MBG 421-Functional Genomic

Gebze Technical University
GEBZE TECHNICAL UNIVERSITY

MBG 421-Functional Genomic
CRISPR/Cas9 Design Tool

Part 1 – A: In your laboratory, you perform CRISPR/Cas9 based genome editing for X gene from
homo sapiens. ( X gene can be selected as you desire ) For this X gene:
You want to create stable knock-out cell lines from difficult-to-transfect cell types. For this purpose,
select proper plasmid vector(s) and design Oligo pairs by using Benchling design tool. Show and
describe all steps with their reasons.
1. Step:
In order to be able to process Benchling, you need to create an account first. Later, by
creating folders with the name of the assignment, the processes can be progressed regularly.
I choose the SPR gene for this process.
This gene encodes an aldo-keto reductase that catalyzes the NADPH-dependent reduction of
pteridine derivatives and is important in the biosynthesis of tetrahydrobiopterin (BH4).
Mutations in this gene result in DOPA-responsive dystonia due to sepiaterin reductase
deficiency. A pseudogene has been identified on chromosome 1. SPR (Sepiapterin
Reductase) is a Protein Coding gene. Diseases associated with SPR include Dystonia, Dopa-
Responsive, Due To Sepiapterin Reductase Deficiency and Dystonia. Among its related
pathways are eNOS activation and regulation and Metabolism. Gene Ontology (GO)
annotations related to this gene include oxidoreductase activity and aldo-keto reductase
(NADP) activity. If you click to "+" opens a list. Select Crisper Guide RNA from this list.
2. Step:
In step 2, a window appears. This window contains a field that can be written "Gene Name".
In this field, the name is written and "Homo Sapiens" is selected from the drop-down list.
GRCH38 should be selected because GRCH38 contains the most current data. The process is
saved in the created folder. Then click "Next" button to move to the next process.
3. Step:
In step 3, some parameters will be entered to design the Guide RNA. "Design Type" için
"Single Guide" seçilir. Because wild-type Cas9 has higher efficiency for single Guide RNA. A
20 nucleotide base pair is ideal for "Guide Lenght". "NGG" was chosen as the "PAM"
sequence. Protospacer adjacent motif (PAM) is a 2-6 base pair DNA sequence immediately
following the DNA sequence targeted by the Cas9 nuclease in the CRISPR bacterial adaptive
immune system. PAM is a component of the invading virus or plasmid, but is not a
component of the bacterial CRISPR locus[1].
4. Step:
In step 4 I chose 1. exon. Then I clicked "Create". In this way the system will give possible
Guide RNA sequences, the "On-target" and "Off-Target" and "PAM sequences" of these
sequences.
5. Step:
You can see the Guide RNAs created in step 5. The most important step here is to choose the best
Guide RNA. When choosing guide RNAs, we must look at both the on-target and off-target scores.
Off-target scores above 50 are considered to be good guides. On-target scores above 60 are
considered to be good guides. Use these scores to rank guides relative to each other. In this step I
chose Guide RNA which could be the highest for both scores.
6. Step:
Guide RNA I selected in step 6 is shown in the DNA sequence. Then click on the "Assemble" option.
But most important is off target because if RNA bing wrong place all experiment will be wrong. I
choose the 64.9 on target and 97.5 off target position. PAM sequence is AGG.
7. Step:
A vector type should be selected in step 7. I chose the "LentiCrisperV2" vector. lentiviral vectors in
gene therapy is a method by which genes can be inserted, modified, or deleted in organisms using
lentivirus. Lentivirus are a family of viruses that are responsible for notable diseases like HIV, which
infect by inserting DNA into their host cells' genome. For Assembly Method, "Type IIS Cloning" is
selected. The "Insertion Region" was selected between 2857 and 4737. Then click "Next".
8. Step:
Guide Sequence is specified in step 8. Then click "Assemble". The program showed me all oligo 1 and
oligo 2 primers. Also show the vector with cut point. In the reaction, Oligo 1 and oligo 2 align and
anneal and analize the direct target in the cell. This oligos are forward and reverse primers but this is
not a classic PCR. This is a insertion reaction. We want to create a Guide RNA for CRISPR.
9. Step:
In step 9, we can see the vector designed.
10. Step:
Guide RNA Sequence CCTTAGCGCCCGCAACGACG

