THEJOURNAL OF BIOLOGICAL CHEMISTRY Vol. 266, No. 27, Issue of September 25, pp.

18268-16275,1991
IC:! 1991 by The American Society for Biochemistry and Molecular Biology, Inc Printed in U.S.A.

Identification of a Glucocorticoid Response Element Contributing to

the Constitutive Expression ofthe Rat Liver a,-Inhibitor I11 Gene*
(Received for publication, December 24, 1990)

Lawrence J. Abraham$, Amy D. BradshawQ, Wolfgang Northemannn,and Georg H. Fey11

From the Department of Immunology, Research Institute of Scripps Clinic, La Jolla, California
92037

al-Inhibitor I11 (a113),a broad range plasma protein- treated and dexamethasone-treatedFAZA cells, simi-
ase inhibitor,is synthesized with striking tissue spec- lar extentsof a113promoter upstream sequences were
ificity in rat livers. The gene is expressed strongly in protected, indicating that proteins capable of binding
periportal hepatocytesof healthy adults and less abun- in the glucocorticoid response-mediating element
dantly in regions near the centrilobular vein. This (GME) region were present before andafter arrival of
expression pattern is suggestive of a concentration the hormonal signal. However,a purified recombinant
gradient of a blood-borne hormonethat enters through fragment of the GR which contained essentially only
the portal vein and diffuses across lobe the toward the its DNA binding domain was unable to at bindtheGME
centrilobular vein. The a113 gene was known to be although it interacted strongly witha consensus GRE
regulated both by glucocorticoids and interleukin 6, sequence.
and therefore the hypothesis was tested that the normal
constitutive expression of this gene depended on glu-
cocorticoids. al13 mRNA levels in the livers of hy-
pophysectomized rats with low endogenous glucocor- al-inhibitor I11 (al13),’like many of the acute phase pro-
ticoid levels were only about 20% of those in control teins, is a broad range proteinase inhibitor. It is the second
r a t livers. Injection of exogenous glucocorticoids re- most abundant plasmaglobulin in rats witha plasma concen-
constituted hepatic al13 mRNA levels up to 64% of tration in the range of6-10 mg/ml. a113 belongs to the a-
their original values aindose-dependent manner. Sim- macroglobulinfamily of thiolester proteins which also in-
ilarly, treatmentof FAZA rat hepatoma cells with the cludes al-macroglobulin, a,-macroglobulin, and the comple-
synthetic glucocorticoid dexamethasone induced u113
ment components C3, C4 and C5 (1-3). Unlike a,-macroglob-
mRNA levels in a dose-dependent manner. Taken to-
ulin, which is strongly induced, and al-macroglobulin,which
gether these data suggested that glucocorticoids are
required for the constitutive high level expressionof is affected onlyvery little by acute inflammations, a113 is
this gene in normal adult rat livers. A series of 5’ strongly down-regulated duringan acute phase inflammatory
deletion constructs and linker scanning mutants of the response (4): during the first 2 days after an inflammation
promoter upstream region were produced and trans- al13 plasma concentrations fall to 1-2 mg/ml. It is the most
fectedinto FAZA cells. A functional glucocorticoid strongly down-regulated “negativeacutephaseprotein”
response element was mapped between-168 and -151 known to date in rat plasma. In previous studies a113 cDNA
base pairs 5’ of the transcription start site. This ele- clones were isolated and characterized and used show to that
ment conforms with an inverted consensus glucocorti- al13 mRNA levels decreased during an inflammation to an
coid response element (GRE) but differs in two posi- extent similar to that seenfor al13 plasma levels (5-7). The
tions essential for protein DNA interaction between transcription rate of the al13 gene was decreased 12.7-fold at
the GRE and the glucocorticoid receptor (GR). The 6h afteranexperimentally induced inflammation witha
induction of a113 gene promoter region constructs by concomitant 16-fold decrease in nuclear aJ3 precursor RNA
dexamethasone was abolished by the receptor antago- concentrations (8).
nist RU486, indicating that the GR participated in the Recently we have analyzed the inflammatory signals that
activation of the al13 gene. In DNase I footprinting are responsible for the acute phasenegative regulation of the
experiments with nuclear protein extracts from un- al13 gene in rat hepatomacell lines (9). In that studywe have
established that interleukin 6 and glucocorticoids can regulate
* This work was supported by Grants A122166 and A123351 from the al13 gene both in a positive and in a negative direction,
the National Institutes of Health (to G. H. F.) and by International depending on the precise concentrations of both hormones.
Fellowship 1F05TW04073-01fromtheFogartyCenter,National
Institutes of Health (toL. J. A,). This is publication
6641-1“ from
We have also identified recently the transcriptional control
the Departmentof Immunology, Research Instituteof Scripps Clinic. elements in the 5’ region of the al13 gene which are respon-
The costs of publication of this article were defrayed in part by the sible for the highly tissue-specific expression seenin ratlivers
payment of pagecharges. Thisarticlemusttherefore be hereby and have begun to characterize the hepatic nuclear factors
marked “aduertisement” in accordance with 18 U.S.C. Section 1734 that bind to these elements (10).
solely to indicate this fact. There is evidence for lobular heterogeneity of hepatocytes,
$Presentaddress:Dept. of ClinicalImmunology,Royal Perth showing systematic differences in the expression of plasma
Hospital, Wellington St., Perth, Australia,6001.
Presentaddress: University of California, Santa Barbara, CA proteins depending on their topographic location in theliver
93163-9963.
1 Presentaddress:Elias,EntwicklungslaborfurImmunoassays The abbreviations used are: ul13, ul-inhibitor 111; GR, glucocor-
GmbH, Obere Hardtstrasse 18, D7800 Freiburg, Germany. ticoid receptor; GRE, glucocorticoid response element; GME, gluco-
11 To whom correspondence should be addressed: Research Institute corticoid response-mediating element; bp, base pairs; AGP, acid gly-
of Scripps Clinic, 10666 N. Torrey Pines Rd., La Jolla, CA 92037. coprotein; LAP, liver activator protein; HBS, Hepes-buffered saline;
Tel.: 619-554-8059; Fax: 619-554-6705. EGTA, [ethylenebis(oxyethylenenitrilo)]tetraaceticacid.

