Acta Physiol Plant (2014) 36:2695–2704
DOI 10.1007/s11738-014-1640-7
ORIGINAL PAPER
Elicitors, SA and MJ enhance carotenoids and tocopherol
biosynthesis and expression of antioxidant related genes
in Moringa oleifera Lam. leaves
R. K. Saini • K. V. Harish Prashanth •
N. P. Shetty • P. Giridhar
Received: 3 April 2014 / Revised: 17 June 2014 / Accepted: 17 July 2014 / Published online: 8 August 2014
 Franciszek Górski Institute of Plant Physiology, Polish Academy of Sciences, Kraków 2014
Abstract Moringa oleifera Lam. leaves are rich source of
carotenoids (provitamin A) and a-tocopherol (vitamin E),
and there is a scope for their further enhancement, through
elicitor mediation, thereby a great potential for addressing
these vitamins deficiency. In the present study, we report
the efficacy of foliar administration of biotic elicitors,
carboxy-methyl chitosan and chitosan, and signaling mol-
ecules, methyl jasmonate (MJ) and salicylic acid (SA) for
enhancement of major carotenoids and a-tocopherol.
Highest a-tocopherol content of 49.7 mg/100 g FW was
recorded upon foliar application of 0.1 mM SA after 24 h
of treatment, which represented a 187.5 % increase in
comparison to the untreated control. Similarly, a maximum
of 52.6 mg/100 g FW lutein, and 21.8 mg/100 g FW b-
carotene content were observed in leaves after 24 h of
treatment with MJ, which represented a 54.0 and 20.3 %
increase in comparison to the untreated control, respec-
tively. Among the major genes of carotenoid biosynthetic
pathway, the expression of lycopene b-cyclase (LCY-b)
was maximum influenced after treatment with elicitors and
signaling molecules, compared to phytoene synthase and
phytoene desaturase, suggesting the LCY-b-mediated
enhancement in the production of b-carotene in elicitor
treated M. oleifera leaves. Enhanced production of a-
tocopherol under respective elicitor treatment was further
Communicated by A. Krolicka.
R. K. Saini
N. P. Shetty
P. Giridhar (&)
Plant Cell Biotechnology Department, CSIR-Central Food
Technological Research Institute, Mysore 570 020, India
e-mail: pcbt@cftri.res.in; parvatamg@yahoo.com
K. V. Harish Prashanth
Meat and Marine Sciences Department, CSIR-Central Food
Technological Research Institute, Mysore 570 020, India
supported by 2.0–2.7 fold up-regulation of c-tocopherol
methyl transferase, compared to untreated control. This is
the first report on elicitor-mediated enhanced production of
tocopherol and carotenoids in foliage of economically
important food plant.
Keywords Signaling molecules
Salicylic acid
Methyl
jasmonate
Chitosan
Lycopene b-cyclase (LCY-b)
c-
Tocopherol methyl transferase
Introduction
Moringa oleifera Lam., (syn. Moringa pterygosperma
Gaertn., 2n = 28) commonly known as horseradish or
drumstick tree, is a tropical deciduous perennial dicotyle-
donous tree (up to 12 m) belongs to family Moringaceae.
M. oleifera is often considered as important famine foods
because of their high tolerance to drought and arid condi-
tions owing to their tuberous roots (Sena et al. 1998).
Almost each and every part of M. oleifera tree are useful
for medicinal, functional food preparations and nutraceu-
ticals (Bhaskarachary et al. 1995; Ching and Mohamed
2001; Anwar et al. 2007; Devi et al. 2008; Anjorin et al.
2010; Saini et al. 2014a, b), and other health beneficial
constituents (Bennett et al. 2003). Significant losses of
carotenoids, tocopherols occur during processing of the
leaves (Saini et al. 2014c), which is a bottleneck in the
maintenance of effective levels of these phytoconstituents
in processed products. Biofortification of carotenoids and
tocopherols through genetic modification (GM) approach
been found successful, such as ‘‘golden rice’’ (Potrykus
2001, 2003), ‘‘golden potatoes’’ to obtain higher amount of
b-carotene and lutein (Ducreux et al. 2005; Diretto et al.
2006) and tomatoes with sevenfold higher b-carotene
123
2696
levels with overexpression of lycopene b-cyclase (Rosati
et al. 2000). Similarly, enrichment of tocopherol by over-
expressing homogentisate phytyltransferase (HPT) and
tocopherol cyclase (TC) in tobacco was reported (Harish
et al. 2013). However, GM based approach is limited to
few crops with societal barriers. So, an eco-friendly
method needs to be evaluated to enhance nutritionally
important phytoconstituents.
Phytoconstituents profile is generally influenced by
biotic and abiotic factors including physical and chemical
damages, UV light, climatic conditions, wounding, patho-
gens, plant microbe interactions, soil fertility as well as
elicitor treatment during growth and development of the
plants (Kim et al. 2007; Puthusseri et al. 2012; Hura et al.
2014). It is also found that these factors are involved in the
up-regulation of biosynthetic genes related to secondary
metabolites and defense-related genes (Hugueney et al.
1996; Zulak et al. 2007). Elicitation is an efficient strategy
by means of compounds or treatments which induces plants
to synthesize phytoalexins at enhanced levels (Ramachan-
dra Rao and Ravishankar 2002). Thus elicitors, have been
used to increase resistance in plants to various pests (El-
Abyad et al. 1993), to enhance the content of beneficial
phytochemicals (Kim et al. 2007), as well in nutraceuticals
(Zhao et al. 2001). The molecular mechanism involved in
elicitor activity is considered to be complex and the effect
of elicitors depends on numerous factors, such as the
concentration and type of the elicitor and the growth stage
of the plant/organ at the time of elicitation. Elicitors (abi-
otic and biotic) and signaling molecules (MJ; methyl
jasmonate and SA; salicylic acid) were previously studied
for their efficacies in enriching nutritionally important
phytoconstituents in seasonal plants (Puthusseri et al. 2012;
Saini et al. 2013a) and microorganisms (Lu et al. 2010).
However, such types of studies were not conducted in
foliage of perennial plants. So, in the present study, the
efficacies of foliar administration of selective elicitors and
signaling molecules, were evaluated to enhance the carot-
enoid and tocopherol content in leaves of field grown M.
oleifera trees. At molecular level, the influence of all these
treatments was evaluated by analyzing mRNA expression
patterns of respective biosynthetic genes for tocopherols
and carotenoids, and antioxidant genes by qRT-PCR to
substantiate the improvement in the accumulation of
carotenoids and tocopherol content in leaves.
Materials and methods
Plant cultivation, reagents and foliar treatment
The field experiment was conducted on 3-year-old M. ol-
eifera (cv. PKM-1) plants grown in Institute’s orchard in
123
Acta Physiol Plant (2014) 36:2695–2704
December 2012 (average temperature was 23–25 C).
Authenticated seeds of M. oleifera Lam., (cv. PKM-1) were
collected from University of Agriculture Sciences, Ban-
galore (Karnataka, India) and grown in field, at 2 m 9 2 m
spacing (Saini et al. 2013b). The soil type was red silt loam
with fine-silty characteristics, which is the best for M. ol-
eifera cultivation. After plantation, at every 2 months
interval, 20 g N–P–K (15:15:15) were applied to each plant
and watered with tap water. Newly developed leaves (from
top third petiole) were used for elicitor treatment. The
different types of elicitors and signaling molecules were
applied in different concentrations, according with previ-
ous studies on leafy vegetables species (Pérez-Balibrea
et al. 2011; Puthusseri et al. 2012). Biotic elicitors, chitosan
and derivative of chitosan–CMC (N,O-carboxy-methyl
chitosan) were prepared according to previously estab-
lished method (Kittur et al. 2002). MJ, SA and triton X-100
were purchased from Sigma Aldrich, Bangalore. All the
elicitors were sprayed on fresh leaves of plants during
10.00–11.00 h of the day.
Experiment was conducted in complete random block
design with three replicates of each treatment, generating a
total of 30 experimental units (10 treatments 9 3 repli-
cates). CMC (5, 10 and 50 ppm), chitosan (5 and 10 ppm),
MJ and SA (0.1 and 0.5 mM) were dissolved in distilled
H2O with 0.1 % triton X-100 (ionic detergent; v/v), and
sprayed on leaves with the help of pressurized plant water
mister sprayer. Approximately, 100 ml elicitor formulation
was applied on 50 g leaves. Quantities of leaves were
determined approximately by harvesting the leaves on trial
basis. Triton X-100 was added to enhance the permeability
and absorption of sprayed formulation (Farmer and Ryan
1992). For control, distilled water containing equal amount
of Triton X-100 was sprayed on leaves. To avoid cross
signaling in systemic response, different type of elicitors
and signaling molecules were applied in triplicates on
different plants in complete random block design. 5 g of
leaf samples were collected in triplicates at 0, 24, 48, 72
and 96 h after treatment, mixed thoroughly and divided in
two parts for HPLC and gene expression analysis. For gene
expression analysis, 1 g of collected leaf samples was
freezed in liquid nitrogen and stored at -80 C for RNA
extraction. For HPLC analysis, carotenoids and tocopherols
were extracted immediately after harvesting the samples.
After elicitor treatment, observations were recorded for
visual changes in leaves such as necrotic changes, because
the value of leafy vegetables is governed by visual
characteristics.
Identification of homologous genes
Total RNA extraction was carried out using TRIzol reagent
(Sigma Aldrich, Bangalore) from 100 mg leaves (from top
Acta Physiol Plant (2014) 36:2695–2704 2697

