Cytokine 127 (2020) 154990

Contents lists available at ScienceDirect

Cytokine
journal homepage: www.elsevier.com/locate/cytokine

Ocular toxoplasmosis associated with up-regulation of miR-155-5p/miR- T

29c-3p and down-regulation of miR-21-5p/miR-125b-5p
⁎
Cristina Silva Meira-Strejevitcha, , Ingrid de Siqueira Pereiraa,
Daise Damaris Carnietto Hippólitoa, Marta Marques Maiaa, Allecineia Bispo Cruza, Ricardo Gavaa,
Cinara Cássia Brandão de Mattosb, Fábio Batista Fredericoc, Rubens Camargo Siqueirac,
Luiz Carlos Mattosb, Vera Lucia Pereira-Chioccolaa
a
Centro de Parasitologia e Micologia, Instituto Adolfo Lutz, Sao Paulo, Brazil
b
Laboratório de Imunogenética, Faculdade de Medicina de São José do Rio Preto, São José do Rio Preto, Brazil
c
Ambulatório de Oftalmologia, Fundação Faculdade Regional de Medicina-Hospital de Base, São José do Rio Preto, Brazil

A R T I C LE I N FO A B S T R A C T

Keywords: Ocular toxoplasmosis (OT) is one of the most common manifestations of Toxoplasma gondii infection and can be
Ocular toxoplasmosis related with congenital or acquired infections. OT cause posterior uveitis that cause serious sequelae as complete
miRNA loss of vision. microRNAs (miRNAs) are small non-coding RNAs, which have regulatory roles in cells by silencing
Gene expression messenger RNA. This study evaluated gene expression of miR-155-5p, miR-146a-5p, miR-21-5p, miR-29c-3p and
Cytokine regulation
miR-125b-5p in plasma of 51 patients with ocular toxoplasmosis (OT Group), 26 individuals with asymptomatic
toxoplasmosis (AT Group), and 25 healthy individuals seronegative for toxoplasmosis (NC Group). Peripherical
blood samples were collected in tube with EDTA for plasma isolation, laboratorial diagnosis for toxoplasmosis
and RNA extraction. miRNA expression of each sample was performed by qPCR and values were expressed in
Relative Quantification (RQ). Results showed that miR-155-5p and miR-29c-3p were up-expressed in OT patients
than AT individuals. On the other hand, miR-21-5p and miR-125b-5p were down-expressed in OT patients.
Differences were statistically significant. miR-146a-5p expression was similar in OT patients and AT individuals,
without significant difference. In addition, comparative analysis for miRNA levels between AT and OT groups
confirms these results. So far, this is the first study to evaluate circulating miRNA levels in ocular toxoplasmosis.
These findings may contribute to further studies evaluating the exact role of these miRNAs in the course of
infection, which may help in understanding the complex parasite-host interaction and future use in diagnosis,
prognosis and therapeutic control in ocular toxoplasmosis.

1. Introduction
Toxoplasmosis, caused by Toxoplasma gondii is one of the most
common infections in humans and animals, with worldwide distribu-
tion [1]. Although the disease is generally asymptomatic individuals, in
immunocompromised patients have serious complications as ocular
toxoplasmosis (OT) [2–5]. OT may be of congenital origin, postnatal
acquired infection, or reactivated in immunocompromised individuals
[6]. Toxoplasmosis causes chorioretinitis with various episodes of in-
flammation and these symptoms can occur years after acute infection.
T. gondii infects the retina, nevertheless, can infect the choroid, vitreous
and anterior chamber of the eye [7,8]. Thus, OT is considered as ne-
crotizing retinopathy triggered by activation of latent cyst stage located
within the retina and the optic nerve [9]. OT is a common disease in the
north-western region of São Paulo state (Brazil). Around 30% of pa-
tients attended in an ophthalmology outpatient clinic had clinical
characteristics of ocular toxoplasmosis [10].
OT severity depend, also, the immune status of the host [11]. The
immune response to T. gondii includes innate and adaptive responses,
which involve cellular interactions between parasite, enterocytes,
monocytes, dendritic cells (DCs), macrophages, natural killer cells (NK),
and neutrophils. Primarily, the resistance to T. gondii is mediated by Th-

⁎
Corresponding author at: Centro de Parasitologia e Micologia, Instituto Adolfo Lutz, Av. Dr Arnaldo, 351, 8 andar, CEP 01246-902 São Paulo, SP, Brazil.
E-mail addresses: cristinadasilvameira@gmail.com (C.S. Meira-Strejevitch), siqueira_ingrid@hotmail.com (I.d.S. Pereira),
daise.carnietto@hotmail.com (D.D.C. Hippólito), m.marquesmaia.3@gmail.com (M.M. Maia), abc_alle@hotmail.com (A.B. Cruz), gava44@gmail.com (R. Gava),
mattosci@gmail.com (C.C. Brandão de Mattos), drfabiofrederico@gmail.com (F.B. Frederico), rubenssiqueira@terra.com.br (R.C. Siqueira),
luiz.carlos@famerp.br (L.C. Mattos), pchioccola@gmail.com (V.L. Pereira-Chioccola).

https://doi.org/10.1016/j.cyto.2020.154990
Received 28 August 2019; Received in revised form 30 October 2019; Accepted 7 January 2020
1043-4666/ © 2020 Published by Elsevier Ltd.
C.S. Meira-Strejevitch, et al. Cytokine 127 (2020) 154990

1 type cell-mediated immune response that depends upon the produc- Table 1
tion of interleukin-12 (IL-12) and interferon-γ (IFN-γ) [12,13]. Clinical and laboratory diagnoses of patient groups analyzed in this study.
MicroRNAs (miRNAs, miR, around 20–22 nucleotides) are small and Groups
non-coding RNAs, which post-transcriptionally regulate gene expres-
a
sion by binding to the 3′-untranslated region of target messenger RNA OT ATb NCc
(mRNAs) for degradation or translational inhibition [14]. Each miRNA (n = 51) (n = 26) (n = 25)