18268
 Variant Glucocorticoid Response Element of the a113Gene 18269
lobule(11, 12). For example, in normal adult rat liversa detected after electrophoresis through a denaturing polyacrylamide
higher frequency of expression of a113 mRNA and protein gel and autoradiography.
FAZA Hepatoma Cell Culture andTransfection-The rat hepatoma
was observed in hepatocytes of the periportal and mediolob- cell line, FAZA (22), and stably transfected derivatives were grown
ular areas than in the perivenous zones (11). One possible in a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's
interpretation of these datawas that various hormones enter- F-12 nutrient solution (GIBCO).Media were supplemented with 10%
ing the liver through the portal vein could create a hormone fetal bovine serum 100 units/ml penicillin and streptomycin. Cells
concentration gradient across the lobe which is reflected in were cultured in 100-mm dishes in an atmosphere of 5% CO, at 37 "C.
For dexamethasone (Upjohn) and RU486 (Roussel Uclaf) treatment,
the gradient of a113 RNA and protein concentrations. We cells were grown to 90% confluence (approximately 5 X 10" cells/100-
knew that glucocorticoids are present in the systemic circu- mm Petri dish) and supplemented with hormone.
lation of normalhealthyadultratsintheabsence of an Transfection was carriedout by amodifiedcalcium phosphate
inflammatory state in concentrationsof approximately precipitation technique (23). Plasmid DNA to be used fortransfection
IO-' M (13) and that expression of a113 in cultured hepatic was isolated using an alkaline lysis procedure (24) and purified by
cells was sensitive to low levels of glucocorticoids (less than twosuccessivecesium chloride equilibrium centrifugation steps.
FAZA cells were plated to be 60% confluent after overnight incuba-
10"" M (9)). Therefore, we wanted to test the hypothesis thattion. Prior to transfection the cells were washed three times with
glucocorticoids may be the principal hormones responsible for Hepes-buffered saline (HBS; 10 mM Hepes, pH 7.3,6.7 mM potassium
the maintenance of the normal constitutive expressionlevels chloride, 142 mM sodium chloride). The DNA precipitate was formed
of al13 in adult rat liver tissue. by dropwise addition of 250 mM calcium chloride to an HBS solution
Here we demonstrate that the al13 gene was regulated by containing 7.5 mM Na2HP0, and 20 pg/ml test plasmid DNA plus 1
glucocorticoids at the transcriptional level through a response pg/ml pRSVCAT (25). After incubation in fresh medium for 1 h the
cells were incubated for 6 h with the precipitate. Thecells were then
element that was a variant of the consensus glucocorticoid shocked with 25% glycerol (in HBS) for 2 min, washed three times
response element (GRE) found in many other genes regulated withHBS,andincubatedinfreshmedium for 40 h. Transient
by glucocorticoids (14-16). This elementdiffered from a con- transfectants were then assayed for luciferase activity. Stable trans-
ventional GRE in thatwas it not sufficient to binda truncated fectants were split 1:l andgrown in the presenceof 400 pg/ml '2418
recombinant glucocorticoid receptor (GR) fragment that con-(GIBCO) for 3 weeks with a change of medium every 5 days. Pools of
tained essentially only the DNA binding domain (17). The approximately 500 stable G418-resistant cloneswere mixed, replated,
and passaged for 2 weeks.
element foundin the al13gene partially overlapped with other Luciferase assays were performedas described(21,27).After
elements important for the liver-specific expression of this transfection, cell extracts were prepared as follows. After washing
gene which were mapped previously (10). Therefore, binding three times with HBS, the cells were scraped off the dish into 100
of the GR at this variant element may require additional mM potassium phosphate, p H 7.2, 1 mM dithiothreitol, washed, and
contacts with other DNA-binding proteins attachedneigh- to subjected to three freeze-thaw cycles. After lysis and removal of the
cell debris by centrifugation, constant amounts of protein (120 pg)
boring sites. The results alsosuggest that glucocorticoids are were assayed for luciferaseactivity using a Monolight2001 luminome-
indeed required for the constitutive expression of the al13 ter (Analytical LuminescenceLaboratories,San Diego, CA).The
gene in normal healthy adult ratlivers. relative efficiency of transfection in each experimentwas monitored
by assaying for the production of constant amounts of chloramphen-
MATERIALSANDMETHODS icol acetyltransferase (26) generated by the cotransfected pRSVCAT
Treatment of Animals and Preparation of RNA-Normal and hy- construct.
pophysectomizedmale Fisher 344 rats, weighing 125-150 g, were a1Z3Luciferase Fusion Genes-A nested setof 5' deletions contain-
obtained from Charles River Laboratories. After surgery,animals ing al13 promoter fragments extending from -2214 bp to + 58, which
were allowed to recover for a t least 6 weeks. Only rats that showed had been introduced into the transcriptionvector, pl9LUC (27),was
no increase in their body weight and the absenceof testicular devel- availablefromaprevious study(10).Thisconstruction produced
opment were used. When required, hypophysectomized animals were fusion genes consisting of the 5'-noncoding sequences of the rvl13
injected intraperitoneally with the indicated concentrations of dexa- gene linked to the coding region of the firefly luciferase gene.
methasone in 0.5 ml of phosphate-buffered saline. Control animals Nuclear Extract Preparation-FAZA nuclear extracts were pre-
wereinjected with 0.5 ml of phosphate-bufferedsaline.Afterthe pared from tissue culturecells that hadreached 90% confluence. The
appropriate time interval rats were killed and the liver removed for cells were detached from the dishes using trypsin EDTA, and extracts
were prepared according to the method of Shapiro et al. (28) and
RNA preparation. Three animalswere used per data point.
RNA Preparation, Dot-blot Hybridization, and PrimerExtension- dialyzed against 20 mM Hepes, pH 7.9,20% glycerol (v/v), 0.2 mM
EDTA, 2 mM EGTA, 2 mM dithiothreitol, 60 mM potassium chloride.
Total RNA was prepared from both normal and hypophysectomized
After dialysis, the extracts were stored in liquid Nr until needed.
rat livers using a guanidinium hydrochloride procedure as described
DNase Z Footprinting and Gel Retardation Assays-DNase I foot-
previously (18). RNA was isolat,ed from cultured cell lines using a
printreactions(29) were carriedoutwithunfractionated nuclear
guanidlnium thiocyanate lysis procedure followed by ultracentrifu-