Table 1 List of oligos used for Primer/gene Forward primer Reverse primer NCBI
qRT-PCR studies name accession no

APX TCGAGCCGATCAAGGAGCAG GCAAAGAAAGCATCCTCATC JQ284377.1

DHFR–TS TCCTCCTTGCCACATGTTTG AATGTTAAACGGCACACCGAG JQ764562.1
APX ascorbate peroxidase,
DHFR–TS bifunctional CAT CATGAATTTCATGCACAGGG TGAAATTGTTCTCCTTCTCA GQ365164.1
dihydrofolate reductase– PHS CAACAGCTTTAGATAGGTGGG AGGTCCATCCTCATTCCTTC JQ284379.1
thymidylate synthase, CAT C-TMT GTGTTCCACGGCGGATTATG TTCCATGTCAGTGCCGACC JQ398858.1
catalase, GAPDH
PDS GCATGGAAAGATGATGATGG TATGCCCTGCTTTCTCATCC JQ284378.1
glyceraldehyde-3-phosphate
dehydrogenase, TUA alpha- LCY-b TTGGGTGGATGAATTTGAGG TGAATCGTAACACCATCATTGC JQ081231.1
tubulin, PHS phytoene synthase, GAPDH GCTCATTTGAAGGGTGGTGC CCTTTCCAACAGCCTTAGCAG JQ764560.1
PDS phytoene desaturase, LCY- TUA TCTCGACACACTCCCTCTTG CTCAGGGAAGCTGTAAGGGAAG JQ764561.1
b lycopene beta cyclase

