Professional Documents
Culture Documents
(Methods in Molecular Biology 1971) Joachim Clos - Leishmania - Methods and Protocols (2019, Springer New York - Humana) PDF
(Methods in Molecular Biology 1971) Joachim Clos - Leishmania - Methods and Protocols (2019, Springer New York - Humana) PDF
Leishmania
Methods and Protocols
Methods in M o l e c u l a r B i o lo g y
Series Editor:
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
Edited by
Joachim Clos
Bernhard Nocht Institute for Tropical Medicine , Hamburg, Germany
Editor
Joachim Clos
Bernhard Nocht Institute for Tropical Medicine
Hamburg, Germany
Cover Caption: Scanning electron micrograph of a Leishmania donovani promastigote, taken by Dr. Monica Hagedorn
at the electron microscope facility of the University of Ulm, Germany.
This Humana Press imprint is published by the registered company Springer Science+Business Media, LLC, part of
Springer Nature.
The registered company address is: 233 Spring Street, New York, NY 10013, U.S.A.
Preface
The Aims
Parasites of the genus Leishmania and other Trypanosomatidae are causative for three of
the most important neglected tropical diseases (NTDs), affecting the lives of millions of
humans in the tropical and subtropical regions of the world. New drugs against these obli-
gate parasites and new tools for the control of their vectors are urgently needed, especially
since all existing treatments have serious drawbacks and limitations. Therefore, additional
efforts are needed; meaning, more researchers must enter the field, not only in applied
science but also in basic research. This is often hampered by a lack of understanding of these
organisms and the particular methodological challenges and chances with which they con-
front “newbies” and even established parasitologists. Fortunately, the last years have seen
tremendous methodological advances, e.g., by the introduction of deep sequencing
approaches and their combination with established strategies but also by the introduction
of state-of-the-art genome editing strategies, and awareness for these new opportunities
must be raised. This compendium is therefore aimed at established parasitologists wishing
to broaden their spectrum but also for scientists from other disciplines who wish to enter
Leishmania research or plan to collaborate with Leishmania researchers in the framework
of multidisciplinary R&D consortia. Its long-term and ambitious goal is to help in getting
leishmaniasis off the list of the NTDs by promoting research.
The contributing authors and I also entertain the hope that this compendium will help
to implement experimental standard procedures. More often than not, similar experimental
strategies are performed following diverse protocols in different laboratories, making direct
comparisons of the results difficult and even impossible. Offering this collection of experi-
mental protocols, we hope to reduce the inconsistency of procedures, to make results more
comparable and to avoid confusion.
The Scope
The various chapters of this book cover a wide range of experimental strategies and tech-
niques contributed by colleagues from the field. They deal with the cultivation of axenic
amastigote forms (Chapter 1) and cover phylogeny and comparative genomics (Chapters 2
and 3) and other strategies collectively known as systems biology (Chapters 4–7). Also
offered are the protocols for genetic manipulation of Leishmania, both classic and new
(Chapters 8–11). A large part of this book is also dedicated to in vitro and in vivo infection
models and their interpretation (Chapters 12–19), ranging from host cell lines to mamma-
lian and arthropod hosts. This compendium cannot cover the entire range of experimental
strategies that are used in Leishmania research. Some expert colleagues had no time to
contribute, and some research fields are too diverse and complex to be covered by one or
two chapters. On the whole, however, I entertain the hope that the protocols found in this
v
vi Preface
book will be a help and a starting point for established and emerging researchers. In addition
to the core target group, Leishmania researchers, colleagues working with other protozoa
of the order Trypanosomatida may also find the book useful, in particular Chapters 3–11,
as most molecular techniques can be applied to those organisms as well.
For the completion of this compendium, I depended on the willingness of a large number
of colleagues to contribute their expertise and to invest their time and that of their col-
laborators. I am happy to state that they embraced the idea of this book with enthusiasm,
and I thank them for their readiness to open their lab manuals for the community. I also
have to thank my colleagues at the Bernhard Nocht Institute for Tropical Medicine for
their readiness to be test readers of selected chapters during the review process.
vii
Contents
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . vii
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
ix
x Contents
Index����������������������������������������������������������������������������������������������������������������������������������� 369
Contributors
xi
xii Contributors
Abstract
This chapter describes, in detail, the method our laboratory developed to differentiate L. donovani pro-
mastigotes into amastigotes in a host-free culture. This method is based on previous observations that
Leishmania promastigotes can combine two environmental signals, typical to lysosomes, acidic pH (~5.5)
and body temperature (37 °C), into a signal that induces differentiation. Based on this concept, we have
modified medium 199 to make it into an amastigote-specific medium. Shifting promastigotes to this
medium, followed by incubation in a CO2 incubator, induced differentiation. Axenic amastigotes reach
maturation within 5 days, resembling the time it takes in vivo. This chapter provides a complete protocol
that should be useful for both Old and New World species of Leishmania.
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_1, © Springer Science+Business Media, LLC, part of Springer Nature 2019
1
2 Dan Zilberstein and Roni Nitzan Koren
2 Materials
2.1 Promastigote 1. Earls based medium 199 (M4530, Sigma-Aldrich Ltd., MO)
Growth Medium supplemented with 10% heat inactivated fetal bovine serum,
0.1 mg/ml streptomycin, and 100 U/ml penicillin.
2. In many cultures, hemin, adenine, and biotin are added, as in
many strains they are essential for promastigote growth.
3. We recommend that each laboratory use their own protocol
for axenic growth of promastigotes.
2.2 Amastigote 1. Earls based medium 199 supplemented with 10 mM succinic
Growth Medium acid, 25% fetal bovine serum, 0.1 mg/ml streptomycin, and
100 U/ml penicillin. Titrate to pH 5.5 with HCl and finally
filter to sterilize.
2. Additional supplements such as hemin, adenine, and biotin
should be added according to local protocols.
3 Methods
3.1 Protocol 1. The following protocol was designed for L. donovani. However,
for Axenic it should work equally well for all Old World species such as L.
Promastigote infantum and L. tropica. Interestingly, efforts to differentiate
to Amastigote axenic L. major promastigotes into amastigotes failed. They do
Differentiation differentiate inside macrophage cell lines but not in axenic cul-
ture [12].
2. Spin down late log phase promastigotes (2-day-old culture,
1 × 107 cells/ml) at 1200 × g in a swing out centrifuge (10 min,
room temperature).
3. Discard supernatant and then suspend pellet in a room tem-
perature prewarmed amastigote medium to the same cell
density.
4. Transfer the cell suspension into sterile plastic flasks and subse-
quently incubate at 37 °C in a 5% CO2 incubator for 24 h.
5. On the second day, dilute the culture 1:10 by adding a 37 °C
prewarmed amastigote medium and then transfer to larger
flasks. (Note: Do not exceed the recommended volume indi-
cated on each flask.)
4 Dan Zilberstein and Roni Nitzan Koren
Fig. 1 Axenic amastigotes (a) and promastigotes (b) of L. donovani. Immunofluorescence of mature parasite of
each stage. Cells were stained with anti-membrane antibodies kindly provided by Dr. Dennis, M. Dwyer [8] and
DNA with propidium iodide
3.2 Morphological 1. Our analyses of two decades indicated that L. donovani pro-
Assessment mastigote to amastigote differentiation is a highly regulated
of Differentiation process [13]. Barak et al., [7], determined time course of mor-
phological development. They divided differentiation into
four phases (Table 1): Phase 1 (t = 0–4 h), signal perception
and processing period. During this time parasites undergo cell
cycle arrest at G1 [7]. Phase 2 (t = 5–9 h) cells cease move-
ment, aggregate, and start rounding. Phase 3 (t = 10–23 h)
Host-Free Systems for Differentiation of Axenic Leishmania 5
Table 1
Morphological time course of L. donovani promastigote to amastigote
differentiation
3.3 Cell Aggregation 1. We found that in the second phase of axenic differentiation the
Is Essential parasites start to aggregate. In an unpublished study we observed
for Differentiation that at around 5–7 h after differentiation initiated parasites
Progression release an adhesion molecule that induces aggregation.
6 Dan Zilberstein and Roni Nitzan Koren
Fig. 3 Expression of LdteCi during L. donovani promastigote to amastigote differentiation. Western blot of
L. donovani at indicated time point of differentiation. Cell lysate proteins was subjected to Western bolt and
then interacted with anti-LdreCi that we raised [14]
4 Notes
References
1. Zilberstein D (2018) Nutrient transport and ization of Leishmania mexicana amastigote-
sensing as pharmacological targets for leish- like forms. Parasitology 105(Pt 2):193–202
maniasis. In: Rivas L, Carmen G (eds) Drug 10. Debrabant A, Joshi MB, Pimenta PF, dwyer
discovery for leishmaniasis, Drug discov- DM (2004) Generation of Leishmania don-
ery, vol 60. The Royal Society of Chemistry, ovani axenic amastigotes: their growth and
Cambridge, UK, pp 282–296 biological characteristics. Int J Parasitol 34(2):
2. Harms E, Gochman N, Schneider JA (1981) 205–217
Lysosomal pool of free-amino acids. Biochem 11. Goyard S, Segawa H, Gordon J, Showalter M,
Biophys Res Commun 99(3):830–836 Duncan R, Turco SJ, Beverley SM (2003) An
3. Burchmore RJ, Barrett MP (2001) Life in in vitro system for developmental and genetic
vacuoles--nutrient acquisition by Leishmania studies of Leishmania donovani phosphogly-
amastigotes. Int J Parasitol 31(12):1311–1320 cans. Mol Biochem Parasitol 130(1):31–42
4. Zilberstein D, Shapira M (1994) The role of 12. Zilberstein D (2008) Physiological and bio-
pH and temperature in the development of chemical aspects of Leishmania develpment.
Leishmania parasites. Annu Rev Microbiol In: Myler PJ, Fasel N (eds) Leishmania after
48:449–470. https://doi.org/10.1146/ the genome: biology and control. Horizon
annurev.mi.48.100194.002313 Scientific Press and Caiser Academic Press,
5. Zilberstein D, Blumenfeld N, Liveanu V, New York, pp 107–122
Gepstein A, Jaffe CL (1991) Growth at 13. Rosenzweig D, Smith D, Opperdoes F, Stern
acidic pH induces an amastigote stage- S, Olafson RW, Zilberstein D (2008) Retooling
specific protein in Leishmania promastigotes. Leishmania metabolism: from sand fly gut to
Mol Biochem Parasitol 45(1):175–178. human macrophage. FASEB J 22(2):590–602.
doi:0166-6851(91)90040-D [pii] https://doi.org/10.1096/fj.07-9254com
6. Doyle PS, Engel JC, Pimenta PF, da Silva 14. Bachmaier S, Witztum R, Tsigankov P, Koren
PP, Dwyer DM (1991) Leishmania donovani: R, Boshart M, Zilberstein D (2016) Protein
long-term culture of axenic amastigotes at kinase a signaling during bidirectional axenic
37 degrees C. Exp Parasitol 73(3):326–334. differentiation in Leishmania. Int J Parasitol
https://doi.org/0014-4894(91)90104-5 46(2):75–82. https://doi.org/10.1016/j.
[pii] ijpara.2015.09.003
7. Barak E, Amin-Spector S, Gerliak E, 15. Saxena A, Lahav T, Holland N, Aggarwal G,
Goyard S, Holland N, Zilberstein D (2005) Anupama A, Huang Y, Volpin H, Myler PJ,
Differentiation of Leishmania donovani in Zilberstein D (2007) Analysis of the Leishmania
host-free system: analysis of signal perception donovani transcriptome reveals an ordered pro-
and response. Mol Biochem Parasitol 141(1): gression of transient and permanent changes in
99–108 gene expression during differentiation. Mol
8. Saar Y, Ransford A, Waldman E, Mazareb Biochem Parasitol 152(1):53–65. https://
S, Amin-Spector S, Plumblee J, Turco SJ, doi.org/10.1016/j.molbiopara.2006.11.011.
Zilberstein D (1998) Characterization of S0166-6851(06)00332-X [pii]
developmentally-regulated activities in axenic 16. Mengeling BJ, Zilberstein D, Turco SJ (1997)
amastigotes of Leishmania donovani. Mol Biosynthesis of Leishmania lipophosphogly-
Biochem Parasitol 95(1):9–20 can: solubilization and partial characterization
9. Bates PA, Robertson CD, Tetley L, Coombs of the initiating mannosylphosphoryltransfer-
GH (1992) Axenic cultivation and character- ase. Glycobiology 7(6):847–853
Chapter 2
Phylogenetic Studies
Katrin Kuhls and Isabel Mauricio
Abstract
Phylogenetics is an important component of the systems biology approach. Knowledge about evolution of
the genus Leishmania is essential to understand various aspects of basic biology of these parasites, such as
parasite–host or parasite–vector relationships, biogeography, or epidemiology. Here, we present a compre-
hensive guideline for performing phylogenetic studies based on DNA sequence data, but with principles
that can be adapted to protein sequences or other molecular markers. It is presented as a compilation of
the most commonly used genetic targets for phylogenetic studies of Leishmania, including their respective
primers for amplification and references, as well as details of PCR assays. Guidelines are, then, presented to
choose the best targets in relation to the types of samples under study. Finally, and importantly, instruc-
tions are given to obtain optimal sequences, alignments, and datasets for the subsequent data analysis and
phylogenetic inference. Different bioinformatics methods and software for phylogenetic inference are pre-
sented and explained. This chapter aims to provide a compilation of methods and generic guidelines to
conduct phylogenetics of Leishmania for nonspecialists.
Key words Leishmania, Phylogenetics, Genetic markers, DNA sequence analysis, Single locus
approaches, Multilocus approaches, Taxonomic levels, Phylogenetic inference methods, Phylogenetic
inference software
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_2, © Springer Science+Business Media, LLC, part of Springer Nature 2019
9
10 Katrin Kuhls and Isabel Mauricio
Applicable for
Marker clinical/biological
Gene category Product category symbol Marker’s full name Copy number Chromo-some material Technical remarks
Nuclear
Ribosomal rRNA SSU Small subunit Multicopy 27 Yes Different authors have used different
DNA ribosomal DNA (10-20) nonoverlapping fragments; working
(18S rDNA) with clinical material might be
problematic in case of coinfections
with different Trypanosomatids
because most primers are highly
conserved
ITS1, ITS2 Internal transcribed Multicopy 27 Yes Alignment of distantly related
spacer 1 and 2 (10-20) taxa is often problematic due to many
indels; sequencing can be problematic
because of homopolymer or
microsatellite tracks and copy
heterogeneity or heterozygosity
SL RNA Miniexon Spliced Multicopy Various Yes Sequencing problems due to differences
SL RNA leader-miniexon (100-200) in copies and due to homopolymer
stretches
Small nuclear snRNA 7SL RNA 7SLRNA Single copy 5 (Yes)a Originally small fragment (~180 bp),
RNA improved method by Stevenson et al.
coding [52] (extended fragment of ~385 bp)
validated only with few strains
Protein Ribosomal protein L23a L23a intergenic Single copy 6 Not tested
coding intergenic region of 60S
genes region ribosomal protein
(continued)
Table 1
(continued)
Applicable for
Marker clinical/biological
Gene category Product category symbol Marker’s full name Copy number Chromo-some material Technical remarks
Antigenic proteinb HSP70 Heat shock protein Multicopy 26, 28, 30, 35 Yes One of the best validated markers with
70 (5-10) high sensitivity; PCR-G primers not
optimal for subgenus L. (Leishmania)
Enzymes RPOIILS RNA polymerase II Single copy 31 (30 Lmex) (Yes)a
largest subunit
POLA DNA polymerase I α Single copy 16 (Yes)a
catalytic subunit
gGAPDH Glycosomal Single copy 30 Not tested
glyceraldehyde
phosphate
dehydrogenase
NAGT N-acetylglucosamine- Single copy 36 (Lmaj, Not tested
1-phosphate Linf), 35
transferase (Lbra)
Kinetoplast (mitochondrial)
kDNA CYTB Cytochrome b Multicopy Maxicircle Yes
maxicircle (25-50)
COII Cytochrome oxidase Multicopy Maxicircle (Yes)a
subunit II (25-50)
CYTC Cytochrome c Multicopy Maxicircle (Yes)a
(25-50)
a
Amplification of clinical material has been shown to be possible, however, it has not been extensively validated for phylogenetic studies;
b
Metalloprotease glycoprotein 63 (GP63) (Major surface protein - MSP) [68–72] and Cysteine protease B (CPB) [72, 73], both multicopy genes that are frequently used for RFLP-typing of
Leishmania at species level, can be impractical for phylogenetic analysis by sequencing due to the occurrence of nonidentical isogenes. Lmex - L. mexicana; Lmaj - L. major; Linf - L. infantum;
Lbra - L. braziliensis
Phylogenetic Studies 13
Table 2
Taxonomic levels covered by the most frequently used markers for phylogenetic studies of the genus
Leishmania
Taxonomic levelb
Family Trypanosomatidae
Genus Leishmaniac
Sections
Markera All genera (EuL, ParaL) Subgenera Complexes Species Intraspecies
SSU x x (x)d
ITS x x x x x
Miniexon (x)e n.a. xf xf xf, g (x)
7SL RNA n.a. xh (x)i
HSP70j n.a. x x x x
RPOIILS k
x x x (x) n.a.
POLAk x x x (x) n.a.
gGAPDH x n.a.
NAGT k
n.a. x x (x) n.a.
L23a x x x
CYTBk n.a. x x x (x) n.a.
COXII k
x x (x) (x)
CYTC k
x x (x) (x)
MLSTl n.a. x x x x x
a
Used with the presented protocols
b
Differentiation of the taxonomic units of this level
c
According to the recently updated taxonomy [12, 13]
d
Subgenera partially differentiated—not fully validated
e
Studied only with primers ME-1/ME-2
f
Only subgenera L. (Leishmania) and L. (Viannia) studied
g
Nearly all species differentiated (not BRA/PER; GUA/PAN; no sequence obtained for LAI)
h
Only subgenera L. (Viannia) and L. (Leishmania) studied so far
i
Different results according to the fragment used: LeishFW/LeishRV (465 bp fragment) differentiates the studied com-
plexes (MAJ, TRO, DON, MEX, BRA, GUA—but not all species were included), TRY7SL.FOR1/TRY7SL.REV1
(185 bp) partially discriminates the complexes of subgenus L. (Leishmania); but not of subgenus L. (Viannia)
j
HSP70 has not been used for studies of Paraleishmania nor for subgenus L. (Sauroleishmania). For subgenus L.
(Mundinia) only L. siamensis has been sequenced
k
Not all complexes including all species (especially for subgenus L. (Viannia)) and a representative set of strains per
species have been studied so far
l
Paraleishmania and subgenera L. (Sauroleishmania), L. (Mundinia) and Porcisia poorly studied; n.a.—not studied;
(x)—not validated, only single strains per species studied. EuL—Euleishmania; ParaL—Paraleishmania
14 Katrin Kuhls and Isabel Mauricio
SSU rRNAb S1 GAT CTG GTT GAT S4 GAT CCA GCT GCA 55 2200 Complete L. donovani 1-2200 Uliana et al. [87]
TCT GCC AG GGT TCA CC X07773c
S12 GGT TGA TTC CGT S4 GAT CCA GCT GCA n.d. 539 Partial L. donovani 1661-2200 Uliana et al. [87]; Bualert
CAA CGG AC GGT TCA CC X07773c et al. [88]; Leelayoova et al.
[27]
R222 TAT TGG AGA TTA R333 AAA GCG GGC GCG 50 392 Partial L. donovani 961-1353 Van Eys et al. [33]; Guan
TGG AGC TG GTG CTG X07773c et al. [26]
R221 GGT TCC TTT CCT R332 GGC CGG TAA AGG 60 603 Partial L. donovani 790-1393 Van Eys et al. [33];
GAT TTA CG CCG AAT AG X07773c Meredith et al. [89]
Schönian et al. [90]
R223 TCC CAT CGC AAC R333 AAA GCG GGC GCG 65 358 Partial L. donovani 995-1353 Van Eys et al. [33]
CTC GGT T (Leishmania GTG CTG (Leishmania X07773c Schönian et al. [90]
specific) specific)
S-763 CAT ATG CTT GTT S-762 GAC TTT TGC TTC 50 2138 Nearly complete L. donovani 25-2163 Maslov et al. [14]
TCA AGG AC CTC TAW TG X07773c
609F CAC CCG CGG TAA 706R CTG AGA CTG TAA 48 842 Partial L. donovani 618-1460 barcoding da Silva et al. [91];
TTC CAG C CCT CAA X07773c region V7-V8 Marcili et al. [28]
Lei70L CGC AAC CTC GGT Lei70R CGC GGT GCT GGA 65 ~345 Partial L. infantum 381-725 Spanakos et al. [74, 84]
TCG GTG TG CAC AGG GTA M81429
ITS1 LITSR CTG GAT CAT TTT 5.8S TGA TAC CAC TTA 53 ~320 Complete ITS1 L. donovani LITSR starts in p. 2184 El Tai et al. [80]
CCG ATG TCG CAC TT X07773 of SSU gene; 5.8S
p. 71-52 in 5.8S gene
LeF TCC GCC CGA AAG LeR CCA AGT CAT CCA 65 ~350 Complete ITS1 L. donovani LeF starts in p.2117 of Spanakos et al. [84]
TTC ACC GAT A TCG CGA CAC G X07773 SSU gene; LeR
p. 3–24 in 5.8S gene
ITS2b 5.8SR AAG TGC GAT AAG LITSV ACA CTC AGG TCT 53 ~600 Complete ITS2 L. donovani 5.8SR: p.52–68 of 5.8S El Tai et al. [80, 92]
TGG TA GTA AAC X07773 gene; LITSV: ends in
p. 1–14 of LSU gene
LGITSF2 GCA TGC CAT ATT LGITSR2 GGC CAA CGC GAA 60 370- Partial ITS2 L. donovani LGITSF2: p. 147–167 de Almeida et al. [86]
CTC AGT GTC GTT GAA TTC 450 AJ634378.1 of 5.8S gene; LGITSR2
p. 377–397 of ITS2
LGITSF2 GCA TGC CAT ATT LGITSR1 GAA TTC TCG TTT 60 370- Partial ITS2 L. donovani LGITSF2: p. 147–167 de Almeida et al. [86]
CTC AGT GTC TGG TTT TTT G 450 AJ634378.1 of 5.8S gene;
LGITSR1: p. 361–382
of ITS2
(continued)
Table 3
(continued)
ITS1+2 IR1g GCT GTA GGT GAA IR2g GCG GGT AGT CCT 55 1000- Complete L. braziliensis IR1: p. 33–1 of 3′ end Cupolillo et al. [67]
CCT GCA GCA GCT GCC AAA CAC TCA 1200 ITS1+ITS2 JQ061322.1 of SSU gene; IR2:
GGA TCA TT GGT CTG p. 2–31 in LSU gene
Miniexon Fme TAT TGG TAT GCG Rme ACA GAA ACT GAT 54 221- Complete unit L. major Friedlin 271.227-271.680 in Marfurt et al. [55]; van
SL RNA AAA CTT CCG ACT TAT ATA GCG 442 chr.2 units 4/5 as example der Auwera et al. [53]
FR796398.1
FME2 ACT TCC GGA ACC ME2R CAG AAA CTG ATA 55 variable Partial unit L. major Friedlin 271.217-271.689 in Roelfsema et al. [58]
TGT CTT CC CTT ATA TAG CGT chr.2 units 4/5 as example
(subgenus Leishmania) TA FR796398.1
ACT TCC GGG ACC
CGT CTT CC (subgenus
Viannia)
ME-1 TTC TGT ACT TTA ME-2 CAA TAA AGT ACA 65/50 variable Complete unit L. major Friedlin 271.227-271.680 in Podlipaev et al. [54];
TTG GTA GAA ACT G chr.2 units 4/5 as example Fernandes et al. [75, 76];
FR796398.1 Svobodova et al. [32]
7SL RNA TRY7SL. gta aaa cga cgg cca gt TRY7SL. cag gaa aca gct atg ac 65 ~ 185d Partial L. tropica 160-343 Zelazny et al. [51]; van
FOR1 GC TCT GTA ACC REV1 GGC TGC TCC GTY FJ525420 der Auwera et al. [53];
TTC GGG GGC T NCC GGC CTG ACC Guan et al. [26]
(lower case = M13 tail) C (lower case = M13
tail)
LeishFW gta aaa cga cgg cca g LeishRV cag gaa aca gct atg ac 65 ~465 Partial L. tropica part of tRNA gene and Stevenson et al. [52]
CAT CCG TGA CAG CGT GGG GCT CAA FJ525420.1 a 98 bp spacer region
GAT TCG AAC C GTG CGG ACA TG followed by partial 7SL
RNA gene
L23a RD6LF gta aaa cga cgg cca gtg RD6LR cag gaa aca gct atg ac C 58 595 Complete L. major 201.161-202.755 Dougall et al. [38];
intergenic GAA GGT CAA CAC TTC TTG GCG GTC intergenic region FR796402.1 Kwakye-Nuako et al. [40]
region 60S CCT GAT CC (lower TTC TGA (lower case (459) chromosome 6
ribosomal case letter = M13 tail) letter = M13 tail)
protein
HSP70b HSP70-F25 GGA CGC CGG CAC HSP70-R1310 CCT GGT TGT TGT 61 1286 Partial PCR-F L. major 480-1765 Montalvo et al. [65]; van
GAT TKC T TCA GCC ACT C XM_001684512 der Auwera et al. [66]
HSP70-F25 GGA CGC CGG CAC HSP70-R617 CGA AGA AGT CCG 61 593 Partial PCR-N L. major 480-1072 Montalvo et al. [65], van
GAT TKC T ATA CGA GGG A XM_001684512 der Auwera et al. [66]
HSP70-F251 GAC AAC CGC CTC HSP70-R991 GTC GAA CGT CAC 65 741 Partial PCR-C L. major 706-1446 Montalvo et al. [65],
GTC ACG TTC CTC GAT CTG C XM_001684512 van der Auwera et al. [66]
HSP70-6F GTG CAC GAC GTG HSP70-R1310 CCT GGT TGT TGT 61 766 Partial PCR-T L. major 1000-1765 van der Auwera et al. [66]
GTG CTG GTG TCA GCC ACT C XM_001684512
HSP70sen= GAC GGT GCC TGC HSP70ant= CCG CCC ATG CTC 61 1422 Partial PCR-G L. major 435-1856 Garcia et al. [60];
HSP70for CTA CTT CAA HSP70rev TGG TAC ATC XM_001684512 Montalvo et al. [63],
Fraga et al. [61]
Hspf TGC GCA TCA TCA Hspr ATC TGG GTC ATG 55 1327 Partial (complete L. major 512-1838 Espinosa et al. [13]
ACG AGC C ATC GGG TT G C 1977) XM_001684512
POLAb DNAP AAC GAG CGC GCR DPO2 GCC GAG GCA GCC 53 1050 Partial (complete L. donovani 1522-2571 Croan et al. [35] (rev
CTG CTY GAC TGG ATA CAT 4023) XM_00385980 primer); Noyes et al. [34]
and Noyes pers. comm. (fw
primer); Kuhls et al. [36]
RPOIILSb RPOF1 GAC ACA GCC GTC RPOR1 GCA GCC GCA CAA 56 (60)f 1300 Partial (complete L. donovani 2413-3712 Croan and Ellis [93];
AAG AC TGC GCT 4989) XM_003863307 Croan et al. [35]; Dougall
et al. [38]; Kwakye-Nuako
et al. [40]; Pothirat et al.