extracts. The -225 to -81 fragment from the aI13 promoter region
gation through a cesium chloride step gradient (19). The concentra- was isolated, end labeled with the Klenow fragment of DNA polym-
tion of the RNA was determined by measuring the absorptiona t 260 erase I, and thenrecleaved with either Ssp1 or EcoRI followed by gel
and 280 nm. Both the integrity and the relative concentrations of the purification. Theglucocorticoid response element containing pGTCO
RNA samples were monitored by electrophoresis in formaldehyde- plasmid2 was preparedsimilarlyafter cleavage with Hind111 and
agarose gels and ethidium bromide staining. EcoRI. The labeled probe fragments (1 ng) were then incubated in
0113mRNA levels were quantitated by dot-blot hybridization. RNA 20-pl reaction volumes containing 4 pg of poly(d1-dC) and either 50
was fixed to nylon (Genescreen)membranes by UV irradiation. pg of nuclear extract or 21 pg of T7X556, a purified glucocorticoid
Filters were then hybridized with cDNA probes for rat al13that had receptor fragment containing theDNA binding domain (17). Control
been :',P labeled (5). In addition, duplicate series
of dots were probed reactions contained40 pg of bovine serum albumin(molecular biology
with a :',P-labeled ribosomal cDNA probe to monitor for constant grade, Boehringer Mannheim) in20 mM Hepes, pH 7.9,20% glycerol,
RNA loading (20). RNA was quantitated by liquid scintillation count- 0.2 mM EDTA, 2 mM EGTA, 2 mM dithiothreitol, 60 mM potassium
ing of individual dots. chloride. After a 10-min incubation on ice and 40 min a t 22 "C, 20 p1
Luciferase mRNA was identifiedby primerextensionusing a of20 mM magnesiumchloride,5 mM calciumchloride was added
specific primer, CTTCCATTTTACCAACAGTACCGGAATGCC, followed by an appropriate dilution of DNase I. After 120 s a t room
that hybridized with nucleotides a t position +63to +92 onthe temperature the reactionwas stopped by the addition of 40 p1 of stop
luciferase coding sequence (21). The specific 30-mer was end labeled buffer (1%sodium dodecyl sulfate, 20 mM EDTA, sodium chloride,
using ['"PIATP and T4 polynucleotide kinase. The primer was hy- 25 pg/ml tRNA). The probe DNA was recovered by phenol/chloro-
bridized at 50 "C using standard conditions, and cDNA was synthe- form extraction and ethanol precipitation analyzed and on denaturing
sized using avian myeloblastosis virus reverse transcriptase (Phar-
macia LKB Biotechnology Inc.). The luciferase-specific cDNA was ' K. Yamamoto, unpublished observation.
18270 Variant Glucocorticoid Response Element of the aJ3 Gene
polyacrylamide gels along with probe DNA that had been subjected
compared with untreated hypophysectomized control and nor-
to the G+A cleavage reaction of Maxam and Gilbert (30). For com-
mal animals. Hepatic mRNAlevels in hypophysectomized
petition experiments 20 ng of cold specific oligonucleotide was in-
cluded in the binding reaction instead rats treatedwith increasing concentrations of dexamethasone
of the nonspecific 35-mer. Gel
(40 pg/kg-8 mg/kg) were increased in a dose-responsive man-
retardation assays (31, 32) were performed using the extracts from
ner (Fig. 1A). For instance, 6 h after administration of 8 mg/
FAZA cells. The binding reaction mixture (20 pl) containing 2 ng of
end-labeled double-stranded oligonucleotide and 0.1-1 pg of extract
kg dexamethasone the mRNA level was increased from 21 to
with 4 pg ofpoly(d1-dC), 0.5 pg of Escherichia coli chromosomal DNA,
40% of normal levels. The a,I3 mRNA levels 12 and 24 h
and 200 ng of the nonspecific 35-mer in DNase I footprinting buffer,
after administration of 8 mg/kg dexamethasone were 57 and
was incubatedfor 30 min onice. Protein-bound DNA complexes were
64%, respectively, of normal levels. Overall, aJ3 expression
analyzed on 8% polyacrylamide gels containing 25 mM Tris borate,
levels in rats with very low levels of glucocorticoidscaused by
0.25 mM EDTA a t 4 "C. Two hundred ng of specific oligonucleotide
hypophysectomy were decreased and could berestored at least
was included in the binding reaction, instead of the nonspecific 35-
mer, when competition assays were performed. in a major part by intraperitoneal injection of glucocortocoids.
The effects of glucocorticoids on al13 expression in vivo
RESULTS were paralleled in vitro in the rat hepatoma cell line, FAZA.
DexamethasoneIncreases a113mRNA Concentration in Hy- FAZA cells were treated with increasing concentrations of
pophysectomized Rats and in FAZA Hepatoma Cells-Results dexamethasone, and 12 hlater RNA was prepared. a113
from previous studies on the acute phase regulation of the mRNAlevelswere increased in a dose-responsive manner
al13 gene in rat liver and rat hepatoma cell lines suggested (Fig. lB), in a similar way as in dexamethasone-treated
that glucocorticoids may be required for the normal expression hypophysectomized rats. The "normal" expression levels in
of al13 (9, 11). To investigate whether glucocorticoids are rats are equivalent to the levels observed in glucocorticoid-
required for normal aJ3 expression in rats al13 mRNA levels treated hepatoma cells.
in the livers of hypophysectomized and normal rats were The Promoter Upstream Region of the a113Gene Mediates
compared. In hypophysectomized ratsthe levels of al13 Glucocorticoid Induction-To establish that theglucocorticoid
mRNA were approximately 20% of those determined in nor- regulation of the al13 gene occurred at thelevel of transcrip-
mal animals (Fig. 1A). To determine whether decreased a113 tion, transfection studies using 5' promoter constructs were
expression was specifically caused by lowered glucocortocoid initiated. Approximately 2.2 kilobase pairs of the al13 gene
levels in the hypophysectomized animals, the effect of admin- 5"flanking sequence were available (8). A restriction map of
istration of dexamethasone was studied. Hypophysectomized this al13 gene promoter region was generated. Subsequently,
rats were treated with increasing doses of dexamethasone for a region extending from -2,214 to +59 (relative to the tran-
varying lengths of time,and the al13 mRNAlevelswere scriptional initiation site in liver) was linked to the coding
region of the firefly luciferase reporter gene (Fig. 2A). This
construct, called A113 (-2,214), was used to cotransfect FAZA
A hepatoma cells. Stable clones expressing luciferase were iso-
I lated after G418 selection. Stable transfectants expressing
luciferase from the SV40 minimal promoter (33) in the plas-
mid pSV232LUC werealso isolated. A mixed culture of stable
A113 (-2,214) transfectants, referred to as F-1, representing
approximately 500 clones was used to test the response of