third petiole) of M. oleifera plant, as per the manufacturer’s
protocol. RNA concentration and purity were determined
by spectrophotometry using Nano Drop 1000 (Thermo
Scientific). After quantification, RNA quality and integrity
was analyzed in a 1.5 % (w/v) agarose formamide gel.
cDNA was synthesized in 40 ll reaction, using 2 lg of
total RNA, 0.5 mM dNTP mix, 5 lM random hexamer,
5 lM oligo dT primers, 40 units of RNase inhibitor and
400 units of M-MLV Reverse transcriptase (Sigma
Aldrich, Bangalore). cDNA was diluted in 160 ll of water
to make five time dilution, and used as the template for
real-time quantitative PCR and homologous genes identi-
fication. Homologous genes identification with PCR is
extremely useful for identifying orthologous genes from
different species using the genomic information from close
relatives where genomic information is not available,
(Lang and Orgogozo 2011). Primers were designed from
conserved domains of desired genes from relative species
of M. oleifera after multiple sequence alignment by Bio-
Edit sequence analysis program (Hall 1999). After PCR,
obtained amplicon were gel-eluted and purified using Quia-
quick gel Extraction kit (Qiagen) and sequenced. Sequence
similarities and open reading frame of obtained sequences
were analyzed by BLAST (http://www.ncbi.nlm.nih.gov)
and open reading frame (ORF) http://searchlauncher.bcm.
tmc.edu/seq-util/seq-util.html. Sequences were submitted
to NCBI database using BankIt Submission tool, and
obtained NCBI sequence accession numbers are given in
Table 1.
Quantitative real-time PCR analysis
For qRT-PCR analysis, total RNA extraction was carried
out using TRIzol reagent (Invitrogen, CA, USA) from
100 mg of elicitor treated and control leaves. Quantitative
RT-PCR was performed in a total volume of 10 ll,
including 2 ll of diluted cDNA, 100 lM of each primer,
and 5 ll of 29 SsoFast EvaGreen Supermix (Bio-Rad Inc.,
CA, USA) on an CFX96 Touch Real-Time PCR Detection
System (Bio-Rad Inc., CA, USA). The qPCR program
included a preliminary step of 95 C for 1 min, followed
by 40 cycles of 95 C for 15 s and 60 C for 30 s. Melt
curve was performed from 65.0 to 95.0 C, with increment
of 0.5 C at every 5 s. M. oleifera GAPDH and a-tubulin
(TUA) was used as an internal control to normalize the
gene expression. Relative gene expression was calculated
according to a 2 DDCT method (Livak and Schmittgen
2001). qPCR was performed in triplicates and the fold
change in each target gene was compared with untreated
control, which was set to 1. Primer sequences of the genes
used in the study is given in Table 1.
Quantification of carotenoids and tocopherol
Carotenoids and tocopherols were extracted and quantified
by HPLC from elicitor and control leaves (Saini et al.
2012). Briefly, 1 g of fresh leaves sample was homoge-
nized in chilled acetone and the extraction was repeated
until the samples became colorless (total volume 15 ml).
The extracts were then centrifuged at 8,000g and filtered
through a 0.45-lm membrane (Nupore, India). A volume
of 20 ll extract was injected into the HPLC system without
saponification. Standards of carotenoids (lutein and b-car-
otene) and tocopherol (d, c and a-tocopherol) were pur-
chased from Sigma Aldrich, Bangalore. The HPLC system
consisted of a Shimadzu chromatograph (LC 20-AD
HPLC), equipped with dual pump, UV detector (SPD 20A)
and an YMC C30 Carotenoid column (250 9 4.6 mm,
5 mm; YMC, Wilmington, NC, USA). The mobile phase
was 81:15:4 methanol:methyl tertiary butyl ether
(MTBE):water (solvent A) and 91:9 MTBE:methanol
(solvent B). The gradient elution was 0–50 % B in 45 min
followed by 0 % B in the next 5 min at a flow rate of 1 ml/
min. Carotenoids (lutein and b-carotene) were monitored at
450 nm and tocopherol at 295 nm (Saini et al. 2012). For
quantification of lutein, b-carotene and a-tocopherol
external standard method was used––standard curves
within the range 0.01–10 lg were separately determined

123
2698 Acta Physiol Plant (2014) 36:2695–2704

Fig. 1 HPLC chromatograms

(UV, 298 nm) of tocopherol
standards (a), a-tocopherol in
0.1 mM salicylic acid treated
leaves, after 24 h of treatment
(b), and a-tocopherol in
untreated control leaves of M.
oleifera (c)

for each of the analyzed metabolite. Concentrations of significant differences (LSD) were calculated to separate
carotenoids and tocopherol were determined applying the the mean values of the different treatments.
linear regression equation of the standard curve.

Statistical analysis Results and discussion

The samples were extracted in triplicates from each inde-
pendent treatments and control. Values from all nine
determinations (3 extractions 9 3 replicates) of each
treatment were averaged and represented as means with
standard deviations (SD). Data were analyzed statistically
by the SPSS 17.0 software by one-way ANOVA and least
The effects of foliar administration of biotic elicitors and
signaling molecules were evaluated to enhance the content
on carotenoids and tocopherol in M. oleifera leaves. Cul-
tivar PKM-1, in particular was selected in the present study
due maximum area under cultivation and also due to the
presence of significantly high amount of carotenoids and a-