Oligo 1 Sequence CACCGCCTTAGCGCCCGCAACGACG
Oligo 2 Sequence aaacCGTCGTTGCGGGCGCTAAGGC
Sequences, lengths, GC content, melting temperatures of the oligos formed in step 10 are indicated.
Thus, SPR gene is mutated.
The GC-content (or guanine-cytosine content) is the percentage of nitrogenous bases on a DNA or
RNA molecule that are either guanine or cytosine. This may refer to a certain fragment of DNA or
RNA, or that of the whole genome. When it refers to a fragment of the genetic material, it may
denote the GC-content of section of a gene (domain), single gene, group of genes, or even a non-
coding region.
The melting temperature of DNA refers to the temperature at which 50% of DNA in a sample has
denatured from double-stranded DNA (dsDNA) to single-stranded DNA (ssDNA). Sensitive
measurement of the melting curve of a sample of DNA can be used to detect single nucleotide
differences between two DNA samples. This technique is possible because guanine-cytosine (GC)
pairs contribute greater stability to dsDNA than adenosine-thymine (AT) pairs.
Part 1 – B: In your laboratory, you perform CRISPR/Cas9 based genome editing for X
gene from homo sapiens. ( X gene can be selected as you desire ) For this X gene:
You want to perform transient functional domain inactive random mutant study. For this
purpose, select proper plasmid vector(s) and design Oligo pairs by using Benchling design
tool. Show and describe all steps with their reasons.
1. Step:
I chose the BRCC3 gene for this section. Metalloprotease that specifically cleaves 'Lys-63'-linked
polyubiquitin chains. Does not have activity toward 'Lys-48'-linked polyubiquitin chains. Component
of the BRCA1-A complex, a complex that specifically recognizes 'Lys-63'-linked ubiquitinated histones
H2A and H2AX at DNA lesions sites, leading to target the BRCA1-BARD1 heterodimer to sites of DNA
damage at double-strand breaks (DSBs). In the BRCA1-A complex, it specifically removes 'Lys-63'-
linked ubiquitin on histones H2A and H2AX, antagonizing the RNF8-dependent ubiquitination at
double-strand breaks (DSBs). Catalytic subunit of the BRISC complex, a multiprotein complex that
specifically cleaves 'Lys-63'-linked ubiquitin in various substrates. Mediates the specific 'Lys-63'-
specific deubiquitination associated with the COP9 signalosome complex (CSN), via the interaction of
the BRISC complex with the CSN complex. The BRISC complex is required for normal mitotic spindle
assembly and microtubule attachment to kinetochores via its role in deubiquitinating NUMA1. Plays
a role in interferon signaling via its role in the deubiquitination of the interferon receptor IFNAR1;
deubiquitination increases IFNAR1 activity by enhancing its stability and cell surface expression.
Down-regulates the response to bacterial lipopolysaccharide (LPS) via its role in IFNAR1
deubiquitination. Firstly, I looked through UniProtKB to look at the domains of this gene, and I have
seen that this gene has only one domain and this domain is located between 12-179. Therefore, it is
necessary to carry out mutations in the respective domains in these position ranges.
2. Step:
Later, by creating folders with the name of the assignment, the processes can be progressed
regularly.
3. Step:
In step 3, a window appears. This window contains a field that can be written "Gene Name". In this
field, the name is written and "Homo Sapiens" is selected from the drop-down list. GRCH38 should be
selected because GRCH38 contains the most current data. The process is saved in the created folder.
Then click "Next" button to move to the next process.
4. Step:
Therefore mentioned domain positions are included in the 1st exon of the BRCC3 gene. So I randomly
added a random sequence into the exon. This way the domain will not be able to do its job. The "CTA
sequence" was added to the labeled site and the complementary sequence was also arranged.
5. Step:
sequence. Then, click to “Finish”.
6. Step:
In step 6, click to “Regenerate Analysis” for selected area.
7. Step:
In step 7, I clicked to "Create". In this way the system will give possible Guide RNA
sequences, the "On-target" and "Off-Target" and "PAM sequences" of these sequences for
target region.
8. Step:
Guide RNA I selected in step 8 is shown in the DNA sequence. But most important is off target
because if RNA bing wrong place all experiment will be wrong. I choose the 67.2 on target and 94.8
off target position. PAM sequence is GGG.
9. Step:
Then click on the "Assemble" option.
10. Step:
I choose also vector for the insertion of this region. I choose wild type vector PX459(WT-2A-PURO.
62988)because I will create a mutant. It show me restriction enzyme as Bbsl. I can change the
enzyme side but ı remain the enzyme as default. Guide RNA insert 250-267 position in the vector.
11. Step:
I see Guide RNA sequence of interested domain in the vector. Then click "Assemble". The program
showed me all oligo 1 and oligo 2 primers. Also show the vector with cut point. In the reaction, Oligo
1 and oligo 2 align and anneal and analize the direct target in the cell . This oligos are forward and
reverse primers but this is not a classic PCR. This is a insertion reaction. We want to create a Guide
RNA for CRISPR.
12. Step:
In step 12, I have a Guide RNA for knock out in the PX459(WT-2A-PURO. 62988) wild type plasmid.
13. Step:
Guide Sequence CCTTAGCGCCCGCAACGACG