A
e -
Y
8 a
1
1
-2214
-1514
-1025
-581-431 -80 *58
Hypophysectomy
6 B
-
1 18000
.E
a
18000

-
14000
s'
J 12000
10000
I
'E 8000
8000

5 4000
2000

-
Dexamethasone Concentration (M)
FIG. 1. Regulated expression of aJ3 mRNA in rat liver and
0
0 10"10" lo" 10' 10' l o "

the FAZA hepatoma cell line. RNA (2 pg) was dotted to a nylon
membrane andhybridized with 32P-labeled al13 cDNA. After washing,
the membrane was autoradiographed, and al13 mRNA levels were
quantitated byliquid scintillationcounting of individual dots. A,
normal orhypophysectomized rats were either mock treated or treated
with increasing concentrations of dexamethasone for 6, 12, or 24 h as
indicated prior to RNA preparation. Each data point was measured
in duplicate. B, duplicate cultures of FAZA cells were treated with
increasing concentrations of dexamethasone, as indicated for 24 h
prior to preparation and quantitationof al13 mRNAlevels.
Dexamethasone Concentration I M P
FIG. 2. Inducible expression ofan al13 luciferase fusion
construct in FAZA-derived stable transfectants. A, a physical
map of the a,I3 luciferase fusion construct, A113 (-2,214), showing
the positions (in bp) of restriction endonuclease cleavage sites with
respect to the transcription initiation site(arrow).B, cultures of the
stable A113 (-2,214) transformed line F1 or the pSV232LUC-trans-
formedline F-232 were treated with increasing concentrations of
dexamethasone for 12 h prior to assayingfor luciferase activity (light
units).
 Variant Glucocorticoid Response Element of the a113Gene 18271
(ul13gene promoter region to different concentrationsof glu- treatment were similartothoseseen with the luciferase
cocorticoid (Fig. 2B). In the absence of dexamethasone, F-1 activity measurements, relative to A113 (-118).
cells expressed luciferase at a basal level (2,000 light units). Delineation of the Glucocorticoid-responsive Element-A se-
Progressively higherconcentrations of dexamethasone caused ries of Sal1 linker scan mutations extending across the region
a n increase in promoter activity from 1.6-fold (3,200 light that had been found tobe essential for basal level expression
units) using 1 X lo-" M dexamethasone to 9-fold (18,300 light (10) was available from a previous study (10). In the present
units) with 1X M dexamethasone. In contrast the activity study, thisregion was found tobe involved also in mediating
of the SV40 minimal promoter in the transformed line, F-232 the induction by dexamethasone. The linker mutant con-
was not increased significantly after dexamethasone treat- structs were transfected into FAZA cells, and luciferase ac-
ment. tivities were measured either with or without dexamethasone
5' Deletion Analysis of the Glucocorticoid-responsive Regions treatment (Fig. 4). Mutations LM5,LM6,LM7, and LM9
Upstream of the a113 Gene-To map the 5' extent of the abolished the glucocorticoid responsiveness of the al13 pro-
region responsible for the glucocorticoid-regulated expression moterconstruct.Previousresults(10) indicated thatthe
of the aI13 gene a series of deletion constructs with inserts mutations LM5, LM6, and LM9 completely abolished basal
extending from +58 bp to between -48 and -2,214 bp up- level transcriptional activity, and the present study showed
stream of the transcription start site was used. These con- that these same mutations also abolished glucocorticoid-in-
structs were linked to the firefly luciferase gene, and the
ducible expression.However, the LM7 mutation did not affect
luciferase activity was measured after transient transfection
basal level transcription (10) but completely abolished induc-
into the rat hepatomaFAZA cell line. Constructs containing
ibility by dexamethasone. Thus,a GRE was contained within
at least 225 bp upstream of the transcription initiation site,
or overlapped the -156 to -151 region covered by the LM7
A113 (-2,214) and A113 (-225), contained sufficient infor-
mation to mediate a 25-fold induction of luciferase activity mutation and may extend further to the 5' end of the LM5
after treatment with 1 X M dexamethasone for 24 h (Fig. mutation at -168. Inspection of the -168 to -151 region
3A). The A113 (-186) construct gave a similar but slightly revealed partial sequence homology to an inverted copy of the
lower induction. In contrast the shortest constructs, A113 consensus GREresponsible for the transcriptionalactivation
(-150) and A113 (-118) were not induced above that seen of many genes by glucocorticoids (14-16,34-36) and function-
withthe pSV232LUC controlplasmid (4-fold). Thus,se- ing asa binding site for theGR. An ideal GRE, asdefined by
quences located between -186 and -150 were necessary for saturation mutagenesis (36), has thepalindromic sequence
at least a 6-fold glucocorticoid induction of the al13 gene. . . . .
Quantitation of the luciferase mRNA produced after transfec- 5' R G N A C A N N N T G T N C Y 3'
tion of constructs A113 (-2,214), A113 (-225), and A113 3' Y C N T G T N N N A C A N G R 5'
(-118) followed by dexamethasone treatment, by primer ex-
tension using a luciferase-specific oligonucleotide (Fig. 3B),
showed that the transcriptional start site used in FAZA cells whereR = purine, Y = pyrimidine,N = any nucleotide;
waswithin4 bp of that used in rat liver aJ3 and that arrows represent the inverted half-sites
of the palindrome on
differences between the luciferase mRNA levels in the A113 theopposite DNA strands,anddotsindicate nucleotides
(-2,214) and A113 (-225) constructs after dexamethasone important for protein DNA contact. The reverse of this se-