123
Acta Physiol Plant (2014) 36:2695–2704
Fig. 2 HPLC chromatogram (UV/VIS, 450 nm) of carotenoids in leaves of M. oleifera. Peak identification: 1 lutein, 2 b-carotene, Chl
chlorophyll (not quantified), hash symbol identified peaks
tocopherol, compared to other Indian cultivars (Saini et al.
2014b). Among different tocopherols (a, c and d-tocoph-
erol), M. oleifera leaves contain only a-tocopherol,
whereas other forms were not detected (Fig. 1). Similarly,
lutein and b-carotene were the major fraction of carote-
noids in M. oleifera leaves (Bhaskarachary et al. 1995;
Lakshminarayana et al. 2005; Saini et al. 2012). So, the
present study was focused on major carotenoids, including,
lutein and b-carotene (Fig. 2). All the treatments were
found to influence the content of all studied constituents
(p \ 0.05). In the present study it is obvious that at lower
concentrations of MJ (0.1 mM), SA (0.1 mM), and chito-
san (5 ppm) treatments, there was a surge in carotenoids
and a-tocopherol content and maximum accumulations of
these phytoconstituents were reached after 24 h in most of
the treatments (Fig. 3). Highest a-tocopherol content
(49.7 mg/100 g FW) was observed following the foliar
application of 0.1 mM SA (after 24 h of treatment), which
represented a 187.5 % increase in comparison to the
untreated control. Maximum lutein and b-carotene content
(i.e. 52.6 and 21.8 mg/100 g FW, respectively) was
observed in the leaves treated with MJ, after 24 h of
treatment (Table 2). In this study, MJ and SA were found
to be most effective for enhancement of carotenoid and a-
tocopherol content, respectively, in M. oleifera leaves.
Visible changes in leaves such as necrosis and chlorosis
were not observed in treated leaves.
Changes in carotenoids and tocopherol content were
correlated with investigating the changes in respective
biosynthetic genes for tocopherol and carotenoids, and
antioxidant related genes by quantitative real time PCR
2699
(qRT-PCR). After elicitor treatments, content of studied
phytoconstituents were increased up to 24 h, but decreased
subsequently, whereas expression of ascorbate peroxidase
(APX), lycopene b-cyclase (LCY-b) and bifunctional
dihydrofolate reductase–thymidylate synthase (DHFR–TS)
genes were recorded maximum at 6 h after treatment
compared to control (Fig. 4). Elicitation with MJ and SA
were found to differentially regulate the expression of
catalase (CAT) mRNA. Expression of CAT mRNA was
maximum (5.82 fold higher compared to control) after 6 h
of treatment with MJ, whereas, in SA treatment, expression
was maximum (3.45 fold higher compared to control) after
12 h of treatment. In contrast to this, significant changes
(p \ 0.05) were not recorded in the expression of phytoene
synthase (PHS) and phytoene desaturase (PDS) mRNA was
after foliar application with MJ and SA (Fig. 3). Expres-
sion of c-tocopherol methyltransferase (c-TMT) was also
found to be differentially regulated after treatment with SA
and MJ.
Methyl jasmonate is the quickest and critical signal
molecule of complex signaling networks in plants which
plays important role in defense against biotic and abiotic
stress (Wang and Buta 1994; Parra-Lobato et al. 2009),
through enhanced production of defense-related molecules,
including phenolics and phytoalexins. Enhanced produc-
tion of b-carotene in apple (Pérez et al. 1993), caffeoyl-
putrescine content in tomato (Chen et al. 2006), nicotine in
tobacco (Jiang et al. 2009), carotenoids in Haematococcus
pluvialis (Lu et al. 2010) and Bixa orellana (Parimalan
et al. 2011), rosmarinic acid in Solenostemon scutellario-
ides (Sahu et al. 2013), withanolides in Withania somnifera
123
2700 Acta Physiol Plant (2014) 36:2695–2704

60.0
0 hrs 24 hrs 48 hrs 72 hrs 96 hrs
50.0
Lutein (mg/100g FW)
40.0

30.0

20.0

10.0

0.0

60.0
0 hrs 24 hrs 48 hrs 72 hrs 96 hrs
50.0
β-carote (mg/100g FW)

40.0

30.0

20.0

10.0

0.0

60.0
0 hrs 24 hrs 48 hrs 72 hrs 96 hrs
α-tocopherol (mg/100g FW)

50.0

40.0

30.0

20.0

10.0

0.0

Fig. 3 Bar diagram showing the effect of elicitors treatment on lutein, b-carotene and a-tocopherol content in fresh leaves of M. oleifera. Data
are Mean ± SD of three replicates. CMC carboxyl methyl chitosan, SA salicylic acid, MJ methyl jasmonate

(Sivanandhan et al. 2013) are reported following the
exogenous application of MJ. Similar to MJ, SA is also an
important signaling molecule play important role in local
as well as systemic disease resistance responses (Rasmus-
sen et al. 1991; Klessig and Malamy 1994). Enhanced
production and accumulation of capsaicinoids in Capsicum
frutescens (Prasad et al. 2006), artemisinin in Artemisia
annua (Pu et al. 2009) and annatto pigments in Bixa
orellana (Parimalan et al. 2011), folate in coriander (Pu-
thusseri et al. 2012), and other phytochemicals in broccoli
sprouts (Pérez-Balibrea et al. 2011) are studied following
the application of SA. Effect of elicitor treatment on
enhanced production of tocopherol is not investigated
earlier on any plant, so for the first time, the present study
is able to show significantly higher (1.8 fold) production of
a-tocopherol in M. oleifera leaves treated with 0.1 mM SA,