[39]
“RPOF1HN” GTA AGC GAG CCA RPOR1 GCA GCC GCA CAA nd 833 Partial L. donovani 2879-3712 Noyes et al. [34]
GGT GT TGC GCT XM_003863307
M172 CGA CAC AGC CGT M173 GGA CGC AGC CGC 70 1305 Partial L. donovani 2412-3716 Yurchenko et al. [30, 31]
CAA GAC GTC CGA C ACA ATG CGC TGG XM_003863307
gGAPDH G1 CGC GGA TCC ASG G2 CGC GGA TCC CCB 55 ~600 Partial L. major nd Hannaert et al. [94];
GYC TYM TCG GBA ACV GCY TTS GCS (complete 1086) FR796426.1 Hamilton et al. [23],
MKG AGA T CGR CCA GT Marcili et al. [28]
G3 TTY GCC GYA TYG G4a GTT YTG CAG SGT 55 927 Partial L. donovani 31-957 Hamilton et al. [23]
GYC GCA TGG CGC CTT GG XM_024473481
G3 TTY GCC GYA TYG G4b CCA MAG SAC VAY 55 969 Partial L. donovani 31-999 Hamilton et al. [23]
GYC GCA TGG CTT GAA GAA XM_024473481
G3 TT YGCC GYA TYG G5 ACM AGR TCC ACC 55 1013 Partial L. donovani 31-1043 Hamilton et al. [23]
GYC GCA TGG ACR CGG TG XM_024473481
(continued)
Table 3
(continued)
NAGTb L1 TCA TGA CTC TTG L4 CTC TAG CGC ACT 58 1405 Complete L. mexicana 1497-2901 Akman et al. [77];
GCC TGG TAG TCA TCG TAG (1401) M96635 Waki et al. [41]
CYTB COIIIF taa tac gac tca cta taG MURF4R ggg ttt tcc cag tca cga 50 1338 Complete L. tarentolae 5271-6609 Luyo Acero et al. [42];
kDNAb TTT ATA TTG ACA cgA ATC TCT CTC (complete 1079) M10126 Asato et al. [45]; Yang et al.
TTT TGT WGA TTe TCC CTTe [46]
Lcyt-S = GGT GTA GGT TTT L.cyt-R = CTA CAA TAA ACA 55 865 Partial L. tarentolae 5456-6321 Kato et al. [43]
LCBF1 AGT YTA GG LCBR2 AAT CAT AAT ATR M10126 Luyo-Acero et al. [42]
CAA TT
LEI-CYTB9 TTA TGG TGT AGG LEI-CYTB10 CCA TCC GAA CTC 55 539 Partial L. tarentolae 5452-5991 Foulet et al. [44]
TTT TAG TYT AGG TT ATA AAA TAA TGT M10126 (first part of over-
lapping fragments of
total size of 939 bp)
LEI-CYTB11 TTT GTT ATT GAA LEI-CYTB12 TGC TAA AAA ACC 55 544 Partial L. tarentolae 5847-6391 Foulet et al. [44]
TWT GAG GWA GTG A ACT CAT AAA TAT M10126 (second part of
ACT over-lapping fragments
of total size of 939 bp)
CytB/F1 ATG CAT TTR TTT CytB/R2 GAA CTT CKA CAA 52 377 Partial L. tarentolae 5951-6327 Lopes et al. [47]
TGT TTA CAT TAT TAH ACA AAT CAT M10126
TTT A AAT A
COII COII-F ATG GCT TTT ATA COII-R GGC ATA AAT CCA 50 606 Partial (complete L. tarentolae 9496-10102 Ibrahim and Barker [49];
kDNA TTA TCA TGT AAG 629) M10126 1-606 Cao et al. [50]
L. major
EF633106.1
CytOxII/F1 TGG CTT TTA TWT CytOxII/R2 GCA TAA ATC CAT 52 604 Partial L. tarentolae 9497-10101 Lopes et al. [47]
TAT CAT TTT GAA TG GTA AAA CAC CAC A M10126 2-605
L. major
EF633106.1
a
References in bold: first description of the assay with the respective primers; in italics: applied by these authors for phylogenetic inference
b
Additional internal sequencing primers are listed in Table 6
c
Sequence published by Looker et al. [95]
d
Size is slightly variable depending on the species
e
Lower case bases do not form part of the consensus sequences found for parasites of the order Kinetoplastida
f
Annealing temperature 60 °C according to [93]
g
Assay developed for L. (Viannia); nd—not defined; Tann - annealing temperature; all primer combinations described in detail in the methods part are marked (bold)
Table 4
Detailed information for PCR amplification of the targets used in multilocus approaches (MLST) for phylogenetic studies of Leishmania
Aspartate ASAT ASAT-F2new ACG AGC GCC ASAT-R2new TTC CYM CAT 24, 34 or 35 60 1239 (1283) 1-1283 Yesb Mauricio et al. [96];
aminotransferase GTC CGY AA CCA CCA AGC [Ldon AJ620798] Herrera et al. [97]
Glucose-6-phosphate GPI GPI-F3 GAA TCC CTT TTC GPI-R4 CCC CTG AGA 12 58 1818 (1971) 293715-295685 Yesb Mauricio et al. [96]
isomerase AAG ATG AGC GAT GGC AAT CAC AG [Lmaj FR796408]
TAT
GPIextF AAT GTT CTT CAT GPIextR TTC CGT CCG 12 53 1746 (2085) 197250-199334 Yesc Tsukayama et al. [98]
ACC CCT CT TCT CCT G [Lper LN609242]
Nucleoside hydrolase 1 NH1 NH1-F1 CTT GCT TAC GCC NH1-R3 GAA AAA AAA GAC 18 65 945 (1103) 695227-696329 Yesb Mauricio et al. [96]
GCA GAT AC GCT TCA CAC [Ldon FR799605]
AAG C
Nucleoside hydrolase 2 NH2 NH2-F10 ACG TGG GCG NH2-R6 GCC ATC TAC ACC 14 60 1059 (1272) 32239-33510 Yesb Mauricio et al. [96]
AAC GCA C TTC AGT GCC [Lmaj FR796410]
TCG GTC
6-phosphogluconate 6PGD PGD-F1 GAA CGA ATC CCT PGD-R2 GGA ACC GGT 35 60 1440 (1508) 1363319-1364826 Yesb Mauricio et al. [96];
dehydrogenase TAT TCT CYA TG TGA GCG GC [Lmaj FR796431] Zhang et al. [99]
c
6PGDextF CAC CAG TCC GCT 6PGDextR GCC TCT GTA TTT 34 53 1440 (1730) 1298520-1300249 Yes Tsukayama et al. [98]
CCC T CAC GCT TC [Lper LN609261]
PGD-F- CTC AAG GAA CAT PGD-R- TTG TCC TTGACT 34 55 1440 (836) 1299154-1299989 Boité et al. [100];
VIAN GAG CAC GA VIAN TGC TCA CG [Lper LN609261] Marlow et al. [101]
Isocitrate ICD ICD-F ATG TTC CGC CAT ICD-R TTA CGC GCT CAT 33,10 55 1308 (1308)e 1-1308 Yesd Zemanová et al. [102];
dehydrogenase GTT TCG GC CGC CTT [Ldon DQ449696.1] Zhang et al. [99]
ICD-F-VIAN GAA TCG GGA ICD-R-VIAN CAT CAT AGC CCC 33,10 55 1278 (1022)e 1125372-1126393 Boité et al. [100];
AGG AGA TCA CA AGA GAG GA [Lper LN609230.1] Marlow et al. [101];
Herrera et al. [97]
Cytosolic NADP-malic ME ME-F CGC AAC CGC TTC ME-R CAA CTC CTT CTC 24 50 1722 (1644) 1-1644 Yesd Zemanová et al. [102]
enzyme ACC AAT AAG GGC CAG GTA GTA GTT [Ldon DQ449725.1]
Mannose phosphate MPI MPI-F ATG TCT GAG CTC MPI-R CTA CCT GTC 32 55 1266 (1266) 1-1266 Yesd Zemanová et al. [102];
isomerase GTA AAG CT GCT CAA GTC [Ldon DQ449761.1] Zhang et al. [99]
MPI-F-VIAN GGC AAG ATG TAT MPI-R-VIAN CTC CCC AGG 32 58 1287 (681) 109-789 Boité et al. [100];
GCG GAG TT AAC CAT CTG TA [Lper EU327917.1] Marlow et al. [101];
Herrera et al. [97]
MPIextF CCC TTT GGT TGT MPIextR TCA TAC GCA TAG 53 1266 (1463) 636737-638199 yesc Tsukayama et al. [98]
CGG T GAG CA [Lper LN609248.1]
(continued)
Table 4
(continued)
Glucose 6-phosphate G6PDH G6PDH-F ATG TCG GAA GAG G6PDH-R TCA CAG CTT ATT 34 50 1689 (1689) 1-1689 Yesd Zemanová et al. [102];
dehydrogenase CAG TCT CGA GGG AA [Ldon DQ449794.1] Zhang et al. [99]
G6PDH-F- ATG GAA GCG TGT G6PDH-R- GGC TCAA CAC 20 55 1686 (881) 53052-53932 Boité et al. [100];
VIAN GAT CGA AT VIAN ACT TCA GCA A [Lper LN609251.1] Herrera et al. [97]
Fumarate hydratase FH FH-F AGC GTC TTG TGT FH-R GAG CCC GTG 24, 28,29 58 1707 (1780) 880070-881849 Yesd Zemanová et al. [102];
TTC CCA TAA GGA GGC [Ldon FR799616.2] Zhang et al. [99]
Phosphoglucomutase PGM PGM-F CAG AGA AGC TGA PGM-R GAC GGG TTC 21 55 1770 (529) 196977-197505 Marco et al. [103];
CGT CCC AG ACG AAG AAG CG [Linf FR796453] Herrera et al. [97]
Alanin aminotransferase ALAT ALAT-F GTG TGC ATC AAC ALAT-R CGT TCA GCT 12 55 1494 (586) 349132-349617 Marco et al. [103];
CCM GGG AA CCT CGT TCC GC [Linf FR796444.1] Herrera et al. [97]
Cytochrome b CYTB Cytb-F AGC GGA GAG Cytb-R GYT CRC AAT AAA kDNA 60 1079 (620) 5404-6023 Herrera et al. [97]
RAR AGA AAA GG ATG CAA ATC [Ltar M10126]
Elongation initiation EF-2α EF-F TTC CAG TTG ACT EF-R GAC GGA GAG 3 58 1299 (859) 221-1080 [Lmaj El Baidouri et al. [104];
factor 2 alpha subunit GCA GAA CG GTG GAT CTG AG XM_003721726] Bualert et al. [88];
381480-382338 Chaara et al. [105];
[Lmaj FR796399] Shaw et al. [106]
Spermidine synthase 1 SRM1 SRM1-F CAG GCC CTG SRM1-R GTG CAT GTC 4 58 903 (851) 239226-240076 El Baidouri et al. [104];
GTC TTC TGC GCT GCT GTA AT [Lmaj FR796400] Bualert et al. [88]
Chaara et al. [105]
SPDSYN.F CGA ACC TGT SPDSYN.R GAY TCG CCC 4 55 903 (394) 239455-239848 Marco et al. [103]
CGC TGA CGT G TGG TTG CAC AC [Lmaj FR796400]
Zinc-binding DH-like DH-like-F GAG AAG CCA DH-like-R GAA GAC GTA 10 58 1116 (858) 285563-286420 El Baidouri et al. [104];
dehydrogenase-like GCC TTG AAG TG GTG CAC CGA CA [Lmaj FR796406] Chaara et al. [105]
protein
Translation initiation TIFα TIF-F AGA GGA TGG TIF-R CAG AAG GAG 12 58 1011 (891) 2825-3715 El Baidouri et al. [104];
factor alpha subunit ACG TCC CAA G CCG TGT GAA A [Lmaj FR796408] Chaara et al. [105];
Shaw et al. [106]
Nucleoside hydrolase- NH-like NH-like-F GAA CCA GGG AAT NH-like-R TTC CAA GAA 14 58 1059 (898) 32482-33379 El Baidouri et al. [104];
like protein GGA GAA CA GCG AGC GTT AT [Lmaj FR796410] Chaara et al. [105];
Shaw et al. [106]
Conserved hypothetical consHP consHP-F ATG AGG CGT CTC consHP-R CGG CGT TCT 31 58 1026 (1000) 73972-74971 El Baidouri et al. [104];
protein CTT CAC AA TGA GTG CTT [Lmaj FR796427] Chaara et al. [105]
Largest subunit of RPOLIILS RPOLIILS-F AAG TAC CAG CAG RPOLIILS-R GCA GCC GCA 30 or 31 58 4989 (567) 3145-3712 El Baidouri et al. [104];
RNA polymerase II TCC CTC ATC CAA TGC GCT [Ldon Bualert et al. [88];
XM_003859800] Chaara et al. [105];
Shaw et al. [106]
Heat shock protein 70 HSP70 HSP70for GAC GGT GCC HSP70rev CCG CCC ATG 1, 28, 61 1977 (1422) 435-1856 Yes Zhang et al. [99]; Marlow
TGC CTA CTT CAA CTC TGG TAC ATC 29,34, 35 [Lmaj (Table 6) et al. [101] Garcia et al.
XM_001684512] [60]; Fraga et al. [61]
Aconitase ACO ACO.F CAA GTT CCT GRC ACO.R GAG TCC GGG 18 55 2691 (579) 203986-204564 Marco et al. [103]
GTC TCT GC TAT AGC AKC CC [Linf FR796450]
Enolase ENO ENOL.F GCT GCC GAT CCT ENOL.R ACC CGT TCT 14 55 1290 (431) 663-1093 Marco et al. [103]
GAT GGA GG CCA TGC ACA GC [Linf
XM_001464266]
Hypoxanthine-guanine HGPRT HGPRT.F GCT CTA CCT GCT HGPRT.R ATC GCG CAG 21 55 636 (412) 311121-311532 Marco et al. [103]
phosphoribosyl- GTG CGT GC CTC GCG RTA CG [Linf FR796453]
transferase
Phosphomannomutase PMM PMM.F TTC AAG CTT GGC PMM.R TAA TCG TTR CCG 35,36 55 744 (536) 112-647 Marco et al. [103]
GTC GTC GG CCC TCT GA [Linf
XM_001469750]
Leishmania homolog of LACK Lack-F ACC ATG AAC TAC Lack-R TTA CTC GGC 28 41 939 (942) 1080458-1081399 Gonzalez-Aseguinolaza
receptors for activated GAG GGT CAC CT GTC GGA GAT [Ldon FR799615.2] et al. [78]; Zhang et al.
protein kinase [99]
Mitochondrial malate MDHMT Mdhmt-F TGC CGA CCT CTT Mdhmt-R GAG TGA GGT 34+20 52 978 (821) 1813-2633 Marlow et al. [101]
dehydrogenase CCA TAT TC GCG TCT TCA CA [Lbra FR798994.1]
Nuclear malate MDHNC Mdhnc-F TCA CAA CCG CAA Mdhnc-R CTA CTC ACG ATA 34+20 52 954 (1156) 9165-10320 Marlow et al. [101]
dehydrogenase CTA CGA ACG GCA GA [Lbra FR798994.1]
MDH MDHextF TCA CAA CCG CAA MDHextR CTA CTC ACG ATA 34+20 53 954 (1156) 9165-10320 Yesc Tsukayama et al. [98]
CTA CGA ACG GCA GA [Lbra FR798994.1]
a
Gene size in bold, amplicon size in parentheses
b
Sequences of the internal primers used for sequencing is given in Mauricio et al. [96]
c
Sequences of the internal primers used for sequencing is given in Tsukayama et al. [98]
d
Sequences of the internal primers used for sequencing is given in Zemanová et al. [102]
e
ICD has two genes, one located at chromosome 10 (1308 bp), the other at 33 (1278 bp)
f
References in bold: first description of the assay with the respective primers; in italics: applied by these authors for phylogenetic inference; Tann - annealing temperature; Lbra - L. braziliensis, Ldon -
L. donovani, Linf - L. infantum, Ldon - L. donovani, Lper - L. peruviana, Ltar - L. tarentolae
Table 5
22
MLST Set Marker symbol Species included in the phylogenetic treea References
Set 1 EF-2α, SRM1, DH-like, TIF-2α, L. infantum, L. donovani, L. tropica, L. killicki, L. aethiopica, L. major, L. El Baidouri et al. [104];
NH-like, ConsHP, RPOIILS turanica, L. gerbilii Chaara et al. [105]
Set 1-sub EF-2α, SRM1, RPOIILS L. siamensis, L. enrietti, L. tarentolae, L. braziliensis, L. panamensis, L. lainsoni, Bualert et al. [88]
L. naiffi, L. amazonensis, L. mexicana, L. donovani, L. infantum, L. tropica, L.
killicki, L. aethiopica, L. major, L. gerbilli, L. turanica, L. arabica (outgroup
Leptomonas culicidarum)
Set 1-sub EF-2α, TIF-2α, NH-like, L. waltoni, L. mexicana, L. amazonensis, L. venezuelensis (outgroup L. infantum) Shaw et al. [106]
RPOIILS
Katrin Kuhls and Isabel Mauricio
Set 2a ASAT, GPI, NH1, NH2, 6PGD L. donovani complex (outgroup L. tropica, L. major, L. gerbilii) Mauricio et al. [96]
Set 2b ICD, ME, MPI, G6PDH, FH L. donovani complex (outgroup L. tropica, L. aethiopica, L. arabica, L. killicki, L. Zemanová et al. [102]
major, L. turanica)
Set 2c G6PDH, 6PGD, MPI, ICD L. braziliensis, L. guyanensis, L. shawi, L. naiffi, L. lainsoni Boité et al. [100]
Set 3 FH, G6PDH, ICD, MPI, L. donovani, L. infantum, L. tropica, L. aethiopica, L. major, L. turanica, L. Zhang et al. [99]
6PGD, HSP70, LACK major, L. braziliensis
Set 4 G6PDH, PGM, MPI, ALAT, L. braziliensis, L. panamensis (outgroup L. tropica, L. major, L. donovani, L. Herrera et al. [97]
ASAT, ICD, CYTB, amazonensis, L. mexicana)
Set 5 MDHMT, MDHNC, 6PGD, L. braziliensis Marlow et al. [101]
MPI, ICD, HSP70
Set 6 MPI, MDHNC, GPI, 6PGD L. braziliensis, L. peruviana, L. guyanensis, L. panamensis, L. lainsoni Tsukayama et al. [98]
Set 7 ACO, ALAT, ENOL, HGPRT, L. braziliensis, L. guyanensis, L. peruviana, L. panamensis, L. major, L. turanica, Marco et al. [103]
PGM, PMM, SPDSYN (SRM) L. arabica, L. gerbilli, L. tropica, L. aethiopica, L. infantum, L. donovani, L.
amazonensis, L. mexicana (outgroup L. enrietti)
a
Sequences for some of the species included in the presented trees were retrieved from GenBank and were sometimes sequenced by other authors with different primers for the
respective marker as in the actual study. Sometimes the amplicon size differs and sequences have to be trimmed to the same length
Phylogenetic Studies 23
1.1 Most Commonly SSU: The SSU rRNA gene is one of the two targets of choice for
Applied Markers Used establishing the phylogenetic position of trypanosomatid flagellates
in Single Locus because it is informative for higher level taxonomy and sufficient for
Approaches, Protocols genus-level ranking. However, for intragenus levels it is not suffi-
of Which Are ciently discriminative. The primers in use for PCR amplification of
Presented Herein this target are conserved and suitable for all trypanosomatids.
Because of the multicopy nature of this target, PCR is very sensitive
1.1.1 Conserved Markers and allows for the direct detection, without prior cultivation, of the
flagellates, including Leishmania in different types of biological
material including clinical samples. PCR amplification of this target
is available in different formats. In the various published phyloge-
nies, different, and often not overlapping, parts of the SSU gene
(total size ca. 2200 bp) have been amplified and sequenced (Fig. 1g)
[26–28, 47, 88, 113]. One of these fragments is also widely used in
leishmaniasis diagnostics of clinical samples or the detection of
Leishmania parasites in sandflies [90]. Another of these fragments
(amplified by primers 609F/706R) corresponds to the so-called
V7V8 SSU rDNA named trypanosomatid barcode [28, 47, 91].
Whole SSU gene sequencing (applying different internal primers)
has been applied mainly in studies addressing the overall phylogeny
of trypanosomatids or kinetoplastids [21–25, 29, 30, 32, 114, 115]
and in two studies on Leishmania [13, 34]. The respective primers
for the different SSU fragments are listed in Table 3.
gGAPDH: The glyceraldehyde-3-phosphate dehydrogenase is
an essential and ubiquitous glycolytic enzyme, the genes for which
have a slow rate of evolution, making it suitable for studies at
higher taxonomical ranks. There are three GAPDH genes in
Trypanosomatids, two of which encode a glycosomal enzyme and
the third encodes a cytosolic one. In Leishmania there are two
copies of the gGAPDH gene, which are in tandem repeat and
identical in sequence. This target has been applied mainly for stud-
ies of the evolution of trypanosomatids in general [23, 94], but in
recent times also for the genus Leishmania in relation to closely
related genera as well as with focus on the phylogenetic relation-
ship between Euleishmania and Paraleishmania and the respective
subgenera including the new subgenus L. (Mundinia) and the new
genus Porcisia [13, 28].
1.1.2 Polymorphic ITS: High levels of interspecies and intraspecies variation have been
Markers observed in Old- and New-World Leishmania species in the inter-
nal transcribed spacers (ITS1 and ITS2) present in the nuclear
multicopy ribosomal operon. This marker combines highly sensi-
tive Leishmania diagnostic PCR suitable for use with different
types of clinical samples (including filter paper with bone marrow
or lymph node aspirates, peripheral blood, skin scrapings, smashed
sandflies, etc.) and subsequent species differentiation by sequenc-
ing and phylogenetic inference. The assay presented herein was
originally reported by El Tai et al. [80] and has been extensively
Fig. 1 Schematic overviews of the different markers and respective fragments amplified by different primer
combinations used in respective phylogenetic studies (references in italics) of the genus Leishmania.
References in which the primers were described for the first time are indicated in bold. PCR primers are indi-
cated in red, internal sequencing primers in blue. Annealing positions of internal primers are given in Table 6.
(a) HSP 70—green numbers indicate the position of the fragments according to the L. major HSP70 gene
sequence (XM_001684512); (b) ITS rDNA; (c) CYTB—green numbers indicate the position of the fragments
according to the L. tarentolae sequence (M10126). Dotted line indicates the sequence used for tree inference
for the COIIIF/MURF4R fragment; (d) miniexon region (spliced leader)—amplicon sizes of unit 4 of L. major
Friedlin (FR796398.1 chromosome 2) are indicated. Respective primer positions for sl RNA units 4–5
Fig. 1 (continued) are given in Table 3; (e) RPOIILS—green numbers indicate the position of the fragments
according to the L. donovani RPOIILS gene sequence (XM_003863307); (f) POLA—green numbers indicate
the position of the fragments according to the L. donovani POLA gene sequence (XM_003859800); (g) SSU
rRNA—green numbers indicate the position of the fragments according to the L. donovani SSU sequence
published by Looker et al. [95] (X07773) (or L. braziliensis JX030136.1). References in brackets indicate selected
studies of different Trypanosomatid genera and the relationship between these genera. The fragment amplified
by primers 609F/706R corresponds to the V7V8 locus used for SSU barcoding of Trypanosomatids
26 Katrin Kuhls and Isabel Mauricio
2 Materials
2.2 Electrophoresis 1. 10× TBE buffer: Mix 108 g Tris, 55 g boric acid, and 40 ml of
of PCR Products 0.5 M EDTA pH 8.0 and adjust to 1 l with distilled water. For
electrophoresis prepare 1× TBE.
2. 50× TAE buffer: Mix 242 g Tris, 57.1 ml glacial acetic acid,
and 100 ml 0.5 M EDTA pH 8.0 and adjust to 1 l with dis-
tilled water. For electrophoresis prepare 1× TAE.
3. Gel loading buffer: mix 10 mg bromophenol blue, 10 mg
xylene cyanol, 5 ml glycerin, 2 ml of 0.5 M EDTA pH 8.0,
0.1 ml of 1 M Tris–HCl buffer pH 8.0 and adjust to a volume
of 10 ml with ddH2O. Store at 4 °C.
4. Staining the gels: Stain G (Serva, Heidelberg, Germany) or,
alternatively, 10 mg/ml ethidium bromide: dissolve 100 mg
of ethidium bromide in 10 ml ddH2O and stir until the dye
has dissolved (Important: Wear appropriate gloves when work-
ing with solutions that contain this dye). Store in a dark bottle
at 4 °C.
5. Agarose for gel electrophoresis (e.g., Sigma-Aldrich/Merck,
Darmstadt, Germany, or Biozym Scientific GmbH, Hessisch-
Oldendorf, Germany).
6. Low melting point agarose for gel extraction of PCR
fragments.
30 Katrin Kuhls and Isabel Mauricio
2.3.2 DNA Sequencing 1. Primers for direct cycle sequencing (including internal primers
Reactions if applicable) (Tables 3, 4, and 6).
2. M13 sequencing primers M13-for 5′-GTA AAA CGA CGG
CCA GT-3′ and M13-rev 5′-CAG GAA ACA GCT ATG
AC-3′.
3. Direct cycle sequencing kit (e.g., BigDye™ Terminator v3.1
Cycle Sequencing Kit (Applied Biosystems, CA, USA) or CEQ
chemistry (Beckman Inc.)).
4. PCR thermocycler.
5. Automated sequencer (e.g., ABI PRISM (Applied Biosystems,
CA, USA), CEQ 8000 (Beckman Coulter, CA, USA)) or
sending the products for commercial Sanger sequencing.