-
A

ATAM
11131-22141 1
AlW
All%-2251
ATAM
A1111-1081
AlAM
11151-1501 LLI
ATAM
A1151-1101
" I 1142

A1151-401 e
AlAM
lu:

pSv232LuC

FIG. 3. Effect of 5' deletions on the glucocorticoid inducibility of the aJ3 promoter. A series of
constructs containing up to2,214 bp of nJ3 5"flanking sequences linked to theluciferase reporter gene were tested
for transcriptional activity, bothwithandwithouttreatment with 1 X M dexamethasone for 24 h after
transient transfection in FAZA cells. A, luciferase activity was measured in cell extracts and normalized with
respect to the chloramphenicol acetyltransferase activities measured in each extract. The luciferaseactivities
presentedarean average of a t least five measurements.Fromthesedatathe relative (fold) induction by
dexamethasone was determined. B, relative luciferase mRNA induction of three constructs after treatment with
dexamethasone was determined by primer extension using a luciferase-specific primer, as described under "Mate-
rials and Methods." The arrow indicates the position of the luciferase-specific product. Also shown is a dideoxy
sequencing reaction (ACGT) using the sameluciferase primer on A113 (-225) plasmid DNA.
18272 Variant Glucocorticoid Response Element of the aJ3 Gene

30 I I I

Linker Mutants-

FIG.4. Linker mutational analysis of the -225 to -118

region of the aJ3 promoter. A series of Sal1 substitutions (LM)
were introduced in the upstream promoter region of the A113 (-225)
construct (10) as indicated below the sequence. The various linker
scan mutants were used to transfect FAZA cells transiently. The "-0

effect of each mutation on the induction of the promoter by 1 X

M dexamethasone was determined by comparing the activity of the
-
"
c
.-

promoter before and after induction. The levels of induction of the FIG. 5. DNase I footprint and gel shift analysis of the aJ3
inducible MMTVLUC construct, the minimal SV40 promoter con- upstream promoter elements. A, footprints on the noncoding
struct, pSV232LUC, and the wild-type construct A113 (-225) are also strand of the nl13 promoter region using either untreated (0 h) or 5-
shown. h dexamethasone-treated FAZA nuclear extracts. The position of the
sequence mediating the glucocorticoid response (-151 to -156) is
indicated. G+A chemical cleavages of the end-labeled probes were
quence matches the GMEof the a113gene as follows. used as sequence markers. R, gel retardation analysis of the GME.
Assays were performed using labeled oligonucleotide B3 and FAZA
. . . 4
extracts from either uninduced, 5-h, or 12-h dexamethasone (1X
irl13GME 5' C C C T G G C A C A T T T C G T G C A A 3' M)-treatedFAZA cells. Competition reactions, in addition, contained
200 ng of unlabeled B3 oligonucleotide. RSA, bovine serum albumin.
-168 3' G G G A C C C T G T A A A G C A C G T T 5'

reverse 3'
lllllllll IIII
Y C N T G T N N N A C A N G R 5'
with the -156 to -151 region mapped as containing the GME
was found. The protected region included the GME region,