123
Acta Physiol Plant (2014) 36:2695–2704 2701

Table 2 Content of lutein, b-carotene and a-tocopherol in elicitor biosynthetic genes in red algae (Lu et al. 2010; Gao et al.
treated leaves (24 h after treatment) 2012). Foliar application of SA and MJ in the concentration
Treatment a-Tocopherol Lutein b-Carotene range of 0.1–0.5 mM has been recorded to enhance the
content of folate, ascorbic acid, phenolic compounds,
CMC, 5 ppm 42.3 ± 3.8a 36.2 ± 1.8c 18.9 ± 1.2b
c c
carotenoids and enzyme activity in fruits and foliage (Elwan
CMC, 10 ppm 26.3 ± 1.7 32.8 ± 2.1 19.9 ± 1.6b and El-Hamahmy 2009; Pérez-Balibrea et al. 2011; Pu-
c c
CMC, 50 ppm 25.6 ± 1.9 29.4 ± 3.1 13.5 ± 0.8c thusseri et al. 2012). In our previous studies, floral applica-
b c
Chitosan, 5 ppm 40.4 ± 2.1 37.1 ± 1.9 17.9 ± 1.1b tion of 0.1 mM SA and 0.1 mM MJ was found most
c b
Chitosan, 10 ppm 30.9 ± 1.5 43.3 ± 2.2 17.8 ± 1.5b beneficial for enhancement of isoflavones in soybean seeds
a b
SA, 0.1 mM 49.7 ± 3.3 46.2 ± 2.2 22.4 ± 0.6a (Saini et al. 2013a). So, in the present study, SA and MJ were
SA, 0.5 mM 28.2 ± 1.1c 39.4 ± 3.3b 16.7 ± 1.3b used in 0.1 and 0.5 mM concentrations.
MJ, 0.1 mM 44.1 ± 2.3a 52.6 ± 3.9a 21.8 ± 1.9a In the present study, expression of LCY-b was most
MJ, 0.5 mM 25.6 ± 2.7c 33.6 ± 2.1c 16.5 ± 1.4b influenced after elicitor treatment, compared to PHS and
d c
Control 17.3 ± 1.1 34.2 ± 1.7 18.1 ± 1.4b PDS, suggesting LCY-b-mediated enhancement in the
Values are mean ± SD of three replicates (mg/100 g FW). Different production of b-carotene in M. oleifera leaves. Enhanced
letters indicate statistically significant differences between the means production of a-tocopherol was also found in concomitant
(p \ 0.05) with up-regulation of c-TMT, following the application of
CMC carboxyl methyl chitosan, SA salicylic acid, MJ methyl MJ and SA. Up-regulation of CAT and APX genes,
jasmonate
obtained in the present study, may occur due to over-
production of antioxidant enzymes to de-activate the
with concordant up-regulation (2–2.7 fold) of c-TMT. Both reactive oxygen species (ROS), generated during biotic
signaling molecules (i.e. SA and MJ) and biotic elicitors and abiotic stress (Scandalios 2005). DHFR–TS plays
(chitosan and CMC) caused an increased level of important role in folate biosynthesis and functions pri-
a-tocopherol in M. oleifera leaves. In the present study, marily in mitochondria of actively dividing tissues. Up-
enhanced levels of a-tocopherol was recorded in treated regulation of DHFR–TS in the present study, suggest the
leaves, this may contribute to beneficial aspects of M. ol- enhanced activity of nucleotide synthesis and DNA
eifera leaves, as vitamin E has importance in human health, methylation in the treated leaves, compared to control.
mainly in the prevention of coronary heart disease (Ros Similarly, APX and CAT are the major ROS scavengers
2009), breast cancer (Zhang et al. 2009), and protection in the plants (Apel and Hirt 2004). APX is mainly
against nicotine induced oxidative stress in the brain (Das responsible for the fine modulation of ROS during sig-
et al. 2009). naling, whereas CAT is responsible for or the detoxifi-
Elicitors at optimum concentration are most effective for cation of ROS during biotic and abiotic stress. These
enhanced production and accumulation of phytoconstitu- antioxidants enzymes are found at high concentrations in
ents. Applied concentration of elicitor and content of elicited chloroplasts and plays role in scavenging of ROS. In the
molecule obtained generally showed a distinct bell-shaped present study, transcript level of CAT was found to
dose–response curve (Kneer et al. 1999), which means that increase sixfold compared to control, which might help in
elicitor molecules are effective at optimum concentration quenching the excessive ROS caused by abiotic stress,
while higher doses are toxic to the plants by inducing cell and this aspect can be implemented to protect to the plant
death and apoplastic oxidative stress (Mur et al. 2006). In during adverse conditions, such as salt and water stress.
general, MJ and SA are key signaling molecules, modulating Exogenous application of jasmonic acid (JA) to wheat
several physiological events such as defense response to seedlings has been recorded to significantly enhance salt
environmental stresses in plants (Singh and Gautam 2013). stress tolerance, through increasing the transcript levels
Exogenous application of SA and MJ activate a set of and activities of antioxidant enzymes (Qiu et al. 2014).
defense genes which has been shown to move systemically These observations suggested that exogenous application
through plants (Lu et al. 2006). Significant evidence showed of signaling molecules, such as JA can efficiently protect
that exogenous supply of MJ led to an increase in various plants from abiotic stress damage by enhancing activities
classes of secondary metabolites of interest in several plants of antioxidant enzymes to quench the excessive ROS.
(Modolo et al. 2002; Wei 2010; Pérez-Balibrea et al. 2011). The present study has some limitations. First, in the
As suggested by earlier reports, the use of MJ might activate present investigation, we have not quantified the enzymatic
the respective genes in the phenylpropanoid (PP) pathway activity of CAT, APX and DHFR–TS; results of such
(Dixon and Paiva 1995). Exogenous application of 25 ppm measurements would further support the concept of the
MJ (111 lM) and SA (190 lM) leads to differential regu- stimulatory effect of SA and MJ on modulation of the
lation (more than sixfold up-regulation) of carotenoid antioxidant potential of plant cells. Second, although