6. Data collection software and DNA Sequencing Analysis soft-
ware (e.g., Applied Biosystems, CA, USA).
2.4 Bioinformatics 1. Exclusive use of computer with high processing speed and
storage capacity, or access to a server for very large datasets
(long DNA sequences, and, in particular, many sequences).
2. Internet access.
Table 6
Internal sequencing primers for the most frequently used single locus markers
Marker Direction Primer name Primer sequence 5′–3′ Position Reference sequence References
SSU Forward S-823 CGA AYA ACT GCY CTA TCA GC 342-361 X07773 Maslov et al. [14]
S-713 CCG CGG TAA TTC CAG CTC C 630-649 X07773 Maslov et al. [14]
S-825 ACC GTT TCG GCT TTT GTT GG 929-949 X07773 Maslov et al. [14]
S-827 GAT TAG AGA CCA TTG TAG TC 1245-1264 X07773 Maslov et al. [14]
S-757 TCA GGG GGG AGT ACG TTC GC 1457-1476 X07773 Maslov et al. [14]
S-828 CAA CAG CAG GTC TGT GAT GC 1822-1841 X07773 Maslov et al. [14]
Reverse S-829 GCA TCA CAG ACC TGC TGT TG 1841-1822 X07773 Maslov et al. [14]
S-714 CGT CAA TTT CTT TAA GTT TC 1502-1482 X07773 Maslov et al. [14]
S-662 GAC TAC AAT GGT CTC TAA TC 1264-1245 X07773 Maslov et al. [14]
S-826 CCA ACA AAA GCC GAA ACG GT 949-929 X07773 Maslov et al. [14]
S-755 CTA CGA ACC CTT TAA CAG CA 680-661 X07773 Maslov et al. [14]
S-824 GCT GAT AGR GCA GTT RTT CG 361-342 X07773 Maslov et al. [14]
ITS2 Forward LIS2MV ATA CAC ACA TGC ACT CTC 173-190 in ITS2 AJ634378.1 El Tai et al. [68, 79]
Reverse LIS2MR AGA GTG CAT GTG TGT AT 190-174 in ITS2 AJ634378.1 El Tai et al. [80, 92]
HSP70 Forward HSP70-F335 CAC GCT TCG TCC GCG ACG 825-843 XM_001684512 Montalvo et al. [63];
Fraga et al. [61]
HSP70-F893 GTT CGA CCT GTC CGG CAT CC 1383-1402 XM_001684512 Montalvo et al. [63];
Fraga et al. [61]
HSP70-2F CTG AAC AAG AGC ATC AAC CC 1084-1103 XM_001684512 Fraga et al. [61]
Reverse HSP70-R429 AAC AGG TCG CCG CAC AGC TCC 938-918 XM_001684512 Montalvo et al. [63];
Fraga et al. [61]
HSP70-R1005 GTG ATC TGG TTG CGC TTG CC 1514-1495 XM_001684512 Montalvo et al. [63];
Fraga et al. [61]
HSP70-2R CTT GAT CAG CGC CGT CAT CAC 1254-1234 XM_001684512 Fraga et al. [61]
POLA Forward L1023-F AAC CTG TGG AGC CGT AC 2029-2045 XM_ 003859800 Noyes et al. [34]
Reverse L1023-R GTA ATG AAC TTR AGR TCG TGG 2117-2097 XM_ 003859800 Noyes et al. [34]
Phylogenetic Studies
RPOIILS Forward RPO-3F CAC RAC RAT GGG TAA GC 2868-2884 XM_003863307 Noyes et al. [34]
RPO-5F CAG CAG TCM CTC ATC AC 3151-3168 XM_003863307 Noyes et al. [34]
Reverse RPO-2R CTG CAG CTC CCG CAC 2943-2829 XM_003863307 Noyes et al. [34]
31
RPO-4R RAT RAA CTG CTG YGC CTC 3402-3384 XM_003863307 Noyes et al. [34]
(continued)
Table 6
32
(continued)
Marker Direction Primer name Primer sequence 5′–3′ Position Reference sequence References
NAGT Forward L3 ATC TAC CTC GGT CCC GTC TAC 2216-2236 M96635 Akman et al. [77];
Waki et al. [41]
Reverse L2 TGC AGA AGA TGC ACA GCA TGG 2270-2250 M96635 Akman et al. [77];
Waki et al. [41]
CYTBa Forward LCBF4 TGT TATT GAA TAT GAG GTA GTG 5849-5870 M10126 Luyo-Acero et al. [42];
Asato et al. [45]
Reverse LCBR4 GAA CTC ATA AAA TAA TGT AAA CAA AA 5985-5960 M10126 Luyo-Acero et al. [42];
Asato et al. [45]
a
Eight additional internal sequencing primers can be found in Luyo-Acero et al. [42]
Katrin Kuhls and Isabel Mauricio
Phylogenetic Studies 33
3 Methods
3.1 Establishment There are several points that have to be considered for planning
of the Study’s the strategy of the study (see Note 3):
Strategy—Selecting
1. Definition of the Taxonomic level of the study:
the Right Markers
and the Appropriate (a) Choose the most appropriate markers for the taxonomic
Sample Set
level under study (Table 2) (see Note 4).
(b) Evaluate all pro and cons of each marker (e.g., technical
limitations) (Tables 1, 3 and 4) (see Note 3).
(c) Check the specificity of the chosen primers (e.g., are the
primers family specific, genus specific, or subgenus spe-
cific?) (see Note 4).
(d) How frequently is the selected marker used, how many
sequences are already available in GenBank for analysis,
do these sequences cover the same sequence positions?
(see below).
(e)
Check which parts of the markers have been used for
which questions or studied taxa—possibilities of comple-
menting the own study with existing data.
(f) Are these markers validated in terms of protocol and per-
formance as well as of discriminative power in the genus
Leishmania?
2. Definition of the sample material:
(a) Applicability of the markers also depends on the kind of
samples—DNA from cultured parasites (all markers are
suitable), clinical samples or other biological material as
sandflies (rather multicopy markers)—check the sensitivity
and specificity of the selected marker (Tables 1 and 2).
(b) MLST needs DNA from cultured parasites.
34 Katrin Kuhls and Isabel Mauricio
3.2 PCR— 1. Several of the PCR protocols used for phylogenetic studies of
Amplification Leishmania, especially those targeting multicopy regions, can
of Genetic Targets be applied using both cultured parasites and clinical samples,
for Phylogenetic including filter paper with bone marrow or lymph node aspi-
Inference rates, peripheral blood, spleen aspirates, skin scrapings, or other
biological material as smashed sandflies etc. (see Note 2). For
DNA extraction use the most commonly applied protocols [89,
90, 92, 120] or alternatively commercial DNA-extraction kits
(e.g., QIAgen—QIAamp DNA Mini Kit; DNeasy Blood and
Tissue Kit, QIAgen, Hilden, Germany).
2. Prepare 10 ng/μl DNA solutions from cultured parasites.
In most PCRs 5–50 ng genomic DNA should be sufficient
(some authors use up to 150 ng). Use undiluted DNA (2–4 μl)
if extracted from clinical material (see Note 2).
3. It is important that positive and negative controls (including
negative extraction controls in case of biological samples) are
used in all PCR reactions (see Note 5).
4. PCR products should be stored at 4 °C or −20 °C until use.
3.2.1 Single Markers The HSP70 locus has been identified as one of the best for
high-resolution species discrimination and phylogenetic analy-
HSP70
sis. The available protocols have been extensively optimized and
validated. The original PCR described by Garcia et al. [60] has
been further improved with respect to sensitivity and specificity
by Montalvo et al. and van der Auwera et al. [65, 66]. (A detailed
protocol is available from www.itg.be/LeishmaniaHSP70.) All
protocols analyze a partial gene. The respective PCRs can be
performed using the following primer combinations, depending
on the chosen fragment for phylogenetic analysis (Fig. 1a,
Table 3) (position within the hsp70 gene of L. major
XM_001684512.1):
PCR-G: position 435-1856: Hsp70sen/Hsp70ant Size 1422 bp Garcia et al. [60]
PCR-F: position 480-1765: F25/R1310 Size 1286 bp Montalvo et al. [65]
PCR-N: position 480-1072: F25/R617 Size 593 bp Montalvo et al. [65]
PCR-T: position 1000-1765: p6F/R1310 Size 766 bp van der Auwera et al. [66]
Phylogenetic Studies 35
1. PCR-G
(a) Set up the PCR amplification reaction containing the fol-
lowing reagents (final concentration): 1× PCR standard
PCR buffer (incl. 1.5 mM MgCl2), 200 μM dNTPs, 5%
DMSO, 0.8 μM of each primer, 2.5 U Taq DNA
Polymerase (see Note 1), ddH2O, and the DNA sample.
(b) For a 25 μl PCR reaction use 2.5 μl 10× PCR buffer,
1.25 μl DMSO, 2.0 μl dNTP mix (2.5 mM), 2 μl forward
primer (10 μM), 2 μl reverse primer (10 μM), 0.25 μl Taq
DNA polymerase (5 U/μl), and 13 μl ddH2O. Vortex and
centrifuge the master mix shortly and dispense it in pre-
chilled labeled PCR-tubes (see Note 6).
(c) Add 2 μl of template DNA (10 ng/μl solutions if DNA
extracted from parasite cultures or undiluted DNA if
extracted from biological or clinical material). Vortex and
centrifuge the mixture briefly.
(d) Run the following thermocycler program: initial denatur-
ation step of 94 °C for 5 min followed by 33 cycles of
94 °C for 30 s, 61 °C for 60 s, 72 °C for 3 min and a final
elongation step at 72 °C for 10 min.
2. PCR-F
(a) Set up the PCR amplification reaction containing the fol-
lowing reagents (final concentration): 1× PCR buffer, 1×
Q-solution (QIAgen, Hilden, Germany), a total of
2.5 mM MgCl2, 200 μM dNTPs, 0.8 μM of each primer,
1U HotStarTaq Plus DNA Polymerase (QIAgen, Hilden,
Germany), ddH2O, and 10 ng of the DNA sample
(respectively 2–4 µl of undiluted DNA extracted from
biological material) (see Note 6). Vortex and centrifuge
the mixture briefly.
(b) Run the following thermocycler program: initial denatur-
ation step of 95 °C for 5 min followed by 35 cycles of
94 °C for 40 s, 61 °C for 60 s, 72 °C for 2 min and a final
elongation step at 72 °C for 10 min.
3. PCR-N and PCR-T
(a) Set up the PCR as for PCR-F using the respective primers
(see Note 6). Run the PCRs with annealing temperatures
61 °C and use an elongation time of 60 s.
36 Katrin Kuhls and Isabel Mauricio
Miniexon Spliced Leader 1. This PCR, based on a protocol first presented by Marfurt et al.
RNA [55], is performed using the primers Fme and Rme and ampli-
fies a fragment ranging from 221 to 442 bp (Fig. 1d, Table 3).
38 Katrin Kuhls and Isabel Mauricio
1. R221/R332 PCR:
(a) Amplification of the R221/R332 fragment is based on a
validated protocol specific for Trypanosomatids frequently
used for diagnosis of Leishmaniasis [33, 89, 90].
(b) Set up the PCR amplification reaction containing the fol-
lowing reagents (final concentration): 1× PCR buffer
(incl. 1.5 mM MgCl2) (supplied by the manufacturer),
2.5 mM MgCl2, 250 μM dNTPs, 1 μM of each primer,
1 U Taq DNA polymerase (see Note 1), ddH2O, and the
DNA sample.
(c) For a 25 μl PCR reaction use 2.5 μl 10× PCR buffer,
1.25 μl MgCl2 (50 mM), 2.5 μl dNTP mix (2.5 mM),
2.5 μl forward primer (10 μM), 2.5 μl reverse primer
(10 μM), 0.2 μl Taq DNA polymerase (5 U/μl), and
11.55 μl ddH2O (see Note 6). Vortex and centrifuge the
master mix shortly and dispense it in prechilled labeled
PCR-tubes.
(d) Add 2 μl of template DNA (10 ng/μl solutions if DNA
extracted from parasite cultures or undiluted DNA
extracted from biological or clinical material). Vortex and
centrifuge the mixture briefly.
40 Katrin Kuhls and Isabel Mauricio
3. Set 2b:
(a)
This MLST approach, based on a protocol first pre-
sented by Zemanová et al. [102], combines five house-
keeping genes used for MLEE: icd, me, mpi, g6pdh, and fh
(Tables 4 and 5).
(b) Set up the PCR amplification reaction containing the fol-
lowing reagents (final concentration): 1× PCR buffer
(incl. 1.5 mM MgCl2) (supplied by the manufacturer),
250 μM dNTPs, 0.4 μM of forward primer, 0.4 μM of
reverse primer, 0.5 U Taq DNA polymerase (see Note 1),
and ddH2O and the DNA sample (usually 10–20 ng) (see
Note 6). Vortex and centrifuge the mixture briefly.
(c) Run the following thermocycler program: initial denatur-
ation step at 96 °C for 5 min followed by 30 cycles of 96 °C
for 60 s, Tann for 60 s, 72 °C for 90 s and a final elongation
step at 72 °C for 10 min. The annealing temperatures
are 55 °C (ICD-F/ICD-R), 50 °C (ME-F/ME-R), 55 °C
(MPI-F/MPI-R), 50 °C (G6PDH-F/G6PDH-R), 58 °C
(FH-F/FH-R) (Table 4).
4. Set 2c:
(a) This MLST approach, based on a protocol first presented by
Boité et al. [100], combines four housekeeping genes and
respective primers: g6pdh (G6PDH-F-VIAN/G6PDH-R-
Vian), 6pgd (pgd-F-VIAN/pgd-R-VIAN), mpi (MPI-F-
VIAN/MPI-R-VIAN), and icd (ICD-F-VIAN/
ICD-R-VIAN) (Tables 4 and 5). The primers are different
from those used by other authors for the same markers.
(b) Set up the PCR amplification reaction containing the fol-
lowing reagents (final concentration): 1× PCR buffer (incl.
1.5 mM MgCl2) (supplied by the manufacturer), 250 μM
dNTPs, 0.1 mM of forward primer, 0.1 mM of reverse
primer, 1 U Taq DNA polymerase (see Note 1), and
ddH2O and the DNA sample (usually 50 ng) (see Note 6).
Vortex and centrifuge the mixture briefly.
(c) Run the following thermocycler program: initial denatur-
ation step at 94 °C for 2 min followed by 35 cycles of
94 °C for 30 s, 55 °C (icd, 6pgd, g6pgd) or 58 °C (mpi)
for 30 s, 72 °C for 60 s and a final elongation step at 72 °C
for 5 min.
5. Set 3:
(a) This MLST approach is based on an approach presented
by Zhang et al. [99]. The authors used a combination of
previously described protocols for the five enzyme coding
genes fh, g6pdh, icd, mpi, and 6pgd and one new proto-
col for a Leishmania homolog of receptors for activated
44 Katrin Kuhls and Isabel Mauricio
3.3 Electrophoresis 1. Prepare a 1–1.2% agarose gel either with 1× TAE or 1× TBE
of PCR Products buffer. Also add the stain G as recommended by the manufac-
turer or use ethidium bromide for staining the gel.
2. For control electrophoresis of the PCR products mix 5 μl of
PCR sample with 1 μl loading dye (if not already incorporated in
the PCR mix) and load this mixture into the slots of the gel.
3. Always use at least one slot for a molecular weight marker to
define the size of your PCR product. The marker should have
at least one fragment close to the expected size of the PCR
product.
4. Run the electrophoresis at 5–10 V/cm in the same buffer as
contained in the gel.
3.4 Sequencing 1. PCR products for DNA sequencing should be a single fragment
of PCR Products free from primers, primer dimers and non-specific products, as
well as from Taq DNA polymerase and other reagents from
3.4.1 Preparation of PCR
the previous reaction mix and have a minimum concentration
Products for DNA
(see Subheading 3.4.2).
Sequencing
2. Purify the amplified fragments using kits, such as the QIAquick
PCR purification kit (QIAGEN) according to manufacturer’s
protocol, or standard ethanol precipitation protocols.
3. If extra products or intense primer dimer bands are present it
is necessary to excise the desired band from the gel after sepa-
ration through electrophoresis. Gel extraction protocols rec-
ommend the use of low melting point agarose at a low
concentration (ideally 0.8%). To reduce the amount of agarose
not containing DNA use large wells which can be made by
placing tape across several teeth to produce a sufficiently large
well when setting the agarose. Use a clean scalpel blade to cut
the band on a transilluminator (important: wear protective
UV glasses or mask) and transfer the band to a sterilized tube.
Purification can be done through standard gel extraction pro-
tocols or kits for DNA purification from gel (e.g., QIAquick
gel extraction kit or Wizard SV Gel and PCR Clean- Up
System—see Subheading 2.3.1).
4. To obtain sufficient PCR product it may be necessary to scale
up the PCR amplification reaction. Consider how many
sequencing reactions will be necessary to cover the entire PCR
product, from a minimum of two reactions, one per primer.
Ideally, all fragments should be sequenced in both directions
to correct sequencing errors and obtain sequences of the
region immediately in front of each primer, if necessary. As
such, and because good Sanger sequencing can produce at
least 600 up to 800 base reads, ensure two reactions per
600 bp of the PCR fragment. If the PCR product obtained is
not sufficiently concentrated, reduce the amount of elution
buffer after purification, even if it is necessary to dilute the
Phylogenetic Studies 47
3.4.2 DNA Sequencing 1. ABI capillary sequencers require fragments generated using
Reactions BigDye™ Terminator v3.1 (Applied Biosystems™) chemistry.
Users should follow the manual guidelines, particularly regard-
ing the amount of template, which varies between 1 and 50 ng,
according to the size of the PCR product. The amount of PCR
product is best estimated through electrophoresis of 1 μl of the
purified PCR product and comparison with a molecular weight
marker with defined amounts of DNA per band.
2. Use internal primers for sequencing large fragments (>600 bp).
The primer sequences for the respective targets are listed in
Table 6 or the original listed references (e.g., for MLST),
some are indicated in the Figures of the targets (Fig. 1).
3. The products of the sequencing reaction should be purified
using one of the protocols described in the manual and left dry
at −20 °C until ready for analysis by the capillary sequencer.
4. Alternatively, it is possible to sequence DNA commercially,
either by sending PCR or cloned products or products from
sequencing reactions to a service provider.
48 Katrin Kuhls and Isabel Mauricio
Fig. 2 Examples of sequencing results. (a) poor sequence quality at the beginning of the fragment (at least
the first 15 nucleotides). (b) double peaks in heterozygous sequences (positions 253, 254, 258–261).
Phylogenetic Studies 49
3.6 Building 1. The dataset for phylogenetic inference should contain appro-
a Dataset priate data for the problem under investigation.
for Phylogenetic 2. If the objective is simply to study genetic diversity within a
Inference single population, then it is possible, although not advisable,
to use only the sequences generated in that study.
3. However, in most cases, it is important to compare the new
data with sequences obtained from previous studies. It is also
important to obtain a representation of the genetic diversity
within each species or group, as complete as possible, so that
phylogenies are as reliable and representative as possible.
3.6.1 Obtaining Two methods can be used to obtain homologous (share a common
Homologous DNA ancestor) sequences available on DNA sequence databases: search
Sequences by name, or search by sequence.
from Databanks
1. Search by species and target name
(a) Sites such as NCBI allow to search different databases
with DNA sequences, such as Nucleotide (https://www.
ncbi.nlm.nih.gov/nuccore/ for GenBank/EMBL/
DDBJ, which are synchronized), EST, Gene or Genome,
for example. Targets can be searched individually or in
datasets (PopSet).
(b) Searches should include the species or genus name and the
name of the desired region or gene.
(c) Care should be taken to search for all possible names asso-
ciated with that region or gene, for example including the
different names between parentheses with the expression
“OR,” (xxxx OR yyyy), or using wildcards, such as xxxx*
for variations of the word.
(d) In some cases, a large number of retrieved items belong to
undesired items, such as human sequences with parasite
homologies in the sequence description. In that case it is
possible to exclude them by adding the expression “NOT”
followed by a keyword (e.g., NOT human).
50 Katrin Kuhls and Isabel Mauricio
2. Search by sequence.
(a)
Use a sequence-based search engine, such as BLAST
(https://blast.ncbi.nlm.nih.gov/Blast.cgi), to look for
similar sequences to an initial sequence. This:
•• c an confirm that the amplified fragments correspond
to the desired sequences,
•• r ecovers any sequences that could be missed by name
searches and identifies the closest sequences.
(b) Obtaining sequences for a phylogeny using BLAST:
•• Introduce a sequence in FASTA format, or just the
sequence without description
•• hoose Database according to needs. “Nucleotide col-
C
lection” should include all available DNA sequences,
but it may be necessary to search different databases.
•• In Organism
–– Leave blank to recover all related sequences.
–– Type group or species name for a directed search.
•• In Program Selection, choose one of three options:
–– Megablast if highly similar sequences are expected.
–– D
iscontiguous Megablast if a higher degree of
dissimilarity or gaps is expected.
–– B
lastn for sequences for which no sequences were
recovered from the previous options.
•• I f more than 100 hits (the default option) are expected,
expand the Algorithm Parameters section and in
General Parameters, choose a higher number of Max
Target Sequences.
•• Run Blast.
•• On the results page:
–– Verify similarity of recovered sequences:
On
the Graphic Summary—highly similar
sequences should be shown in red, cover most
of the length of the query sequence.
n the Descriptions list, the Identity should have
O
a high value (90–100%), the E-value should be
very low (close to zero), and Query Cover
should be high (80–100%), depending on the
target sequence.
–– Obtain a file with the recovered sequences by:
Selecting All or specific sequences
hoose from Download, FASTA complete
C
sequences (entire original sequence), FASTA
Phylogenetic Studies 51
3.6.3 DNA Sequence 1. Prior to phylogenetic analysis, it must be ensured that homol-
Alignment ogous sites and regions are compared. Sequences with differ-
ing lengths, and of different origins, should thus be aligned to
ensure that like is compared to like. Multiple sequence align-
ment tools are required to prepare datasets for phylogenetic
analyses (Table 7).
2. Examples of alignment algorithms:
(a) ClustalW: smaller alignments [122].
(b) MUSCLE: large dataset alignment [123].
(c) MAFFT: nucleotide sequences with high variation [124].
(d) T-Coffee: for many taxa [125].
(e) WebPRANK: makes use of phylogenetic information to
decide placement of insertions and deletions (see
Subheading 3.6.4) [126].
3.6.4 Gaps 1. The gaps generated in the alignments done in the Subheading
3.6.3. may pose a problem if it is not clear where they should
be positioned.
2. The alignment method, such as Clustal W, may choose to
place gaps from identical sequences in different positions,
Table 7
Examples of commonly used programs or sites with alignment features
3.6.6 Input Data File 1. Users should check carefully which format for input data is
required by the chosen program and the format
specifications.
54 Katrin Kuhls and Isabel Mauricio
3.7 Phylogenetic There are several methods available to produce trees for phyloge-
Tree Inference netic studies (Table 8). Methods can be grouped according to their
main characteristics and can be used for different purposes:
3.7.1 Choice of Method
for Phylogenetic Tree 1. Distance methods: the tree is produced from a matrix of genetic
Inference distances, calculated according to percentage of nucleotide dif-
ferences, often corrected by a mutation model (see Subheading
3.7.2). They are fast and produce a single tree
(a)
Neighbor-joining: this tree building method produces
unrooted trees. It is a robust method and recommended
as a first approach for phylogenetic analysis.
(b)
UPGMA: this method produces rooted trees, which
assume a constant rate of evolution (molecular clock). It
should not be used unless it has been demonstrated that a
molecular clock applies to the dataset (see Subheading
3.8), otherwise, it is highly susceptible to long branch
attraction1 effects and other distortions in relation to the
1
Long branch attraction is a phenomenon in phylogenetics that can alter tree
topology. It can occur when the mutation rate is higher along a lineage, or in
the presence of a single more distantly related branch. This longer branch tends
to be pushed toward the root, or toward shorter branches. It is a problem for
most methods, although more for some (Maximum Parsimony, UPGMA) than
for others (Maximum Likelihood, Neighbor-Joining), but it is still a problem
for those considered as the best methods, such as maximum likelihood, even for
long (>100,000 positions) sequences [118]. Reviewed by [119].
Phylogenetic Studies 55
Table 8
Examples of commonly used programs or sites to produce phylogenetic trees. For a more
comprehensive list, see Subheading 5
3.7.2 Choice of Mutation 1. Some methods for phylogenetic inference require a mutation
Model for Distance-Based model (see Subheading 3.7.1), either to calculate distances or
and Model-Based Methods probabilities.
2. No underlying model: either by counting the number of dif-
ferences between sequences, or calculating p (percentage of
differences)
3. Mutation models may incorporate different aspects, such as:
(a) Substitution rate.
(b) Transition (A<->G, i.e., from purine to purine, or C<->T,
i.e., from pyrimidine to pyrimidine) and transversions
(from purine to pyrimidine or vice versa) rates and the
transition/transversion rate (it is usually close to 2 in most
biological systems, although it would be expected to be ½
if mutations were random).
Phylogenetic Studies 57
3.7.3 Programs 1. This is often a personal choice that may depend on operating
for Phylogenetics system (Windows, Macintosh, or other), knowledge of code
language, availability of funds, requirements for analysis, etc.
Most programs currently offer a Windows version, but some
require a Command Prompt for use.
2. In practice, most researchers use different packages for different
types of analyses (Table 8).
3. MEGA X [119] and previous versions, are often used, at least
for preliminary analysis of data, despite many earlier critics.
The latest versions have become more sophisticated and flexi-
ble regarding choice of models and parameters. It is very user
friendly, although it can sometimes be difficult to find and
interpret the methods from the Help menu. It is Menu based,
with easy to follow menus, and it accepts input data files in
different formats, including FASTA.
4. PHYLIP [132] is one of the earliest phylogenetic programs. It
requires a command prompt and processes are separated into
different packages, requiring different file names, which can
become burdensome and confusing. It can be used to gener-
ate distance files from nonsequence data, as well as handling
fragment data generated by methods such as RFLP, AFLP,
RAPD, and similar. Data files must be in PHYLIP format.
5. PAUP* [133] has often been the package of choice for maxi-
mum parsimony, but it requires purchase. Input files should
be in NEXUS format.
6. BEAST [134] requires an initial NEXUS format, which is used
to produce a specific XML file, and interaction is via a com-
mand prompt window.
7. MrBayes [135] also uses a command prompt window and
input NEXUS files in nonstandard format, which must be
checked in the Manual.