can target hundreds of mRNAs within a given cell type, and single Data of the sample 2016–2019 2016–2019 2016–2019
mRNA is often the target of multiple miRNAs [15]. miRNAs can exert collection (year)
functions in the cells that produce them. They also may be secreted and Median Age (range) 63 (15–76) 36 (22–60) 29 (24–36)
transferred to other cells, circulating in virtually all body fluids, either Gender 23M-28F 12M-14F 4M-21F
Clinical diagnosisd Active RtC Chronic Healthy
in protein complexes or enclosed inside extracellular vesicles, such as
(27%)e toxoplasmosis
microvesicles and exosomes [16]. Active and RtC (asymptomatic)
Over 100 different miRNAs are expressed by cells of the immune scar (14%)
system. They influence the molecular pathways controlling the devel- RtC scar (59%)
Positive PCR in blood 17% (9/51) Neg (26/26) Neg (25/25)
opment and function of innate and adaptative immune cells [17].
(for T. gondii
miRNAs regulate T-cell activation and differentiation; and act on sub- DNA)
sets of effector T cells (CD4+ Th1, Th2, Th17, Th22, Th9, and cytotoxic Anti-T. gondii IgG Pos (51/51) Pos (26/26) Neg (25/25)
CD8+), and regulatory T (Treg) cells. These T cells are defined by cy- (ELISA)
tokine profiles and master transcription factors that control their dif- a
ferentiation [18]. Consequently, miRNAs participate on cytokine ac- OT (ocular toxoplasmosis).
b
AT (asymptomatic toxoplasmosis).
tivity and production [19]. c
NC (negative controls).
IFN-γ is essential for regulation of host immune response against d
Diagnosis was defined by clinical, images and laboratory data as described
intracellular T. gondii infection and may control the consequences of in Materials and Methods section.
infection [20]. Previous studies have shown alterations in cytokine e
Active and retinochoroiditis (RtC) scars in the right and left eyes, respec-
concentrations in patients developing ocular toxoplasmosis [21–24]. tively.
Recently, our group showed differences in mRNA levels for expressing
IL-6, TGB-β and IL-10 [22] and IFN-γ, TNF-α cytokine concentrations groups. OT Group were composed of 51 plasma samples from patients
by ELISA from patients with OT [21]. In this context, multiple miRNAs with ocular toxoplasmosis. They were from Ophthalmology Outpatient
can modulate these mechanism [25]. Among the most studied miRNAs Clinics from Fundação Faculdade Regional de Medicina, Hospital de
in the context of immune response regulation, miR-155-5p has been Base, São José do Rio Preto, São Paulo, Brazil. These clinical samples
identified as the component of macrophage and monocyte response to were received at the Centro de Parasitologia e Micologia, Instituto
different types of inflammatory mediators, such as IFN-γ and TNF-α Adolfo Lutz, São Paulo, Brazil, between March 2016 to January 2019.
[26,27] while miR-146a was found to be highly expressed in Treg cells They were clinically diagnosed by fundoscopic examination as re-
and vital to maintain IFN-γ-mediated Th1 immune response [28]. miR- tinochoroiditis scars caused by T. gondii [10,34,35]. AT Group consisted
29-3p targets many genes related in Th1 differentiating pathway and in of 26 plasma samples from asymptomatic individuals, seropositive for
regulation of adaptive immune response through IFN-γ modulation toxoplasmosis. NC Group (negative controls) composed of 25 plasma
[25,29]. In addition, miR-125b-5p can target TNF-α mRNA, and down- samples from seronegative individuals for toxoplasmosis. For each pa-
expression leads increased inflammatory response [30]. In contrast, tient/individual was collected peripheral blood in a tube with EDTA
miR-21-5p is a key mediator for anti-inflammatory process and can (5 mL) for laboratory diagnosis. Blood cells were used for real-time PCR
interfere on levels of the anti-inflammatory cytokine IL-10 and in TNF-α (qPCR) and plasma, for ELISA and RNA extractions. Samples were sent
production [31]. to the laboratory within two days after collection, and processed. In OT
Interestingly, circulating miRNAs can be detected in biological patients, peripheral blood samples were collected before the T. gondii
fluids as serum, saliva and others, exhibiting a good potential as non- therapy. A summary of clinical and laboratory diagnoses is described in
invasive biomarkers [32]. Studies of miRNAs as biomarkers in tox- Table 1.
oplasmosis have provided promising candidates. However, so far, there
are no studies on circulating miRNA in humans with toxoplasmosis,
especially with ocular form. Furthermore, T. gondii could modify both 2.3. Laboratorial diagnosis
miRNAs and mRNAs from the host, causing alterations in gene levels
related to host immune system [33]. Taken together, this study was Plasma samples were performed by ELISA, for serological diagnosis,
aimed to analyze the miRNA levels of miR-155-5p, miR-146a-5p, miR- using a T. gondii lysate antigen. ELISA methodology and TLA were done
21-5p, miR-29-3p and miR-125b-5p in patients with ocular tox- as described before [36,37]. Tachyzoites maintained in Vero cell cul-
oplasmosis and discuss their possible impact on the immune response of tures were purified by filtration. After washed and suspended in PBS,
these patients. parasites were lysed (by glass beads) by vortex (8 cycles/4 min with 2-
minute intervals). Tachyzoites extract was centrifuged (3000g) and
2. Materials and methods dissolved in NaCl (0.3 M). Protein concentration was determined by
spectrometry in a NanoDrop ND100 (Thermo Scientific, Waltham, MA,
2.1. Ethical considerations US), at 280 nm.
PCR were done as described before for blood samples [38]. DNA
The Ethics Committees of all involved Institutions approved the molecules were extracted from peripheral blood samples and tachy-
entire study, which was performed per recommendations of these zoites (positive control) by QIAamp DNA Mini Kit. DNA purifications
Committees (CAAE numbers: 40236414.5.0000.0059 and were performed in a Robotic workstation for automated purification of
32259714.8.0000.5415). DNA (QIAcube, Qiagen). qPCR was performed using the REP-529 mo-
lecular marker, which amplifies a highly repeatable 112 bp sequence in
2.2. Patients and clinical samples T. gondii genome. The sequences consist in the forward (5′-AGAGACA
CCGGAATGCGATCT-3′) and reverse (5′-TTCGTCCAAGCCTCCGACT-3′)
This prospective study analyzed 102 plasma samples classified in 3 primers; and the hybridization probe (5′-TCGTGGTGATGGCGGAGAG

