATG 239
Mex R_R TGACATGATGGCTTCCGCAT
82
silico analysis of for primer specificity was tested by BLAST
program against both universal data and the group of
primers used in the multiplex for the Primer specificity.
PCR reactions for drug resistant genes were performed
in a final volume of 50 mL containing the following reaction
mixtures PCR Buffer (10x) 5 mL, MgCl2 (25 mM) 2 mL, dNTPs
(10 mM) 2 mL, each forward and reverse primers (5 pmol/
mL) 2 mL, Taq DNA polymerase (3 U/mL) 0.3 mL, template
DNA (1e10 ng/mL) 10 mL, and distilled water 26.7 mL (PCR
reagents purchased from GeNet Bio, Korea). The thermo-
cycler (Applied Biosystems, Verti) program for respective
genes consisted of 5 min initial denaturation at 94  C, 35
cycles of denaturation at 94  C for 30 s, annealing tem-
perature standardized according to the respective multi-
plex PCR group shown in Table 1 for 30 s, extension at 72  C
for 1.5 min, and final extension at 72  C for 7 min. The PCR
products were confirmed by gel electrophoresis in 2% (w/v)
agarose gel (SRL, Mumbai) in TBE buffer and visualized with
ethidium bromide staining and photographed with UV
waves through Bio-Rad Gel Documentation System.
PCR conditions were optimized for each assays and the
expected amplicons sizes were obtained from respective
control strains used separately or mixed for their group
specificity confirmation. Specificity against target genes
was analyzed with DNA template from human and other non
resistant bacteria and fungus and the results was found to
highly specific under optimal conditions. Initially simplex
PCR was applied on clinical isolates for all the targeted
genes and the resultant positive amplicons were recon-
firmed by PCR based DNA sequencing and the same were
used as positive control for the respective gene targets.
RNA extraction and cDNA synthesis
Real Time assay was performed to verify whether PCR
positive for efflux genes were expressed in all the studied
strains or not. P. aeruginosa cells grown in LB were har-
vested at 12 h of growth by centrifugation. The cells were
immediately used for RNA extraction using Total RNA
Extraction by TRIZOL method as suggested by the manu-
facture’s instruction. The removal of genomic DNA re-
siduals was carried out by genomic DNA elimination
reaction (Qiagen). Synthesis of cDNA was performed by
reverse transcription using QIAGEN OneStep RT-PCR Kit
(Germany). cDNA from each bacterial strain was individu-
ally used as DNA template in RT-PCR, as well as cDNA from
all reference strains as controls. All the RT-PCR reactions
were carried out in a 25 ml volume containing 5 ml cDNA
(100e200 ng/ml). The primers for RT-PCR and the protocol
was followed as per Dumas et al. [23]. In brief, all gene
expressions were compared with rPsL gene expression as
the housekeeping gene. The assay was performed in trip-
licates for each sample and the mean of three obtained
quantities was considered as quantity values for all gene
expression from standard strain examined by Bio-Rad Real-
time PCR. The P. aeruginosa VRFPA07 wild Type strain was
used as control strain. To check for residual contaminating
genomic DNA, control reactions without reverse transcrip-
tase were analyzed in the same way using the rpsL-F/R
primers. The amount of signal in the controls was usually
close to the nontemplate control (NTC). An effect on gene
N. Murugan et al.
expression was considered significant when the corre-
sponding ratios were >2.5 [24].
Ration of Gene expression Z (E target gene):ct target gene
(VRFPA07
test strain)
/(E rpsL gene):ct rpsL gene (VRFPA07
test strain)
Results
The present investigation was carried out to determine the
antimicrobial susceptibility pattern by phenotypic method
and standardization, application of multiplex PCR targeting
ESBL, MBL and Efflux pump mediated drug resistant genes
among P. aeruginosa isolated from variety of clinical
specimens predominantly from ocular isolates. P. aerugi-
nosa were identified and confirmed based on standard
methods [15,16] and subjected to multiplex PCRs.