58 Katrin Kuhls and Isabel Mauricio
3.7.4 Testing Tree 1. As seen above (Subheading 3.7.1) some methods do not
Reliability—Bootstrap Test incorporate intrinsic measures of confidence in the tree
obtained. In any case, even in a robust tree, it should be esti-
mated how the data affect tree topology and estimate reliabil-
ity of individual branches.
2. The bootstrap test is the most widely used method to estimate
confidence in the tree, and in specific branches.
3. It may be calculated automatically in some programs (e.g.,
MEGA) or separately (e.g., PHYLIP).
4. It is based on resampling with replacement of the original
data, and it is nonparametric. It produces a tree for each of a
set of resampled datasets, gives the percentage of times each
group in the original tree is present in the new set of trees.
5. Number of resampled datasets: the minimum number should
be 100, but the highest possible number should be chosen
according to computational power and available time, ideally
between 1000 and 10,000.
6. Interpretation: it is similar to standard statistical confidence,
but it is more conservative. So, ideally, bootstrap support
should be above 95% to be considered a very reliable group.
In most cases, however, good support can be considered down
to 80%. Groups with lower than 75% support should not be
considered robust in any way.
3.8 Molecular Clock 1. The concept of a molecular clock allows to date events (nodes)
along a phylogenetic tree and to determine the earliest com-
mon ancestor (root).
2. It implies that the mutation rate is the same across all branches
of the tree, and, therefore, all tips of the tree should be at the
same distance from the root.
3.8.1 Testing Conformity 1. Algorithms for tree construction, such as UPGMA, imply a
of the Tree with a molecular clock, and should only be used if the data conforms
Molecular Clock to a molecular clock, or the tree topology could be distorted,
sometimes significantly.
2. Programs such as MEGAX [119] and previous versions allow to
test the overall topology of the tree (Maximum likelihood test)
or pairs of sequences in relation to an outgroup (Tajima’s
relative rate test [136]).
3. An overall test will provide an indication of whether the tree
conforms to a molecular clock, and can be used as a first
screening tool.
Phylogenetic Studies 59
3.8.2 Molecular Clock 1. Calibration of a molecular clock can be achieved in two main
Calibration ways: mutation rate or through known events.
2. Mutation rate.
(a) Mutation rates can be estimated from long-term cultures of
clones of Leishmania, or long-term passages in animal
models, by comparing sequences or markers in the original
clone with recovered cultures (direct mutation rate) or
comparing sequences in recovered cultures of different lin-
eages originating from the same clone (2× mutation rate).
(b) The time to branch nodes can then be extrapolated by
comparing the experimental mutation rate with the num-
ber of mutations along the branches leading to a node
(ancestor).
3. Known events.
(a)
Events, such as known introduction in a nonendemic
region, or physical separation within an endemic region,
or even association with new hosts, can be mapped to tree
nodes.
(b) The number of mutations to those nodes is divided by the
known time to give an overall mutation rate that can then
be applied to date all nodes in the tree.
(c) Examples of known events:
•• ithin kinetoplastids, separation between Africa and
W
South America can be used to date the separation
between Trypanosoma cruzi and Trypanosoma brucei
clades, which is useful for older events and phyloge-
nies at higher taxonomic levels.
•• more recent event is the introduction of L. infan-
A
tum in South America from circa 500 years ago, which
can be useful for calibration at species and population
level.
4. Care should be taken when applying the concept of a molecu-
lar clock, as mutation rates can vary with time in different lin-
eages due to different generation times, exposure to mutagens,
recombination rates, gene conversion rates, etc.
60 Katrin Kuhls and Isabel Mauricio
4 Notes
5 Further Resources
References
1. Dedet J-P, Pratlong F, Lanotte G, Ravel C old neglected tropical diseases. Springer,
(1999) The Parasite. Clin Dermatol 17: Cham, pp 15–30. https://doi.
261–268 org/10.1007/978-3-319-72386-0
2. Schönian G, Cupolillo E, Mauricio I (2013) 5. Lanotte G, Rioux JA, Lepart J, Maazoun R,
Molecular evolution and phylogeny of Pasteur N, Pratlong F (1984) Numerical
Leishmania. In: Ponte-Sucre A, Diaz E, cladistics of the phylogeny of the genus
Padrón-Nieves M (eds) Drug resistance in Leishmania Ross, 1903 (Kinetoplastida-
Leishmania parasites. Springer, Vienna, Trypanosomatidae). Use of enzyme charac-
pp 15–44. https://doi.org/10.1007/ teristics. C R Acad Sci III 299(19):
978-3-7091-1125-3_2 769–772
3. Akhoundi M, Kuhls K, Cannet A, Votýpka J, 6. Rioux JA, Lanotte G, Serres E, Pratlong F,
Marty P, Delaunay P, Sereno D (2016) A his- Bastien P, Perieres J (1990) Taxonomy of
torical overview of the classification, evolu- Leishmania. Use of isoenzymes. Suggestions
tion, and dispersion of Leishmania parasites for a new classification. Ann Parasitol Hum
and sandflies. PLoS Negl Trop Dis 10(3): Comp 65(3):111–125
e0004349 7. Thomaz-Soccol V, Lanotte G, Rioux JA,
4. Mauricio I (2018) Leishmania taxonomy. In: Pratlong F, Martini-Dumas A, Serres E
Bruschi F, Gradoni L (eds) The leishmaniases: (1993) Monophyletic origin of the genus
62 Katrin Kuhls and Isabel Mauricio
Leishmania Ross, 1903. Ann Parasitol Hum panosomatids: phylogeny versus taxonomy.
Comp 68(2):107–108 J Eukaryot Microbiol 45(3):293–297
8. Thomaz-Soccol V, Lanotte G, Rioux JA, 19. Stevens JR, Noyes HA, Dover GA, Gibson
Pratlong F, Martini-Dumas A, Serres E WC (1999) The ancient and divergent origins
(1993) Phylogenetic taxonomy of New World of the human pathogenic trypanosomes,
Leishmania. Ann Parasitol Hum Comp Trypanosoma brucei and T cruzi. Parasitology
68(2):104–106 118(Pt 1):107–116
9. Cupolillo E, Grimaldi G Jr, Momen H (1994) 20. Stevens JR, Noyes HA, Schofield CJ, Gibson
A general classification of New World W (2001) The molecular evolution of
Leishmania using numerical zymotaxonomy. Trypanosomatidae. Adv Parasitol 48:1–56
Am J Trop Med Hyg 50(3):296–311 21. Maslov DA, Podlipaev SA, Lukeš J (2001)
10. Schönian G, Kuhls K, Mauricio IL (2011) Phylogeny of the kinetoplastida: taxonomic
Molecular approaches for a better under- problems and insights into the evolution of
standing of the epidemiology and population parasitism. Mem Inst Oswaldo Cruz
genetics of Leishmania. Parasitology 138(4): 96(3):397–402
405–425 22. Merzlyak E, Yurchenko V, Kolesnikov AA,
11. Van der Auwera G, Dujardin JC (2015) Alexandrov K, Podlipaev SA, Maslov DA
Species typing in dermal leishmaniasis. Clin (2001) Diversity and phylogeny of insect try-
Microbiol Rev 28(2):265–294. https://doi. panosomatids based on small subunit rRNA
org/10.1128/cmr.00104-14 genes: polyphyly of Leptomonas and
12. Akhoundi M, Downing T, Votýpka J, Kuhls Blastocrithidia. J Eukaryot Microbiol
K, Lukeš J, Cannet A, Ravel C, Marty P, 48(2):161–169
Delaunay P, Kasbari M, Granouillac B, 23. Hamilton PB, Stevens JR, Gaunt MW, Gidley
Gradoni L, Sereno D (2017) Leishmania J, Gibson WC (2004) Trypanosomes are
infections: molecular targets and diagnosis. monophyletic: evidence from genes for glyc-
Mol Aspects Med 57:1–29 eraldehyde phosphate dehydrogenase and
13. Espinosa OA, Serrano MG, Camargo EP, small subunit ribosomal RNA. Int J Parasitol
Teixeira MM, Shaw JJ (2018) An appraisal of 34(12):1393–1404. https://doi.
the taxonomy and nomenclature of trypanoso- org/10.1016/j.ijpara.2004.08.011
matids presently classified as Leishmania and 24. Moreira D, Lopez-Garcia P, Vickerman K
Endotrypanum. Parasitology 145(4):430–442. (2004) An updated view of kinetoplastid phy-
https://doi.org/10.1017/s00311820 logeny using environmental sequences and a
16002092 closer outgroup: proposal for a new classifica-
14. Maslov DA, Lukeš J, Jirků M, Simpson L tion of the class Kinetoplastea. Int J Syst Evol
(1996) Phylogeny of trypanosomes as inferred Microbiol 54(Pt 5):1861–1875. https://doi.
from the small and large subunit rRNAs: org/10.1099/ijs.0.63081-0
implications for the evolution of parasitism in 25. Simpson AG, Stevens JR, Lukeš J (2006) The
the trypanosomatid protozoa. Mol Biochem evolution and diversity of kinetoplastid flagel-
Parasitol 75(2):197–205 lates. Trends Parasitol 22(4):168–174.
15. Noyes HA, Camps AP, Chance ML (1996) https://doi.org/10.1016/j.pt.2006.02.006
Leishmania herreri (Kinetoplastida; 26. Guan W, Cao DP, Sun K, Xu JN, Zhang JR,
Trypanosomatidae) is more closely related to Chen DL, Chen JP (2012) Phylogenic analy-
Endotrypanum (Kinetoplastida; sis of Chinese Leishmania isolates based on
Trypanosomatidae) than to Leishmania. Mol small subunit ribosomal RNA (SSU rRNA)
Biochem Parasitol 80(1):119–123 and 7 spliced leader RNA (7SL RNA). Acta
16. Noyes HA, Arana BA, Chance ML, Maingon Parasitol 57(2):101–113. https://doi.
R (1997) The Leishmania hertigi org/10.2478/s11686-012-0022-9
(Kinetoplastida; Trypanosomatidae) complex 27. Leelayoova S, Siripattanapipong S, Hitakarun
and the lizard Leishmania: their classification A, Kato H, Tan-ariya P, Siriyasatien P,
and evidence for a neotropical origin of the Osatakul S, Mungthin M (2013) Multilocus
Leishmania-Endotrypanum clade. J Eukaryot characterization and phylogenetic analysis of
Microbiol 44(5):511–517 Leishmania siamensis isolated from autoch-
17. Lukeš J, Jirků M, Dolezel D, Kral'ová I, Hollar thonous visceral leishmaniasis cases, southern
L, Maslov DA (1997) Analysis of ribosomal Thailand. BMC Microbiol 13:60. https://
RNA genes suggests that trypanosomes are doi.org/10.1186/1471-2180-13-60
monophyletic. J Mol Evol 44(5):521–527 28. Marcili A, Speranca MA, da Costa AP, Madeira
18. Hollar L, Lukeš J, Maslov DA (1998) Mde F, Soares HS, Sanches Cde O, Acosta Ida
Monophyly of endosymbiont containing try- C, Girotto A, Minervino AH, Horta MC, Shaw
Phylogenetic Studies 63
44. Foulet F, Botterel F, Buffet P, Morizot G, 53. Van der Auwera G, Ravel C, Verweij JJ, Bart
Rivollet D, Deniau M, Pratlong F, Costa JM, A, Schönian G, Felger I (2014) Evaluation of
Bretagne S (2007) Detection and identifica- four single-locus markers for Leishmania spe-
tion of Leishmania species from clinical speci- cies discrimination by sequencing. J Clin
mens by using a real-time PCR assay and Microbiol 52(4):1098–1104. https://doi.
sequencing of the cytochrome B gene. J Clin org/10.1128/jcm.02936-13
Microbiol 45(7):2110–2115. https://doi. 54. Podlipaev SA, Sturm NR, Fiala I, Fernandes
org/10.1128/jcm.02555-06 O, Westenberger SJ, Dollet M, Campbell DA,
45. Asato Y, Oshiro M, Myint CK, Yamamoto Y, Lukeš J (2004) Diversity of insect trypanoso-
Kato H, Marco JD, Mimori T, Gomez EA, matids assessed from the spliced leader RNA
Hashiguchi Y, Uezato H (2009) Phylogenic and 5S rRNA genes and intergenic regions.
analysis of the genus Leishmania by cyto- J Eukaryot Microbiol 51(3):283–290
chrome b gene sequencing. Exp Parasitol 55. Marfurt J, Nasereddin A, Niederwieser I, Jaffe
121(4):352–361. https://doi.org/10.1016/ CL, Beck HP, Felger I (2003) Identification
j.exppara.2008.12.013 and differentiation of Leishmania species in
46. Yang BB, Chen DL, Chen JP, Liao L, Hu XS, clinical samples by PCR amplification of the
Xu JN (2013) Analysis of kinetoplast cyto- miniexon sequence and subsequent restriction
chrome b gene of 16 Leishmania isolates from fragment length polymorphism analysis. J Clin
different foci of China: different species of Microbiol 41(7):3147–3153
Leishmania in China and their phylogenetic 56. Mauricio IL, Stothard JR, Miles MA (2004)
inference. Parasit Vectors 6:32. https://doi. Leishmania donovani complex: genotyping
org/10.1186/1756-3305-6-32 with the ribosomal internal transcribed spacer
47. Lopes EG, Geraldo Junior CA, Marcili A, and the mini-exon. Parasitology 128(Pt
Silva RD, Keid LB, Oliveira TM, Soares RM 3):263–267
(2016) Performance of conventional PCRs 57. Votýpka J, Maslov DA, Yurchenko V, Jirků M,
based on primers directed to nuclear and Kment P, Lun ZR, Lukeš J (2010) Probing
mitochondrial genes for the detection and into the diversity of trypanosomatid flagel-
identification of Leishmania spp. Rev Inst lates parasitizing insect hosts in South-West
Med Trop Sao Paulo 58:41. https://doi. China reveals both endemism and global dis-
org/10.1590/s1678-9946201658041 persal. Mol Phylogenet Evol 54(1):243–253.
48. Leelayoova S, Siripattanapipong S, Manomat https://doi.org/10.1016/j.
J, Piyaraj P, Tan-Ariya P, Bualert L, Mungthin ympev.2009.10.014
M (2017) Leishmaniasis in Thailand: a review 58. Roelfsema JH, Nozari N, Herremans T,
of causative agents and situations. Am J Trop Kortbeek LM, Pinelli E (2011) Evaluation and
Med Hyg 96(3):534–542. https://doi. improvement of two PCR targets in molecular
org/10.4269/ajtmh.16-0604 typing of clinical samples of Leishmania
49. Ibrahim ME, Barker DC (2001) The origin patients. Exp Parasitol 127(1):36–41. https://
and evolution of the Leishmania donovani doi.org/10.1016/j.exppara.2010.06.024
complex as inferred from a mitochondrial 59. Fraga J, Montalvo AM, Van der Auwera G,
cytochrome oxidase II gene sequence. Infect Maes I, Dujardin JC, Requena JM (2013)
Genet Evol 1(1):61–68 Evolution and species discrimination according
50. Cao DP, Guo XG, Chen DL, Chen JP (2011) to the Leishmania heat-shock protein 20 gene.
Species delimitation and phylogenetic rela- Infect Genet Evol 18:229–237. https://doi.
tionships of Chinese Leishmania isolates org/10.1016/j.meegid.2013.05.020
reexamined using kinetoplast cytochrome 60. Garcia L, Kindt A, Bermudez H, Llanos-
oxidase II gene sequences. Parasitol Res Cuentas A, De Doncker S, Arevalo J, Wilber
109(1):163–173. https://doi.org/ Quispe Tintaya K, Dujardin JC (2004)
10.1007/s00436-010-2239-6 Culture-independent species typing of neo-
51. Zelazny AM, Fedorko DP, Li L, Neva FA, tropical Leishmania for clinical validation of
Fischer SH (2005) Evaluation of 7SL RNA a PCR-based assay targeting heat shock pro-
gene sequences for the identification of tein 70 genes. J Clin Microbiol
Leishmania spp. Am J Trop Med Hyg 42(5):2294–2297
72(4):415–420 61. Fraga J, Montalvo AM, De Doncker S,
52. Stevenson LG, Fedorko DP, Zelazny AM Dujardin JC, Van der Auwera G (2010)
(2010) An enhanced method for the identifica- Phylogeny of Leishmania species based on the
tion of Leishmania spp. using real-time poly- heat-shock protein 70 gene. Infect Genet
merase chain reaction and sequence analysis of Evol 10(2):238–245. https://doi.
the 7SL RNA gene region. Diagn Microbiol org/10.1016/j.meegid.2009.11.007
Infect Dis 66(4):432–435. https://doi. 62. da Silva LA, de Sousa Cdos S, da Graca GC,
org/10.1016/j.diagmicrobio.2009.11.005 Porrozzi R, Cupolillo E (2010) Sequence
Phylogenetic Studies 65
analysis and PCR-RFLP profiling of the hsp70 The gp63 gene locus, a target for genetic char-
gene as a valuable tool for identifying acterization of Leishmania belonging to the
Leishmania species associated with human subgenus Viannia. Parasitology 117:1–113
leishmaniasis in Brazil. Infect Genet Evol 72. Garcia AL, Kindt A, Quispe-Tintaya KW,
10(1):77–83. https://doi.org/10.1016/j. Bermudez H, Llanos A, Arevalo J, Bañuls AL,
meegid.2009.11.001 De Doncker S, Le Ray D, Dujardin JC (2005)
63. Montalvo AM, Fraga J, Monzote L, Montano American tegumentary leishmanisis: antigene
I, De Doncker S, Dujardin JC, Van der Auwera polymorphism, taxonomy and clinical pleo-
G (2010) Heat-shock protein 70 PCR-RFLP: morphism. Inf Gen Evol 5:109–111
a universal simple tool for Leishmania species 73. Quispe-Tintaya KW, Ying X, Dedet JP, Rijal
discrimination in the New and Old World. S, De Bolle X, Dujardin JC (2004) Antigen
Parasitology 137(8):1159–1168. https://doi. genes for molecular epidemiology of leish-
org/10.1017/s0031182010000089 maniasis: polymorphism of cystein protease b
64. Odiwuor S, Veland N, Maes I, Arevalo J, and surface metalloprotease glycoprotein 63
Dujardin JC, Van der Auwera G (2012) in the Leishmania donovani complex. J Inf
Evolution of the Leishmania braziliensis spe- Dis 189:1035–1043
cies complex from amplified fragment length 74. Spanakos G, Patsoula E, Kremastinou T,
polymorphisms, and clinical implications. Saroglou G, Vakalis N (2002) Development
Infect Genet Evol 12(8):1994–2002. https:// of a PCR-based method for diagnosis of
doi.org/10.1016/j.meegid.2012.03.028 Leishmania in blood samples. Molecular and
65. Montalvo AM, Fraga J, Maes I, Dujardin JC, Cellular Probes 16: 415–420 https://doi.
Van der Auwera G (2012) Three new sensi- org/10.1006/mcpr.2002.0436
tive and specific heat-shock protein 70 PCRs 75. Fernandes O, Temeira MMG, Sturm NR,
for global Leishmania species identification. Sousa MA, Camargo EP, Degrave WM,
Eur J Clin Microbiol Infect Dis 31(7):1453– Campbell DA (1997) Miniexon gene
1461. https://doi.org/10.1007/ sequences define six groups within the genus
s10096-011-1463-z Crithidia. J Euk Microbiol 44(6):535–539
66. Van der Auwera G, Maes I, De Doncker S, 76. Fernandes O, Murthy VK, Kurath U, Degrave
Ravel C, Cnops L, Van Esbroeck M, Van WM, Campbell DA (1994) Mini-exon gene
Gompel A, Clerinx J, Dujardin JC (2013) variation in human pathogenic Leishmania
Heat-shock protein 70 gene sequencing for species. Mol Biochem Parasitol 66: 261–271
Leishmania species typing in European tropi- 77. Akman L, Aksu HSZ, Wang RQ, Ozensoy S,
cal infectious disease clinics. Euro Surveill Ozbel Y, Alkan Z, Ozcel MA, Culha G, Ozcan
18(30):20543 K, Uzun S, Memisoglu HR, Chang KP
67. Cupolillo E, Grimaldi Jr G, Momen H, (2000) Multi-site DNA polymorphism analy-
Beverly S (1995) Intergenic region typing ses of Leishmania isolates define their geno-
(IRT): A rapid molecular approach to the types predicting clinical epidemiology of
characterization and evolution of Leishmania. Leishmaniasis in a specific region. J Eukaryot
Mol Biochem Parasitol 73:145–155 Microbiol 47(6):545–554
68. Mauricio IL, Gaunt MW, Stothard JR, Miles 78. Gonzalez-Aseguinolaza G, Taladriz S,
MA (2007) Glycoprotein 63 (gp63) genes Marquet A, Larraga V (1999) Molecular
show gene conversion and reveal the evolu- cloning, cell localization and binding affinity
tion of Old World Leishmania. Int J Parasitol to DNA replication proteins of the p36/
37(5):565–576 LACK protective antigen from Leishmania
69. Guerbouj S, Victoir K, Guizani I, Seridi N, infantum. Eur J Biochem 259:909–916.
Nuwayri-Salti N, Belkaid M, Ben Ismail R, Le 79. Davila AM, Momen H (2000) Internal-
Ray D, Dujardin JC (2001) Gp63 gene poly- transcribed-spacer (ITS) sequences used to
morphism and population structure of explore phylogenetic relationships within
Leishmania donovani complex: influence of Leishmania. Ann Trop Med Parasitol
the host selection pressure? Parasitology 94(6):651–654
122:25–35 80. El Tai NO, El Fari M, Mauricio I, Miles MA,
70. Victoir K, De Doncker S, Cabrera L, Alvarez Oskam L, El Safi SH, Presber WH, Schönian
E, Arevalo J, Llanos-Cuentas A, Le Ray D, G (2001) Leishmania donovani: intraspecific
Dujardin JC (2003) Direct identification of polymorphisms of Sudanese isolates revealed
Leishmania species in biopsies from patients by PCR-based analyses and DNA sequencing.
with American tegumentary leishmaniasis. Exp Parasitol 97(1):35–44. https://doi.
Trans R Soc Trop Med Hyg 97:80–87 org/10.1006/expr.2001.4592
71. Victoir K, Bañuls AL, Arevalo J, Lllanos- 81. Berzunza-Cruz M, Cabrera N, Crippa-Rossi
Cuentas A, Hamers R, Noël S, de Doncker S, M, Sosa Cabrera T, Perez-Montfort R, Becker
Le Ray D, Tibayrenc M, Dujardin JC (1998) I (2002) Polymorphism analysis of the inter-
66 Katrin Kuhls and Isabel Mauricio
nal transcribed spacer and small subunit of 90. Schönian G, Nasereddin A, Dinse N,
ribosomal RNA genes of Leishmania mexi- Schweynoch C, Schallig HD, Presber W, Jaffe
cana. Parasitol Res 88(10):918–925. https:// CL (2003) PCR diagnosis and characteriza-
doi.org/10.1007/s00436-002-0672-x tion of Leishmania in local and imported clin-
82. Kuhls K, Mauricio IL, Pratlong F, Presber W, ical samples. Diagn Microbiol Infect Dis
Schönian G (2005) Analysis of ribosomal 47(1):349–358
DNA internal transcribed spacer sequences of 91. Da Silva FM, Noyes H, Campaner M,
the Leishmania donovani complex. Microbes Junqueira AC, Coura JR, Anez N, Shaw JJ,
Infect 7(11-12):1224–1234. https://doi. Stevens JR, Teixeira MM (2004) Phylogeny,
org/10.1016/j.micinf.2005.04.009 taxonomy and grouping of Trypanosoma
83. Spanakos G, Patsoula E, Kremastinou T, rangeli isolates from man, triatomines and syl-
Saroglou G, Vakalis N (2002) Development vatic mammals from widespread geographical
of a PCR-based method for diagnosis of origin based on SSU and ITS ribosomal
Leishmania in blood samples. Molecular and sequences. Parasitology 129(Pt 5):549–561
Cellular Probes 16: 415–420 https://doi. 92. El Tai NO, Osman OF, el Fari M, Presber W,
org/10.1006/mcpr.2002.0436 Schönian G (2000) Genetic heterogeneity of
84. Spanakos G, Piperaki ET, Menounos PG, ribosomal internal transcribed spacer in clini-
Tegos N, Flemetakis A, Vakalis NC (2008) cal samples of Leishmania donovani spotted
Detection and species identification of Old on filter paper as revealed by single-strand
World Leishmania in clinical samples using a conformation polymorphisms and sequenc-
PCR-based method. Trans R Soc Trop Med ing. Trans R Soc Trop Med Hyg 94(5):
Hyg 102(1):46–53. https://doi. 575–579
org/10.1016/j.trstmh.2007.05.019 93. Croan D, Ellis J (1997) Monophyletic origin
85. Parvizi P, Ready PD (2008) Nested PCRs and of the genus Sauroleishmania. Arch
sequencing of nuclear ITS-rDNA fragments Protistenkd 148:269–275
detect three Leishmania species of gerbils in 94. Hannaert V, Opperdoes FR, Michels PA
sandflies from Iranian foci of zoonotic cutane- (1998) Comparison and evolutionary analysis
ous leishmaniasis. Trop Med Int Health of the glycosomal glyceraldehyde-
3-
13(9):1159–1171. https://doi. phosphate dehydrogenase from different
org/10.1111/j.1365-3156.2008.02121.x Kinetoplastida. J Mol Evol 47(6):728–738
86. de Almeida ME, Steurer FJ, Koru O, Herwaldt 95. Looker D, Miller LA, Elwood HJ, Stickel S,
BL, Pieniazek NJ, da Silva AJ (2011) Sogin ML (1988) Primary structure of the
Identification of Leishmania spp. by molecular Leishmania donovani small subunit ribosomal
amplification and DNA sequencing analysis of RNA coding region. Nucleic Acids Res
a fragment of rRNA internal transcribed spacer 16(14b):7198
2. J Clin Microbiol 49(9):3143–3149. 96. Mauricio IL, Yeo M, Baghaei M, Doto D,
https://doi.org/10.1128/jcm.01177-11 Pratlong F, Zemanová E, Dedet JP, Lukeš J,
87. Uliana SR, Nelson K, Beverley SM, Camargo Miles MA (2006) Towards multilocus
EP, Floeter-Winter LM (1994) Discrimination sequence typing of the Leishmania donovani
amongst Leishmania by polymerase chain complex: resolving genotypes and haplotypes
reaction and hybridization with small subunit for five polymorphic metabolic enzymes
ribosomal DNA derived oligonucleotides. (ASAT, GPI, NH1, NH2, PGD). Int
J Eukaryot Microbiol 41(4):324–330 J Parasitol 36(7):757–769. https://doi.