Oligo 1 CACCGCTTTACATAGCTCTGTCGCG
Oligo 2 aaacCGCGACAGAGCTATGTAAAGC
Sequences, lengths, GC content, melting points of the oligos formed in step 10 are indicated.
MPN+ domain-containing proteins are classified as metalloenzymes responsible for
isopeptidase activity. These proteins contain a conserved glutamate (E) and a JAMM
(Jab1/MPN/Mov34 metalloenzyme) motif, typically consisting of a canonical sequence (H-x-
H-x[7]-S-x[2]-D) and coordinating a zinc ion. MPN- domains are recognizable by the absence
of essential Zn(2+)- coordinating residues that are required for catalytic function. In protein
complexes, an MPN+ domain can associate with MPN- domains for purposes that are not
well understood[2]. Thus, the domain is mutated randomly. A protein domain is a conserved
part of a given protein sequence and tertiary structure that can evolve, function, and exist
independently of the rest of the protein chain. That's why, I choose domain of BRCC3 gene.
Part 1 – B - BONUS: In your laboratory, you perform CRISPR/Cas9 based genome editing
for X gene from homo sapiens. ( X gene can be selected as you desire ) For this X gene:
You want to perform transient functional domain inactive random mutant study. For this
purpose, select proper plasmid vector(s) and design Oligo pairs by using Benchling design
tool. Show and describe all steps with their reasons. Perfom this study with HDR based
precise editing.
1. Step:
In step 1, by creating folders with the name of the assignment, the processes can be progressed
regularly. Then, I choose “+” for creating Crisper Guides and HR Template.
2. Step:
In step 2, a window appears. This window contains a field that can be written "Gene Name". In this
field, the name is written and "Homo Sapiens" is selected from the drop-down list. GRCH38 should be
selected because GRCH38 contains the most current data. The process is saved in the created folder.
Then click "Next" button to move to the next process.
3. Step:
sequence. Then, click to “Finish”.
4. Step:
In step 4, I chose 1. exon. Then I clicked "Create". In this way the system will give possible
Guide RNA sequences, the "On-target" and "Off-Target" and "PAM sequences" of these
sequences.
5. Step:
You can see the Guide RNAs created in step 5. The most important step here is to choose the best
Guide RNA. When choosing guide RNAs, we must look at both the on-target and off-target scores.
Off-target scores above 50 are considered to be good guides. On-target scores above 60 are
considered to be good guides. Use these scores to rank guides relative to each other. In this step I
chose Guide RNA which could be the highest for both scores.
6. Step:
Guide RNA I selected in step 6 is shown in the DNA sequence. Then click on the "Assemble" option.
But most important is off target because if RNA bing wrong place all experiment will be wrong. I
choose the 75.9 on target and 80.4 off target position. PAM sequence is AGG. Then, click on the
"Crisper" icon in the field indicated by 1 and click on the "Design HR Template" button.
7. Step:
In step 7, Genome and PAM informations are selected as default and “Create a copy this sequence”
buton is clicked. Then, “Create” button must be selected.
8. Step:
In step 8, I choose random DNA sequence and clicked to right on selected area. Then, I selected
“Insert Bases” because of I will make mutant this area.
9. Step:
So I randomly added a random sequence into the exon 1. This way the exon 1 will not be able to do
its job. The "CCC sequence" was added to the labeled site and the complementary sequence was also
arranged. Then, I clicked to “ENTER” button.
10. Step:
In step 10, the changing DNA sequence is visualised as P protein. In Knock-in Edits, we can see
inserted CCC location at 155071618. Then, I clicked to “Next” button.
11. Step:
In step 11, we can see template, left arm and right arm lenghts. Then, clicked to “Next” button.
12. Step:
In step 12, the Guide Sequence must be added to specified area for Guide Sequence. This figure
shows wild type sequences and mutant sequence. “TTT” sequence is a mutant but the other
sequences are wilt type. And, bases included to complete triplets are colored grey and the PAM site
is colored blue. In “Final” region, we can see created mutated DNA sequence. Also, we can choose
mutation site from other wild type sequence. Then, I clicked to “Next” button.
13. Step:
In step 13, we can see “Template Range”, “Guide Sequence” and “Original and Mutated Sequence”.
Guide Sequence is GAGCGTGGTTGAGACAAACG. Also, TTC site of original target sequence is changed
as TTT site.
Homology directed repair (HDR) is a mechanism in cells to repair double strand DNA lesions. The
most common form of HDR is homologous recombination. The HDR mechanism can only be used by
the cell when there is a homologue piece of DNA present in the nucleus, mostly in G2 and S phase of
the cell cycle. Other examples of homology-directed repair include single-strand annealing and
breakage-induced replication. When the homologue DNA piece is absent, another process called
non-homologous end joining (NHEJ) can take place instead.
HDR is important for suppressing the formation of cancer. HDR maintains genomic stability by
repairing broken DNA strands; it is assumed to be error free because of the use of a template. When
a double strand DNA lesion is repaired by NHEJ there is no validating DNA template present so it may
result in a novel DNA strand formation with loss of information. A different nucleotide sequence in
the DNA strand results in a different protein expressed in the cell. This protein error may cause
processes in the cell to fail. For example, a receptor of the cell that can receive a signal to stop
dividing may malfunction, so the cell ignores the signal and keeps dividing and can form a cancer. The
importance of HDR can be seen from the fact that the mechanism is conserved throughout evolution.
The HDR mechanism has also been found in more simple organisms, such as yeast[3].
Differential Gene Expression