GRE
-
. . . . . indicating that a complex of nuclear factors bound to these
sequences as described previously (10). Both uninduced and
induced extracts gave a similar region of protection from
However, the GME varies in two nucleotides of one half site DNase I digestion (Fig. 5A and data not shown), suggesting
which are both important for receptor DNA contact. There- thatsimilaroridenticalGMEbindingactivities may be
fore, the GME of the a113 gene deviates significantly from a present in both uninduced and
induced extracts.
consensus GRE. This sequence variation implies apotentially These results were confirmed and extendedby gel retarda-
different way of protein DNA contacts between the GR and tion assayusing a double-stranded oligonucleotide B3, 5'
a consensus GRE and the GME of the al13gene, respectively. TCCCCTGGCATTTCGTGCAAC 3', which included the
Stimulation of Luciferase Expression Is Mediated by the GME sequence (Fig. 5B). When nuclear extracts from unin-
Glucocorticoid Receptor-To determine whether theeffect of duced FAZA cells were used in the assay, two predominant
dexamethasone on the transcriptional activationof the al13 retarded complexes were seen. When nuclear extractsfrom 5-
promoter was mediated through the glucocorticoid receptor, or 12-h dexamethasone-treated FAZA cells were used two
the effect of the receptor antagonist RU486 was tested (37, retarded complexes were seen which appeared tobe identical
38). FAZA cells were transfected with A113 (-225) followed tothoseobtainedwithuninducedextracts.The retarded
by treatment with 10" M dexamethasone for 24h. The complexes could be competed specifically by unlabeled 3B.
transcriptional activityof the al13 luciferase fusion increased There was no apparent change in the GME binding activity
approximately 10-fold after treatment with this concentrationwhen FAZA cells were treated withdexamethasone. If the GR
of dexamethasone (data not shown). However, simultaneous bound to thisregion only after hormonal treatment then one
treatment with both M dexamethasoneand M RU486 might have expected to find a corresponding change in the
led to a low transcriptional activity thatwas similar to that gel retardation pattern, even if the bindingwas weak.
measured with either RU486 alone or control transfected cells. Purified GlucocorticoidReceptor Does Not Bindto the GME
Thus, RU486 blocked completely the inductionby dexameth- of the a113Gene-DNase I footprint analysis was carried out
asone, suggesting that the effect of dexamethasone on aJ3 on the aJ3 GME region to determine whether theglucocor-
promoter activity was mediated through theGR. ticoid receptor was able to bind. A 150-amino acid glucocor-
DNase I Footprint Analysis of the a113 Glucocorticoid In- ticoid receptor fragment, T7X556, was used in footprint re-
duction-mediating Element (GME)-To investigate whether actions. This fragment contained the DNA binding domain
transcription factors bind to theregion that hadbeen mapped and protected the same GRE sequence as the full-length
as being important for the glucocorticoid induction of the al13 receptor (17). When the al13 promoter region was used in
gene, DNase I footprint analysis of the area surrounding the footprint reactions this receptor fragment was unable to bind
-156 to -151 region of the promoter was carried out using to the sequence delineated by the LM7 mutation (-151 to
nuclear extracts preparedfrom either uninduced or 5-hdex- -156) or to sequences extending through the LM5 and LM6
amethasone-induced FAZA cells (Fig. 5A and data not shown).region (-157 to -168). Onlyavery minorchangeinthe
A region protected from DNase I digestion which coincided footprint profile was seen around-151 and also around -163
 Variant Glucocorticoid Respo'me Element of the a113Gene 18273
on the noncoding strand but not on the coding strand. The administration of glucocorticoids served to restore a major
consensus GRE contained in the pGTCO plasmid2was very fraction of the normal a113 mRNA expression levels.
strongly protected from DNase I digestion by this receptor In the current study, FAZA hepatoma cells treated with
even when %O of the concentration of T7X556 was used as dexamethasone were shown tobehave similarlyto hepatocytes
compared with thea113binding reactions (Fig. 6). in vivo; both the endogenous al13 gene and transfected al13
promoter luciferase constructs were induced by dexametha-
DISCUSSION sone ina dose-responsive manner. The resultsconfirmed that
Two essential results were obtained in this study. ( a ) Glu- FAZA hepatoma cells provided a good model system to study
cocorticoids are required forthe constitutivehigh level expres- the glucocorticoid-mediated transcriptional regulation of the
sion of the al13 gene in healthy adult rat livers. ( b ) The al13 gene. In this model system, resting hepatoma cells were
glucocorticoid response element of the al13gene is a variant considered to be equivalent to hepatocytes hypophysectom- in
of the consensus GRE, differing from it in qualitatively im- ized rat liver. Glucocorticoid-treated (induced)hepatoma
portant aspects. cells, in contrast, were equivalent to hepatocytes in normal
Glucocorticoids participate in the transcriptional activation rats with normal levels of circulating glucocorticoids. Using a
of a number of hormone-induciblegenes (14-16). T o our transient transfection assay, a glucocorticoid-responsive ele-
knowledge, however, there are no well documented cases in ment was located between positions -186 and -150 bp up-
which glucocorticoids havebeenshown to be an essential stream from the al13transcription initiation site. Linker scan
prerequisite for the constitutive, high level expression of a analysis delineated the GRE to the sequence CCCTGGCA-
gene in its normal producer cell type. The a113 gene is an CATTTCGTGC (-167 to -150). Comparison of this sequence
example of such a situation. Thisgene differs strikingly from with the glucocorticoid response element found in many ste-
the majority of other plasma protein genes expressed in the roid-responsive genes(14-16,34-36) showed that this element
liver which have been studied so far. Other genes, specifying is an inverted consensus GRE element differingina few
abundant plasma proteins that are constitutively expressed, nucleotides from the consensus GRE(8).The consensus GRE
such as the transferrin, complement C3, C4, or albumingenes, has been defined in two different ways in the literature: once
are controlled by a set of transcription factors (HNF1,39-41; by comparing the functional elements found in different many
C/EBP; DBP-LAP; 42-45 and others) which are themselves genes (14-16), and, more recently, be systematic saturation
constitutively and preferentially expressed in fully differen- mutagenesis in all 15 nucleotide positions of the GRE and
tiated hepatocytes. In contrast to those genes, the al13 gene comparing relative binding intensities for the GR (36). The