88. Bualert L, Charungkiattikul W, Thongsuksai P, org/10.1016/j.ijpara.2006.03.006
Mungthin M, Siripattanapipong S, 97. Herrera G, Hernandez C, Ayala MS, Florez C,
Khositnithikul R, Naaglor T, Ravel C, El Teheran AA, Ramirez JD (2017) Evaluation of
Baidouri F, Leelayoova S (2012) a multilocus sequence typing (MLST) scheme
Autochthonous disseminated dermal and vis- for Leishmania (Viannia) braziliensis and
ceral leishmaniasis in an AIDS patient, south- Leishmania (Viannia) panamensis in
ern Thailand, caused by Leishmania siamensis. Colombia. Parasit Vectors 10(1):236. https://
Am J Trop Med Hyg 86(5):821–824. https:// doi.org/10.1186/s13071-017-2175-8
doi.org/10.4269/ajtmh.2012.11-0707 98. Tsukayama P, Lucas C, Bacon DJ (2009)
89. Meredith SE, Zijlstra EE, Schoone GJ, Kroon Typing of four genetic loci discriminates
CC, van Eys GJ, Schaeffer KU, el-Hassan among closely related species of New World
AM, Lawyer PG (1993) Development and Leishmania. Int J Parasitol 39(3):355–362.
application of the polymerase chain reaction https://doi.org/10.1016/j.
for the detection and identification of ijpara.2008.08.004
Leishmania parasites in clinical material. Arch 99. Zhang CY, Lu XJ, Du XQ, Jian J, Shu L, Ma
Inst Pasteur Tunis 70(3-4):419–431 Y (2013) Phylogenetic and evolutionary anal-
Phylogenetic Studies 67
Abstract
Next generation sequencing (NGS) technology transformed Leishmania genome studies and became an
indispensable tool for Leishmania researchers. Recent Leishmania genomics analyses facilitated the discov-
ery of various genetic diversities including single nucleotide polymorphisms (SNPs), copy number varia-
tions (CNVs), somy variations, and structural variations in detail and provided valuable insights into the
complexity of the genome and gene regulation. Many aspects of Leishmania NGS analyses are similar to
those of related pathogens like trypanosomes. However, the analyses of Leishmania genomes face a unique
challenge because of the presence of frequent aneuploidy. This makes characterization and interpretation
of read depth and somy a key part of Leishmania NGS analyses because read depth affects the accuracy of
detection of all genetic variations. However, there are no general guidelines on how to explore and inter-
pret the impact of aneuploidy, and this has made it difficult for biologists and bioinformaticians, especially
for beginners, to perform their own analyses and interpret results across different analyses. In this guide we
discuss a wide range of topics essential for Leishmania NGS analyses, ranging from how to set up a com-
putational environment for genome analyses, to how to characterize genetic variations among Leishmania
samples, and we will particularly focus on chromosomal copy number variation and its impact on genome
analyses.
Key words Next generation sequencing, Bioinformatics, Somy variation, SNP calling, Leishmania
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_3, © Springer Science+Business Media, LLC, part of Springer Nature 2019
69
70 Hideo Imamura and Jean-Claude Dujardin
it affects all aspects of the NGS analyses [3–7, 9]. Many of the
common NGS guidelines and practices established for other
euploid and polyploid organisms are not particularly applicable to
genomes with frequent aneuploidy. First of all, normalization fac-
tors must be calculated separately for all individual chromosomes
to reflect aneuploidy. Second, aneuploidy is common in cloned and
noncloned cultured promastigotes regardless of their cloning sta-
tus, and the presence of different copy numbers of a given chromo-
some in cloned cells (somy mosaicism) is considered to be common
[10]. This somy mosaicism makes it difficult but critical to charac-
terize the somy values of all chromosomes. It is essential to care-
fully distinguish technical artifacts and real chromosome copy
number variations when somy mosaicism is also possible. In
Leishmania genome analyses, it is imperative to evaluate normal-
ized read depth with and without somy effects to properly attri-
bute the cause of depth changes to local copy number variations or
somy variations [3, 4, 11], and we will discuss this point in detail.
Frequent aneuploidy is one of the major differences between
Leishmania and Trypanosoma genome analyses [12, 13].
This guide mainly focuses on practical and specific computa-
tional aspects of Leishmania NGS sequencing analyses. However,
we must emphasize that proper planning and meticulous prepara-
tion are crucial, and before considering bioinformatics, we must
optimize many experimental details in genome sequencing thor-
oughly, including the experimental setup, number of samples,
number of replicates, type of DNA preparation kits, and read
length and insertion size [14, 15].
In this guide, we will concentrate on DNA genomics analyses
mainly and will also briefly discuss RNA sequencing. We will first
discuss how to set up computer environments and computational
tools for NGS analyses. Then we will discuss key sequencing pro-
cessing steps such as read mapping, reference genome evaluation,
depth characterization, and SNP and indel characterization, which
are described in a schematic diagram (Fig. 1). We describe the
details of depth analyses that are often ignored or misunderstood
since that is the key factor to understand Leishmania NGS results.
2.1 Set Up a Linux Most bioinformatic tools are developed for the Linux system.
Computer System Therefore, it is highly recommended to use either a Linux or
Linux-based system. We briefly discuss the different options below,
as well as some practical solutions for people working with a
Windows-based system.
Linux: People performing sequencing analysis regardless of
their previous backgrounds must get familiar with a Linux com-
puter system and key essential Linux commands for genome
sequence analyses. Many programs are designed for a Linux envi-
A Guide to Next Generation Sequence Analysis of Leishmania Genomes 71
2) Mapping reads to
the reference
1) Acquiring sequence reads
and a reference genome read mapping
samtools
• base quality check Picard
• masking reference SMALT
BWA alignment (sam/bam )
bowtie2
3) Evaluating mapping
4) Depth 4) SNPs/indels
evaluation identification
GATK
raw depth dr mpileup calling SNPs and indels
Freebayes
depth per chromosome dch filter SNPs
GATK
Fig. 1 Schematic diagrams for different key sequencing steps: (1) acquiring sequence reads and a reference
genome, (2) mapping reads to the reference, (3) evaluating mapping, and (4) depth evaluation and SNPs/indels
identification. The program names are shown left to the process they work on, and some key processes and
characteristics are shown with bullet points
ronment including Mac OS, and these systems are most suitable
for sequencing analyses that generate a large amount of data.
Bio-linux: For beginners, it may be difficult to decide what
kind of programs to install, and there are specialized Linux pack-
ages designed for sequence analysis such as Bio-linux (http://envi-
ronmentalomics.org/bio-linux/). This package offers a simple
solution, but the programs in the package tend to become out-
dated quickly. Therefore, it is recommended to check their
sequencing tools and to install updated versions of these tools
individually.
Windows: In Windows, merely inspecting simple results can be
daunting, and many essential tools are not available for this envi-
ronment. Therefore, it is essential to have access to some form of
Linux computer environment. For Windows users, Linux can be
readily installed as an virtual operation system within Windows
(e.g., https://www.virtualbox.org), and recently Windows 10 has
started offering a Linux environment; thus, Windows users are
72 Hideo Imamura and Jean-Claude Dujardin
2.2 Setting Once our computer is ready for sequence analyses, it is time to
Up Sequencing install various relevant programs, and we will list a limited number
Analysis Tools of essential general software packages that will help us to analyze
and appreciate the sequence results. There are also more alterna-
tive programs available, but we keep the list short because once we
get familiar with these tools, we will be able to obtain the addi-
tional programs we need. We will discuss some specific sequencing
tools in detail in the upcoming sections.
Software managing programs: Installing programs can be com-
plicated and time-consuming, but several specialized programs will
help to install recent sequencing tools. For example, a software man-
aging program called “Homebrew” can be installed both in Mac
(https://brew.sh) and Linux (http://linuxbrew.sh) and is a conve-
nient software managing tool to install the most recent sequencing
tools including samtools. When a software managing program can-
not update programs anymore, it is recommended to reinstall a new
Linux OS which makes bioinformatics tasks much easier.
Scripting languages and their scientific packages: Python and
Perl are popular versatile scripting languages, suitable for sequenc-
ing data including characters, numbers, and processing files.
Python has many numerical and scientific packages for sequencing
data processing. A Python package manager called anaconda
(https://www.anaconda.com) helps users to install most of Python
scientific packages including matplotlib (https://matplotlib.org),
numpy, scipy, and pandas (https://www.scipy.org) for computa-
tion and visualization with ease. Biopython (https://biopython.
org) also provides bioinformatics tools but its strength is leaning
toward structural biology. Perl is a flexible and versatile scripting
language to handle characters and complex text, and it is easy to
create our own statistical functions; however, it lacks extensive
statistical and visualization modules. The Comprehensive Perl
A Guide to Next Generation Sequence Analysis of Leishmania Genomes 73
3.1 Obtain Most of the Leishmania and Trypanosoma reference genomes can
a Reference Genome be obtained from TriTrypDB (http://tritrypdb.org/common/
and Obtain Sequence downloads/) [17]. However, other updated Leishmania refer-
Reads ence genomes are also hosted by Leishmania expression and
sequencing projects (http://leish-esp.cbm.uam.es), and an
updated Leishmania donovani LdBPK282 reference can be also
74 Hideo Imamura and Jean-Claude Dujardin
3.2 How to Evaluate To evaluate overall sequence quality, we need to measure various
Sequence Quality sequence features such as base quality and read depth quality. High
quality of bases, read depth, and a reference are equally critical for
the accurate sequence analyses. If the read depth fluctuation is too
high, if a reference is not assembled correctly or contains many
repetitive regions, it would affect the identification of all genetic
variations. Therefore, to thoroughly evaluate sequence quality, we
must cross-examine all aspects of the data shown in Fig. 1 as a
whole because when there are many technical artifacts, it is difficult
to identify the real genetic variations.
The quality of bases can be measured by a read base quality
control (QC) program at the beginning, but it can be more effi-
ciently measured after mapping the reads since low quality bases
would be trimmed off by an aligner or can be easily screened out
in a SNP calling process. Using alignment files, we can start evalu-
ating read depth and at the same time we can evaluate base quality,
and it is far more effective to evaluate sequence quality by inspect-
ing alignments in sequence viewers. Initial base quality control is
more essential for de novo assembly, but it is often counterproduc-
tive to assume that the initial read quality control and trimming
reads would guarantee high-quality genome sequencing results
without thoroughly examining other sequencing properties such
as the quality of read depth, mapping, and a reference. So, first, we
briefly describe how to check base quality and then describe how
to evaluate read depth and overall quality of sequence data.
Read quality check and base trimming: Read quality control
(QC) programs such as FastQC (http://www.bioinformatics.
babraham.ac.uk/projects/fastqc/) can be applied to measure vari-
ous basic read quality factors, such as base quality, overall GC con-
tent, GC content per position, duplicate level, length distribution,
and FastQC produces read quality information in an html file that
we can view in a browser (Fig. 1). Then reads can be trimmed
using a program such as trimmomatic [18] to remove bad-quality
bases [19]. If we obtain sequence reads from public short read
archive (SRA) databases, we are new to sequencing, we are testing
new methods, we are performing de novo assembly, or we are par-
ticularly interested in structural variation in detail, it is essential to
perform read quality control by a read quality evaluation program
because the quality of reads can vary significantly depending on
A Guide to Next Generation Sequence Analysis of Leishmania Genomes 75
3.3 Mapping Reads Read mapping algorithms: The first step of sequence analysis is to
map fasta read files with their base quality scores (FASTQ) to a
reference genome (Fig. 1) There are two main read mapping algo-
rithms, and we will briefly describe these two. One is based on hash
indexing and another is based on Burrows–Wheeler character
string transformation. For a hash-based alignment method, map-
ping FASTQ reads to a reference involves two steps: indexing a
reference and mapping reads to a refence. Indexing a reference
creates an indexed reference database which make a reference
genome readily accessible for quick search, instead of preforming
intensive base similarity search all over a reference database. Using
the indexed reference database, an aligner will identify optimal
matching positions in a reference by hash search and then perform
more rigorous search for best matches around these candidate
positions in the indexed reference. An alternative algorithm is
based on suffix/prefix digital trees (Burrows–Wheeler transforma-
tion) and can store genetic variations more efficiently [20–22].
The size of Leishmania reference genomes is around 32 million
bases, roughly 100 times smaller than a human genome reference,
making it possible to perform more thorough sensitive search for
alignment than the default parameters.
Read aligners SMALT, BWA, and bowtie2: For read mapping,
SMALT based on a hash algorithm, BWA [20] and bowtie2 [21],
based on Burrows–Wheeler transformation, are often used in
Leishmania sequencing studies. They are all effective aligners, and
we can select one after testing these.
A Guide to Next Generation Sequence Analysis of Leishmania Genomes 77
3.4.3 Copy Number To evaluate copy number variations at gene level, we define an
Variation average haploid depth per gene without its somy impact as d HG and
define full cell depth with its somy impact as d FG and their relation-
ship is given as d FG = S × d HG. To evaluate copy number variations,
in general, average values of haploid depth dH and full cell depth dF
in 1000 or 2000 bases windows can be used, and if the depth varia-
tion is high, then the window size must be increased. Sliding win-
dows of 200 bases were used to measure copy number variations in
Imamura 2016 [3]. This method resolved smaller scale CNVs but
it was difficult to identify CNV boundaries to find commonly
shared CNVs among the samples. Therefore, it is more practical to
use a wider window size so that the CNV shared by many strains
would have the same CNV boundaries. CNVs can become statisti-
cally significant in two ways: a statistically higher copy number and
a statistically longer CNV. The cutoff values of these statistical sig-
nificances must be defined for each sample set because these cutoffs
depend on the size of vertical depth fluctuation and the size of
horizontal depth fluctuation of each data set. The z-score can be
used to find optimal cutoffs.
We illustrated how to perform CNV analyses based on the
CNV analyses in a previous work [3]. For a CNV analysis, it is
essential to define a baseline haploid depth level using median or
average haploid depth for a number of strains. If wild type strains
A Guide to Next Generation Sequence Analysis of Leishmania Genomes 79
B 4
3.5
3
2.5
somy
2
1.5
1
0.5
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
chromosome
Somy
Fig. 2 Chromosome depth and somy: (a) Median chromosome depths are given in dark grey. The median
depth of all chromosome median depths dmch is suitable for somy normalization rather than the average
depth of all chromosome median depths. (b) These chromosome median depths can be converted to somy
values using dmch
3.4.4 Length Bias In somy values in some previous studies, we frequently observed
of Somy and Local Somy some somy bias associated with chromosome length for some
Normalization sequencing data. For example, we often observed the trend that
somy values of shorter chromosomes tend to be smaller in samples
sequenced by Illumina Genome Analyzer II [4, 5]. Similar skewed
somy values affected by chromosome length have been still
observed in Illumina HiSeq results [6]. However, it is clear that
these somy biases were technical artifacts because when these sam-
ples were sequenced again, none of these depth biases were
80 Hideo Imamura and Jean-Claude Dujardin
amplicon 15K
B
large scale deletion and duplication
duplication
reads deletion
depth
reference
linear episome up to 300K
reads
depth
reference
Fig. 3 Somy variation and local copy number variations: (a) Chromosome copy numbers are quite variable in
many chromosomes of Leishmania promastigotes. (b) Large-scale deletions and duplications are also com-
mon. Long and high copy number amplifications containing a few genes spanning about 15,000 bp and long
linear episomes spanning up to 300,000 bp have been observed in Leishmania donovani strains [3]
3.4.5 Somy Estimation When the depth of samples is not sufficient or the variability of
for Sequences with Higher depth is too large, it is necessary to use other normalization fac-
Depth Variability tors, such as various percentile depths, or obtain depth from single
copy genes [30] or from nonrepetitive regions and the latter was
A Guide to Next Generation Sequence Analysis of Leishmania Genomes 81
3.4.6 Somy It is possible to estimate somy values from alternative read allele
and Alternative Read Allele frequency because when there are sufficient heterozygous SNPs,
Frequency read allele frequency distribution can reflect somy in most cases [5,
7]. However, read allele frequency can drastically change along a
chromosome without any somy or copy number variation [11, 13,
31, 32]; therefore, we must carefully interpret the relationship
between somy and read allele frequency.
3.4.7 Evaluating Somy When the depth of sequence is low and all the chromosomes have
Based on Binned similar read depth, we can still estimate somy from read allele fre-
Alternative Read Allele quency estimated from multiple SNP sites (e.g., 1000 SNP sites)
Frequency [13]. This method was applied to establish the evidences for viable
and stable triploid Trypanosoma congolense parasites during its life
cycle [13]. This method can be used to monitor somy variations
across different environment conditions when there are a sufficient
amount of heterozygous SNPs and sufficient DNA from the para-
sites from different stages because it requires the comparisons of
aggregated read allele frequency between different samples.
3.5 Characterizing Once alignment files (bam) are created, we can identify genetic
Base Variations variants such as single nucleotide polymorphisms and small
indels with these bam files. We describe three ways to identify
3.5.1 Individual
genetic variations. The first is an individual variant calling mode
and Population Variant
that identifies genetic variations per sample independently from
Calling Modes
any other samples, and is the simplest method [4, 11, 23, 32]. The
and Consensus Method
second is a population variant calling mode that identifies genetic
variations from multiple samples simultaneously [6, 12, 13, 28,
31]. The third is a consensus variant calling that obtains a consen-
sus of different variant calling methods, and this can be done in
individual [3, 24] or population mode or can be hybrid of both,
though these complicated cases will not be discussed here.
Individual variant calling: An individual variant calling
method is the one many people are familiar with and is commonly
used for analyzing various Leishmania samples. This method is
suitable to characterize a single sample or several unrelated samples
in detail. The advantages of this approach are its simplicity, and
SNP calling parameters can be adjusted to each sample. The main
disadvantage of this method is that it can miss a SNP whose read
allele frequency is less than 0.05 (e.g., a position with total depth
of 20, 19 reference allele bases, and 1 alternative allele base).
82 Hideo Imamura and Jean-Claude Dujardin
1
0.9
0.8
2) a duplication 4) a duplication
close to a gap
reference
unique unique tandem repeats unique
Fig. 5 Locations associated with many false positive SNPs in a reference genome: False positive SNPs were
often found in (1) low complexity regions such as homopolymers or short tandem repeat regions, (2) a dupli-
cated region where tandem repeats are truncated into a shorter unit in the reference, (3) tandem repeats
where mapping quality is zero and these SNPs may not be detected by SNP callers leading to false negative
SNPs, (4) duplications close to a gap, and (5) duplications close to the end and beginning of a chromosome.
The broad light green lines represent unique self-blast hits to themselves and the dark grey lines represent
repetitive matchings. In the figure, “SNP” indicates a real SNP. “F” indicates a false positive SNP and “FN”
indicates a false negative SNP. The left upper box highlights the characteristics of high-quality SNPs
3.5.2 Masking Our challenge here is to distinguish true SNPs from a flood of false
a Reference: Reference- SNPs mainly caused by a reference itself. The main characteristics of
Specific False Positives true SNPs are described in the box in Fig. 5, which include (1)
clean neighboring bases without gaps, repeats nor base errors, (2)
higher alternative read allele frequency, (3) high mapping score,
and (4) nonrepetitive high complexity regions. In contrast, we illus-
trated how a true SNP (SNP), false positive SNPs (F), and false
negative SNPs (FN) can appear in an alignment in Fig. 5. We
depicted the various features causing false SNPs in a hypothetical
reference genome including a homopolymer, a duplication, tandem
repeats, duplications close to a gap and the end of a chromosome.
Here a reference genome was self-blasted to itself, and one-to-one
A Guide to Next Generation Sequence Analysis of Leishmania Genomes 85
3.5.3 Sample-Specific Read depth cutoffs: Duplicated and deleted regions can create false
Cutoffs positive SNPs for phylogenetic analysis; it is therefore common to
apply a read depth cutoff. For example, read depth cutoff-
normalized depth dm > 0.5 or dm < 2 can be used. Ideally, this
normalized depth must be defined for each chromosome in
Leishmania since somy values can vary significantly, but it is com-
mon to set a general common cutoff for all chromosomes for indi-
vidual samples or a total depth for all samples. More practically, raw
depth cutoffs can be used to simplify the computation.
SNP clusters: It is common to exclude or mark SNP clusters
where there are more than three SNPs within ten bases of each
other because these clusters are often associated with false positive
SNPs. The definition of SNP clusters, however, must be adjusted
for each data set, based on the amount of real SNP clusters.
Specifying somy: A various integer somy value can be assigned
for given chromosomes in GATK and Freebayes, which is quite
effective for polyploid plant genomes, whose ploidy is over penta-
somy. In Leishmania genomes, however, aneuploidy can often be
transient, and also intermediate somy values are quite common [3,
6]. Therefore, it is often difficult to specify proper somy values for
each chromosome in different strains without introducing unin-
tended biases. Therefore, it is normally sufficient to use a default
somy setting for SNP calling. For example, we have never observed
any SNP deficiency in chromosome 31, whose somy has been
always greater than 3 [3], nor in septasomic chromosomes we have
examined (data not shown).
3.5.4 Annotating A functional annotation program SnpEff [41] can be used to clas-
Functional Impact of SNPs sify all SNPs and indels based on their functional impact such as
and Indels frameshift, nonsynonymous, synonymous change and intergenic
mutation. SNPs and indels were compiled in a population genetic
variation vcf file. From this vcf file alternative allele and depth
information can be extracted for further analysis. Variants common
to all strains are often uninformative, and they can be excluded
from the analysis.
3.6 Screening SNPs Filtering SNPs and indels: Once SNPs and indels are identified, the
and Indels next step is to apply a variant filtering such as GATK Variant
Filtration, which evaluates many SNP quality conditions including
SNP quality per depth, SNP strand bias, root mean square of the
mapping quality and mapping quality test between reference and
alternative alleles. A caution here is that GATK is updated fre-
quently and their recommended parameters change occasionally;
therefore, it is essential to consult the GATK user guide to set
proper parameters.
SNP quality score: The next step is to test and select a SNP
score that match the sensitivity and specificity required for the
analysis. There is no universal SNP score that can be applied to any
samples since a SNP score itself depends on read depth, read base
A Guide to Next Generation Sequence Analysis of Leishmania Genomes 87
quality, and other factors, but we will provide some values that
applied in our previous analyses.
In practice, SNP scores are given in the 6th column with the
tag QUAL in vcf files. They are expressed in terms of Phred scores
Q defined to be Q = −10 log10(P) where P is the estimated error
probability for that base-call [42]. In our data set for L. donovani,
other Leishmania and Trypanosoma species, we found that SNP
scores of 300 for GATK individual calling and 1500 for GATK
population calling are sufficient to remove most of false positive
SNPs. These values must be adjusted specifically to a given data set
because each data set can have different biases. In our previous
analyses, these values were selected after testing GATK using the
BPK282 sequence data from which the reference genome was cre-
ated. For example, in a sample set containing about 200 samples in
which dozens of samples are affected by base errors, a GATK SNP
score might be elevated to 4000 or higher in a population calling
to eliminate low-quality heterozygous false positive SNPs. In gen-
eral, a proper SNP cutoff should not change the number of SNPs
substantially when the cutoff is changed slightly such as 300–500 in
a population SNP calling of several dozen samples and 50–100 in
an individual SNP calling. If this happens, the SNP cutoff is too
low [3], and it is often safe to use the cutoff around which the
number of SNPs is stable, since the number of true positive SNPs
should not vary much depending on the cutoff. Alternatively, it is
better to remove samples producing excessive SNPs, if that is pos-
sible. During selection of a SNP cutoff, it is essential to inspect
SNPs visually in the Integrative Genomic Viewer, artemis, or sam-
tools tview to avoid false positives and mask regions that produce
excessive false positive SNPs.
3.7 Specific We have discussed the basics of sequence analyses and now we will
Sequencing Analyses further discuss more specific cases that improve sequencing analysis
methods and also explore topics that are important but less fre-
quently discussed.
3.7.1 Mapping Reference Mapping reference reads to the genome itself is a good practice to
Reads to Its Own become familiar with a reference genome and to know its potential
Reference Genome misassemblies. For example, the reference genome of L. major
to Understand Friedlin is considered the most accurate among Leishmania
the Reference genomes. However, the copy number variation analysis of various
and to Improve CNV of Leishmania genomes showed that many of the repetitive genes
Detection and SNP Calling were often concatenated, resulting in their higher copy numbers
Methods [5, 40]. Therefore, mapping reference reads to itself is excellent
way to calibrate and improve our own CNV detection and SNP
calling methods. Higher depth in a gene of a reference indicates
that some sections were truncated in the reference while lower
depth around a repetitive region indicated that the region was
overextended in the assembly process and this was observed in ref-
erences assembled by PacBio SMRT Sequencing [6, 31].
88 Hideo Imamura and Jean-Claude Dujardin
3.7.2 Optimizing SNP Optimizing SNP calling can be done by using simulated reads but
Calling Using Artificial it is more relevant to optimize the method by using alignments of
Mixtures of Two Samples an artificial mixtures of two samples, which have sufficient amount
of homozygous SNP differences. The main weakness of the simu-
lated reads is that these reads are too clean and too easy to train our
methods because real samples produce nearly intractable SNPs that
simulated reads cannot simply emulate. If we do not have two
clean samples to train our SNP calling method, it might be infor-
mative to optimize our SNP calling using the dataset which is
already published. For example, the data for in vitro selection of
miltefosine resistance in promastigotes of Leishmania donovani
from Nepal [29] may be used. These samples do not contain more
than 200 homozygous and heterozygous SNPs and BPK282 lines
are closely related to the reference BPK282 strain. Therefore, they
are an ideal data set to calibrate SNP calling. To refine SNP calling
parameters further, the alignment files of BPK282s and BPK275s,
which belong to a different genotype, can be mixed at certain pro-
portions using “samtools view -s” command. We are able to test
sensitivity and specificity of the method based on artificially mixed
simulated data set based on the real alignments because BPK275
lines have their own unique mainly homozygous SNPs. By using
these data sets, we will notice that some regions would produce
disproportionally many SNPs because of their repetitiveness or
some unknown factors and these regions must be masked for fur-
ther SNP analyses [3].
3.7.3 Genetic Variation Sequencing samples to identify genetic variations that can explain
Detection Among Samples specific phenotypes is common. One of the most common analyses
with Different Phenotypes is comparing between a drug-sensitive line and an induced drug-
Including Drug Induction resistant line. In this case, it is essential to identify any genetic
Experiments variations located in coding regions or even noncoding regions.