Part 2: Perform a differential expression analysis by using GenePattern server. For this purpose,
find proper datasets from literature studies. Please prepare this part of homework within the proper
format:
Abstract: Include basic informations and general purpose of selected study.
Methods: Show and describe all steps with their reasons.
Result & Discussion: Show the results and select one up regulated and one down regulated gene.
Discuss these genes based on study and literature information.
Reference: Include using reference informations.
ABSTRACT
In the classical view of gene regulation and functional genomics, DNA sequence motifs dictate
the specific binding of transcriptional regulatory proteins, either activators or repressors, and
these bound regulators activate or repress the expression of the corresponding structural gene.
This paradigm has been the basis for interpreting numerous experiments over the past three
decades, but the relationships between DNA sequence motif, protein binding in vivo, and
transcriptional activity have rarely been examined in an unbiased manner. The combination of
chromatin immunoprecipitation (ChIP) and high-density, tiled microarrays covering entire
genomes (or mechanistically unbiased portions such as whole chromosomes) makes it possible
to map transcription-factor binding sites in an unbiased fashion. Using tiled microarrays
covering the entire human genome, they identify ∼5800 target sites for p63, a p53 homolog
essential for stratified epithelial development. p63 targets are enriched for genes involved in cell
adhesion, proliferation, death, and signaling pathways. The quality of the derived DNA sequence
motif for p63 targets correlates with binding strength binding in vivo, but only a small minority
of motifs in the genome is bound by p63. Conversely, many p63 targets have motif scores
expected for random genomic regions. Thus, p63 binding in vivo is highly selective and often
requires additional factors beyond the simple protein-DNA interaction. There is a significant, but
complex, relationship between p63 target sites and p63-responsive genes, with ΔNp63 isoforms
being linked to transcriptional activation. Many p63 binding regions are evolutionarily
conserved and/or associated with sequence motifs for other transcription factors, suggesting
that a substantial portion of p63 sites is biologically relevant[4].
METHODS
1. Step: In step 1, I used to Gene
Expression Omnibus(GEO) for
datasets of articles. This
database is very useful because
several datasets of areas of
scientific articles are found and
it is user friendly. I examined
cancer datasets and found "
Relationships between p63
binding, DNA sequence,
transcription activity, and
biological function in human
cells" article.
2. Step:
In step 2, I looked over samples of this article because sometimes samples of articles can be so
complex and GenePattern processes can be slow. This article has six samples and these samples are
suitable for my studies. I used GEO accession number of this article and it is GSE5993.
3. Step:
In step 3, I entered to GenePattern web site and registered to this web site. I clicked to “Use
GenePattern” button.
4. Step:
In step 4, I clicked to “Modules” button and a text-box is opened. I wrote “GEOImporter” in this text-
box.
5. Step:
In step 5, module of GEOImporter is opened and I wrote GEO accession number in text-box. Then, I
clicked to “Run” button. I used this module because this module convert samples from dataset to .gct
file. The GenePattern can use only .res, .gct or .cls file types.
6. Step:
In step 6, the GEOImporter module created from GSE5993 accession number to GSE5993.gct file. We
must download this file because if we drag file, the web site can give a error message and does not
make operations. Normally, this file is used to PreprocessDataset module and this module clear
background noises but I did not use this model.
7. Step:
In step 7, I clicked to “Modules” button and a text-box is opened. I wrote “ClsFileCreator” in this text-
box and I clicked to ClsFileCreator module. All analysis modules read and write data using standard
GenePattern file formats, which are tab-delimited or comma-delimited text files. That’s why, we
must careful for true file formats. The ClsFileCreator module convert to .cls file format from .gct file
format.
8. Step:
In step 8, GSE5993.gct is uploaded to input file area. Then, “Run” button must be clicked.
9. Step:
In step 9, this figure shows you samples name of article. These samples consists two class. First class
is control class and second class is p63shRNA. This page helps to select samples for Cls file and we
can select that want to samples. Then, I clicked to “Next” button.
10. Step:
In step 10, we can select required classes. I select two class because my article samples have two
different name. This step is important because these classes are used for comparison of results.
Then, I clicked to “Next” button.
11. Step:
In figure 11, first class is control class and second class is p63shRNA. Then, I clicked to “Next” button.
12. Step:
In step 12, GSM139217,GSM139218, GSM139219 samples are first class so they are control group.
Bi-directional arrows are used for sample selection. Then, I clicked to “Next” button.
13. Step:
In step 13, GSM139220, GSM139221, GSM139222 samples are second class so they are p63shRNA
group. Bi-directional arrows are used for sample selection. Then, I clicked to “Next” button.
14. Step:
In step 14, we can see selected samples according to classes. If this area is true, we can click to
“Next” button but if this area is not true, our .cls file does not created and this process must
repeated.
15. Step:
In step 15, we must download this file because if we drag file, the web site can give a error message
and does not make operations. Then, we must click to “Save” button. Thus, .cls extentions file is
downloaded to our computer. We must open this file with notepad because file can be wrongly
converted. If this file consists only zero numbers, this file is wrongly converted. If this file consist zero
and one numbers, this file is truly converted and this file is used for another processes.
16. Step:
In step 16, I clicked to “Modules” button and a text-box is opened. I wrote