Totally 200 clinical isolates of P aeruginosa belonging to
31 varied clinical specimens received from two different
labs were studied. Majority of the isolates were from ocular
isolates consisting of 46 (23%) corneal scraping and 33
(16.5%) conjunctival swab followed by 15 (7.5%) Vitreous
aspirate, 14 (7%) Corneal button, 14 (7%) Eviscerated ma-
terial followed by 13 (6.5%) blood, 9 (4.5%) Donor corneal
rim, 9 (4.5%) urine, 8 (4%) Contact lens and Aqueous
chamber tap, each 2 (1%) isolates from bandage contact
lens, infective suture, intraocular lens, iris tissue, rectal
swab, scleral scraping and sputum respectively, followed by
each single isolates (0.5%) were identified from biopsy,
canalicular pus, cassette fluid, cassette of vitrectomy,
conjunctival scraping, donor conjunctival swab, corneal
pus, eye ball, infective buckle, lacrimal sac, lung tissue
fluid, nasal cavity and tracheal aspirate.
Out of 200 P aeruginosa tested, drug susceptibility
rate was higher for beta lactam group of drugs namely
192 (96%) Aztreonam, 189 (94.5%) Cefepime, 188
(94%) Imipenem with EDTA, 186 (93%) Ceftazidime clav-
ulanate combinations, 167 (83.5%) Amikacin, 164 (82%)
Cefotaxime/Clavulanate, 163 (81.5%) meropenem with
EDTA, 159 (79.5%) Imipenem, 158 (79%) for cephalexin,
cefuroxime, ceftriaxone, cefoperazone, cefpodoxime,
azithromycin, chloramphenicol, 155 (77.5%) Ampicillin þ
sulbactam, 154 (77%) amoxycillin þ clavulanic acid, 153
(76.5%) Piperacillin þ tazobactam, meropenem, 150 (75%)
Norfloxacin, 149 (74.5%) Ciprofloxacin, 148 (74%) of Cefta-
zidime, cefdinir, Ceftazidime, 143 (71.5%) of Cefotaxime,
Moxifloxacin, Gatifloxacin, 141 (70.5%) Ofloxacin, 140 (70%)
Cefazolin, 139 (69.5%) Tobramycin, 131 (65.5%) piperacillin,
127 (63.5%) ampicillin (10mcg). The least susceptibility was
observed for 124 (62%) for amoxicillin and Gentamycin. The
complete susceptibility pattern is shown in Fig. 1.
Results for ESBL & MBL test
In ESBL confirmatory-cephalosporin/clavulanate combina-
tion disc test, totally 38 (19%) out of 200 isolates displayed
positive results against ceftazidime with clavulanic acid
compared to ceftazidime alone and 21 (10.5%) against
cefotaxime with clavulanic acid compared to cefotaxime
alone. Among, MBL screening test using carbapenem-EDTA
combination test 29 (14.5%) out of 200 tested positive
against Imipenem with EDTA compared to Imipenem alone
P. aeruginosa Drug resistance detection by mPCR
Figure 1. Shows complete susceptibility pattern of P. aeruginosa isolated from various clinical specimens.
whereas only 10 (5%) against meropenem with EDTA as
compared to meropenem alone showed positive result
(Fig. 2).
Multiplex PCR results
Multiplex PCRs carried out among 200 clinical strains
included in the study revealed efflux pump genes
(confirmed by gene expression by Real Time PCR) being
predominantly present among the strains mainly 163
(81.5%) nfxB regulator gene, 102 (51%) MexA, 96 (48%)
MexC, 93 (46.5%) MexB, 86 (43%) MexD, 81 (40.5%) OprM, 74
(37%) OprJ, 72 (36%) OprD, 67 (33.5%) MexR, 53 (26.5%)
MexX, OprN, 49 (24.5%) MexY gene. Whereas, betalacta-
mases 145 (72.5%) blaTem gene, 67 (33.5%) blaOXA, 35 (17.5%)
blaVim, 23 (11.50%) blaVeb, 21 (11.5%) blaGes, 14 (7%) Ctx-
m and 10 (5%) AmpC and 5 (2.5%) blaDim-1gene (Figs. 3e5).
All the efflux pump PCR positives isolates were shown to be
expressed and the corresponding ratios were >2.5 (Fig. 2).