Further, we must not discard but explore base variations that over-
lap with local copy number variations since it is known that some
specific gene like L. donovani miltefosine transporter (LdMT) and
aquaglyceroporin 1 (AQP1) can contain partial or full deletions,
SNPs, or indels simultaneously in cells [3]. In drug induction
experiments, it is essential to the monitor allele frequency changes
at various intermediate stages to identify SNPs critical to drug resis-
tance. Here applying a population calling method among sensitive,
intermediate, and resistant lines will help to identify critical genetic
variations because it provides all allele frequency information at a
position where at least one high score SNP is present. For example,
in the previously mentioned miltefosine drug resistance induction
experiment [29], the critical SNP at LdMT was not detected at the
beginning of the induction experiment, but the SNP allele gradu-
ally increased and reached up to 100% in fully miltefosine-resistant
parasites (Fig. 4). To monitor this type of SNP allele transition, it
was more effective to use a population c alling method. If an indi-
A Guide to Next Generation Sequence Analysis of Leishmania Genomes 89
3.7.5 How to Handle For a large sequencing project, sequence data can come from vari-
Samples with Biased ous sources. Sequencing data quality may not be uniform and
False SNPs some samples may be of lower quality. Therefore, the data from
public archives must be treated with caution, and it is critical to
read the original paper in which the sequence data was generated
because the paper often describes the read quality issues and practi-
cal solutions in detail when the quality of some samples are lower
than that of other samples. For example, in our previous L. don-
ovani project [4], 18 samples had lower sequence quality and these
samples would have generated ten times more false positive SNPs
than the rest of the samples, but the problem was solved by apply-
ing additional SNP screening conditions to these samples. If we
obtained the data from a public database and observed abnormal
number of SNPs in a limited number of samples, then it is appro-
priate to remove these samples from the analyses rather than keep-
ing them, provided these samples are not essential.
3.7.6 Characterizing When a read can be mapped to multiple locations with the same
Depth and SNPs mapping score, aligners select one location randomly or alterna-
from Repetitive Regions tively ignore the multiple mapped read. Selecting a random posi-
tion is often more appropriate to characterize base variations and
copy number variations than keeping only uniquely mapped reads.
When only uniquely mapped reads are kept, the depth of repetitive
regions such as GP63 and HSP70 would be underestimated
90 Hideo Imamura and Jean-Claude Dujardin
3.7.7 Lower Input DNA For various technical and biological reasons, the depth of samples
Samples can be lower than one or two reads per bases. It is, however, still
possible to estimate somy and perform genotyping from such
lower depth samples. For example, the read depth for Leishmania
donovani amastigotes from a hamster was lower than 0.8 and too
low to estimate somy based on a regular depth method as discussed
above. It was, however, possible to estimate their somy based on
the number of reads per 1000 bp [6]. Genotyping using regular
SNP calling methods is not possible for such low depth samples,
but if diagnostic SNP markers are known from other higher depth
samples, direct searching of base motifs that contain a diagnostic
SNP marker can be used for genotyping. For copy number varia-
tion, it is likely possible to identify amplicons with a high copy
number using depth based on a certain window. Smaller scale
CNVs can be detected by clustering many lower depth samples
together to increase resolution.
3.8 Transcriptomics We will briefly summarize the basics of upstream analysis of tran-
Analysis scriptomics sequencing and describe the read count normalization
specific to Leishmania and how to handle repetitive genes. RNA
sequencing analysis generally requires replicates per sample rang-
ing from 2 to 6. When it is not feasible to have replicates in some
experimental and clinical settings, it is common to group samples
together based on phenotypic differences to increase statistical
power. It is more difficult to choose an optimal RNA sequencing
library than DNA sequencing library because we must optimize
many factors such as number of replicates, read depth, read length,
inset size, and single or paired reads [43–45].
RNA read mapping and read counting: For RNA analysis,
STAR (Spliced Transcripts Alignment to a Reference) is likely a
convenient option in many cases [46]. It can perform elaborate
two-step mapping and read counting by itself. It can also handle
strand-specific RNA sequencing. Leishmania does not have introns
in general, so a splicing-aware mapping may not be needed; but it
is an attractive feature. As a cautionary note for STAR users, when
using a gff file from TritrypDB, a gff annotation file must be con-
verted to gtf annotation file even though STAR indicates that a gff
file is accepted. In general, STAR often produces an empty count-
ing when a gff from TritrypDB is used. Once we obtained read
count data, they can then be analyzed by DEseq2 which provides
normalized read count and fold changes and Benjamini–Hochberg-
adjusted p-values. It is common to use a fold change cutoff 2, and
a Benjamini–Hochberg adjusted p value <0.05 to define differen-
tially expressed genes.
A Guide to Next Generation Sequence Analysis of Leishmania Genomes 91
4 Conclusion
Acknowledgments
References
16. Haddock SHD, Dunn CW (2011) Practical 30. Reis-Cunha JL, Rodrigues-Luiz GF, Valdivia
computing for biologists. Sinauer, Sunderland HO et al (2015) Chromosomal copy number
17. Aslett M, Aurrecoechea C, Berriman M et al variation reveals differential levels of genomic
(2009) TriTrypDB: a functional genomic plasticity in distinct Trypanosoma cruzi strains.
resource for the Trypanosomatidae. Nucleic BMC Genomics 16(1):499
Acids Res 38(suppl_1):D457–D462 31. Schwabl P, Imamura H, Van den Broeck F et al
18. Bolger AM, Lohse M, Usadel B (2014) (2018) Parallel sexual and parasexual popula-
Trimmomatic: a flexible trimmer for tion genomic structure in Trypanosoma cruzi.
Illumina sequence data. Bioinformatics bioRxiv. https://doi.org/10.1101/338277
30(15):2114–2120 32. Rogers MB, Downing T, Smith BA et al
19. Cuypers B, Domagalska MA, Meysman P et al (2014) Genomic confirmation of hybridi-
(2017) Multiplexed spliced-leader sequencing: sation and recent inbreeding in a vector-
a high-throughput, selective method for RNA- isolated Leishmania population. PLoS Genet
seq in Trypanosomatids. Sci Rep 7(1):3725 10(1):e1004092
20. Li H, Durbin R (2009) Fast and accurate short 33. McKenna A, Hanna M, Banks E et al (2010)
read alignment with Burrows–Wheeler trans- The genome analysis toolkit: a MapReduce
form. Bioinformatics 25(14):1754–1760 framework for analyzing next- generation
21. Langmead B, Salzberg SL (2012) Fast gapped- DNA sequencing data. Genome Res
read alignment with Bowtie 2. Nat Methods 20(9):1297–1303
9(4):357 34. Marth GT, Korf I, Yandell MD et al (1999)
22. Li H, Homer N (2010) A survey of sequence A general approach to single-nucleotide poly-
alignment algorithms for next-generation morphism discovery. Nat Genet 23(4):452
sequencing. Brief Bioinform 11(5):473–483 35. Li H, Handsaker B, Wysoker A et al (2009)
23. Zackay A, Cotton JA, Sanders M et al (2018) The sequence alignment/map format and
Genome wide comparison of Ethiopian SAMtools. Bioinformatics 25(16):2078–2079
Leishmania donovani strains reveals differences 36. Iqbal Z, Caccamo M, Turner I et al (2012)
potentially related to parasite survival. PLoS De novo assembly and genotyping of variants
Genet 14(1):e1007133 using colored de Bruijn graphs. Nat Genet
24. Coughlan S, Mulhair P, Sanders M et al (2017) 44(2):226
The genome of Leishmania adleri from a mam- 37. Frith MC (2010) A new repeat-masking
malian host highlights chromosome fission in method enables specific detection of homolo-
Sauroleishmania. Sci Rep 7:43747 gous sequences. Nucleic Acids Res 39(4):e23
25. Coughlan S, Taylor AS, Feane E et al (2018) 38. Derrien T, Estelln J, Sola SM et al (2012) Fast
Leishmania naiffi and Leishmania guyanensis computation and applications of genome map-
reference genomes highlight genome structure pability. PLoS One 7(1):e30377
and gene evolution in the Viannia subgenus. R 39. Otto TD, Sanders M, Berriman M, Newbold
Soc Open Sci 5(4):172212 C (2010) Iterative correction of reference
26. Rastrojo A, García-Hernández R, Vargas P nucleotides (iCORN) using second genera-
et al (2018) Genomic and transcriptomic alter- tion sequencing technology. Bioinformatics
ations in Leishmania donovani lines experi- 26(14):1704–1707
mentally resistant to antileishmanial drugs. Int 40. Gonznformaticssecond S, Peirnformati R et al
J Parasitol Drugs Drug Resist 8(2):246–264 (2017) Resequencing of the Leishmania infan-
27. Valdivia HO, Reis-Cunha JL, Rodrigues- tum (strain JPCM5) genome and de novo
Luiz GF et al (2015) Comparative genomic assembly into 36 contigs. Sci Rep 7(1):18050
analysis of Leishmania (Viannia) peruviana 41. Cingolani P, Platts A, Wang LL et al (2012)
and Leishmania (Viannia) braziliensis. BMC program for annotating and predicting the
Genomics 16(1):715 effects of single nucleotide polymorphisms,
28. Dumetz F, Cuypers B, Imamura H et al (2018) SnpEff: SNPs in the genome of Drosophila
Molecular preadaptation to antimony resis- melanogaster strain w1118; iso-2; iso-3. Fly
tance in Leishmania donovani on the Indian 6(2):80–92
subcontinent. mSphere 3(2):e00548–e00517 42. Ewing B, Green P (1998) Base-calling of auto-
29. Shaw CD, Lonchamp J, Downing T et al mated sequencer traces using phred. II. Error
(2016) In vitro selection of miltefosine resis- probabilities. Genome Res 8(3):186–194
tance in promastigotes of Leishmania donovani 43. Schurch NJ, Schofield P, Gierliński M et al
from Nepal: genomic and metabolomic charac- (2016) How many biological replicates are
terization. Mol Microbiol 99(6):1134–1148 needed in an RNA-seq experiment and which
94 Hideo Imamura and Jean-Claude Dujardin
differential expression tool should you use? standing of the biology and host-pathogen
RNA 22(6):839–851 interactions. Infect Genet Evol 49:273–282
44. Fiebig M, Kelly S, Gluenz E (2015) 46. Dobin A, Davis CA, Schlesinger F et al (2013)
Comparative life cycle transcriptomics revises STAR: ultrafast universal RNA-seq aligner.
Leishmania mexicana genome annotation and Bioinformatics 29(1):15–21
links a chromosome duplication with parasitism 47. Love MI, Huber W, Anders S (2014)
of vertebrates. PLoS Pathog 11(10):e1005186 Moderated estimation of fold change and
45. Patino LH, Ramírez JD (2017) RNA-seq in dispersion for RNA-seq data with DESeq2.
kinetoplastids: A powerful tool for the under- Genome Biol 15(12):550
Chapter 4
Abstract
High-throughput sequencing of cDNA copies of mRNA (RNA-seq) provides a digital readout of mRNA
levels over several orders of magnitude, as well as mapping the transcripts to the nucleotide level. Here we
describe two different RNA-seq approaches, including one that exploits the 39-nucleotide mini-exon or
spliced leader (SL) sequence found at the 5′ end of all Leishmania (and other trypanosomatid) mRNAs.
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_4, © Springer Science+Business Media, LLC, part of Springer Nature 2019
95
96 Peter J. Myler et al.
2 Materials
2.1 RNA Preparation 1. RNase-free water, pipette tips, and centrifuge tubes, RNaseZap
(Applied Biosystems #AM9780).
2. TRIzol Reagent (Invitrogen #15596-026).
3. Chloroform, isopropanol, and 75% ethanol (RNase-free).
4. High-speed refrigerated centrifuge and fixed-angle rotor.
5. Qubit Fluorimeter (Applied Biosystems).
6. Quant-iT RNA Assay kit (Applied Biosystems #Q33140).
7. Bioanalyzer 2100 and RNA 6000 Nano Kit (Agilent
#5067-1511).
2.3 First Strand 1. RNase-free water, pipette tips, and centrifuge tubes.
cDNA Synthesis 2. Random_Hexamer_P7 (GTGACTGGAGTTCAGACGTGT
GCTCTTCCGATCTNNNNNN)—HPLC-purified first strand
primer handled under RNase-free conditions.
3. SMARTscribe Reverse Transcriptase (Clontech, 639536),
including 5× Takara First Strand Buffer and 20 mM DTT.
4. Advantage® UltraPure PCR Deoxynucleotide Mix (10 mM
each dNTP, Clontech, 639125), combined in equimolar pro-
portions, 10 mM final concentration.
5. 96-well PCR machine, with 0.2-ml thin-wall strip tubes
(nuclease-free).
6. RNasin Ribonuclease Inhibitor, 40 U/μl (Promega, N2515).
3 Methods
3.1 RNA Preparation 1. Pellet ~5 × 108 cells (see Note 2) at 3000 × g for 10 min at
4 °C in a 50-ml conical tube and discard supernatant.
2. Add 1 ml of TRIzol Reagent to each tube, pipet up and down
to disrupt the pellet, before letting sit at room temperature
for 5 min.
3. Add 200 μl chloroform and shake vigorously by hand for 15 s,
before letting the sample sit at room temperature for another
5 min.
4. Centrifuge for 15 min, at 12,000 × g, 4 °C and transfer 400 μl
of the aqueous phase to a new tube.
5. Add 500 μl of isopropanol and mix by inversion, before incu-
bating at room temperature for 10 min.
6. Centrifuge for 10 min, at 12,000 × g, 4 °C and discard
supernatant.
100 Peter J. Myler et al.
3.2 Poly A+ mRNA 1. Bring all reagents off the Invitrogen mRNA DIRECT Kit to
Purification room temperature and set heat block to 70 °C.
2. Add 22 μl oligo-dT beads to a 1.5-ml tube, place on magnet,
and remove supernatant.
3. Remove from magnet, add 22 μl Lysis/Binding buffer, and
pipet-mix.
4. Bring 1 μg RNA to 50 μl using RNase-free water and incubate
at 70 °C for 2 min.
5. Add 50 μl binding buffer and pulse-centrifuge.
6. Add 20 μl oligo-dT beads, gently mix using a pipette, and
incubate for 5 min at room temperature. Meanwhile, incubate
RNase-free water (25 μl per sample) at 80 °C.
7. Briefly centrifuge samples (see Note 3) place on magnet, and
discard supernatant.
8. Add 100 μl Wash Buffer A, gently pipet, and pulse-centrifuge.
Place on magnet and discard supernatant.
9. Add 150 μl Wash Buffer B, gently pipet, and pulse-centrifuge.
Place on magnet and discard supernatant.
10. Resuspend beads in 25 μl 80 °C RNase-free water and incu-
bate at room temperature for 30 s.
11. Add 25 μl Lysis/Binding buffer and incubate at room tem-
perature for 5 min.
12. Repeat steps 7–9.
13. Add 15 μl 10 mM Tris and incubate at 80 °C for 2 min.
14. Place on magnet, and immediately transfer 14.5 μl sample to
another tube.
3.3 First Strand 1. Add 1 μl of 100 μM first strand primer (Random_Hexamer_
cDNA Synthesis P7) and 5 μl Takara First Strand Buffer to polyA+ mRNA and
incubate at 95 °C for 2 min.
Quantitative RNA Analysis Using RNA-Seq 101
3.4 Second Strand 1. Dilute second strand primers to 100 μM (ST_2nd) or 10 μM
Synthesis (SL_2nd) with RNase-free water.
2. For stranded RNAseq libraries, transfer 12.5 μl of the first
strand reaction to a new strip tube (labeled “ST”) and add
0.5 μl SMARTScribe Reverse Transcriptase and 1 μl of 100 μM
ST_2nd primer.
3. For slRNAseq libraries, transfer 12.5 μl of the first strand reac-
tion to a strip tube (labeled “SL”) and add 0.5 μl SMARTScribe
Reverse Transcriptase and 1 μl 10 μM SL_2nd primer.
4. Incubate samples at 42 °C for 120 min.
5. Transfer samples to 1.5-ml tubes and add a 1× volume (see
Note 4) of Ampure XP beads using RNase-free low-retention
pipette tips and pipet up and down until evenly suspended.
6. Allow DNA to bind to the beads at room temperature for
10 min.
7. Place on magnet. Once the supernatant is clear, carefully
remove and discard the supernatant, making sure not to dis-
lodge the beads.
8. Without disturbing the beads, add 200 μl freshly prepared
80% ethanol.
9. Incubate at RT for 30 s, then carefully remove and discard the
ethanol.
10. Repeat steps 8 and 9, for a total of two washes.
11. Remove residual ethanol from bottom and sides of tubes with
a P20 pipette tip and air-dry until beads are no longer shiny,
but before they have cracked (see Note 5).
12. Thoroughly resuspend the dried beads in 25 μl TElow using a
low-retention pipette tip.
13. Incubate at room temperature for 2 min and place samples
onto magnet.
14. Transfer supernatant to a fresh tube and repeat steps 5–11.
15. Thoroughly resuspend the dried beads in 27 μl TElow using a
low-bind pipette tip.
16. Incubate at room temperature for 2 min and place samples on
magnet.
17. Transfer 25 μl of supernatant to a fresh strip tube (see Note 6).
102 Peter J. Myler et al.
3.5 PCR 1. For Stranded RNAseq libraries, prepare the PCR reaction mix
Amplification and DNA at room temperature by mixing:
Purification (a) 12.5 μl purified second strand cDNA above.
(b) 25 μl Phire Hotstart 2× Master Mix.
(c) 1 μl 20 μM ST_P5 primer.
(d) 1 μl 20 μM P7iX primer.
(e) 10.5 μl water.
2. PCR amplification is carried out by heating to 98 °C for 3 min;
followed by two cycles of 98 °C for 15 s, 58 °C for 15 s, 72 °C
for 1 min; 12–35 cycles (see Note 7) of 98 °C for 15 s, 72 °C
for 75 s; and, finally, 72 °C for 10 min, before cooling to 4 °C.
3. For slRNAseq libraries, prepare the PCR reaction at room
temperature by mixing:
(a) 12.5 μl purified second strand cDNA above.
(b) 25 μl Phire Hotstart 2× Master Mix.
(c) 1 μl 20 μM SL_P5 primer.
(d) 1 μl 20 μM P7iX primer.
(e) 10.5 μl water.
4. PCR amplification is carried out by heating to 98 °C for 3 min;
followed by two cycles of 98 °C for 15 s, 35 °C for 15 s, 72 °C
for 1 min; 12–35 cycles (see Note 7) of 98 °C for 15 s, 72 °C
for 75 s; and, finally, 72 °C for 10 min, before cooling to 4 °C.
5. Transfer samples to 1.5-ml tubes and add 0.8× volume (40 μl)
of Ampure XP beads using RNase-free low-retention pipette
tips and pipet up and down until incorporated.
6. Allow DNA to bind to the beads at room temperature for
10 min.
7. Place on magnet. Once the supernatant is clear, carefully
remove and discard, making sure not to dislodge the beads.
8. Without disturbing the beads, add 200 μl freshly prepared
80% ethanol.
9. Incubate at RT for 30 s and carefully remove and discard
ethanol.
10. Repeat steps 8 and 9, for a total of two washes.
11. Remove residual ethanol from the bottoms and sides of the
tubes with a P20 pipette tip and air-dry until beads are no
longer shiny, but before they have cracked.
12. Thoroughly resuspend the dried beads in 25 μl TElow using a
low retention pipette tip.
13. Incubate at room temperature for 2 min and place samples on
magnet.
Quantitative RNA Analysis Using RNA-Seq 103
Concentration ( ng / µl ) × 106
pM =
size × 0.66
3.7 Illumina 1. Provide 10 μl of each RNAseq library (and the concentration
Sequencing determined above) to a sequencing facility, along with an ali-
(See Note 9) quot of the custom sequencing primer (SL_SEQ) for slRNA-
seq samples (see Note 10).
2. The sequencing facility will usually provide fastq files for each
sample after deindexing.
3.8 Data Quality 1. Fastq files are uncompressed using appropriate tool (e.g., gun-
Check zip) and the average read quality calculated using FastQC tool
and Read-Filtering kit. Reads with a quality score of less than 20 are removed
from subsequent analysis.
2. The average quality for each cycle/base position is calculated
and plotted graphically using a customized R script. If there
are striking discrepancies in read qualities of adjacent bases,
the possible cause is investigated by consultation with the
sequencing facility.
3. The average GC content for each cycle/base is calculated and
compared to that of Leishmania (~60%). Because of method
of library preparation, we expect an over-abundance of Gs at
residues 4–6 of Read1 from Stranded RNAseq libraries, but
non-random distribution at other positions would indicate a
heavily skewed or contaminated library. The presence of Ns at
any position indicates a problem with read quality.
4. The thousand most-frequent reads are identified and aligned
to the reference genome (see below). The frequency and posi-
104 Peter J. Myler et al.
3.9 Alignment 1. A fasta file containing the reference genome sequence (usually
to Reference Genome obtained from TritrypDB) is indexed with “bowtie2-build”
command of the Bowtie2 suite.
2. Fastq files are aligned against the indexed reference genome
using Bowtie2 with following parameters: –very-sensitive-
local -trim5 6 (to trim the nontemplated sequence from the 5′
end of Stranded RNAseq libraries).
3. SAM output is converted into a binary format (BAM), sorted,
and indexed using default parameters in Samtools.
4. Using the SL-Seq software package (https://github.com/
CuypersBart/SL-Seq), the gene annotations of the organism are
expanded such that the 5′ UTR of a gene reaches the 3′ end of
the upstream gene. This change allows splice leader sequences to
map to the gene models during gene counting and produces a
new gene annotation file (GTF) to reflect these changes.
5. Using the featureCounts module from the subreads package
(http://bioinf.wehi.edu.au/featureCounts/), we utilize the
BAM alignment and the modifed splice leader GTF to produce
gene counts in a tab-delimited file to be used for differential
gene expression analysis.
3.10 Differential 1. Raw count data (not RPKM) are loaded into the Bioconductor
Expression Analysis edgeR package via the readDGE() function.
(See Note 12) 2. The DGEListobject$samples$lib.size <- colSums(DGEListo-
bject$counts) function is used to recalculate Library sizes
after filtering out genes with fewer than three counts in any
libraries.
3. Normalization factors are calculated using the calcNormFac-
tors() function (see Note 13).
4. A sample-wide common Biological Coefficient of Variation
(BCV) is calculated using the estimateGLMCommonDisp()
function (see Note 14).
5. The estimateGLMTagwiseDisp() function is used to calculate
gene-wise dispersion from common BCV (see Note 15).
6. The glmFit() function is used to fit the negative binomial GLM
for each gene and the glmLRT() used to perform a differential
expression test using likelihood ratio test (see Note 16).
7. The log2 ratio of median-normalized read counts (see Note 17)
between the libraries is calculated for each gene to determine
the fold-change in mRNA expression level between samples.
In case of time-series experiments, the starting sample (time-
zero) is usually used as a common reference.
Quantitative RNA Analysis Using RNA-Seq 105
4 Notes
10. If required, the sequencing facility will add the SL_SEQ primer
to the samples prior to loading onto the cBOT. We use a
locked nucleic acid (LNA) oligonucleotide to raise the melting
temperature of the SL_SEQ primer to match that of the
TruSEQ Read1 primer.
11. Since the 3′ UTRs for most genes are not yet defined, all SL
sites between the 3′ end of the CDS and the nearest boundary
of the next gene upstream are associated with each particular
gene. The major SL site is defined as that with the most reads
and minor SL sites are ranked in decreasing order of read
abundance.
12. The choice of approach used to identify differentially
expressed genes will be influenced heavily by the experimental
design. Here we describe the use of edgeR Bioconductor
package ([25]) for cases where there are two or more biologi-
cal replicates in a least one of the sample groups. edgeR can
analyze two or more sample groups (e.g., drug-treated and
untreated) for one (treatment effect) or multiple compound-
ing factors (batch effects, life cycle stage, etc.) at the same
time. While it is not possible to perform rigorous statistical
analyses on experiments that lack replicates, we use median-
normalization to correct for differences in library size to allow
descriptive analysis of single-replicate experiments. The raw
read counts for each gene is divided by the median read count
of all genes in each library and multiplied by 100. To minimize
artifacts due to low read counts, genes with raw read counts
below 10% of the median value are assigned a normalized read
count of 10.
13. calcNormFactors normalizes for RNA composition by finding a
set of scaling factors for the library sizes that minimize the log-
fold changes between the samples for most genes. The default
method for computing these scale factors uses a Trimmed
Mean of M-values (TMM) between each pair of samples ([25]).
The product of the original library size and the scaling factor is
called the “effective library size,” which replaces the original
library size in all downstream analyses.
14. A lower BCV indicates higher consistency within biological
replicates.
15. This estimates the unknown variation that exists between
genes within biological replicates.
16. The method used to calculate false discovery rate (FDR) can
be changed using p.adjust() function. The toptags() function
can be used to retrieve the results of edgeR analysis in a tabular
form (containing GeneID, log2-Fold Change, P-Values, and
FDR, among others) for use in subsequent analyses using
different software.
Quantitative RNA Analysis Using RNA-Seq 107
17. The raw read count for a gene is divided by the median read
count of all genes in each library and multiplied by 100. To
minimize artifacts due to low read counts, genes with raw read
counts below 10% of the median value are assigned a normal-
ized read count of 10.