2
C.S. Meira-Strejevitch, et al. Cytokine 127 (2020) 154990

AATTGA-3′) labeled with FAM and BHQ1. DNA samples were also as-
sayed using a housekeeping gene that amplified a 140 bp fragment of
the human β-globulin gene (5′-ACCACCAACTTCATCCACGTTCACC-3′
and 5′-CTTCTGACACAACTGTGTTCACTAGC-3′) to verify the absence
of PCR inhibitors. The protocols of PCR amplifications were performed
at the same conditions as described before [38].
2.4. RNA isolation and cDNA synthesis
To minimize the RNA degradation by RNases during the experi-
mental process, all materials and working surfaces were cleaned using
RNaseZap® RNase Decontamination Solution (Ambion™) prior to
handling the samples. The total RNA, including miRNA, was extracted
from plasma using the miRNeasy Serum/Plasma Kit (Qiagen, Hilden,
Germany). Plasma (200 µL) were mixed with denaturing buffer in the
volumes described in manufacturing protocol. The homogenate was
incubated at room temperature for 5 min. Then 25 fmol of synthetic
Caenorhabditis elegans miRNA (Cel-miR-39, Ambion) were spiked to
each sample as the external control [39]. Subsequently, the manu-
facture protocols were followed for RNA extraction. Total RNA, in-
cluding miRNAs were eluted into 30 µL of nuclease-free water.
Next, 2 μL of total RNA, including miRNAs were reverse-tran-
scripted (RT) using Taqman® Advanced miRNA cDNA synthesis kit
(Applied Biosystems). RT was performed in a Veriti® 96-Well Thermal
Cycler (Applied Biosystems) according to manufacture instructions, in
four steps and under the following thermal conditions: 45 min at 37 °C,
10 min at 65° for poly (A) tailing reaction, 60 min at 16 °C for ligation
reaction, 15 min at 42 °C, 5 min at 85° for reverse transcription reaction
and 5 min at 95 °C, followed by 14 cycles of 95 °C for 3 sec and 60 °C for
30 sec and a stop reaction at 99 °C for 10 min, for miR-Amp reaction.
All cDNA samples were stored at −70 °C until use in quantitative qPCR.
2.6. Data analysis
The values of miRNA expression were shown as “Relative
Quantification” (RQ) and calculated by the comparative CT method
(2−ΔΔCT) as described before [40]. The amplification plot was de-
termined based on the threshold cycle (CT) values for each sample. The
amplification plot reflects the fluorescent signal at each cycle. The
average of the CT value was calculated after the PCRs were run in tri-
plicate for each sample. The calibrators for calculations in miRNA ex-
pression experiments were constituted of 25 plasma samples from the
NC Group (negative controls). The expression values of this group by
the comparative CT method assume the value of 1.0. The miR-26b-5p
value was chosen as the endogenous control because of its uniform
expression throughout serum samples (data not shown).
Statistical analyses were done using Graph Pad Prism software
version 6.0 (San Diego, CA, USA). Comparation between groups was
done by Mann–Whitney test. Differences were considered statistically
significant when p ≤ 0.05.
3. Results
3.1. Characteristics, clinical and laboratorial diagnosis
Clinical and laboratory diagnoses are shown in Table 1. Patients of
OT group and individuals of AT group were seropositive for tox-
oplasmosis. Each group (OT, AT and NC) consisted of 51, 26 and 25
individuals, respectively. The gender ratio was 23 men and 28 women
(OT group), 12 men and 14 women (AT group) and 4 men and 21
women (NC group). Out of the 51 patients from OT group, the clinical
and fundoscopic examination determined that 14 patients had active
lesions, 7 had both, active lesions and scars; and 30, retinochoroiditis
scars. qPCR was positive in 17% of patients.

2.5. Quantitative qPCR 3.2. Expression of miR-155-5p and miR-29c-3p were higher in OT patients

qPCR amplification mixture contained 5 μL of 2X TaqMan Fast
Advanced Master Mix and 0.5 μL TaqMan® Advanced miRNA Assays
(both Applied Biosystems) for the following miRNAs: miR-155-5p, miR-
146a-5p, miR-21-5p, miR-29c-3p, miR-125b-5p, miR-26b-5p and cel-
miR-39. Description and Assay IDs of each miRNA are shown in Table 2.
Each template cDNA was diluted 1:10 in RNAse-free water and added
2.5 µL to the mixture. Finally, RNAse-free water (2 µL) were added to a
total volume of 10 µL. Reactions were performed in triplicate for each
sample and all assays. Samples were amplified and detected using a
StepOne™ Real-Time PCR System (Applied Biosystems) using the fol-
lowing thermal profile: 95 °C for 20 sec, followed by 40 cycles per-
formed at 95 °C for 1 sec and 60 °C for 20 sec. Samples without am-
plification in qPCR were repeated three times; and all samples had
positive amplification in cel-miR-39.
RQ results for miRNA levels are shown in Fig. 1. miR-155-5p and
miR-29c-3p were up-expressed in plasma samples of OT patients than
those of AT individuals. Mean RQ for miR-155-5p was 1.427 and for
miR-29c-3p was 3.005 in OT patients. Differently, plasma samples of AT
individuals had lower mean expression, 1.198 and 1.418 for miR-155-
5p and miR-29c-3p, respectively. Differences between OT and AT
groups were statistically significant at p = 0.0009 (miR-155-5p) and
p < 0.0001 (miR-29c-3p).
miR-21-5p and miR-125b-5p were down-expressed in plasma sam-
ples of OT patients (mean of 1.928 and 2.465, respectively), when
compared with those values of AT individuals (mean of 3.344 and
4.063, respectively). Variations between OT and AT groups were sta-
tistically significant at p = 0.0148 (miR-21-5p) and p = 0.0180 (miR-
125b-5p). Plasma samples of OT patients and AT individuals expressed

Table 2
Description of the genes analyzed in this study.
a
Assay Name Gene Family Assay IDb miRBase Location Chromosome Mature miRNASequence
Accession number

hsa-miR-155-5p MIPF0000157, mir-155 477927_mir [MIMAT0000646] 21 UUAAUGCUAAUCGUGAUAGGGGU

hsa-miR-146a-5p MIPF0000103, mir-146 478399_mir [MIMAT0000449] 5 UGAGAACUGAAUUCCAUGGGUU
hsa-miR-21-5p MIPF0000060, miR-21 477975_mir [MIMAT0000076] 17 UAGCUUAUCAGACUGAUGUUGA
hsa-miR-29c-3p MIPF0000009, miR-29 479229_mir [MIMAT0000681] 1 UAGCACCAUUUGAAAUCGGUUA
hsa-miR-125b-5p MIPF0000033, mir-10 477885_mir [MIMAT0000423] 11 UCCCUGAGACCCUAACUUGUGA
hsa-miR-26b-5p MIPF0000043, mir-26 478418_mir [MIMAT0000083] 2 UUCAAGUAAUUCAGGAUAGGUc
cel-miR-39-3p MIPF0000304, mir-39 478293_mir [MIMAT0000010] NDd UCACCGGGUGUAAAUCAGCUUG

a
hsa, Homo sapiens; cel, Caenorhabditis elegans.
b
Purchased from Applied Biosystems.
c
Control endogenous sequence.
d
Non-determinate.