“ComparativeMarkerSelection” in this text-box and I clicked to ComparativeMarkerSelection module.
ComparativeMarkerSelection analysis must be made to find the genes in the dataset that are most
closely correlated with the two phenotypes in the dataset.
17. Step:
In step 17, I uploaded GSE5993.gct file to input file area and GSE5993.cls file to cls file area. Then, I
clicked to “Run”.
18. Step:
In step 18, ComparativeMarkerSelection module completed process and produced

GSE5993.comp.marker.odf file. I clicked to “Save File” for download this file.
19. Step:
In step 19, I clicked to “Modules” button and a text-box is opened. I wrote “ComparativeMarker
SelectionViewer” in this text-box and I clicked to ComparativeMarkerSelectionViewer module. After
running the ComparativeMarkerSelection analysis, ComparativeMarkerSelectionViewer is run to
examine the analysis results.
20. Step:
In step 20, I uploaded GSE5993.comp.marker.odf file to comparative marker selection filename area
and GSE5993.gct file to dataset filename area. Then, I clicked to “Run”.
21. Step:
In step 21, the results of ComparativeMarkerSelectionViewer module is showed. This result page has
two color and tones of these colors. The red color and its tones specified for samples of control class.
The blue color and its tones specified for samples of p63shRNA class. Also, we can see several
statistically calculation such as t-test, fold change etc.
22. Step:
In step 22, we can see upregulated features of contol and p63shRNA classes. The red color
represents upregulated features of control class and the blue color represent upregulated features of
p63shRNA class. But upregulation of samples of p63shRNA class increase down. That’s why, we can
say samples of p63shRNA class are downregulated according to control class.
23. Step:
In step 23, I clicked to “Modules” button and a text-box is opened. I wrote “ExtractMarker
SelectionResults” in this text-box and I clicked to ExtractMarkerSelectionResults module. I have
examined the ComparativeMarkerSelection analysis results, I want to create a new dataset that
contains only the most promising marker genes from the results file for further analysis. That's why, I
used ExtractMarkerSelectionResults module.
24. Step:
In step 24, I uploaded GSE5993.comp.marker.odf file (The results from ComparativeMarkerSelection