123
2702 Acta Physiol Plant (2014) 36:2695–2704

Fig. 4 Effect of foliar spray of Salicylic acid

methyl jasmonate and salicylic 0.82
PDS 0.86
acid on expression of CAT 0.84
catalase, APX ascorbate
1.37
peroxidase, DHFR–TS 1.90
LCY-B
bifunctional dihydrofolate 2.60*
reductase–thymidylate synthase,
PDS phytoene desaturase, PHS 1.83
phytoene synthase, LCY-b CAT 3.45*
1.10
lycopene b-cyclase, and c-TMT
c-tocopherol methyl transferase 0.98 48 hrs
TMT 2.05*
genes in leaves of M. oleifera,
1.66 24 hrs
determined by qRT-PCR.
Relative transcript abundances 1.04 6 hrs
of each gene were normalized to PHS 0.89
0.57
housekeeping genes (GAPDH
and TUA). Values are 1.38
1.72
mean ± SD. *Significant DHFR-TS
3.07*
(p \ 0.05) compared to control
0.73
APX 1.14
1.60

0.00 0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00

0.79 Methyl jasmonate

PDS 0.90
0.92

1.02
LCY-B 1.66
3.67*
0.29*
CAT 1.18
5.82*

0.64 48 hrs
TMT 1.43
2.77* 24 hrs
0.59 6 hrs
PHS 1.08
1.22
1.23
DHFR-TS 1.60
6.59*

1.00
APX 1.03
2.90*

0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00

Fold changes in mRNA abundance compared to control

significant enhancement of the content of studied phyto- Highlights

constituents was recorded in leaves upon treatments,
application of lower concentrations of elicitors and MJ and
SA might provide better insight into the mechanism of the
studied processes.
In conclusion, carotenoids (provitamin A) and tocoph-
erol (vitamin E) from M. oleifera are highly responsive for
elicitor-mediated enhancement. There is a great potential
for enhanced production of these nutritionally important
phytoconstituents using eco-friendly and non GM-based
approach for better health benefits of M. oleifera based
functional food.
• First report on elicitor-mediated enhanced production
of a-tocopherol
• Highest enhancement of a-tocopherol was seen in
salicylic acid treated leaves
• Lycopene b-cyclase-mediated enhanced production of
b-carotene in treated leaves
• Highest enhancement of lutein and b-carotene in
methyl jasmonate treated leaves
• 2.0–2.7 fold up-regulation of c-tocopherol methyl
transferase in treated leaves.