All the efflux pump genes were expressed as it showed
positive for RNA PCR (see Fig. 6).
The current study estimated the prevalence of blaTem
gene among 145 (72.5%) out of 200 isolates studied, indi-
cating that blaTem gene emerged as a part of chromosomal
genome. Hence, the presence of Tem gene does not
Figure 2. Multiplex PCR showing Drug resistance encoding gene wise results.
83
warrant the resistant nature of P aeruginosa unless until
the variant of Tem with broad range of resistance corre-
lated by many studies suggesting the presence of 100% Tem
gene studied isolate [20] and here phenotypically all the
Tem positive isolates were resistance to neither ampicillin
73 (36.5%), amoxycillin 76 (38%), piperacillin 69 (34.5%)
which correlates the genotypic results.
Discussion
Advancement of PCR has revolutionized the field of infec-
tious disease diagnosis. To overcome the inherent disad-
vantage of cost and to improve the diagnostic capacity of
the test, multiplex PCR, a variant of the PCR test in which
more than one target sequence is amplified using more than
one pair of primers been developed and applied in this
study [24]. Results obtained in this multiplex PCR assays can
be used to detect clinically relevant antibiotic resistance
genes frequently encountered in P aeruginosa. These as-
says were optimized and applied on to P aeruginosa strains
recovered from various clinical specimens.
Overall, we found 100% correlation between phenotypic
and genotypic methods drug resistance detection. Appli-
cation of this method may warrants the conductance of a
more rational and appropriate therapy with a rapidity of
84 N. Murugan et al.

Figure 3. Results of multiplex PCR for amplification of ESBL, MBL and efflux pump genes. Figures showing Ethidium bromide
stained agarose gel electrophoretogram of multiplex PCR amplificons; M;- Ladder: 100 bp (GeneDirex 100 bp H3 RTU); NC- Negative
control (no template DNA) Fig. 3A; blaOXA(920 bp); blaTem(800 bp); ctx-m (700 bp) gene and blaVim (480 bp) from various clinical
isolates. Lanes 1,2,3 and 4: Clinical strains that have expressed Tem, Oxa, CTX-M and Vim gene respectively Lane5: Tem and Oxa
positive; Lane6:Tem and CTX-M positive; Lane7:Tem and Vim positive; Lane8:Tem, CTX-M and Vim positive; Lane9: Tem, Oxa, CTX-
M positive; Lane10: Tem, Oxa and Vim positive Lane PC: Mixed DNA positive isolate M1179(Tem, Oxa, Ctx-m)and M2444 (Vim).
Fig. 3B; blaGes(692 bp); AmpC(576 bp); blaDim (410 bp) gene and blaVeb (180 bp) from various clinical isolates. Lanes 1 and 3:
Clinical strains that have expressed Dim and Veb gene respectively Lane2: Ges and AmpC positive; Lane4:Dim and Veb positive;
Lane5:Ges, AmpC and Veb positive; Lane PC: Mixed DNA positive isolate M1243(Ges, AmpC)and M1426 (Dim and Veb). Fig. 3C; oprM
(812 bp); MexA (772 bp); MexB (255 bp) gene from various clinical isolates. Lanes 1 and 2: Clinical strains that have expressed MexA
and MexB gene respectively Lane3: MexA and MexB positive; Lane4-5:MexA, MexB and oprM positive; Lane 6e9: negative for all
MexA-B oprM genes; Lane PC: Clinical isolate M2227R showed positive for MexA-B oprM genes. Fig. 3D; MexX (1164 bp);
MexY(734 bp); oprN (236 bp) gene from various clinical isolates. Lanes 1 and 2: Clinical strains that have expressed MexX and MexY
gene respectively Lane3: MexX and MexY positive; Lane4-5:MexX, MexY and oprN positive; Lane 6e10: negative for all MexX-Y oprN
genes; Lane PC: Clinical isolate M2227R showed positive for MexX-Y oprN genes. Fig. 3E: MexD (951 bp); oprJ(845 bp); MexC
(188 bp) gene from various clinical isolates. Lanes 1e6: Clinical strains that have expressed MexC-D oprJ gene respectively Lane
7e11: negative for all MexC-D oprJ genes; Lane PC: Clinical isolate MS5278 showed positive for MexC-D oprJ genes. Fig. 3F; oprD
(788 bp); MexR(239 bp); nfxB (194 bp) gene from various clinical isolates. Lanes 1: nfxB positive; Lane2: nfxB and MexR positive;
Lane3: nfxB and oprD positive; Lane PC: Mixed DNA positive isolate M 1178 (Mex R and oprJ) and M2363 (nfxB) gene.