3
C.S. Meira-Strejevitch, et al. Cytokine 127 (2020) 154990

Fig. 1. Expression levels of miR-155-5p, miR-29c-3p, miR-21-5p, miR-125b-5p and miR-146a-5p in plasma of ocular toxoplasmosis patients (OT), asymptomatic
toxoplasmosis individuals (AT) and negative controls (NC). Gene expression of each miRNA was determined by qPCR, after miRNA isolation and cDNA synthesis.
Relative quantification was determined by 2−ΔΔCT method and all miRNA expression values were normalized to the miR-26b-5p endogenous control. Lines in scatter
dot plots show mean ± SEM (standard error mean). Comparison of expression levels between groups was performed by Mann-Whitney test at *p < 0.05,
**p < 0.005, ***p < 0.0005, ****p < 0.00005.

similar levels of miR-146a-5p (2.837 and 2.332, respectively).
Plasma samples of NC group were used as calibrators in miRNA
expression experiments. Thus, the expression values of NC group, by the
comparative CT method were considerate as 1.0. Variations between
NC group and OT or AT groups were statistically significant for all
miRNAs analyzed in this study at p < 0.0001.
Comparative results for miRNA levels between AT and OT groups
are shown in Fig. 2. In this case, plasma samples from the AT group
were used as calibrator. miR-155-5p and miR-29c-3p were up-expressed
in plasma samples of OT patients than those of AT individuals. Mean RQ
for miR-155-5p and miR-29c-3p were 3.2 and 2.8, respectively. Dif-
ferences between OT and AT groups were statistically significant at
p = 0.0143 (miR-155-5p) and p < 0.0001 (miR-29c-3p). miR-21-5p
and miR-125b-5p were down-expressed in plasma samples of OT pa-
tients (mean of 0.67 and 0.85, respectively), when compared with AT
individuals (mean of 1.0). Differences were statistically significant at
p = 0.0150 (miR-21-5p) and p = 0.0160 (miR-125b-5p).
In addition, plasma samples of OT patients up-expressed levels of
miR-146a-5p than those AT individuals (2.4 and 1.0, respectively), but
without statistically significant differences.
4. Discussion
miRNAs suffer an intense regulation, normally in transcriptional
and processing levels. The transcription of some miRNAs found in im-
mune cells was correlated to inflammatory stimuli and pro-