123
Acta Physiol Plant (2014) 36:2695–2704
Author contribution R.K.S. designed research, performed
the experiments, analyzed the data, and wrote the manu-
script. H.P.K.V. prepared the chitosan and derivative of
chitosan. N.P.S and P.G. supervised and designed research,
analyzed the data, and wrote the manuscript.
Acknowledgments The authors are thankful to Council of Scien-
tific and Industrial Research, New Delhi (India), for financial assis-
tance. RKS is thankful to University Grant Commission (UGC) New
Delhi, India for awarding research fellowship.
References
Anjorin TS, Ikokoh P, Okolo S (2010) Mineral composition of
Moringa oleifera leaves, pods and seeds from two regions in
Abuja, Nigeria. Int J Agric Biol 12:431–434
Anwar F, Latif S, Ashraf M, Gilani AH (2007) Moringa oleifera: a
food plant with multiple medicinal uses. Phytother Res
21:17–25. doi:10.1002/ptr.2023
Apel K, Hirt H (2004) Reactive oxygen species: metabolism,
oxidative stress and signal transduction. Annu Rev Plant Biol
55:373–399. doi:10.1146/annurev.arplant.55.031903.141701
Bennett RN, Mellon FA, Foidl N et al (2003) Profiling glucosinolates
and phenolics in vegetative and reproductive tissues of the multi-
purpose trees Moringa oleifera L. (Horseradish tree) and
Moringa stenopetala L. J Agric Food Chem 51:3546–3553
Bhaskarachary K, Rao DSS, Deosthale YG, Reddy V (1995) Carotene
content of some common and less familiar foods of plant origin.
Food Chem 54:189–193. doi:10.1016/0308-8146(95)00029-I
Chen H, Jones AD, Howe GA (2006) Constitutive activation of the
jasmonate signaling pathway enhances the production of
secondary metabolites in tomato. FEBS Lett 580:2540–2546
Ching LS, Mohamed S (2001) Alpha-tocopherol content in 62 edible
tropical plants. J Agric Food Chem 49:3101–3105
Das S, Gautam N, Dey SK et al (2009) Oxidative stress in the brain of
nicotine-induced toxicity: protective role of Andrographis pan-
iculata Nees and vitamin E. Appl Physiol Nutr Metab
34:124–135
Devi R, Arcot J, Sotheeswaran S, Ali S (2008) Folate contents of some
selected Fijian foods using tri-enzyme extraction method. Food
Chem 106:1100–1104. doi:10.1016/j.foodchem.2007.07.037
Diretto G, Tavazza R, Welsch R et al (2006) Metabolic engineering of
potato tuber carotenoids through tuber-specific silencing of
lycopene epsilon cyclase. BMC Plant Biol 6:13. doi:10.1186/
1471-2229-6-13
Dixon RA, Paiva NL (1995) Stress-induced phenylpropanoid metab-
olism. Plant Cell 7:1085
Ducreux LJ, Morris WL, Hedley PE et al (2005) Metabolic
engineering of high carotenoid potato tubers containing
enhanced levels of b-carotene and lutein. J Exp Bot 56:81–89
El-Abyad MS, El-Sayed MA, El-Shanshoury AR, El-Sabbagh SM
(1993) Towards the biological control of fungal and bacterial
diseases of tomato using antagonistic Streptomyces spp. Plant
Soil 149:185–195
Elwan MWM, El-Hamahmy MAM (2009) Improved productivity and
quality associated with salicylic acid application in greenhouse
pepper. Sci Hortic 122:521–526. doi:10.1016/j.scienta.2009.07.
001
Farmer EE, Ryan CA (1992) Octadecanoid precursors of jasmonic
acid activate the synthesis of wound-inducible proteinase
inhibitors. Plant Cell Online 4:129–134
Gao Z, Meng C, Zhang X et al (2012) Induction of salicylic acid (SA)
on transcriptional expression of eight carotenoid genes and
2703
astaxanthin accumulation in Haematococcus pluvialis. Enzym
Microb Technol 51:225–230. doi:10.1016/j.enzmictec.2012.07.
001
Hall TA (1999) BioEdit: a user-friendly biological sequence align-
ment editor and analysis program for Windows 95/98/NT.
Nucleic Acids Symp Ser 41:95–98
Harish MC, Dachinamoorthy P, Balamurugan S et al (2013)
Enhancement of a-tocopherol content through transgenic and
cell suspension culture systems in tobacco. Acta Physiol
Plant 35:1121–1130. doi:10.1007/s11738-012-1149-x
Hugueney P, Bouvier F, Badillo A et al (1996) Developmental and
stress regulation of gene expression for plastid and cytosolic
isoprenoid pathways in pepper fruits. Plant Physiol 111:619–626
Hura K, Hura T, Grzesiak M (2014) Function of the photosynthetic
apparatus of oilseed winter rape under elicitation by Phoma
lingam phytotoxins in relation to carotenoid and phenolic levels.
Acta Physiol Plant 36:295–305. doi:10.1007/s11738-013-1410-y
Jiang K, Pi Y, Hou R et al (2009) Promotion of nicotine biosynthesis
in transgenic tobacco by overexpressing allene oxide cyclase
from Hyoscyamus niger. Planta 229:1057–1063. doi:10.1007/
s00425-009-0896-4
Kim H-J, Fonseca JM, Choi J-H, Kubota C (2007) Effect of methyl
jasmonate on phenolic compounds and carotenoids of Romaine
lettuce (Lactuca sativa L.). J Agric Food Chem 55:10366–
10372. doi:10.1021/jf071927m
Kittur FS, Harish Prashanth KV, Udaya Sankar K, Tharanathan RN
(2002) Characterization of chitin, chitosan and their carboxy-
methyl derivatives by differential scanning calorimetry. Carbo-
hydr Polym 49:185–193. doi:10.1016/S0144-8617(01)00320-4
Klessig DF, Malamy J (1994) The salicylic acid signal in plants. Plant
Mol Biol 26:1439–1458
Kneer R, Poulev AA, Olesinski A, Raskin I (1999) Characterization
of the elicitor-induced biosynthesis and secretion of genistein
from roots of Lupinus luteus L. J Exp Bot 50:1553–1559. doi:10.
1093/jxb/50.339.1553
Lakshminarayana R, Raju M, Krishnakantha TP, Baskaran V (2005)
Determination of major carotenoids in a few Indian leafy
vegetables by high-performance liquid chromatography. J Agric
Food Chem 53:2838–2842. doi:10.1021/jf0481711
Lang M, Orgogozo V (2011) Identification of homologous gene
sequences by PCR with degenerate primers. Methods Mol Biol
772:245–256. doi:10.1007/978-1-61779-228-1_14
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta
C(T)) method. Methods 25:402–408. doi:10.1006/meth.2001.
1262
Lu Z-X, Gaudet D, Puchalski B et al (2006) Inducers of resistance
reduce common bunt infection in wheat seedlings while
differentially regulating defence-gene expression. Physiol Mol
Plant Pathol 67:138–148
Lu Y, Jiang P, Liu S et al (2010) Methyl jasmonate-or gibberellins
A3-induced astaxanthin accumulation is associated with up-
regulation of transcription of b-carotene ketolase genes (bkts) in
microalga Haematococcus pluvialis. Bioresour Technol
101:6468–6474
Modolo LV, Cunha FQ, Braga MR, Salgado I (2002) Nitric oxide