References
1. Ivens AC, Peacock CS, Worthey EA, Murphy Chromosome and gene copy number variation
L, Aggarwal G, Berriman M, Sisk E, allow major structural change between species
Rajandream MA, Adlem E, Aert R, Anupama and strains of Leishmania. Genome Res
A, Apostolou Z, Attipoe P, Bason N, Bauser 21(12):2129–2142
C, Beck A, Beverley SM, Bianchettin G, 4. Downing T, Imamura H, Decuypere S, Clark
Borzym K, Bothe G, Bruschi CV, Collins M, TG, Coombs GH, Cotton JA, Hilley JD, de
Cadag E, Ciarloni L, Clayton C, Coulson RM, Doncker S, Maes I, Mottram JC, Quail MA,
Cronin A, Cruz AK, Davies RM, De Gaudenzi Rijal S, Sanders M, Schonian G, Stark O,
J, Dobson DE, Duesterhoeft A, Fazelina G, Sundar S, Vanaerschot M, Hertz-Fowler C,
Fosker N, Frasch AC, Fraser A, Fuchs M, Dujardin JC, Berriman M (2011) Whole
Gabel C, Goble A, Goffeau A, Harris D, genome sequencing of multiple Leishmania
Hertz-Fowler C, Hilbert H, Horn D, Huang donovani clinical isolates provides insights into
Y, Klages S, Knights A, Kube M, Larke N, population structure and mechanisms of drug
Litvin L, Lord A, Louie T, Marra M, Masuy D, resistance. Genome Res 21(12):2143–2156
Matthews K, Michaeli S, Mottram JC, Muller- 5. Raymond F, Boisvert S, Roy G, Ritt JF, Legare
Auer S, Munden H, Nelson S, Norbertczak H, D, Isnard A, Stanke M, Olivier M, Tremblay
Oliver K, O'Neil S, Pentony M, Pohl TM, MJ, Papadopoulou B, Ouellette M, Corbeil
Price C, Purnelle B, Quail MA, Rabbinowitsch J (2012) Genome sequencing of the lizard
E, Reinhardt R, Rieger M, Rinta J, Robben J, parasite Leishmania tarentolae reveals loss of
Robertson L, Ruiz JC, Rutter S, Saunders D, genes associated to the intracellular stage of
Schafer M, Schein J, Schwartz DC, Seeger K, human pathogenic species. Nucleic Acids Res
Seyler A, Sharp S, Shin H, Sivam D, Squares 40(3):1131–1147
R, Squares S, Tosato V, Vogt C, Volckaert G,
Wambutt R, Warren T, Wedler H, Woodward 6. Guimond C, Trudel N, Brochu C, Marquis N,
J, Zhou S, Zimmermann W, Smith DF, El F, Peytavi R, Briand G, Richard D, Messier
Blackwell JM, Stuart KD, Barrell B, Myler PJ N, Papadopoulou B, Corbeil J, Bergeron MG,
(2005) The genome of the kinetoplastid para- Legare D, Ouellette M (2003) Modulation of
site, Leishmania major. Science 309(5733): gene expression in Leishmania drug resistant
436–442 mutants as determined by targeted DNA micro-
arrays. Nucleic Acids Res 31(20):5886–5896
2. Peacock CS, Seeger K, Harris D, Murphy L,
Ruiz JC, Quail MA, Peters N, Adlem E, Tivey 7. Duncan R (2004) DNA microarray analysis of
A, Aslett M, Kerhornou A, Ivens A, Fraser A, protozoan parasite gene expression: outcomes
Rajandream MA, Carver T, Norbertczak H, correlate with mechanisms of regulation.
Chillingworth T, Hance Z, Jagels K, Moule S, Trends Parasitol 20(5):211–215
Ormond D, Rutter S, Squares R, Whitehead S, 8. Duncan RC, Salotra P, Goyal N, Akopyants
Rabbinowitsch E, Arrowsmith C, White B, NS, Beverley SM, Nakhasi HL (2004) The
Thurston S, Bringaud F, Baldauf SL, application of gene expression microarray tech-
Faulconbridge A, Jeffares D, Depledge DP, nology to kinetoplastid research. Curr Mol
Oyola SO, Hilley JD, Brito LO, Tosi LR, Med 4(6):611–621
Barrell B, Cruz AK, Mottram JC, Smith DF, 9. McNicoll F, Drummelsmith J, Muller M,
Berriman M (2007) Comparative genomic Madore E, Boilard N, Ouellette M,
analysis of three Leishmania species that cause Papadopoulou B (2006) A combined pro-
diverse human disease. Nat Genet 39(7): teomic and transcriptomic approach to the
839–847 study of stage differentiation in Leishmania
3. Rogers MB, Hilley JD, Dickens NJ, Wilkes J, infantum. Proteomics 6(12):3567–3581
Bates PA, Depledge DP, Harris D, Her Y, 10. Almeida R, Gilmartin BJ, McCann SH, Norrish
Herzyk P, Imamura H, Otto TD, Sanders M, A, Ivens AC, Lawson D, Levick MP, Smith DF,
Seeger K, Dujardin JC, Berriman M, Smith Dyall SD, Vetrie D, Freeman T, Coulson RM,
DF, Hertz-Fowler C, Mottram JC (2011) Sampaio I, Schneider H, Blackwell JM (2004)
108 Peter J. Myler et al.
Expression profiling of the Leishmania life 18. Clayton CE (2002) Life without transcrip-
cycle: cDNA arrays identify developmentally tional control? From fly to man and back again.
regulated genes present but not annotated in EMBO J 21(8):1881–1888
the genome. Mol Biochem Parasitol 136(1): 19. Nilsson D, Gunasekera K, Mani J, Osteras M,
87–100 Farinelli L, Baerlocher L, Roditi I, Ochsenreiter
11. Holzer TR, McMaster WR, Forney JD (2006) T (2010) Spliced leader trapping reveals wide-
Expression profiling by whole-genome inter- spread alternative splicing patterns in the highly
species microarray hybridization reveals differ- dynamic transcriptome of Trypanosoma brucei.
ential gene expression in procyclic PLoS Pathog 6(8):e1001037. https://doi.
promastigotes, lesion-derived amastigotes, and org/10.1371/journal.ppat.1001037
axenic amastigotes in Leishmania mexicana. 20. van Luenen HG, Farris C, Jan S, Genest PA,
Mol Biochem Parasitol 146(2):198–218 Tripathi P, Velds A, Kerkhoven RM, Nieuwland
12. Saxena A, Lahav T, Holland N, Aggarwal G, M, Haydock A, Ramasamy G, Vainio S,
Anupama A, Huang Y, Volpin H, Myler PJ, Heidebrecht T, Perrakis A, Pagie L, van
Zilberstein D (2007) Analysis of the Leishmania Steensel B, Myler PJ, Borst P (2012)
donovani transcriptome reveals an ordered pro- Glucosylated hydroxymethyluracil, DNA base
gression of transient and permanent changes in J, prevents transcriptional readthrough in
gene expression during differentiation. Mol Leishmania. Cell 150(5):909–921
Biochem Parasitol 152(1):53–65 21. Mittra B, Cortez M, Haydock A, Ramasamy G,
13. Leifso K, Cohen-Freue G, Dogra N, Murray A, Myler PJ, NW A (2013) Iron uptake controls
McMaster WR (2007) Genomic and proteomic the generation of Leishmania infective forms
expression analysis of Leishmania promastigote through regulation of ROS levels. J Exp Med
and amastigote life stages: The Leishmania 210(2):401–416
genome is constitutively expressed. Mol 22. Martin JL, Yates PA, Soysa R, Alfaro JF, Yang
Biochem Parasitol 152(1):35–46 F, Burnum-Johnson KE, Petyuk VA, Weitz
14. Cohen-Freue G, Holzer TR, Forney JD, KK, Camp DG 2nd, Smith RD, Wilmarth PA,
McMaster WR (2007) Global gene expression David LL, Ramasamy G, Myler PJ, Carter NS
in Leishmania. Int J Parasitol 37(10): (2014) Metabolic reprogramming during
1077–1086 purine stress in the protozoan pathogen
15. Rochette A, Raymond F, Ubeda JM, Smith M, Leishmania donovani. PLoS Pathog 10(2):
Messier N, Boisvert S, Rigault P, Corbeil J, e1003938
Ouellette M, Papadopoulou B (2008) 23. Goldman-Pinkovich A, Balno C, Strasser R,
Genome-wide gene expression profiling analy- Zeituni-Molad M, Bendelak K, Rentsch D,
sis of Leishmania major and Leishmania infan- Ephros M, Wiese M, Jardim A, Myler PJ,
tum developmental stages reveals substantial Zilberstein D (2016) An arginine deprivation
differences between the two species. BMC response pathway is induced in Leishmania
Genomics 9:255 during macrophage invasion. PLoS Pathog
16. Lahav T, Sivam D, Volpin H, Ronen M, 12(4):e1005494
Tsigankov P, Green A, Holland N, Kuzyk M, 24. Hunt AG (2015) A rapid, simple, and inexpen-
Borchers C, Zilberstein D, Myler PJ (2011) sive method for the preparation of strand-
Multiple levels of gene regulation mediate dif- specific RNA-Seq libraries. Methods Mol Biol
ferentiation of the intracellular pathogen 1255:195–207
Leishmania. FASEB J 25(2):515–525 25. Robinson MD, McCarthy DJ, Smyth GK (2010)
17. Wang Z, Gerstein M, Snyder M (2009) RNA- edgeR: a Bioconductor package for differential
Seq: a revolutionary tool for transcriptomics. expression analysis of digital gene expression
Nat Rev Genet 10(1):57–63 data. Bioinformatics 26(1):139–140
Chapter 5
Abstract
Ribosomes are the machinery responsible for reading mRNAs and translating them into proteins. The
ribosome profiling approach is based on high-throughput sequencing of ribosome-protected mRNAs.
RNAs not harboring ribosomes are removed by nuclease digestion leaving the so-called ribosome “foot-
prints.” The purified “footprint” RNA molecules are processed into DNA libraries and their individual
abundance is determined by deep sequencing. Ribosome profiling reveals the portion of transcripts which
are actually protein-coding and can be used for differential gene expression analysis addressing rates of
protein synthesis, and translational control and efficiency.
Key words Deep sequencing, Gene expression, mRNA levels, Translation efficiency, Protein abundance,
Translational control, Ribosome positions, CDSs
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_5, © Springer Science+Business Media, LLC, part of Springer Nature 2019
109
110 Amelie J. Kraus and Raúl O. Cosentino
[5], and only a few steps were modified for the use in trypano-
somes (see Notes 1–3). The method should be readily applicable
for use in Leishmania spp.
2 Materials
2.2 Cell Lysis 1. Wild-type bloodstream form (BF) cells of T. brucei Lister 427
(MITat 1.2 clone 221) cultivated at 37 °C in HMI-11 to a cell
density of 1.5 × 106 cells/ml or wild-type procyclic form (PF)
cells of T. brucei strain Lister 427 cultivated at 27 °C in SDM-
79 medium supplemented with 10% fetal bovine serum and
hemin (7.5 mg/l) to a cell density of 107 cells/ml.
2. Cycloheximide 100 mg/ml in DMSO.
3. Polysome lysis buffer [6]: 10 mM Tris–HCl pH 7.4, 300 mM
KCl, 10 mM MgCl2.
4. Cell lysis buffer (per 109 cells): 360 μl polysome lysis buffer,
40 μl of 10% noctylglycoside, and 10 μl TURBO DNaseI
(Ambion; 2 U/μl).
3 Methods
4. Lyse cells using 410 μl cell lysis buffer per 109 cells and incubate
for 30 min on ice.
5. Centrifuge lysate at 16,000 × g, 4 ° C for 10 min and transfer
supernatant to a new microcentrifuge tube.
6. Determine OD260 using a NanoDrop 2000. OD260 should be
≥80. Dilute cell lysate with cell lysis buffer to OD260 = 40.
7. Shock-freeze 200 μl aliquots (OD260 = 40) in liquid nitrogen
and store at −80 °C (samples can be stored for at least
6 months).
13. Remove gradients carefully from the rotor, put them at 4 °C,
and immediately carry out fractionation.
14. Fractionate sucrose gradients on the Gradient station (speed:
0.2 mm/s, distance/fraction: 80 mm).
15. Collect the 80S monosome peaks in 15 ml tubes. Note:
The 80S monosome peak should be larger for the digested
sample compared to the undigested sample.
16. If the collected volume is <700 μl, adjust volume with 10%
sucrose solution to 700 μl.
17. Freeze samples in liquid nitrogen and store at −80 °C.
3.2.2 RNA Purification All steps using organic solvents must be performed under a fume
from 80S Monosome hood, wearing protective gloves and facial shields/eye protection.
Fraction
1. Prewarm phenol–chloroform–isoamyl alcohol (PCI) to 65 °C
in water bath.
2. Adjust fractionated extracts to 65 °C and add 20% SDS to a
final concentration of 1%.
3. Add one sample volume PCI to each sample, vortex briefly,
and incubate the samples at 65 °C for 5 min in water bath
(vortex briefly every minute).
4. Incubate samples on ice for 5 min.
5. Centrifuge for 15 min at 4500 × g and 4 °C.
6. Carefully recover the upper, aqueous phase and transfer to
fresh 15 ml tubes.
7. If phase volume is ≤550 μl recover aqueous phase in a 1.5 ml
nonstick RNase-free tube.
8. Add one sample volume PCI to each sample, vortex briefly
and incubate the samples at RT for 5 min (vortex briefly every
minute).
9. Centrifuge for 15 min at 4500 × g and 4 °C for 15 ml tubes.
Alternatively, centrifuge 1.5 ml nonstick RNase-free tubes for
5 min at full speed and 4 °C.
10. Transfer aqueous phase to fresh 15 ml tube or 1.5 ml nonstick
RNase-free tube (if volume is ≤550 μl).
11. Add 1/10 (v/v) 3 M NaOAc (pH 5.5), 0.5 μl GlycoBlue, and
1.5 vol of isopropanol.
12. Precipitate RNA at −20 °C for at least 30 min (or
overnight).
13. Centrifuge the samples at 4500 × g and 4 °C for 60 min for
15 ml tubes or at full speed and 4 °C for 30 min for 1.5 ml
nonstick RNase-free tubes.
14. Discard supernatant.
Ribosome Profiling in Trypanosomatids 115
3.3 General Protocol: In the following, the general extraction procedure of nucleic acids
Nucleic Acid from polyacrylamide gel is described. The specific requirements for
Extraction DNA or RNA are described where required.
from Polyacrylamide 1. Prerun polyacrylamide gels for 30 min in 1× TBE buffer at
Gels 180 V.
2. Load samples and run for 75 min at 180 V.
3. Prepare 0.5 ml non-stick nuclease-free tube: Poke a hole in the
bottom of the tube.
4. Stain gel with 1× SYBR Gold in 1× TBE for 3 min and visual-
ize gel under UV monitor.
5. Excise region of interest using a clean razor blade.
6. Transfer gel slice to the clean 0.5 ml non-stick nuclease-free
tube with a hole in the bottom.
7. Place 0.5 ml tube into a 1.5 ml tube and centrifuge at
16,000 × g and RT for 2 min, thereby straining the gel slice
through the hole and into the 1.5 ml tube.
8. Add elution buffer (see below) to the gel and elute overnight
on rotating wheel at 4 °C.
9. On the next day, transfer gel slurry to a microcentrifuge tube
spin filter and centrifuge at maximum speed and RT for 2 min.
10. Add 1.5 μl of GlycoBlue and 500 μl of isopropanol, vortex,
and place the tubes at −20 °C for at least 30 min (or
overnight).
11. Spin sample at 16,000 × g and 4 °C for 30 min, remove super-
natant, and add 1 ml of 80% ethanol. Mix thoroughly by
vortexing.
12. Spin sample at 16,000 × g and 4 °C for 20 min, and remove
supernatant.
13. Spin down briefly to collect residual ethanol at the bottom and
remove supernatant.
116 Amelie J. Kraus and Raúl O. Cosentino
3.4.2 RNA 1. Add 33 μl of nuclease-free water to samples and denature for
Dephosphorylation 90 s at 90 °C. Let samples cool down to 37 °C and set up the
reactions according to Table 1.
2. Mix thoroughly and incubate reactions at 37 °C for 1 h.
3. Afterward, inactivate the enzyme at 70 °C for 10 min.
4. Precipitate RNAs by adding 39 μl of water, 1 μl of GlycoBlue,
and 10 μl of 3 M sodium acetate, mixing them together, and
then adding 150 μl isopropanol.
Ribosome Profiling in Trypanosomatids 117
Table 1
Reaction mix for RNA dephosphorylation
Final
Component Amount (μl) concentration
RNA sample 43.0
T4 polynucleotide kinase buffer (10×) 5.0 1×
SUPERase•In RNase inhibitor (20 U/μl) 1.0 20 U
T4 polynucleotide kinase buffer (10 U/μl) 1.0 10 U
Table 2
Reaction mix for linker ligation to the RNA samples
Final
Component Amount (μl) concentration
RNA and linker 10.0
T4 RNA ligase 2 truncated buffer (10×) 2.0 1×
PEG 8000 (50%, wt/vol) 6.0 15% (wt/vol)
SUPERase•In RNase inhibitor (20 U/μl) 1.0 20 U
T4 RNA ligase 2 truncated (200 U/μl) 1.0 200 U
3.4.3 Linker Ligation 1. Add 1.5 μl of preadenylated linker (0.5 μg/μl) to RNA samples
and denature for 90 s at 80 °C. Let samples cool down to
37 °C and set up the reactions according to Table 2.
2. Mix thoroughly and incubate reactions at RT for 2.5 h.
3. Precipitate RNAs by adding 338 μl of water, 1.5 μl of
GlycoBlue, and 40 μl of 3 M sodium acetate, mixing them
together, and then adding 500 μl isopropanol.
4. Store reaction at −20 °C for at least 30 min (or overnight).
5. Pellet RNAs at 16,000 × g, 4 °C for 30 min, remove supernatant
carefully, and add 1.0 ml of 80% ethanol.
118 Amelie J. Kraus and Raúl O. Cosentino
3.4.4 Reverse 1. Add 2 μl of reverse transcription primer to ligated RNA sam-
Transcription ples, denature for 2 min at 80 °C in a thermal cycler and place
reactions immediately on ice.
2. Set up reactions according to the following pipetting scheme
in Table 3.
Table 3
Reaction mix for reverse transcription
Final
Component Amount (μl) concentration
Ligated RNA and primer 12.0
First-strand buffer (5×) 4.0 1×
dNTPs (10 mM) 1.0 0.5 mM
DTT (0.1 M) 1.0 5 mM
SUPERase•In RNase inhibitor (20 U/μl) 1.0 20 U
SuperScript III (200 U/μl) 1.0 200 U
Ribosome Profiling in Trypanosomatids 119
3.4.5 Separation 1. Add 1.66 μl of 6× DNA loading dye and 3.34 μl of nuclease-
of Reverse-Transcription free water to each sample. Prepare 1 μl 10 bp DNA ladder
Products (1 μg/μl) and 2 μl of 1.25 μM reverse-transcription primer
from Unextended Primer similarly.
2. Prepare one 8% (wt/vol) denaturing-PAGE gel, prerun it for
30 min, and load samples, ladder, and controls (10 μl per well).
3. Run gels for 40 min at 180 V, stain with SYBR Gold 1× for
3 min, and visualize gels under UV.
4. Excise reverse transcription products (>100 nt) and transfer
each gel slice to a 0.5 ml non-stick DNase-free tube with a
hole in the bottom.
5. Perform extraction as described above. Use 0.4 ml of DNA gel
extraction buffer as elution buffer.
6. After precipitation, resuspend size-selected DNA in 16 μl of
10 mM Tris–HCl (pH 8).
7. Transfer the samples to 0.2 ml PCR tubes and store at −20 °C
or proceed to the next step.
Table 4
Reaction mix for circularization of cDNA templates
Table 5
Reaction mix for amplification and barcode addition of the circularized
DNA templates
Table 6
PCR cycling protocol for amplification and barcode addition of the
circularized DNA templates
4 Notes
Acknowledgments
References
1. Clayton CE (2002) Life without transcriptional 5. Ingolia NT et al (2012) The ribosome profiling
control? From fly to man and back again. strategy for monitoring translation in vivo by
EMBO J 21(8):1881–1888 deep sequencing of ribosome-protected mRNA
2. Ingolia NT et al (2009) Genome-wide analysis fragments. Nat Protoc 7(8):1534–1550
in vivo of translation with nucleotide resolution 6. Jensen BC et al (2005) Species specificity in
using ribosome profiling. Science 324(5924): ribosome biogenesis: a nonconserved phospho-
218–223 protein is required for formation of the large
3. Vasquez JJ et al (2014) Comparative ribosome ribosomal subunit in Trypanosoma brucei.
profiling reveals extensive translational com- Eukaryot Cell 4(1):30–35
plexity in different Trypanosoma brucei life 7. Ingolia NT (2010) Genome-wide translational
cycle stages. Nucleic Acids Res 42(6): profiling by ribosome footprinting. Methods
3623–3637 Enzymol 470:119–142
4. Smircich P et al (2015) Ribosome profiling 8. Webb H et al (2005) Developmentally regu-
reveals translation control as a key mechanism lated instability of the GPI-PLC mRNA is
generating differential gene expression in dependent on a short-lived protein factor.
Trypanosoma cruzi. BMC Genomics 16:443 Nucleic Acids Res 33(5):1503–1512
Chapter 6
Abstract
Cosmid libraries can represent an entire genome in a library of circular DNA molecules, allowing for the
faithful amplification, cloning and isolation of large genomic DNA fragments. Moreover, using the so-
called shuttle cosmid vectors, genomic DNA may be propagated in bacteria and in eukaryotic cells, which
is a prerequisite for classic functional cloning and for the newly described Cos-Seq strategies.
Key words High-quality gDNA extraction, Cosmid library preparation, Cosmid library evaluation,
Functional cloning
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_6, © Springer Science+Business Media, LLC, part of Springer Nature 2019
123
124 Joachim Clos and Dorothea Zander-Dinse
2 Materials
2.1 Cell Culture 1. Medium 199, Hanks’ Salts (Sigma) supplemented with 20%
fetal calf serum (batch-tested, heat-inactivated), 100 μM ade-
nine, 10 μg/ml heme, 40 μM HEPES (pH 7.4), 1.2 μg/ml
6-biopterin, and 20 μg/ml gentamycin [18].
2. TE buffer: 10 mM Tris–HCl (pH 8.0), 1 mM EDTA [17].
3. Phosphate-buffered saline = PBS, pH 7.4.
2.2 Cell Lysis 1. Extraction buffer: 10 mM Tris–HCl pH 8.0; 100 mM EDTA,
and DNA Extraction pH 8.0; 0.5% SDS; 40 μg/ml RNase A.
2. 10 μg/μl RNaseA stock in distilled water.
3. 20 μg/μl Proteinase K stock.
Cosmid Library Construction and Functional Cloning 125
3 Methods
3.1 Cell Culture 1. Leishmania promastigotes are grown in axenic liquid medium
culture, monitoring cell density at daily intervals.
2. From a logarithmically growing culture, 4–5 × 109 cells are
collected and sedimented by centrifugation at 1200 × g, 4 °C
for 10 min.
3. The cell pellet is washed twice in 20 ml of 1× PBS and sedi-
mented by centrifugation at 1200 × g, 4 °C for 10 min.
4. After washing, promastigotes are suspended in TE buffer at
1 × 109 cells/ml.
3.2 Cell Lysis, DNA 1. To the cell suspension, add ten volumes of extraction buffer
Extraction and 40 μg/ml RNaseA; incubate at 37 °C for 1 h.
2. Add Proteinase K at 0.1 μg/μl; incubate at 50 °C for 3 h.
Steps 3–7. to be performed in a fume hood wearing solvent-
resistant gloves (nitrile gloves) and facial protection.
3. Transfer cell lysate to 100 ml separation funnel (Fig. 2) and
add one volume of Tris-saturated phenol (pH 8.0); mix gently.
Fix with clamp and leave in fume hood overnight.
4. Using the stop cock, drain the lower, organic phase into a
waste container, but leave the interphase!
5. Repeat Subheadings 3 and 4 once.
6. To the aqueous phase, add 0.5 volumes each of Tris-saturated
phenol and of chloroform–isoamyl alcohol mix (24:1); mix
gently. Hold the stopper carefully. After mixing, place separa-
tion funnel in clamp, carefully open stopper once to release
fumes. Leave overnight.
7. Carefully transfer the aqueous phase to a 50 ml centrifuge
tube (any type of “50 ml Falcon tube”).
3.3 DNA 1. To the recovered aqueous phase, add 0.2 volumes of 7.5 M
Precipitation ammonium acetate solution and mix gently.
and Spooling 2. Overlay the aqueous phase with 1 volume of pure ethanol
(>96%). Using a glass hook (see Subheading 2.3, item 2,
Fig. 1), gently stir the border between aqueous and ethanol
phase, thereby spooling the high molecular weight DNA onto
the glass hook.
3. Break off the hook into a 2 ml reaction vial using a strong
forceps and add 500 μl of TE buffer, covering the glass. Place
on a roller mixer at very low speed for at least 24 h to dissolve
the high molecular weight DNA without shearing.
4. Determine the OD260 nm and OD280 nm of a 10 μl aliquot diluted
1:100 in TE buffer. The ratio OD260 nm/OD280 nm should be
1.8; higher ratios indicate RNA contamination. Calculate
gDNA concentration as OD260 nm × 100/21 (see Note 1).
5. Check the quality of the gDNA by electrophoresis of a 1 μg
aliquot by field inversion gel electrophoresis (FIGE, 1% aga-
rose in 0.5× TBE buffer, 7 V cm−1, 16 h, forward–reverse 2:1)
[19] or, if not available, by horizontal agarose gel electropho-
resis (0.8% agarose in 1× TAE buffer, 2 V cm−1, 12 h, buffer
circulation). Stain the gel for 15–30 min in 0.5 TBE buffer
with ethidium bromide, destain in buffer for 20 min. View gel
on UV (λ > 300 nm) transilluminator. The majority of the
gDNA should migrate as >200 bp fragments (FIGE) or be
stuck in the gel loading well (agarose gel electrophoresis).
3.4 Partial 1. In the first step, the best DNA–enzyme ratio must be deter-
Restriction Enzyme mined. We generally use the restriction endonuclease Sau3A1
Digest of gDNA for partial digests, generating fragments with 5′-GATC
overhangs that are compatible in ligation with the 5′-GATC
overhangs generated with the BamHI restriction endonucle-
ase (5′-G|GATCC-3′). A series of restriction digests with con-
stant substrate amount and increasing enzyme concentrations
Cosmid Library Construction and Functional Cloning 129
Enzyme mix
Sau3AI 36 units
10× NEBuffer 1.1 3.6 μl
H2O add 36 μl
Sample 1 2 3 4 5 6 7 8 9
H2O [μl] 24.8 24.6 24.4 24.2 24.0 23 μl 23.6 23.4 23.2
gDNA mix [μl] 15
Enzyme-mix (0.125 units/μl) 0.20 0.40 0.60 0.80 1.00 1.20 1.40 1.60 1.80
Enzyme units 0.025 0.050 0.075 0.100 0.125 0.150 0.175 0.200 0.225
3.5 Preparation 1. Mix 40 μg pcosTL circular DNA with 20 μl 10× CutSmart
of Cosmid Vector Arms buffer, 60 units of SmaI restriction endonuclease, and add
H2O to 200 µl. Incubate at 25 °C for 1 h. Add ten units of
SmaI and continue incubation at 25 °C for another hour
(see Note 4).
2. Add 22 μl 10× NEB Phosphatase-buffer and 20 units
Antarctic phosphatase to the reaction. Incubate at 37 °C for
15–30 min. Dephosphorylation will prevent ligation of the
blunt end SmaI ends. Add 1/100 volumes of
1,10-phenanthroline stock (100 mM) and heat to 65 °C for
5 min. Cool down to RT.