4
C.S. Meira-Strejevitch, et al.
Fig. 2. Comparative results for miRNA levels between ocular toxoplasmosis
patients (OT- gray bars) and asymptomatic toxoplasmosis individuals (AT-
white bar). Plasma samples from the AT group were used as calibrator and the
expression values assume the value of 1.0. The bars indicate the means ± SEM
(standard error mean). Comparison of expression levels between groups was
performed by Mann-Whitney test at *p < 0.05, ***p < 0.0005.
inflammatory cytokines. In addition, miRNA levels regulate cytokine
production, and cytokines can modulate miRNA levels [26,41]. Ac-
cording to different studies, miRNAs could function as a bridge between
the immune response and T. gondii.
Among miRNAs analyzed in this study, miR-155-5p and miR-29c-3p
were up-expressed in OT patients. miR-155-5p is processed from B-cell
Integration Cluster, a non-coding transcript highly expressed in active B
and T cells; and in monocytes/macrophages [42]. Besides that, miR-
155-5p was identified as a component of macrophage and monocyte
response to different types of inflammatory mediators, such as bacterial
lipopolysaccharide (LPS), interferon-γ (IFN-γ), and TNF-α [26,27] miR-
155-5p expression is also closely related to TGF-β immunosuppressive
cytokine [43]. Increased expression of miR-155-5p, showed in this
study, was also associated with elevated proinflammatory cytokines (IL-
6, TNF-α and IL-1B) production [44]. In agreement, in our previous
study, higher levels of proinflammatory cytokine IL-6, TNF-α and TGF-
β were found in OT patients compared to asymptomatic individuals
[20,22]. IL-6, a pro-inflammatory mediator in OT, is capable to an-
tagonize the antimicrobial properties of IFN-γ by sustained activation of
STAT3, an inhibitor of IL-12 and IFN-γ [45,46].
Some studies have shown that high IL-6 intra-ocular could enhance
chemokine action and aggravate the destructive local inflammatory
response within the retina [47,48]. Indeed, high retina levels of IL-6
and TGF-β were found in experimental ocular toxoplasmosis. Parasite
burden in retina and inflammatory process is suggested to be controlled
by IL-6, whereas TGF-β (an regulator of ocular immune response), in
association with IL-10, [48] limits inflammatory activity [47]. Also,
high TNF-α levels are straight involved in the regulation of tachyzoite
growth [49] and in OT patients the high production of TNF-α con-
tribute to the inflammatory response and damage of the chroid and
retina [50,51].
miR-155-5p repress cytokines formed by Th2 cells. An increase in
Th2 cells, as well as, levels of IL-4, IL-5, and IL-10 were observed in vitro
differentiation of miR-155-deficient CD4+ T cells under Th2-polarizing
conditions [52]. Indeed, our group has shown low IL-4 levels of per-
ipheral blood mononuclear cells (PBMC) from OT patients after T.
gondii lysate antigen stimulation in vitro (data not shown). However,
these patients had high levels of IL-10 compared with asymptomatic
individuals [22].
miR-146a-5p belongs to a family of circulating miRNAs that co-
fractionate in plasma and serum with exosomes [53]. miR-146a-5p is
induced upon TLR engagement and is abundant human T-cells [54].
Over-expression of miR-146a-5p was shown to damage IL-2 production,
which is a consequence of reduced activity of AP-1 transcription factor
[54]. In this study, similar levels of miR-146a-5p were found between
OT patients and AT individuals. It is known that miR-146a-5p con-
tributes to the continuous suppression of the Th1-like features in Treg
cells and mainten Treg-cell identity [28]. Cannella et al [55] studying
5
Cytokine 127 (2020) 154990
mice brains challenged with T. gondii in a strain-specific manner,
identified that miR-146a-5p deficiency led to control of parasite burden
in the gut and most likely of early parasite dissemination in the brain
tissue, resulting in the long-term survival of mice. In fact, miR-146a was
found to be highly expressed in Treg cells and vital to maintain IFN-γ-
mediated Th1 immune response, as miR-146a damage in Treg cells
caused an increased IFN-γ production by CD4+ and CD8+ effector T
cells [28].
miR‐29 family is formed by miR‐29a, miR‐29b and miR‐29c. They
share a common seed sequence [56]. Several miR‐29 target transcripts
were identified and their regulation has been associated with many
physiological and pathological processes. The importance of miR-29-3p
in the regulation of adaptive immune response against intracellular
pathogens such as T. gondii through IFN-γ modulation has been de-
monstrated. miR-29-3p targets many genes related in Th1 differ-
entiating pathway. IFN-γ (and down-stream STAT1) induces the ex-
pression of miR-29-3p (in synergy with TCR activation), and miR-29-3p
inhibits IFN-γ expression [25,29]. Steiner et al [25] demonstrated the
ability of miR-29-3p to interact with mRNA from transcription factors
involved in regulating IFN-γ gene expression, while Ma et al [29] de-
monstrated the ability of this miRNA to bind directly to the IFN-γ
mRNA molecule, suggesting the action of miR-29-3p at multiple points
to regulate expression of this cytokine.
IFN-γ is crucial for resistance against T. gondii. IFN-γ control the
regulation of T. gondii load and distribution in the eyes. In addition,
IFN-γ is a mediator to control of T. gondii in the brain and to preserve
the latency in chronic infection [20,57,58,59]. Recent studies show that
OT patients have low levels of IFN-γ while high levels of IFN-γ are
observed in AT individuals [21,60]. In this study, OT patients had
higher levels of miR-29c-3p compared to AT individuals. In this context,
given the functions of miR-29c-3p in regulating IFN-γ expression, it is
possible that miRNA is playing an important role in the pathogenesis of
ocular toxoplasmosis, since low resistance to developing eye damage is
linked to the patient's ability to produce IFN-γ against the parasite.
miR-21-5p and miR-125b-5p were down-expressed in OT patients
when compared with AT individuals. According to Tili et al. [27], while
miR-155-5p and miR-146-5p were up-expressed in macrophages in re-
sponse to LPS stimulation, miR-125b-5p was down-expressed. miR-
125b-5p can target TNF-α mRNA, and down-expression leads to ele-