synthase-mediated phytoalexin accumulation in soybean cotyle-
dons in response to the Diaporthe phaseolorum f. sp. meridio-
nalis elicitor. Plant Physiol 130:1288–1297. doi:10.1104/pp.
005850
Mur LA, Kenton P, Atzorn R et al (2006) The outcomes of
concentration-specific interactions between salicylate and jasm-
onate signaling include synergy, antagonism, and oxidative
stress leading to cell death. Plant Physiol 140:249–262
Parimalan R, Mahendranath G, Giridhar P, Ravishankar GA (2011)
Abiotic elicitor-mediated augmentation of annatto pigment
123
2704
production in standing crop of Bixa orellana L. Ind J Fundam
Appl Life Sci 1:229–236
Parra-Lobato MC, Fernandez-Garcia N, Olmos E et al (2009) Methyl
jasmonate-induced antioxidant defence in root apoplast from
sunflower seedlings. Environ Exp Bot 66:9–17. doi:10.1016/j.
envexpbot.2009.01.002
Pérez AG, Sanz C, Richardson DG, Olı́as JM (1993) Methyl
jasmonate vapor promotes b-carotene synthesis and chlorophyll
degradation in Golden Delicious apple peel. J Plant Growth
Regul 12:163–167. doi:10.1007/BF00189648
Pérez-Balibrea S, Moreno DA, Garcı́a-Viguera C (2011) Improving
the phytochemical composition of broccoli sprouts by elicitation.
Food Chem 129:35–44
Potrykus I (2001) Golden rice and beyond. Plant Physiol 125:
1157–1161
Potrykus I (2003) Nutritionally enhanced rice to combat malnutrition
disorders of the poor. Nutr Rev 61:S101–S104
Prasad BCN, Gururaj HB, Kumar V et al (2006) Valine pathway is
more crucial than phenyl propanoid pathway in regulating
capsaicin biosynthesis in Capsicum frutescens Mill. J Agric Food
Chem 54:6660–6666. doi:10.1021/jf061040a
Pu G-B, Ma D-M, Chen J-L et al (2009) Salicylic acid activates
artemisinin biosynthesis in Artemisia annua L. Plant Cell Rep
28:1127–1135
Qiu Z, Guo J, Zhu A, Zhang L, Zhang M (2014) Exogenous jasmonic
acid can enhance tolerance of wheat seedlings to salt stress.
Ecotoxicol Environ Saf 104:202–208. doi:10.1016/j.ecoenv.
2014.03.014
Puthusseri B, Divya P, Lokesh V, Neelwarne B (2012) Enhancement
of folate content and its stability using food grade elicitors in
coriander (Coriandrum sativum L.). Plant Foods Hum Nutr
67:162–170. doi:10.1007/s11130-012-0285-1
Ramachandra Rao S, Ravishankar GA (2002) Plant cell cultures:
chemical factories of secondary metabolites. Biotechnol Adv
20:101–153
Rasmussen JB, Hammerschmidt R, Zook MN (1991) Systemic
induction of salicylic acid accumulation in cucumber after
inoculation with Pseudomonas syringae pv syringae. Plant
Physiol 97:1342–1347
Ros E (2009) Nuts and novel biomarkers of cardiovascular disease.
Am J Clin Nutr 89:1649S–1656S
Rosati C, Aquilani R, Dharmapuri S et al (2000) Metabolic
engineering of beta-carotene and lycopene content in tomato
fruit. Plant J 24:413–420
Sahu R, Gangopadhyay M, Dewanjee S (2013) Elicitor-induced
rosmarinic acid accumulation and secondary metabolism
enzyme activities in Solenostemon scutellarioides. Acta Physiol
Plant 35:1473–1481. doi:10.1007/s11738-012-1188-3
Saini RK, Shetty NP, Giridhar P, Ravishankar GA (2012) Rapid
in vitro regeneration method for Moringa oleifera and perfor-
mance evaluation of field grown nutritionally enriched tissue
cultured plants. 3 Biotech 2:187–192. doi:10.1007/s13205-012-
0045-9
Saini RK, Akithadevi MK, Giridhar P, Ravishankar GA (2013a)
Augmentation of major isoflavones in Glycine max L. through
123
Acta Physiol Plant (2014) 36:2695–2704
the elicitor-mediated approach. Acta Bot Croat 72 (2), 311–322.
doi:10.2478/v10184-012-0023-7
Saini RK, Saad KR, Ravishankar GA et al (2013b) Genetic diversity
of commercially grown Moringa oleifera Lam. cultivars from
India by RAPD, ISSR and cytochrome P450-based markers.
Plant Syst Evol 299:1205–1213. doi:10.1007/s00606-013-0789-
7
Saini RK, Shetty NP, Giridhar P (2014a) GC-FID/MS analysis of
fatty acids in Indian cultivars of Moringa oleifera: potential
sources of PUFA. J Am Oil Chem Soc. doi:10.1007/s11746-014-
2439-9
Saini RK, Shetty NP, Giridhar P (2014b) Carotenoid content in
vegetative and reproductive parts of commercially grown
Moringa oleifera Lam. cultivars from India by LC–APCI–MS.
Eur Food Res. doi:10.1007/s00217-014-2174-3
Saini RK, Shetty NP, Prakash M, Giridhar P (2014c) Effect of
dehydration methods on retention of carotenoids, tocopherols,
ascorbic acid and antioxidant activity in Moringa oleifera leaves
and preparation of a RTE product. J Food Sci Technol. doi:10.
1007/s13197-014-1264-3
Scandalios JG (2005) Oxidative stress: molecular perception and
transduction of signals triggering antioxidant gene defenses.
Braz J Med Biol Res 38:995–1014
Sena LP, Vanderjagt DJ, Rivera C et al (1998) Analysis of nutritional
components of eight famine foods of the Republic of Niger.
Plant Foods Hum Nutr 52:17–30
Singh PK, Gautam S (2013) Role of salicylic acid on physiological
and biochemical mechanism of salinity stress tolerance in plants.
Acta Physiol Plant 35:2345–2353. doi:10.1007/s11738-013-
1279-9
Sivanandhan G, Rajesh M, Arun M et al (2013) Effect of culture
conditions, cytokinins, methyl jasmonate and salicylic acid on
the biomass accumulation and production of withanolides in
multiple shoot culture of Withania somnifera (L.) Dunal using
liquid culture. Acta Physiol Plant 35:715–728. doi:10.1007/
s11738-012-1112-x
Wang CY, Buta JG (1994) Methyl jasmonate reduces chilling injury
in Cucurbita pepo through its regulation of abscisic acid and
polyamine levels. Environ Exp Bot 34:427–432. doi:10.1016/
0098-8472(94)90025-6
Wei S (2010) Methyl jasmonic acid induced expression pattern of
terpenoid indole alkaloid pathway genes in Catharanthus roseus
seedlings. Plant Growth Regul 61:243–251. doi:10.1007/s10725-
010-9468-7
Zhang C-X, Ho SC, Chen Y-M et al (2009) Greater vegetable and
fruit intake is associated with a lower risk of breast cancer
among Chinese women. Int J Cancer 125:181–188
Zhao J, Zhu W-H, Hu Q (2001) Enhanced catharanthine production in
Catharanthus roseus cell cultures by combined elicitor treatment
in shake flasks and bioreactors. Enzyme Microb Technol
28:673–681
Zulak KG, Cornish A, Daskalchuk TE et al (2007) Gene transcript
and metabolite profiling of elicitor-induced opium poppy cell
cultures reveals the coordinate regulation of primary and
secondary metabolism. Planta 225:1085–1106