time especially where culture remains negative. In order to
determine the susceptibility pattern more accurately and
quickly, the current prospective study was carried out to
optimize and apply Multiplex PCR. Betalactam resistance in
P aeruginosa among clinical isolates were predominantly
mediated by ESBL and MBL enzymes frequently encoded by
Tem, Oxa, Ctx-m, Ges, Veb, Vim and Dim genes.
Moreover all the P aeruginosa predominantly carries
Tem gene as it’s a narrow spectrum beta lactamases
parentally derived from single nucleotide mutations from
TEM-1 and TEM-2 leads to Tem-3 and other variants which
conferring resistance to penicillin group of drugs. Variants
of Tem-3 to Tem-210 were reported till now which has wide
range of resistance activity against specific betalactam
P. aeruginosa Drug resistance detection by mPCR 85

Figure 4. A-F. Analytical Sensitivity Results of multiplex PCR for amplification of ESBL, MBL and efflux pump genes. Figures
showing Ethidium bromide stained agarose gel electrophoretogram of multiplex PCR amplicons; M;- Ladder: 100 bp (GeneDirex
100 bp H3 RTU); NC- Negative control (no template DNA). The least 10-fold dilution of DNA of respective positive controls
(mentioned in test results) strains were amplified with primer sets of respective mPCR were obtained.; Lane 1: Neat DNA of
standard Positive control (with out dilution); Lane 2e11:10 fold dilutions of consecutive method (i.e., 1x, 10x, 100x, 1,000x,
10,000x and etc.).

drugs, but still they were susceptible for betalactamase
inhibitors like clavulanate and sulbactam [24].
Further ureido- and carboxypenicillins and some
extended-spectrum cephalosporins (ESCs) is often associ-
ated with the overproduction of a naturally produced
cephalosporinase class D ESBLs, OXA gene belongs to OXA-2
or OXA-10 derivatives. Unlike class A ESBLs, most OXA-type
ESBLs are weakly inhibited by clavulanic acid and cannot be
identified at routine microbiology laboratories due to lack
of standard phenotypic detection methods [25]. We found
67 (33.5%) out of 200 isolates were found to harboring these
oxa gene which may include pathogenic variant of oxa-48 to
parental non-pathogenic oxa-1 or oxa-2 type among the
clinical isolates studied. Inspite, of Tem and Oxa occur-
rence was not considered as highly pathogenic gene
comparably to ctx-m, blaVim and blaDim genes.
Since, Ceftazidime and Cefoperazone were considered
as drug of choice as it proved to be a better anti-
pseudomonal drugs, used routinely, found to be resistant 52
(26%) and 42 (21%) respectively among 200 isolates studied.
Genotypically they were correlated with 23 (11.50%) blaVeb
and, 21 (11.5%) blaGes and 14 (7%) CTX-M mediated resis-
tance against cephalosporin drugs.
Prevalence of blaVim gene and blaDim gene was 35 (17.5%)
and 5 (2.5%) respectively, wherein 100% correlation was
observed with MBL positive strains of 29 (14.5%) confirmed
by carbapenem-EDTA combination disk method. MBL pro-
ducing bacteria are associated with a higher morbidity and
mortality among the patients. It is not only true that the
MBL producers will hydrolyze all classes of betalactams but
also that we are still lack of research for development of a
safe therapeutic antibiotic against these MDR and Pandrug
resistant strains.
Hence, their continued spread would be a clinical
disaster posing a serious concern for infection control
management. Prevalence of MBL producers in Pseudomonas
to be around 14.5%, which was in accordance to similar
studies by, Variaya et al. (20.8%) [26] and Navneeth et al.