vated TNF-α production and, consequently, increased inflammatory
response. miR-125b-5p is up-expressed in macrophages, that promotes
greater macrophage activation and IFN-γ response [30]. Here, miR-
125b-5p was down-expressed in OT patients when compared to AT
individuals. Since miR-125b-5p is able to negatively regulate TNF-α
and positively IFN-γ production, these data corroborate with other
studies where low IFN-γ levels and high TNF-α levels were found in
patients with ocular toxoplasmosis [21,22]. Together these data suggest
that miR-125b-5p is involved in regulation of toxoplasmosis.
miR-21-5p is very expressed in mammalian cells [61,62] and is up-
expressed miRNA in distinct cancers [63,64]. Studies confirmed a key
role for miR-21-5p in the resolution of inflammation and in down-
regulate the pro-inflammatory response induced by stimuli that trigger
miR-21-5p induction. In particular, miR-21-5p is a key mediator for
anti-inflammatory process, since during LPS signaling negatively in-
terfere on levels of the anti-inflammatory cytokine IL-10, and may in-
terfere in TNF-α production [31]. Negative regulation of TNF-α levels
by miR-21-5p may help to prevent the excessive inflammation and
explain the effects of miR-21-5p on cell proliferation, migration, inva-
sion, and transformation associated with excessive miR-21-5p levels
and cancer [31].
In this study, AT individuals had higher miR 21-5p levels than OT
patients. Considering that miR-21-5p can negatively regulate IL-10 and
TNF-α, these findings are in agreement with our previous studies,
which individuals with asymptomatic toxoplasmosis had low IL-10 and
TNF-α levels [21,22]. These data suggest the regulatory action of miR
21-5p. The difference of other mediators is its action as a signal
C.S. Meira-Strejevitch, et al.
mediating the balance and transition between both states of the infec-
tion. Thus, miR21-5p is not solely characteristic of a pro-inflammatory
or an immunosuppressive state, miR-21-5p induction can be seen as a
“molecular rheostat” regulating the inflammatory switch [31].
Importantly, when analyzing our results we take into account fac-
tors inherent to the host that are important in the context of miRNAS
dysregulation, such as age, gender, and presence of active or inactive
parasites with circulating miRNA levels, but no differences were found.
However, it is important to note that in this study it was only possible to
analyze 51 samples from ocular toxoplasmosis patients during 3 years
of sample collection, since follow-up these patients is difficult.
In the last years, miRNA recognition and functions has uncovered an
additional regulatory layer of gene expression. miRNAs are genetic
targets which provide subsidies for therapeutic studies and diagnostic
tools. Most studies have been conducted on different types of cancer,
cardiovascular and autoimmune diseases. Recently, attention has fo-
cused on the use of circulating miRNAs as diagnostic/prognostic bio-
markers of infectious disease as human tuberculosis, sepsis and viral
hepatitis [65]. Despite the importance of miRNA studies, there are few
reports in the literature evaluating circulating miRNA, especially in
infectious diseases such as toxoplasmosis.
This study provides the first description of miRNA expression dys-
regulation in ocular toxoplasmosis patients. These findings may con-
tribute to future studies of how host miRNAs can modulate parasite
infections may help to better understand the mechanisms of parasite-
host interactions. This knowledge can provide valuable information
about future potential of miRNAs in the diagnosis and therapeutic
control of ocular toxoplasmosis.
Funding
This study was supported by grants from the FAPESP (Fundação de
Amparo à Pesquisa do Estado de Sao Paulo, Brazil) 2018/04708-8, ABC,
MMM and ISP were supported by scholarship from CAPES; DDCH, from
FAPESP (2015/04803-6); VLP-C, from CNPq (Conselho Nacional de
Desenvolvimento Científico e Tecnológico) 302327/2018-5.
Disclosures
The authors have no other relevant affiliations or financial in-
volvement with any organization or entire with a financial interest in or
financial conflict with the subject matter or materials discussed in the
manuscript apart from those disclosed. No writing assistance was uti-
lized in the production of this manuscript or financial relationships that
could be construed as a potential conflict of interest.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influ-
ence the work reported in this paper.
References
[1] D.E. Hill, S. Chirukandoth, J.P. Dubey, Biology and epidemiology of Toxoplasma
gondii in man and animals, Anim. Health. Res. Rev. 6 (2005) 41–61.
[2] J.P. Dubey, The history of Toxoplasma gondii - the first 100 years, J. Eukaryot.
Microbiol. 55 (2008) 467–475.
[3] V.L. Pereira-Chioccola, J.E. Vidal, C. Su, Toxoplasma gondii infection and cerebral
toxoplasmosis in HIV -infected patients, Future Microbiol. 4 (2009) 1363–1379.
[4] G. Saadatnia, M. Golkar, A review on human toxoplasmosis, Scand. J. Infect. Dis. 44
(2012) 805–814.
[5] N.J. Butler, J.M. Furtado, K.L. Winthrop, J.R. Smith, Ocular toxoplasmosis II:
clinical features, pathology and management, Clin. Exp. Ophthalmol. 41 (2013)
95–108.
[6] L.A. Jones, J. Alexander, C.W. Roberts, Ocular toxoplasmosis: in the storm of the
eye, Parasite Immunol. 28 (2006) 635–642.
[7] A.G. Commodaro, R.N. Belfort, L.V. Rizzo, C. Muccioli, C. Silveira, M.N. Burnier Jr.,
R. Belfort Jr., Ocular toxoplasmosis: an update and review of the literature, Mem.
6
Cytokine 127 (2020) 154990
Inst. Oswaldo Cruz 104 (2009) 345–350.
[8] E. Delair, P. Latkany, A.G. Noble, P. Rabiah, R. McLeod, A. Brézin, Clinical mani-
festations of ocular toxoplasmosis, Ocul. Immunol. Inflamm. 19 (2011) 91–102.
[9] S.K. Halonen, L.M. Weiss, Toxoplasmosis, Handb. Clin. Neurol. 114 (2013)
125–145.
[10] M. Previato, F.B. Frederico, F.H. Murata, R.C. Siqueira, A.P. Barbosa, A.P. Silveira-
Carvalho, C.S. Meira, V.L. Pereira-Chioccola, R. Gava, P.P. Martins Neto, L.C. de
Mattos, C.C. de Mattos, Brazilian report using serological and molecular diagnosis
to monitoring acute ocular toxoplasmosis, BMC Res. Notes 8 (2015) 746.
[11] D.G. Mack, J.J. Johnson, F. Roberts, C.W. Roberts, R.G. Estes, C. David,