is representativeof a rare category of strongly expressed liver- "ideal" GRE, defined by this latter approach as the best GR
specific genes which,in addition to those constitutive factors,protein binding sequence, showed good agreement with the
require inducible factors such as the GRfor their transcrip- consensus GRE asdefined by the first approach(14-16). The
tion. Our results showed that in ratshypophysectomy greatly GRE consistsof two half-sites ina palindromic arrangement.
decreased the productionof al13 mRNA in theliver and that One half-site is thought to be occupied first and to facilitate
binding of a second molecule of the GR at the second half-
a113 a113 site by cooperative interaction (36). Until recently it was
coding strand nomcoding strand pGTCO
U 4
thought that the strong half-site must be a hexanucleotide
?S a +Sa + S =
0 m o o m o o m o with only one unspecified position (N) separating the TGT
triplet from the CY doublet. However, it was shown recently
(36) that a half-site can also be a heptanucleotide with two
unspecified nucleotidesseparating the triplet and doublet:
the
T G T N1 N2C Y. This result suggests that within each half-
site there are two separable subelements that are possibly
contact points for separate subdomains of the GR with the
DNA. I t is of interest to note that in the GME of the aI13
gene, one half-site is perfectly conserved whereas inthe
second half-site two nucleotides differ as shown in the align-
ment given under "Results." Both of these variant positions
are nucleotides involved in protein DNA contact between a
consensus GRE and theGR. It is therefore conceivable that
the second half-site of the GMEbecomes a veryweak binding
site or no binding site a t all and that itcould even destabilize
or prevent bindingof a first copy of the GR at the conserved
strong half-site. The variant sequence of the GME suggests
the plausible prediction that the GME of the a113 may be a
much weaker binding site for the GR thana consensus GRE.
In view of the variant sequence of the GME we were
FIG.6. DNase I footprint analysis of the a113-225 region prompted to ask whether the glucocorticoid effect involved
using purified glucocorticoid receptor. An al13 promoter frag-
ment extending from -225 to -81 was labeled on either the coding
the GR and whether the receptor bound directly to the GME
or noncoding strand and used in the binding reaction with either of theal13 gene. The glucocorticoid receptor antagonist
bovine serum albumin or 21 pg of glucocorticoid receptor fragment, RU486 was able to block the effect of dexamethasone com-
T7X556 (17). The controlplasmid, pGTCO, containing a glucocorti- pletely, indicating that the al13 promoter activity was me-
coid-responsive element, was used in binding reactionswith 2.1 pg of diated through the GR. However, when the purified recom-
T7X556. The position of the GME mapped by the LM7 mutation binant GR fragmentwas used in footprint reactionswith the
(-156 to -151) is indicated. Also, the maximum extent of the GRE
is shown by the broken lines. The arrow marks the position of the al13 GME, no significant binding was observed. There are a
weak protection by the GR, from DNase I digestion. The protected number of possible explanations for this observation.
GRE on pGTCOis indicated by brackets. First, the GR may be able to bind weakly at the GME of
18274 Variant Glucocorticoid Respcmse Elementof the a113Gene
the al13 gene, but to initiate transcription successfully it may the GME and these previously characterized tissue specific
need to be held in place by interaction with other accessory cis-acting elements it islikely that there isa close association
factors. This interactionpossibly requires domainsof the GR between the various transcription factors that bind to these
other than its DNA binding domain. In our experiments with sequences.
the truncated recombinant GR fragment no binding may have
been observed because ( a ) the intrinsic binding to the GME Acknowledgments-We thank Dr. K. Fournier for the FAZA hep-
was too weak because of the variant DNA sequence of the atoma cell line. We gratefully acknowledge gifts of RU486 from
site; and( b ) because the necessary factors were not present. Roussel UCLAF, France andof purified T7X556 glucocorticoid recep-
tor fragment from Dr. K. Yamamoto. We thank Keith Dunn for
The glucocorticoid receptor is known to undergo coopera- preparation of the manuscript and Dr. H. Leffert for helpful discus-
tive GRE binding with a variety of transcription factors such sions.
as nuclear factor 1, Spl, OTF-1,CCAAT box binding factors
and the estrogen receptor, to activate an adjacent promoter REFERENCES
(46-48, 58). Chang and co-workers (59) have shown that the 1. Sottrup-Jensen, L., Stepanik, T. M., Kristensen, T., Lonblad, P.
transcriptionfactorAGP/EBP, amember of theC/EBP B., Jones, C. M., Wierzbicki, D. M., Magnusson, S., Domdey,
family and probably the murine equivalentof rat interleukin H., Wetsel, R. A,, Lundwall, A,, Tack, B. F., and Fey, G. H.
6-DBP/liver activator protein (44, 45), binds at a sequence (1985) Proc. Natl. Acad. Sci. U. S. A. 8 2 , 9-13
overlapping the GRE of the murine alAGP gene. The fact 2. Sottrup-Jensen, L., Sand, O., Kristensen, L., and Fey, G. H.
(1989) J. Biol. Chem. 2 6 4 , 15781-15789
that the GME of the al13 gene is highly conserved with the 3. Sottrup-Jensen, L. (1987) in The Plasma Proteins (Putnam, F.
functionally active glucocorticoid response regions of the rat W., ed) pp. 191-291, Academic Press, Orlando, FL
and murine alAGP (8, 49-50, 59) and a2"-g1obulin genes (8, 4. Lonberg- Holm, K., Reed, D. L., Roberts, R. C., Herbert, R. R.,
51) makes the involvement of accessory proteins plausible. In Hillman, M. C., and Kutney, R. M. (1986) J. Biol. Chem. 2 6 2 ,
fact, for the controlof the rat alAGPgene by glucocorticoids, 438-445
Klein et al. (52, 53) have demonstrated a requirement for 5. Braciak, T. A., Northemann, W., Hudson, G. O., Shiels, B. R.,
accessory proteins bindingat neighboring sites, some of which Gehring, M. R., and Fey, G. H. (1988) J. Biol. Chem. 2 6 3 ,
are labile and need to be resynthesized continuously. The 3999-4012
6. Aiello, L. P., Shia, M. A., Robinson, G. S., Pilch, P. F., and
alAGP GRE shares a higher degree of sequence homology Farmer, S. R. (1988) J. Bid. Chem. 263, 4013-4022
with the GME of the rat a113 gene than with the consensus 7. Schweizer, M., Takabayashi, K., Geiger, T., Laux, T., Biermann,
GRE sequence (8). However, unlike alAGP, the al13 GME G., Buhler, J. M., Gauthier, F., Roberts, L. M., and Heinrich,
appears unable to bind recombinant GR in footprint reac- P. C. (1987) Eur. J. Biochem. 1 6 4 , 375-381
tions. It is possible that because of the constitutive induction 8. Northemann, W., Shiels, B. R., Braciak, T. A,, and Fey, G. H.
of al13 by glucocorticoids and its down-regulation during the (1989) Biochemistry 28, 84-95