(12%) [27].
Antipseudomonal beta lactam antibiotics (piperacillin,
cefepime and meropenem) are among mexCD-OprJ’s sub-
strates isolates carrying 96 (48%)MexC, 86 (43%) MexD, 74
(37%) OprJ gene were more resistant to cefepime and
piperacillin/tazobactam. Betalactam antibiotics (piper-
acillin, ceftazidime, cefepime, aztreonam and mer-
openem) are substrates of mexAB-OprM. 102 (51%)MexA, 93
86 N. Murugan et al.

Figure 5. A-F. Analytical Specificity Results of multiplex PCR for amplification of ESBL, MBL and efflux pump genes. Figures
showing Ethidium bromide stained agarose gel electrophoretogram of multiplex PCR amplicons; M;- Ladder: 100 bp (GeneDirex
100 bp H3 RTU); NC- Negative control (no template DNA). The amplification of ESBL, MBL, Efflux primer sets with the DNA of 1. ATCC
bacterial Staphylococcus. aureus (ATCC 25923); 2.Staphylococcus. epidermidis (ATCC 49461); 3. Streptococcus. pyogenes (ATCC
12384); 4.Streptococcus. pneumoniae (ATCC 49619); 5. E. coli (ATCC 25922), 6.Acinetobacter. lwoffii (ATCC 15309)7. H. influenzae
(ATCC 49247)8. Pseudomonas aeruginosa (clinical isolate R291) 9. Candida. albicans (ATCC 90028) and 10. Human DNA tested
against all the target genes and showed no amplification other than positive control of their respective target genes and thus
confirmed specificity of the mPCR.

(46.5%) MexB, 81 (40.5%) OprM significant relation was
determined between mexAB-OprM gene and ceftazidime,
cefepime and piperacillin/tazobactam resistance.
MexR occurrence in 67 (33.5%) clinical isolates may
negatively regulates mexAB-oprM efflux system but in this
study there is no significant relation between resistance
against ceftazidime, cefepime and meropenem. Except
carbapenem such as imipenem and meropenem other drugs
like Piperacillin, cefepime, ceftazidime were encountered
as a substrates of mexXY-OprM efflux system consist of 53
(26.5%) MexX; 49 (24.5%) MexY gene; 81 (40.5%) OprM gene.
The most concerning development in recent years has
been the emergence of carbapenemase among MDR
P. aeruginosa. The outer membrane protein OprD allows
entry of carbapenems, and its reduced expression is
frequently noted in carbapenem-resistant isolates. In this
study, 72 (36%) OprD positives correlated with the suscep-
tibility of carbapenems and cephalosporins. Outer mem-
brane proteins; oprJ and oprN are related to multidrug
resistance. 74 (37%) OprJ, 53 (26.5%), OprN had a significant
relation between the antibiotics cefepime, imipenem and
meropenem. Though this study was applied and standard-
ized with P aeruginosa, this mPCRs assays could be applied
on all gram negative bacteria carrying any of the above
included betalactamase and efflux pump genes.
Our major aim of this work was to chart a group drugs
that could be used to treat the patients when there is
culture negative and Eubacterial positive with anyone/
more genes positive by this multiplex PCR. If a clinical
specimen positive for Tem gene and other efflux genes
MexAB-OprM, MexCD-oprJ, drugs such as Cefoperazone,
ceftazidime, Imipenem, Meropenem, Moxifloxacin, Gati-
floxacin can be used to treat. If blaCTX-M is positive and
negative for all other betalactamase genes, Cefotaxime
and other third generation cephalosporins should be avoi-
ded and quinolones, aminoglycosides, fourth and fifth
generation cephalosporins and carbapenems can be used to
treat according to the site of infection. If blaVim/Dim with
blaTem and CTX-M gene is positive then the patient should be
treated with aztreonam, colistin or polymyxin group of
drugs. If all or any of the efflux pump genes were positive,
then the dosage of antibiotic should be increased in
P. aeruginosa Drug resistance detection by mPCR
Figure 6. Relative expression of efflux pump regulators and efflux pump transporter genes at number of clinical isolates. Data
from three independent total mRNA extractions of Pseudomonas aeruginosa. A ratio of 1 corresponds to no alteration in expression
compared with control organism P. aeruginosa VRFPA07. Ratios above 2.5 are considered significant. 2.5 to 3.5 (weak production);
3.6 to 5.5 (moderate production); above 5.6 (over expression). Values were corrected for standard deviation range.
addition with pump inhibitors should be administered ac-
cording to the patient condition.