F.C. Grumet, R. McLeod, HLA-class II genes modify outcome of Toxoplasma gondii
infection, Int. J. Parasitol. 29 (1999) 1351–1358.
[12] R.T. Gazzinelli, E.Y. Denkers, A. Sher, Host resistance to Toxoplasma gondii: model
for studying the selective induction of cell-mediated immunity by intracellular
parasites, Infect. Agents Dis. 2 (1993) 139–149.
[13] A. Sher, C. Collazzo, C. Scanga, D. Jankovic, G. Yap, J. Aliberti, Induction and
regulation of IL-12-dependent host resistance to Toxoplasma gondii, Immunol. Res.
27 (2003) 521–528.
[14] J. Winter, S. Jung, S. Keller, R.I. Gregory, S. Diederichs, Many roads to maturity:
microRNA biogenesis pathways and their regulation, Nat. Cell Biol. 11 (2009)
228–234.
[15] D.P. Bartel, MicroRNAs: target recognition and regulatory functions, Cell 136
(2009) 215–233.
[16] X. Chen, H. Liang, J. Zhang, K. Zen, C.Y. Zhang, Horizontal transfer of microRNAs:
molecular mechanisms and clinical applications, Protein Cell. 3 (2012) 28–37.
[17] R.M. O'Connell, D.S. Rao, A.A. Chaudhuri, D. Baltimore, Physiological and patho-
logical roles for microRNAs in the immune system, Nat. Rev. Immunol. 10 (2010)
111–122.
[18] Y. Kanno, G. Vahedi, K. Hirahara, K. Singleton, J.J. O'Shea, Transcriptional and
epigenetic control of T helper cell specification: molecular mechanisms underlying
commitment and plasticity, Annu. Rev. Immunol. 30 (2012) 707–731.
[19] T. Amado, N. Schmolka, H. Metwally, B. Silva-Santos, A.Q. Gomes, Cross-regulation
between cytokine and microRNA pathways in T cells, Eur. J. Immunol. 45 (2015)
1584–1595.
[20] V.B. Carruthers, Y. Suzuki, Effects of Toxoplasma gondii infection on the brain,
Schizophr. Bull. 33 (2007) 745–751.
[21] C.S. Meira, V.L. Pereira-Chioccola, J.E. Vidal, C.C. de Mattos, G. Motoie, T.A. Costa-
Silva, R. Gava, F.B. Frederico, L.C. de Mattos, Toxoplasma Groups. Cerebral and
ocular toxoplasmosis related with IFN-γ, TNF-α, and IL-10 levels, Front. Microbiol.
5 (2014) 492.
[22] M.M. Maia, C.S. Meira-Strejevitch, V.L. Pereira-Chioccola, D.D.C. de Hippólito,
V.O. Silva, C.C. Brandão de Mattos, F.B. Frederico, R.C. Siqueira, L.C. de Mattos,
FAMERP and IAL Toxoplasma Research Group. Evaluation of gene expression levels
for cytokines in ocular toxoplasmosis, Parasite Immunol. 3 (2017) 9(10)12462.
[23] A.L. Vallochi, M.V. Nakamura, D. Schlesinger, M.C. Martins, C. Silveira, R. Belfort
Jr, L.V. Rizzo, Ocular toxoplasmosis: more than just what meets the eye, Scand. J.
Immunol. 55 (2002) 324–328.
[24] A. Sauer, E. Rochet, I. Lahmar, J. Brunet, M. Sabou, T. Bourcier, E. Candolfi,
A.W. Pfaff, The local immune response to intraocular Toxoplasma re-challenge: less
pathology and better parasite control through Treg/Th1/Th2 induction, Int. J.
Parasitol. 43 (2013) 721–728.
[25] D.F. Steiner, M.F. Thomas, J.K. Hu, Z. Yang, J.E. Babiarz, C.D. Allen,
M. Matloubian, R. Blelloch, K.M. Ansel, MicroRNA-29 regulates T-box transcription
factors and interferon-γ production in helper T cells, Immunity 35 (2011) 169–181.
[26] R.M. O'Connell, K.D. Taganov, M.P. Boldin, G. Cheng, D. Baltimore, MicroRNA-155
is induced during the macrophage inflammatory response, PNAS 30 (2007)
1604–1609.
[27] E. Tili, J.J. Michaille, A. Cimino, S. Costinean, C.D. Dumitru, B. Adair, M. Fabbri,
H. Alder, C.G. Liu, G.A. Calin, C.M. Croce, Modulation of miR-155 and miR-125b
levels following lipopolysaccharide/TNF-alpha stimulation and their possible roles
in regulating the response to endotoxin shock, J. Immunol. 179 (2007) 5082–5089.
[28] L.F. Lu, M.P. Boldin, A. Chaudhry, L.L. Lin, K.D. Taganov, T. Hanada, A. Yoshimura,
D. Baltimore, A.Y. Rudensky, Function of miR-146a in controlling Treg cell-medi-
ated regulation of Th1 responses, Cell 142 (2010) 914–929.
[29] F. Ma, S. Xu, X. Liu, Q. Zhang, X. Xu, M. Liu, M. Hua, N. Li, H. Yao, X. Cao, The
microRNA miR-29 controls innate and adaptive immune responses to intracellular
bacterial infection by targeting interferon-γ, Nat. Immunol. 12 (2011) 861–869.
[30] A.A. Chaudhuri, A.Y. So, N. Sinha, W.S. Gibson, K.D. Taganov, R.M. O'Connell,
D. Baltimore, MicroRNA-125b potentiates macrophage activation, J. Immunol. 187
(2011) 5062–5068.
[31] F.J. Sheedy, Turning 21: induction of miR-21 as a key switch in the inflammatory
response, Front. Immunol. 6 (2015) 19.
[32] R. Manzano-Román, M. Siles-Lucas, MicroRNAs in parasitic diseases: potential for
diagnosis and targeting, Mol. Biochem. Parasitol. 186 (2012) 81–86.
[33] Y. Cai, J. Shen, Modulation of host immune responses to Toxoplasma gondii by
microRNAs, Parasite Immunol. 39 (2017) 2.
[34] C.C. Mattos, C.S. Meira, A.I. Ferreira, F.B. Frederico, R.M. Hiramoto, G.D. Almeida
Jr, L.C. Mattos, V.L. Pereira-Chioccola, Contribution of laboratory methods in di-
agnosing clinically suspected ocular toxoplasmosis in Brazilian patients, Diagn.
Microbiol. Infect. Dis. 70 (2011) 362–366.
[35] A.I.C. Ferreira, C.C.B. De Mattos, F.B. Frederico, C.S. Meira, G.C. Almeida Jr,
F. Nakashima, C.R. Bernardo, V.L. Pereira-Chioccola, L.C. De Mattos, Risk factors
for ocular toxoplasmosis in Brazil, Epidemiol. Infec. 142 (2014) 142–148.
[36] C.S. Meira, T.A. Costa-Silva, J.E. Vidal, I.M. Ferreira, R.M. Hiramoto, V.L. Pereira-
Chioccola, Use of the serum reactivity against Toxoplasma gondii excreted-secreted
antigens in cerebral toxoplasmosis diagnosis in human immunodeficiency virus-
C.S. Meira-Strejevitch, et al.
infected patients, J. Med. Microbiol. 57 (2008) 845–850.
[37] T.A. Costa-Silva, C.S. Meira, N. Frazzatti-Gallina, V.L. Pereira-Chioccola,
Toxoplasma gondii antigens: recovery analysis of tachyzoites cultivated in Vero cell
maintained in serum free medium, Exp. Parasitol. 130 (2012) 463–469.
[38] L.M. Camilo, V.L. Pereira-Chioccola, R. Gava, C.S. Meira-Strejevitch, J.E. Vidal,
C.C. Brandão de Mattos, F.B. Frederico, L.C. De Mattos, L.C.J.F. Spegiorin, FAMERP
Toxoplasma Research Group. Molecular diagnosis of symptomatic toxoplasmosis: a
9-year retrospective and prospective study in a referral laboratory in São Paulo,
Brazil. Braz. J. Infect. Dis. 21 (2017) 638–647.
[39] P.S. Mitchel, R.K. Parkin, E.M. Kroh, B.R. Fritz, S.K. Wyman, E.L. Pogosova-
Agadjanyan, A. Peterson, J. Noteboom, K.C. O'Briant, A. Allen, D.W. Lin, N. Urban,
C.W. Drescher, B.S. Knudsen, D.L. Stirewalt, R. Gentleman, R.L. Vessella,