acute phase, the GR requires accessory factors to bind to the 9. Abraham, L. J., Bradshaw, A., Fletcher, R., and Fey, G. H. (1990)
Mol. Biol. Med 7 , 261-272
GME since cycloheximide completely blockedboth the unin- 10. Abraham, L. J., Bradshaw, A. D., Shiels, B. R., Northemann, W.,
duced and the dexamethasone-induced expression of the al13 Hudson, G., and Fey, G. H. (1990) Mol. Cell. Bid. 1 0 , 3483-
gene." 3491
A second possible explanation of our data is that the GR 11. Bernuau, D., Legres, L., Lamri, Y., Giuily, N., Fey, G., and
may not bind directly to the GME DNAsequence but rather Feldmann, G. (1989) J. Exp. Med. 170,349-354
indirectly to other proteins that are in turn attached to the 12. Kushner, I., and Feldmann, G. (1978) J . Exp. Med. 1 4 8 , 466-
DNA. A similar mechanism was proposed for the regulation 470
13. Sapolsky, R., Rivier, C., Yamamoto, G., Plotsky, P., and Vale,
of the prolactin gene by steroids. Regulation of this gene W. (1987) Science 2 3 8 , 522-534
involves the estrogen and glucocorticoid receptors interacting 14. Beato, M. (1989) Cell 5 6 , 335-344
with other transcription factors to suppress prolactin gene 15. Yamamoto, K. R. (1985) Annu. Reu. Genet. 1 9 , 209-252
transcription (54). Similarly, the glucocorticoid receptoris 16. Evans, R. M. (1988) Science 240,889-894
involved in the transcriptional repression of the collagenase 17. Freedman, L. P., Luisi, B. F., Korszun, Z. R.,Basavappa,R.,
gene not by direct binding to the DNA but by interaction Sigler, P. B., and Yamamoto, K. R. (1988) Nature 3 3 4 , 543-
with the transcription factor jun in thefluid phase and thus 546
18. Gehring, M. R., Shiels, B. R., Northemann, W., de Bruijn, M. H.
preventing it from activating the gene through an AP1 site L., Kan, C.-C., Chain, A. C., Noonan, D. J., and Fey, G. H.
(55-57). (1987) J. Bid. Chem. 262,446-454
A third possible explanation is that the glucocorticoid effect 19. Turpin, T. H., and Griffith, 0. M. (1987) Biotechnigues 4 , 11-13
on the al13 gene is indirect and does not involve binding of 20. Mroczka, D. L., Cassidy, D., Busch, H. B., and Rothblum, L. I.
the GR at the GME, either by direct protein-DNA interaction (1984) J. Mol. Biol. 1 7 4 , 141-162
or by protein-proteininteraction.Instead, glucocorticoids 21. de Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., and
could activate an intermediate gene, and the intermediate Subramani, S. (1987) Mol. Cell. Biol. 7 , 725-737
S. E., and Weiss, M. C. (1974) Proc. Natl. Acad. Sci.
gene product could exert its control over the al13 gene through 22. Malawista,
U. S. A. 71,927-931
the GME site without interactionof the GR with this site. 23. Graham, F. L., and Van der Eb, A. J. (1973) Virology 5 2 , 456-
Among the possibilities, we believe the most likely is that 467
the GR bindsat the GME to the DNA and requires auxiliary 24. Birnboim, H. C., and Doly, J. (1979) Nucleic Acids Res. 7 , 1513-
proteins bound atneighboring sites tohold it in place and to 1523
interact productively with the components of the transcrip- 25. Gorman, C. M., Merlino, G. T., Willingham, M. C., Pastan, I.,
tional machinery to augment the rateof transcription initia- and Howard, B. H. (1982) Proc. Natl. Acad. Sci. U. S. A. 79,
tion. Previously we have mapped four tissue specific cis-acting 6777-6781
26. Sleigh, M. J. (1986) Anal. Biochem. 1 5 6 , 251-256
elements tosequences surrounding the GME in the al13 gene 27. van Zonneveld, A.-J., Curriden, S. A., and Loskutoff, D. J. (1988)
(10). We have established that nuclear factors bind to these Proc. Natl. Acad. Sci. U. S. A. 8 5 , 5525-5529
elementsinbothuninducedanddexamethasone-induced 28. Shapiro, D. J., Sharp, P. A., Wahli, W. W., and Keller, M. J.
FAZA nuclear extracts. Considering the close proximity of (1988) D N A ( N . Y . ) 7,47-55
29. Galas, D., and Schmitz, A. (1978) Nucleic Acids Res. 5 , 3157-
L. Abraham, unpublished data. 3170
 Variant Glucocorticoid Response
Element
30. Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 6 5 ,
499-560
31. Garner, M. M., and Revzin, A. (1981) Nucleic Acids Res. 9,3047-
3060
32. Fried, M., and Crothers,D. M. (1981) Nucleic Acids Res. 9,6505-
6525
33. Fromm, M., and Berg, P. (1982) J. Mol. Appl. Genet. 1 , 457-481
34. Karin, M., Haslinger, A,, Hallgrave, H., Richards, R. I., Krauter,
P., Westphal, H. M., and Beato, M. (1984) Nature 3 0 8 , 513-
519
35. Straehle, U., Klock, G., and Schuetz, G. (1987) Proc. Natl. Acad.
Sci. U. S. A . 8 4 , 7871-7895
36. Nordeen, S. K., Suh, B. J., Kuehnel, B., and Hutchison, C. A., I11
(1990) Mol. Endocrinol. 4 , 1866-1873
37. Baulieu, E. E., and Segal, S.J. (1985) in The Antiprogesterone
RU486 in Human FertilityControl, Plenum Publishing Co.,
New York
38. Schweizer, G., Cadepond-Vincent, F., and Baulieu, E. E. (1985)
Biochemistry 2 4 , 1742-1749
39. Courtois, G., Baumhueter, S., and Crabtree, G . (1988) Proc. Nutl.
Acad. Sci. U. S. A . 8 5 , 7937-7941
40. Baumhueter, S., Mendel, D. B., Conley, P. B., Kuo, C. J., Turk,
C., Graves, M. K., Edwards, C. A,, Courtois, G., and Crabtree,
G. R. (1990) Genes & Deu. 4, 372-379
41. Frain, M., Swart, G., Monaci, P., Nicosia, A., Staempfli, S., Frank,
R., and Cortese, R. (1989) Cell 59, 145-157
42. Johnson, P. F.,Landschulz, W. H., Graves, B. J., and McKnight,
S. L. (1987) Genes & Deu. 1, 133-146
43. Mueller, C. R., Maire, P., and Schibler, U. (1990) Cell 6 1 , 279-
291
44. Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E., and
of the a113Gene 18275
Schibler, U. (1990) Genes & Deu. 4 , 1541-1551
45. Poli, V., Mancini, F. P., and Cortese, R. (1990) Cell 6 3 , 643-653
46. Schuele, R., Mueller,M., Haltschmidt, C., and Renkawitz,R.
(1988) Science 2 4 2 , 1418-1420
47. Schuele, R., Mueller, M., Otsuka-Murakami, H., and Renkawitz,
R. (1988) Nature 3 3 2 . 8 7 - 9 0
48. Straehle, V., Schmid, W., and Schuetz, G. (1988) EMBO J . 7,
3389-3395
49. Reinke, R., and Feigelson, P. (1985) J . Biol. Chem. 2 6 0 , 4397-
4403
50. Baumann, H., and Maquat, L. E. (1986) Mol. Cell. Biol. 6 , 2551-
2561
51. Addison, W. R., and Kurtz, D. T. (1986) Mol. Cell. Biol. 6 , 2334-
2346
52. Klein, E. S., Reinke, R., Feigelson, P., and Ringold, G. M. (1987)
J. Biol. Chem. 2 6 2 , 520-523
53. Klein, E. S.,DiLorenzo, D., Posseckert,G.,Beato, M., and
Ringold, G. (1988) Mol. Endocrinol. 2, 1343-1351
54. Adler, S., Waterman, M. L., He, X., and Rosenfeld, M. G. (1988)
Cell 5 2 , 685-695
55. Jonat, C., Rahmsdorf, H. J., Park, K.-K., Cato, A. C. B., Gebel,
S., Ponta, H., and Herrlich, P. (1990) Cell 6 2 , 1189-1204
56. Yang-Yen, H.-F.,Chambard,J.-C.,Sun, Y. L., Smeal, T.,
Schmidt, T. J., Drouin, J., and Karin,M. (1990) Cell 6 2 , 1205
57. Schuele, R., Rangarajan, P., Kliewer, S., Ransom, L. J., Bolado,
J., Yang, N., Verma, I. M., and Evans, R. M. (1990) Cell 6 2 ,
1217-1226
58. Briiggemeier, U., Kalff, M., Franke, S., Scheidereit, C., and Beato,
M. (1991) Cell 6 4 , 565-572
59. Chang, C. J., Chen, T. T., Lei, H. Y., Chen, D. S., and Lee, S. C.
(1990) Mol. Cell. B i d . 1 0 , 6642-6653