The emergence of antibiotic resistant bacteria prolongs
the patients stay at hospital, thus leading to an increased
economic burden on them. In the present study, the anti-
biogram pattern of the 200 isolates of P. aeruginosa showed
resistance against 76 (38%) Gentamycin and amoxycillin, 73
(36.5%) ampicillin, 69 (34.5%) piperacillin, 61 (30.5%) Tobra-
mycin, 60 (30%) cefazolin, 59 (29.5%) ofloxacin, 57 (28.5%)
resistance rate. Our findings were similar to the observations
by Ibukun group who reported a higher susceptibility [28].
Ocular studies by MJ Bharathi group on two different study
results were concordant with our findings [29,30].
But, our findings were differed from those of Diwivedi
and Arya group who reported a higher resistant rate among
P aeruginosa obtained from post operative wound in-
fections [31,32] Findings by Haleem and Ferguson was not
similar with our study which is due to the isolate of our
study included predominantly from ocular specimens,
whereas most of the other studies included from wide
group of specimens [33e35].
There are 2 (1%) isolates which is negative for all the
betalactamases tested except blaTem but it showed resis-
tant to third generation cephalosporins and carbapenem
drug, which is the disadvantage of this study, which in-
dicates that the presence of other genes like blaNDM, blaSHV,
blaIMP, blaKPC or other lower prevalent genes/novel beta-
lactamases which is not reported in higher level from local
studies as possible. This is the hindrance of this study which
could not screen all the betalactamase genes except the
target one, hence, this multiplex PCR could be used as a
preliminary diagnostic level and to characterize the drug
resistance mechanism among various clinical studies at the
molecular level approach.
87
We report the six multiplex PCRs able to detect preva-
lent type of beta lactamases and efflux pump genes
simultaneously among P aeruginosa. This multiplex PCR
method is fast, accurate, specific and low-cost reliable tool
for the screening of frequently encountered betalacta-
mases and efflux pump mechanisms which can’t be identi-
fied through phenotypic method as accurate as molecular
methods. Application of these assays will assist in moni-
toring their emergence and their spread, and it could be
used in epidemiological surveys. To conclude, our study
showed the high prevalence of Tem and Oxa type ESBLs and
Vim type MBL gene among the 200 clinical isolates of P
aeruginosa obtained from various clinical specimens.
Acknowledgments
We gratefully acknowledge the funding agency for this whole
genome project from Indian Council of Medical Research
(ICMR), for providing financial support (ICMR project ID:-
AMR/10/2011-ECD-I).
References
[1] Lister PD, Wolter DJ, Hanson ND. Antibacterial-resistant
Pseudomonas aeruginosa: clinical impact and complex regu-
lation of chromosomally encoded resistance mechanisms. Clin
Microbiol Rev 2009;22:582e610.
[2] Hirsch EB, Tam VH. Impact of multidrug-resistant Pseudo-
monas aeruginosa infection on patient outcomes. Expert Rev
Pharmacoecon Outcomes Res 2010;10:441e51.
[3] Rawat D, Nair D. Extended-spectrum ß-lactamases in gram
negative bacteria. J Glob Infect Dis 2010;2:263.
88
[4] Queenan AM, Bush K. Carbapenemases: the versatile b-lac-
tamases. Clin Microbiol Rev 2007;20:440e58.
[5] Avrain L, Mertens P, Van Bambeke F. RND efflux pumps in P.
aeruginosa: an underestimated resistance mechanism. Ant
Suscep 2013:26e8.
[6] Deschaght P, De Baets F, Vaneechoutte M. PCR and the detec-
tion of Pseudomonas aeruginosa in respiratory samples of CF
patients. A literature review. J Cyst Fibros 2011;10:293e7.