P.S. Nelson, D.B. Martin, M. Tewari, Circulating microRNAs as stable blood-based
markers for cancer detection, PNAS 105 (2008) 10513–10518.
[40] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) method, Methods 25 (2001)
402–408.
[41] K.D. Taganov, M.P. Boldin, K.J. Chang, D. Baltimore, NF-kappaB-dependent in-
duction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate
immune responses, PNAS 15 (2006) 12481–12486.
[42] J. Raisch, A. Darfeuille-Michaud, H.T. Nguyen, Role of microRNAs in the immune
system, inflammation and cancer, World J. Gastroenterol. 28 (2013) 2985–2996.
[43] L.M. Das, M.D. Torres-Castillo, T. Gill, A.D. Levine, TGF-β conditions intestinal T
cells to express increased levels of miR-155, associated with down-regulation of IL-2
and itk mRNA, Mucosal Immunol. 6 (2013) 167–176.
[44] K.M. Pauley, M. Satoh, A.L. Chan, M.R. Bubb, W.H. Reeves, E.K. Chan, Upregulated
miR-146a expression in peripheral blood mononuclear cells from rheumatoid ar-
thritis patients, Arthritis Res. Ther. 10 (2008) R101.
[45] R. Hoekzema, P.I. Murray, A. Kijlstra, Cytokines and intraocular inflammation,
Curr. Eye Res. 9 (Suppl) (1990) 207–211.
[46] R.J. Whitmarsh, C.M. Gray, B. Gregg, D.A. Christian, M.J. May, P.J. Murray,
C.A. Hunter, A critical role for SOCS3 in innate resistance to Toxoplasma gondii,
Cell Host Microbe 10 (2011) 224–236.
[47] J.T. Kong, M.E. Grigg, L. Uyetake, S. Parmley, J.C. Boothroyd, Serotyping of
Toxoplasma gondii infections in humans using synthetic peptides, J. Infect. Dis. 187
(2003) 1484–1495.
[48] L. Shobab, U. Pleyer, J. Johnsen, S. Metzner, E.R. James, N. Torun, M.P. Fay,
O. Liesenfeld, M.E. Grigg, Toxoplasma serotype is associated with development of
ocular toxoplasmosis, J. Infect. Dis. 208 (2013) 1520–1528.
[49] E.Y. Denkers, R.T. Gazzinelli, Regulation and function of T-cell-mediated immunity
during Toxoplasma gondii infection, Clin. Microbiol. Rev. 11 (1998) 569–588.
[50] G.R. Wallace, M.R. Stanford, Immunity and Toxoplasma retinochoroiditis, Clin. Exp.
Immunol. 153 (2008) 309–315.
[51] H. Talabani, T. Mergey, H. Year, E. Delair, A.P. Brézin, G. Langsley, J. Dupouy-
Camet, Factors of occurrence of ocular toxoplasmosis. A review, Parasite 17 (2010)
177–182.
[52] A. Rodriguez, E. Vigorito, S. Clare, M.V. Warren, P. Couttet, D.R. Soond, S. van
Dongen, R.J. Grocock, P.P. Das, E.A. Miska, D. Vetrie, K. Okkenhaug, A.J. Enright,
G. Dougan, M. Turner, A. Bradley, Requirement of bic/microRNA-155 for normal
immune function, Science 316 (2007) 608–611.
Cytokine 127 (2020) 154990
[53] J.D. Arroyo, J.R. Chevillet, E.M. Kroh, I.K. Ruf, C.C. Pritchard, D.F. Gibson,
P.S. Mitchell, C.F. Bennett, E.L. Pogosova-Agadjanyan, D.L. Stirewalt, J.F. Tait,
M. Tewari, Argonaute2 complexes carry a population of circulating microRNAs
independent of vesicles in human plasma, PNAS 108 (2011) 5003–5008.
[54] G. Curtale, F. Citarella, C. Carissimi, M. Goldoni, N. Carucci, V. Fulci,
D. Franceschini, F. Meloni, V. Barnaba, G. Macino, An emerging player in the
adaptive immune response: microRNA-146a is a modulator of IL-2 expression and
activation-induced cell death in T lymphocytes, Blood 115 (2010) 265–273.
[55] D. Cannella, M.P. Brenier-Pinchart, L. Braun, J.M. van Rooyen, A. Bougdour,
O. Bastien, M.S. Behnke, R.L. Curt, A. Curt, J.P. Saeij, L.D. Sibley, H. Pelloux,
M.A. Hakimi, miR-146a and miR-155 delineate a MicroRNA fingerprint associated
with Toxoplasma persistence in the host brain, Cell Rep. 6 (2014) 928–937.
[56] J.J. Kwon, T.D. Factora, S. Dey, J. Kota, A Systematic review of miR-29 in cancer,
Mol. Ther. Oncolytics 12 (2018) 173–194.
[57] P.J. Gaddi, G.S. Yap, Cytokine regulation of immunopathology in toxoplasmosis,
Immunol. Cell Biol. 85 (2007) 155–159.
[58] R.S. Goldszmid, P. Caspar, A. Rivollier, S. White, A. Dzutsev, S. Hieny, B. Kelsall,
G. Trinchieri, A. Sher, NK cell-derived interferon-γ orchestrates cellular dynamics
and the differentiation of monocytes into dendritic cells at the site of infection,
Immunity 36 (2012) 1047–1059.
[59] R. Nijhawan, R. Bansal, N. Gupta, N. Beke, P. Kulkarni, A. Gupta, Intraocular cysts
of Toxoplasma gondii in patients with necrotizing retinitis following periocular/in-
traocular triamcinolone injection, Ocul. Immunol. Inflamm. 21 (2013) 396–399.
[60] A. de-la-Torre, A. Sauer, A.W. Pfaffm, T. Bourcier, J. Brunet, C. Speeg-Schatz,
L. Ballonzoli, O. Villard, D. Ajzenberg, N. Sundar, M.E. Grigg, J.E. Gomez-Marin,
E. Candolfi, Severe South American ocular toxoplasmosis is associated with de-
creased Ifn-γ/Il-17a and increased Il-6/Il-13 intraocular levels, PLoS Negl. Trop.
Dis. 7 (2013) e2541.
[61] M. Lagos-Quintana, R. Rauhut, W. Lendeckel, T. Tuschl, Identification of novel
genes coding for small expressed RNAs, Science 294 (2001) 853–858.
[62] P. Landgraf, M. Rusu, R. Sheridan, A. Sewer, N. Iovino, A. Aravin, S. Pfeffer, A. Rice,
A.O. Kamphorst, M. Landthaler, C. Lin, N.D. Socci, L. Hermida, V. Fulci, S. Chiaretti,
R. Foà, J. Schliwka, U. Fuchs, A. Novosel, R.U. Müller, B. Schermer, U. Bissels,
J. Inman, Q. Phan, M. Chien, D.B. Weir, R. Choksi, G. De Vita, D. Frezzetti,
H.I. Trompeter, V. Hornung, G. Teng, G. Hartmann, M. Palkovits, R. Di Lauro,
P. Wernet, G. Macino, C.E. Rogler, J.W. Nagle, J. Ju, F.N. Papavasiliou, T. Benzing,
P. Lichter, W. Tam, M.J. Brownstein, A. Bosio, A. Borkhardt, J.J. Russo, C. Sander,
M. Zavolan, T. Tuschl, A mammalian microRNA expression atlas based on small
RNA library sequencing, Cell 129 (2007) 1401–1414.
[63] S. Volinia, G.A. Calin, C.G. Liu, S. Ambs, A. Cimmino, F. Petrocca, R. Visone,
M. Iorio, C. Roldo, M. Ferracin, R.L. Prueitt, N. Yanaihara, G. Lanza, A. Scarpa,
A. Vecchione, M. Negrini, C.C. Harris, C.M. Croce, A microRNA expression sig-
nature of human solid tumors defines cancer gene targets, PNAS 103 (2006)
2257–2261.
[64] F. Meng, R. Henson, H. Wehbe-Janek, K. Ghoshal, S.T. Jacob, T. Patel, MicroRNA-
21 regulates expression of the PTEN tumor suppressor gene in human hepatocel-
lular cancer, Gastroenterology 133 (2007) 647–658.
[65] C.N. Correia, N.C. Nalpas, K.E. McLoughlin, J.A. Browne, S.V. Gordon,
D.E. MacHugh, R.G. Shaughnessy, Circulating microRNAs as potential biomarkers
of infectious disease, Front. Immunol. 16 (8) (2017) 118.