module) to comparative marker selection filename area and GSE5993.gct file to dataset filename
area. Then, I clicked to “Run” button.
25. Step:
In step 25, we can see the results of ExtractComparativeMarkerResults module. The two files are
created but I only used to GSE5993.comp.marker.filt.gct file in my study.
26. Step:
In step 26, clicked to “Modules” button and a text-box is opened. I wrote “HeatMapViewer” in this
text-box and I clicked to HeatMapViewer module. The HeatMapViewer displays expression values in
a color-coded heat map. The largest expression values are displayed in red (hot) and the smallest
values are displayed in blue (cool). Intermediate values are displayed in different shades of red and
blue. The color-coding provides a quick coherent view of gene expression levels[5]. According to this
tutorial informatin, I analysed HeatMap.
27. Step:
In step 27, I uploaded GSE5993.comp.marker.filt.gct file to dataset. Then, I clicked to “Run” button.
28. Step:
In step 28, we can see the results of HeatMapViewer. Then, I saved this file and used for other
analysis tool.
RESULTS AND DISCUSSION
Differential expression analysis means taking the normalised read count data and performing
statistical analysis to discover quantitative changes in expression levels between experimental
groups. For example, we use statistical testing to decide whether, for a given gene, an observed
difference in read counts is significant, that is, whether it is greater than what would be expected just
due to natural random variation.
29. Step:
In step 29, we can see dark

red area, dark blue area and
the tones of red and blue
colors. There is largest
expression levels in the dark
red area but this situation is
different for the dark blue
color. The dark blue color
shows lowest expression
levels. Other mid-tones show
the differantiation of
expression levels.
30. Step:
In step 30, I choose two upregulated samples and copied to g: Profiler web site.
31. Step:
In step 31, I pasted selected samples to Query area and choose options according to article. Then, I
clicked to the “Run query” button.
32. Step:
In step 32, we can see results of this process. According to the this results, 229050_S_AT is novel
transcript similar to small nucleolar RNA host gene 7 and 1552496_A_AT is cordon-bleu WH2 repeat
protein.
33. Step:
In step 33, I choose two downregulated samples and copied to g: Profiler web site.
34. Step:
In step 34, I pasted selected samples to Query area and choose options according to article. Then, I
clicked to the “Run query” button.
35. Step:
In step 35, we can see results of this process. According to the this results, 202422_S_AT is acyl-Coa
synthetase long chain family member 4 and 233669_S_AT is tripartitate motif containing 54.
REFERENCES
[1] https://en.wikipedia.org/wiki/Protospacer_adjacent_motif
[2] https://prosite.expasy.org/rule/PRU01182
[3]http://www.wikizero.biz/index.php?
q=aHR0cHM6Ly9lbi53aWtpcGVkaWEub3JnL3dpa2kvSG9tb2xvZ3lfZGlyZWN0ZWRfcmVwYWly
[4] Yang A, Zhu Z, Kapranov P, McKeon F et al. Relationships between p63 binding, DNA
sequence, transcription activity, and biological function in human cells. Mol Cell 2006 Nov
17;24(4):593-602.
[5] https://software.broadinstitute.org/cancer/software/genepattern/tutorial

MBG 421-Functional Genomic

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

MBG 421-Functional Genomic

Uploaded by

Copyright:

Available Formats

Gebze Technical University

GEBZE TECHNICAL UNIVERSITY

CRISPR/Cas9 Design Tool

Guide RNA Sequence CCTTAGCGCCCGCAACGACG

In step 6, click to “Regenerate Analysis” for selected area.

Then click on the "Assemble" option.

Guide Sequence CCTTAGCGCCCGCAACGACG

Differential Gene Expression

In step 16, I clicked to “Modules” button and a text-box is opened. I wrote

In step 18, ComparativeMarkerSelection module completed process and produced

In step 24, I uploaded GSE5993.comp.marker.odf file (The results from ComparativeMarkerSelection

RESULTS AND DISCUSSION

In step 29, we can see dark

You might also like