[7] Qin X, Emerson J, Stapp J, Stapp L. Use of real-time PCR with
multiple targets to identify Pseudomonas aeruginosa and
other non fermenting gram-negative bacilli from patients with
cystic fibrosis. J Clin Microbiol 2003;41:4312e7.
[8] Motoshima M, Yanagihara K, Fukushima K, Matsuda J. Rapid
and accurate detection of Pseudomonas aeruginosa by real-
time polymerase chain reaction with melting curve analysis
targeting gyrB gene. Diagn Microbiol Infec Dis 2007;58:53e8.
[9] De Vos DA, Lim A, Pirnay JP, Struelens M. Direct detection and
identification of Pseudomonas aeruginosa in clinical samples
such as skin biopsy specimens and expectorations by multiplex
PCR based on two outer membrane lipoprotein genes, oprI and
oprL. J Clin Microbiol 1997;35:1295e9.
[10] Da silva Filho LV, Levie JE, Bento CN, Ramos SR, Rozov T. PCR
identification of Pseudomonas aeruginosa and diclinical rect
detection in samples from cystic fibrosis patients. J Med
Microbiol 1999;48:357e61.
[11] Da Silva Filho LV, Tateno AF, Martins KM, Azzuz Chernishev AC.
The combination of PCR and serology increases the diagnosis
of Pseudomonas aeruginosa colonization/infection in cystic
fibrosis. Ped Pulmo 2007;42:938e44.
[12] Malathi J, Murugan N, Umashankar V, Bagyalakshmi R. Draft
genome sequence of multidrug-resistant Pseudomonas aeru-
ginosa strain VRFPA02, isolated from a septicemic patient in
India. Genome Announc 2013;1. e00425e13.
[13] Murugan N, Malathi J, Umashankar V, Madhavan HN.
Comparative genomic analysis of multidrug-resistant Pseudo-
monas aeruginosa clinical isolates VRFPA06 and VRFPA08 with
VRFPA07. Genome Announc 2014;2. e00140e14.
[14] Murugan N, Malathi J, Umashankar V, Madhavan HN. Draft genome
sequence of blaVeb-1, blaoxa-10producing multi-drug resistant
(MDR) Pseudomonas aeruginosa strain VRFPA09 recovered from
bloodstream infection. Braz J Microbiol 2015;46:639e40.
[15] Murugan NA, Malathi J, Therese KL, Madhavan HN. Antimi-
crobial susceptibility and prevalence of extended spectrum
betalactamase (ESBL) and Metallo betalactamase (MBL) and
its co-existence among Pseudomonas aeruginosa recovered
from ocular infections. Int J Pharm Pharm Sci 2015;7:147e51.
[16] Murugan N, Malathi J. Evaluation of a method for detection of
both metallo betalactamase (MBL) and efflux production using
carbonyl cyanide 3-chlorophenylhydrazone (CCCP)  combi-
nation method among Pseudomonas aeruginosa isolated from
clinical specimens. Int J Pharm Pharm Sci 2015;8:185e9.
[17] Murugan N, Malathi J, Umashankar V, Madhavan HN. First
complete genome sequence of ocular isolate carrying blaVim-
2 mediated multi-drug-resistant (MDR) Pseudomonas aerugi-
nosa VRFPA04 from India and two draft genome sequence of
ocular isolates Pseudomonas aeruginosa VRFPA03 and
VRFPA05. Int J Pharm Pharm Sci 2015;7:291e2.
[18] Murugan N, Malathi J, Umashankar V, Madhavan HN. Resis-
tome and pathogenomics of multidrug resistant (MDR) Pseu-
domonas aeruginosa VRFPA03, VRFPA05 recovered from
alkaline chemical keratitis and post-operative endoph-
thalmitis patient. Gene 2016;578:105e11.
[19] Sowmiya M, Malathi J, Madhavan HN. Screening of ocular
enterobacteriaceae isolates for presence of chromosomal
blaNDM-1 and ESBL genes: a 2-Year study at a tertiary eye care
N. Murugan et al.
center prevalence of ESBL among ocular enterobacteriaceae.
Invest Ophthalmol Vis Sci 2012;53:5251e7.
[20] Murugan N, Malathi J, Umashankar V, Madhavan HN. Unrav-
eling genomic and phenotypic nature of multidrug-resistant
(MDR) Pseudomonas aeruginosa VRFPA04 isolated from kera-
titis patient. Microbiol Res 2016;193:140e9.
[21] Bokaeian M, Zahedani SS, Bajgiran MS, Moghaddam AA. Fre-
quency of PER, VEB, SHV, TEM and CTX-M genes in resistant
strains of Pseudomonas aeruginosa producing extended
spectrum b-Lactamases. Jundishapur J Microbiol 2015;8.
[22] Peshattiwar PD, Peerapur BV. ESBL and MBL mediated resis-
tance in Pseudomonas aeruginosa: an emerging threat to
clinical therapeutics. J Clin Diagn Res 2011 Dec;5:1552e4.
[23] Dallenne C, Da Costa A, Decré D, Favier C. Development of a
set of multiplex PCR assays for the detection of genes
encoding important b-lactamases in Enterobacteriaceae. J
Antimicrob Chemother 2010;12. dkp.498.
[24] Dumas JL, van Delden C, Perron K, Köhler T. Analysis of
antibiotic resistance gene expression in Pseudomonas aeru-
ginosa by quantitative real-time-PCR. FEMS Microbiol Lett
2006;254:217e25.
[25] Elnifro EM, Ashshi AM, Cooper RJ, Klapper PE, Multiplex PCR.
Optimization and application in diagnostic virology. Clin
Microbiol Rev 2000;13:559e70.
[26] Yan JJ, Tsai SH, Chuang CL, Wu JJ. OXA-type beta-lactamases
among extended-spectrum cephalosporin-resistant Pseudo-
monas aeruginosa isolates in a university hospital in southern
Taiwan. J Microbiol Immunol Infect 2006;39:130e4.
[27] Varaiya A, Kulkarni N, Kulkarni M, Bhalekar P. Incidence of
metallo beta lactamase producing Pseudomonas aeruginosa in
ICU patients. Indian J Med Res 2008;27:398.
[28] Navaneeth BV, Sridaran D, Sahay D, Belwadi MR. A preliminary
study on metallo-[beta]-lactamase producing Pseudomonas aer-
uginosa in hospitalized patients. Indian J Med Res 2002;116:264.
[29] Ibukun A, Tochukwu N, Tolu O. Occurrence of ESBL and MBL in
clinical isolates of Pseudomonas aeruginosa from Lagos,
Nigeria. J Am Sci 2007;3:81e5.
[30] Bharathi MJ, Ramakrishnan R, Vasu S. Aetiological diagnosis of
microbial keratitis in South India-A study of 1618 cases. Indian
J Med Microbiol 2002;20:19.
[31] Jayahar Bharathi M, Ramakrishnan R, Ramesh S, Murugan N.
Extended-spectrum beta-lactamase-mediated resistance
among bacterial isolates recovered from ocular infections.
Ophthalmic Res 2011;47:52e6.
[32] Dwivedi M, Mishra A, Singh RK, Azim A. Nosocomial cross-
transmission of Pseudomonas aeruginosa between patients
in a tertiary intensive care unit. Indian J Pathol Microbiol
2009;52:509.
[33] Arya M, Arya PK, Biswas D, Prasad R. Antimicrobial suscepti-
bility pattern of bacterial isolates from post-operative wound
infections. Indian J Pathol Microbiol 2005;48:266e9.
[34] Ferguson D, Cahill OJ, Quilty B. Phenotypic, molecular and
antibiotic resistance profiling of nosocomial Pseudomonas
aeruginosa strains isolated from two Irish Hospitals. J Med Biol
Sci 2007;1:1e5.
[35] Haleem H, Tarrad J, Banyan I. Isolation of Pseudomonas aer-
uginosa from clinical cases and environmental samples, and
analysis of its antibiotic resistant spectrum at hilla teaching
hospital. Med J Babylon 2011;8:34e41.
Appendix A. Supplementary data
Supplementary data related to this article can be found at
https://doi.org/10.1016/j.kjms.2017.09.010.