3. Add 200 μl of phenol–chloroform–isoamyl alcohol mix
(25:24:1) and mix for 5 min using a benchtop mixer.
Centrifuge for 2 min at 10,000 × g and carefully remove and
discard the lower phase. Add 200 μl of chloroform–isoamyl
alcohol mix (24:1), mix for 5 min using a benchtop mixer and
centrifuge for 2 min at 10,000 × g. Transfer the upper, aque-
ous phase to a fresh reaction vial.
4. Add 20 μl of 7.5 M ammonium acetate and 600 μl of 96%
ethanol. Mix thoroughly by turning the vial bottom over top
repeatedly. Immediately sediment the DNA by centrifugation
at 14,000 × g, 25 °C for 20 min (see Note 5). Remove the
supernatant carefully, spin briefly to collect remaining super-
natant and remove that, too. Add 100 μl of H2O and dissolve
pellet for 1 h at RT. Remove a 2 μl aliquot, mix with 2 μl of
formamide sample buffer, and store at RT for later analysis.
5. To the remaining 100 μl of SmaI-digested cosmid vector,
add 15 μl of 10× CutSmart buffer, 60 units of BamHI HF
restriction endonuclease and fill to 150 μl with H2O. Incubate
at 37 °C for 1 h. Add 20 units of BamHI HF and continue
incubation at 37 °C for another 1 h.
6. Cast a 1%, 1 cm deep agarose (LE agarose) gel with 1× Tris–
acetate–EDTA (TAE) buffer and insert a wide-toothed,
132 Joachim Clos and Dorothea Zander-Dinse
3.7 Packaging (See 1. Collect packaging extract aliquots from the −80 °C storage
Note 7) and thaw quickly between fingers. Once the contents start to
thaw, add 0.5 μg of DNA from a ligation reaction and stir
gently with the pipet tip. Collect the reaction at the bottom of
the tube with a short centrifuge spin. Incubate packaging reac-
tion at RT for 2 h.
2. Ad 500 μl of SM buffer to the reaction.
3. Ad 20 μl of chloroform and mix gently.
4. Briefly spin the tube at 10,000 × g to sediment debris.
5. Transfer the supernatant containing the newly assemble phage
particles to a fresh reaction vial. Prepare 1:10 and 1:50 dilu-
tions of the supernatant in SM buffer. Supernatant may be
stored for up to 1 month at 4 °C.
4. Mix 25 μl of the packaging reaction and the 1:10 and 1:50
dilutions, respectively, from Subheading 3.7, step 5. with
100 μl of the bacteria in a 1.5 ml reaction vial. Incubate at RT
for 30 min.
5. Add 200 μl LB medium to each sample and incubate at 37 °C
for 1 h, gently shaking the vial every 15 min. This step allows
expression of the ampicillin resistance.
6. Spin at 6000 × g for 1 min. Remove all but 100–150 μl of the
supernatant. Resuspend the cell pellet in the leftover
supernatant and distribute the suspension on an LB medium
agar plate containing 50 μg/ml ampicillin using a Drigalski
spatula and a spin table. Incubate at 37 °C overnight.
3.9 Quality Control 1. From the number of ampicillin-resistant clonal colonies on the
LB agar plates, the number of colony-forming units in each
infection can be calculated. To achieve a full coverage of the
genome with 99% certainty, >4200 individual cosmid-bearing
clones are required [20].
2. Genome coverage of a library can be tested by next generation
sequencing of the cosmid DNA from the library in E. coli.
Cosmid DNA is isolated from a bacterial culture using the
Nucleobond Xtra Maxi kit (Machery & Nagel). The DNA is
then processed by fragmentation and library building. Libraries
are then subjected to NGS, and the reads are aligned to the
relevant Leishmania genome using the Bowtie 2.0 algorithm.
Figure 5 shows such an alignment indicating a high degree of
genome coverage in a cosmid gDNA library. For further
instructions and information, contact your local sequencing
core facility or a commercial sequencing service provider. This
type of verification is a prerequisite for the Cos-Seq strategy of
functional cloning (see Chapter 7).
3.10 Final Now the remainder of the packaging reaction is used to infect the
Preparation bacteria.
of the Cosmid Library
1. Prepare bacteria for infection as described (see Subheading
3.8, steps 1–3).
2. Mix 2× 250 μl of packaging extract with 500 μl of the bacteria
in a 13 ml vented centrifuge tube and incubate at room tem-
perature for 30 min.
3. Add 2.5 ml of LB medium to each sample and incubate for 1 h
at 37 °C, shaking the tube gently once every 15 min.
4. Spin the tube for 5 min at 10,000 × g; remove the supernatant
but for 100–200 μl.
5. Suspend the pellet in leftover medium and plate it on LB/
Amp plates, using a Drigalski spatula. Incubate the plates
overnight at 37 °C.
136 Joachim Clos and Dorothea Zander-Dinse
Fig. 5 Next generation sequencing of cosmid library DNA and alignment of NGS reads to chromosomes 34, 35,
and 36, indicating a high degree of genome coverage in the library
4 Notes
Acknowledgments
References
1. Sollelis L, Ghorbal M, MacPherson CR, 11. Ryan KA, Dasgupta S, Beverley SM (1993)
Martins RM, Kuk N, Crobu L, Bastien P, Shuttle cosmid vectors for the trypanosomatid
Scherf A, Lopez-Rubio JJ, Sterkers Y (2015) parasite Leishmania. Gene 131(1):145–150
First efficient CRISPR-Cas9-mediated genome 12. Ryan KA, Garraway LA, Descoteaux A, Turco
editing in Leishmania parasites. Cell Microbiol SJ, Beverley SM (1993) Isolation of virulence
17(10):1405–1412. https://doi. genes directing surface glycosyl-
org/10.1111/cmi.12456 phosphatidylinositol synthesis by functional
2. Zhang WW, Matlashewski G (2015) CRISPR- complementation of Leishmania. Proc Natl
Cas9-mediated genome editing in Leishmania Acad Sci U S A 90(18):8609–8613
donovani. MBio 6(4):e00861. https://doi. 13. Turco S, Descoteaux A, Ryan K, Garraway L,
org/10.1128/mBio.00861-15 Beverley S (1994) Isolation of virulence genes
3. Duncan SM, Myburgh E, Philipon C, Brown directing GPI synthesis by functional comple-
E, Meissner M, Brewer J, Mottram JC (2016) mentation of Leishmania. Braz J Med Biol Res
Conditional gene deletion with DiCre demon- 27(2):133–138
strates an essential role for CRK3 in Leishmania 14. Beverley SM, Turco SJ (1995) Identification
mexicana cell cycle regulation. Mol Microbiol of genes mediating lipophosphoglycan biosyn-
100(6):931–944. https://doi.org/10.1111/ thesis by functional complementation of
mmi.13375 Leishmania donovani mutants. Ann Trop Med
4. Ngo H, Tschudi C, Gull K, Ullu E (1998) Parasitol 89(Suppl 1):11–17
Double-stranded RNA induces mRNA degra- 15. Descoteaux A, Luo Y, Turco SJ, Beverley SM
dation in Trypanosoma brucei. Proc Natl Acad (1995) A specialized pathway affecting viru-
Sci U S A 95(25):14687–14692 lence glycoconjugates of Leishmania. Science
5. Ullu E, Tschudi C, Chakraborty T (2004) 269(5232):1869–1872
RNA interference in protozoan parasites. Cell 16. Descoteaux A, Avila HA, Zhang K, Turco SJ,
Microbiol 6(6):509–519 Beverley SM (2002) Leishmania LPG3 encodes
6. Lye LF, Owens K, Shi H, Murta SM, Vieira a GRP94 homolog required for phosphoglycan
AC, Turco SJ, Tschudi C, Ullu E, Beverley SM synthesis implicated in parasite virulence but
(2010) Retention and loss of RNA interference not viability. EMBO J 21(17):4458–4469
pathways in trypanosomatid protozoans. PLoS 17. Sambrook J, Russell DW (2001) Molecular
Pathog 6(10):e1001161. https://doi. cloning, 3rd edn. Cold Spring Harbor
org/10.1371/journal.ppat.1001161 Laboratory Press, Cold Spring Harbor, NY
7. LeBowitz JH, Coburn CM, McMahon-Pratt 18. Hübel A, Krobitsch S, Horauf A, Clos J (1997)
D, Beverley SM (1990) Development of a sta- Leishmania major Hsp100 is required chiefly in
ble Leishmania expression vector and applica- the mammalian stage of the parasite. Mol Cell
tion to the study of parasite surface antigen Biol 17(10):5987–5995
genes. Proc Natl Acad Sci U S A 87: 19. Reiling L, Chrobak M, Schmetz C, Clos
9736–9740 J (2010) Overexpression of a single Leishmania
8. Sanderson SJ, Pollock KG, Hilley JD, Meldal major gene is sufficient to enhance parasite
M, Hilaire PS, Juliano MA, Juliano L, Mottram infectivity in vivo and in vitro. Mol Microbiol
JC, Coombs GH (2000) Expression and char- 76(5):1175–1190
acterization of a recombinant cysteine protein- 20. Nuhs A, Schafer C, Zander D, Trube L, Tejera
ase of Leishmania mexicana. Biochem J 347(Pt Nevado P, Schmidt S, Arevalo J, Adaui V, Maes
2):383–388 L, Dujardin JC, Clos J (2014) A novel marker,
9. Chen DQ, Kolli BK, Yadava N, Lu HG, ARM58, confers antimony resistance to
Gilman-Sachs A, Peterson DA, Chang KP Leishmania spp. Int J Parasitol Drugs Drug
(2000) Episomal expression of specific sense Resist 4(1):37–47. https://doi.org/10.1016/j.
and antisense mRNAs in Leishmania amazo- ijpddr.2013.11.004
nensis: modulation of gp63 level in promasti- 21. Laban A, Wirth DF (1989) Transfection of
gotes and their infection of macrophages Leishmania enriettii and expression of chlor-
in vitro. Infect Immun 68(1):80–86 amphenicol acetyltransferase gene. Proc Natl
10. Kelly JM, Das P, Tomás AM (1994) An Acad Sci U S A 86:9119–9123
approach to functional complementation by 22. Clos J, Hübel A, Brandau S, Dresel A, Hörauf
introduction of large DNA fragments into A (1997) LeishmaniaHsp100. In: Gething M-J
Trypanosoma cruzi and Leishmania donovani (ed) Guidebook to molecular chaperones and
using a cosmid shuttle vector. Mol Biochem protein folding catalysts. Sambrook and Tooze,
Parasitol 65:51–62 Oxford, pp 259–261
Chapter 7
Abstract
Leishmania is still a major cause of mortality and morbidity worldwide. Few efficient drugs are available,
and resistance threatens actual treatments. In order to improve knowledge about the mode of action of
current drugs and those in development, as well as to understand the mechanisms pertaining to their resis-
tance, we recently described a sensitive and high-throughput method termed Cos-Seq. Here we provide a
detailed protocol for every step of the procedure, from library construction to drug selection, cosmid
extraction, and next-generation sequencing of extracted cosmids. A section on the bioinformatics of Cos-
Seq is also included. Cos-Seq facilitates the identification of gain-of-function resistance mechanisms and
drug targets and is a useful tool in resistance and drug development studies.
Key words Leishmania, Next-generation sequencing, Cos-Seq, Drug resistance, Mode of action
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_7, © Springer Science+Business Media, LLC, part of Springer Nature 2019
141
142 Jade-Eva Potvin et al.
2 Materials
3 Methods
3.1 Preparation Functional cloning in Leishmania has been developed for lipophos-
of Cosmid Library phoglycan biosynthetic genes and an alternative protocol for the
production of cosmid libraries is also available elsewhere [11].
3.1.1 Genomic DNA 1. Extract gDNA from Leishmania promastigotes using your
(gDNA) Extraction favorite kit or protocol and store at 4 °C. You should aim for a
and Optimization of Partial gDNA concentration ≥500 ng/μL (see Note 3).
Restriction Digest 2. Verify the size of gDNA by migrating 2–5 μg in 0.4% agarose
gel. The size of your gDNA should be ≥100 kb (see Note 4).
3. Perform restriction digests as indicated below to find the
reaction that will yield fragments with a mean size of ~35 kb
(see Note 5).
Optionally, changing incubation time may also be done to
test additional restriction digest conditions (Table 1).
4. Once optimization of gDNA partial digest is done, continue
with step 5 below (gDNA digestion), which should be
done simultaneously with cLHYG digestion if possible (see
Subheading 3.1.2).
5. gDNA digestion.
(a) Digest 50 μg of gDNA (5 tubes with 10 μg each) based on
the optimal digestion condition identified at step 3.
(b) Dephosphorylate DNA by adding 6 μL of 10× Antarctic
phosphatase buffer, 10 units of Antarctic phosphatase
Gain of Function Cos-seq Screens in Leishmania 145
Table 1
Optimization of genomic DNA partial restriction digest
(j) Stop the power supply, gently take out the gel from the
electrophoresis tank and cut the gel at position equivalent
to line B in Fig. 1. Put this second gel slice (i.e., gel part
#2 in Fig. 1) in a second glass dish, cover with TBE buffer
containing DNA staining solution and incubate for 30 min.
Put back the remaining part of the gel (i.e., gel part #3 in
Fig. 1) in the electrophoresis tank (do not resume electro-
phoresis at this point).
(k) Visualize the two stained gel slices with a ruler under UV
light.
(l) From the distance on the ruler separating the bulks of
DNA in gel slice #1 versus gel slice #2, infer the electro-
phoresis time remaining at 4 V/cm before the ~25 kb
fragments from lane 10 are just short of falling into the
large well in the middle section of the gel.
(m) Resume electrophoresis at 4 V/cm for the amount of time
estimated at step l.
(n) Stop electrophoresis and remove a bit of TBE buffer from
the tank so that its level is just below the top edge of the
gel (see Note 10). Clean the big well located in the middle
section of lane 10 with clean TBE buffer twice. Remove
any remaining TBE buffer from the big well.
Gain of Function Cos-seq Screens in Leishmania 147
3.1.2 cLHYG Digestion 1. Extract cLHYG cosmids from E. coli using the QIAGEN
Plasmid Mega kit following manufacturer’s recommendations,
or using a similar kit. cLHYG is sequentially digested with
SmaI and BamHI restriction enzymes as described below.
SmaI digestion liberates the cos sites at each extremities of
cLHYG, which are necessary for proper phage packaging and
thus for library transformation into E. coli. The BamHI restric-
tion site is compatible with Sau3AI and is therefore used to
clone genomic fragment into the SmaI-linearized cosmid (for
further information see map in ref. 11).
148 Jade-Eva Potvin et al.
Table 2
SmaI digestion of cLHYG
Table 3
BamHI digestion of cLHYG
Table 4
Ligation of partially digested gDNA into cLHYG
3.1.4 Library Packaging 1. We use the Gigapack III Gold packaging kit from Agilent tech-
and Amplification nologies with E. coli DH5α. While other packaging kits exist,
these have not been benchmarked by us. Whichever packaging
kit, ~300,000 clones per phage infection need to be obtained
upon titration (see Note 16).
2. After infection, centrifuge E. coli cells for 1 min at maximum
speed and remove supernatant.
3. Resuspend the cell pellet into 500 μL of LB broth and spread
onto 10 LB agar plates (150 mm) supplemented with
100 μg/mL ampicillin. Also plate 5 μL onto a single 10 mm
LB agar plate supplemented with 100 μg/mL ampicillin.
This plate will be used at Subheading 3.1.5 for estimating
library diversity.
4. Incubate the plates at 37 °C for 16 h.
5. Recover colonies from the plates by adding 3 mL of LB media
to one of the 150 mm plate (plate 1) and scrape off cells.
6. Transfer as much volume of LB media from plate 1 to a second
150 mm plate (plate 2) and scrape off cells. Repeat until the
last 150 mm plate. Remove as much volume as possible from
the last plate and put into a 50 mL tube (see Note 17).
7. Wash plate 1 with an additional 1 mL of fresh LB media and
transfer as much volume as possible to plate 2. Repeat until the
last 150 mm plate. Remove as much volume from the last plate
and put into the same 50 mL tube as in step 6.
8. Aliquot the cosmid library into 2 mL cryogenic tubes (700 uL
of cosmid library per tube).
9. Add 300 μL of LB-glycerol (50:50 v/v) to the cryogenic tubes
(for a final glycerol concentration of 15%) and mix well by
inversion.
10. Store the cryogenic tubes at −80 °C.
3.1.5 Estimation 1. Pick 21 random E. coli colonies from the 10 mm plate from
of Library Diversity Subheading 3.1.4 and grow independently in 5 mL LB broth
supplemented with 100 μg/mL ampicillin for 16 h at 37 °C.
2. Extract cosmid DNA using your favorite plasmid DNA mini-
prep kit. Leave one of the 21 cosmid extractions at −20 °C for
later use at Subheading 3.1.6 for estimating Leishmania trans-
fection efficiency.
3. Digest each of the 20 remaining cosmid extracts with EcoRI in
a volume of 50 μL for 3 h.
4. Migrate the restriction digests (the entire volume of each
digestion) on a 150 mL agarose gel at 1 V/cm for 16 h. You
should obtain different migration profiles between samples
upon imaging of the gel. This ensures proper genomic inserts
diversity in the cosmid library (see Note 18).
Gain of Function Cos-seq Screens in Leishmania 151
3.1.6 Monitoring Cosmid 1. Determine the half maximal effective concentration (EC50) of
Transfection Efficiency HYG and of the drug undergoing Cos-Seq against your
in Leishmania (See Note Leishmania strain.
19) (a) Prepare six 25 cm3 culture flasks with 5 mL of LCM (see
Note 20).
(b) Add your drug of interest in incremental concentrations in
flasks 1 to 5. Do not add any drug to flask number 6 which
will be used as a control for maximal growth.
(c) Inoculate all flasks with 1 × 106 mid-log phase parasites.
(d) Incubate at 25 °C until the control flask reaches early sta-
tionary phase of growth (e.g., OD600 ~ 0.6).
(e) Monitor OD600 for all flask and plot against the drug con-
centration to extrapolate EC50.
2. Transfection of Leishmania.
(a) Quantify the cosmid DNA extracted and stored at −20 °C
at Subheading 3.1.5. You should have a DNA concentra-
tion ≥1 μg/μL. If not, concentrate by speed vacuum.
(b) Prepare 150 mm LCM agar plates supplemented with 30×
the HYG EC50 for your strain. Store at 4 °C.
(c) Warm two 25 cm3 culture flasks containing 10 mL of
LCM in an incubator at 25 °C.
(d) Remove T cell Nucleofector solution from 4 °C and bring
to room temperature on the bench.
(e) Count parasites from an exponential phase of growth cul-
ture of your Leishmania strain using a hemacytometer.
You will need 2 × 107 promastigote parasites per
transfection.
(f) Spin down the appropriate volume of Leishmania culture
at 3000 × g at room temperature for 10 min. The required
volume will vary according to the number of transfections
to be done and the parasite counts in your culture. You
need to plan for 2 × 107 parasites per transfection.
(g) Wash the cell pellet with 10 mL of 1× PBS and spin at
3000 × g at room temperature for 10 min.
(h) Resuspend the cell pellet in 1 mL 1× PBS and aliquot in
equal volume into the appropriate number of 1.5 mL tube
(1 tube per transfection, i.e., 2 × 107 parasites per tube).
(i) Spin the 1.5 mL tubes at 3000 × g at room temperature
for 5 min.
(j)
Completely remove the supernatant from each tube.
Importantly, steps 18–22 now need to be completed
within 15 min.
(k) Set up the Lonza 2d Nucleofector to the U-033 program,
or equivalent.
152 Jade-Eva Potvin et al.
(l) Resuspend each cell pellet from step j with 100 μL T cell
Nucleofector solution brought to room temperature.
(m) Immediately add 5 μg (in ≤5 μL) of cosmid DNA to the
appropriate tube (plan for one negative control tube with-
out DNA) and transfer to nucleofection cuvettes, carefully
avoiding bubbles.
(n) Perform nucleofection (U-033 program).
(o)
Immediately transfer the content of the nucleofection
cuvettes to prewarmed LCM 25 cm3 culture flasks (one
transfection per flask). Use 500 μL from the flask to rinse
the cuvette in order to recover as much parasites as
possible.
(p) Incubate the culture flasks at 25 °C overnight.
(q) On day 2 add 15× the HYG EC50 concentration for your
strain (the HYG EC50 has been determined at step 1) to
each culture flask and incubate at 25 °C overnight.
(r) On day 3, spread different volumes (e.g., 100 μL of a
1/100 dilution, 100 μL and 300 μL) of transformed
Leishmania cultures from step q onto LCM agar plates
prepared at step a (bring the plates to room temperature
prior to plating the parasites). Using several plating vol-
umes will ensure that at least one plate per transfection will
have amenable colony counts for estimating transfection
efficiency.
3. Calculate transfection efficiency based on the number of trans-
fected cells, the volume of culture spread onto plates and the
number of colonies obtained per plate.
3.1.7 Transfection 1. Thaw one vial of cosmid library from Subheading 3.1.4 and
and Storage of the Whole inoculate into 50 mL of LB broth supplemented with 100 μg/
Cosmid Library mL ampicillin. Incubate with shaking overnight.
in Leishmania 2. Dilute the 50 mL overnight culture into 1000 mL of LB broth
supplemented with 100 μg/mL ampicillin and incubate under
shaking until the culture reaches late-log phase.
3. Extract cosmid DNA using the Promega Wizard Plus Megaprep
DNA Purification System (or equivalent kit) and quantify by
NanoDrop. You need a concentration ≥1 μg/mL to continue.
If required, concentrate the cosmid library by speed vacuum.
4. Calculate the number of transfections you will need according
to the transfection efficiency obtained at Subheading 3.1.6, the
average cosmid insert size and the size of the genome of your
Leishmania strain. You should aim for a ≥10× genome cover-
age. We usually need ~10 transfection reactions.
5. Perform nucleofection of the cosmid library as described at
Subheading 3.1.6.
Gain of Function Cos-seq Screens in Leishmania 153
3.2 Leishmania 1. Determine the library coverage by estimating the total number
Cosmid Library of Leishmania colonies on plates (coverage = #colonies *
Recovery and Storage 35 kb/size of genome in kilobases). You should aim for ≥10×
genome coverage.
2. Recover colonies from the plates by adding 3 mL of LCM to
one plate (plate 1) and very gently scrape off cells.
3. Recover the media from plate 1 (containing the scraped para-
sites) and transfer onto a second plate. Repeat until the last
plate and transfer the recovered LCM volume into a 50 mL
tube (see Note 17).
4. Rinse plate 1 with an additional 1 mL of LCM, recover by
pipetting and transfer onto a second plate. Repeat until the last
plate and transfer the recovered LCM volume into the 50 mL
tube from step 3.
5. Aliquot the cosmid library into 2 mL cryogenic tubes (750 μL
of cosmid library per tube).
6. Add 250 μL of LCM–DMSO (80:20 v/v) to the cryogenic
tubes (for a final DMSO concentration of 5%) and mix well by
inversion.
7. Store at −80 °C for 10 days and then transfer to −150 °C for
long-term storage.
3.3 Cos-Seq 1. Thaw one vial of frozen Leishmania cosmid library and transfer
Selection into a 25 cm3 culture flask containing 5 mL of LCM supple-
mented with 30× the HYG EC50.
2. Incubate at 25 °C overnight (see Note 21).
3. Library expansion.
(a) Expand the Leishmania cosmid library by inoculating a
75 cm3 culture flask containing 44.5 mL of LCM and 30×
the HYG EC50 with the 5 mL culture from step 2.
(b) Incubate the 75 cm3 flasks at 25 °C (see Note 21) until
late-log phase of growth (OD600 0.7, ~3–4 days). This cul-
ture will be your P0 culture (P0 stands for Cos-Seq passage
0). Keep 5 mL of the P0 culture to initiate the first round
of Cos-Seq as described at step 4 below. While this volume
allows for Cos-Seq selection for two drugs in duplicate,
the current protocol describes a Cos-Seq experiment per-
formed with a single drug in duplicate. This protocol is
also for the promastigote stage of the parasite which in
general is easier and give a wider range of cosmids than
intracellular screens.
154 Jade-Eva Potvin et al.
(w) Air-dry the pellet for 5 min by opening the cap of the tube
(see Note 28).
(x) Resuspend the cosmid DNA pellet using 30 μL of nucle-
ase free H2O.
(y) Quantify cosmid DNA and measure the A260/280 ratio
(see Note 29).
3.4 DNA Sequencing 1. Construct NGS libraries from purified cosmids (Plasmid-Safe
DNase-treated and kDNA removed). The yield of purified cos-
mids usually requires the use of NGS library kits with low
DNA input. We usually generated our Cos-Seq NGS libraries
using the Nextera DNA sample prep kit according to the man-
ufacturer’s protocol and the AMPure XP beads for both puri-
fication steps. Other low DNA input NGS library kits exist
(NEBNext Ultra II DNA prep kit for Illumina, TruSeq DNA
Nano) but these have not been benchmarked by us. Include
appropriate Nextera indices (or appropriate indices) for sample
multiplexing (see Note 30).
2. Perform sequencing at your favorite NGS facility. Our sequenc-
ing is usually conducted using a paired-ends protocol on an
Illumina HiSeq 2500. The samples should be multiplexed to
get ~15 M reads per sample.
conditionA(tab)conditionB
conditionA(tab)conditionC
conditionA(tab)conditionD
conditionA(tab)conditionE
conditionA(tab)conditionF
conditionB(tab)conditionC
conditionB(tab)conditionD
conditionB(tab)conditionE
conditionB(tab)conditionF
conditionC(tab)conditionD
conditionC(tab)conditionE
conditionC(tab)conditionF
conditionD(tab)conditionE
conditionD(tab)conditionF
conditionE(tab)conditionF
3. Gene abundance quantification.
Before we can process any FASTQ files, we must first build
the reference index, so that it may subsequently be loaded into
memory. The Trinity toolkit comes with a script that bundles
the reference processing and gene abundance estimations
steps. The relative abundance of each gene is independently
calculated from NGS data derived from cosmid populations
isolated at each drug concentration. You should thus have one
script for each of your sample or replicate, and run them sepa-
rately. These scripts, which should be named ‘trinity_
kallisto_<sampleID>.sh’ (<sampleID> should hereafter be
replaced by the name of the appropriate sample), should look
like the following (see Note 35):
#shell
$TRINITY_HOME/util/align_and_estimate_abun dance.
pl \
--transcripts Reference.fasta \
--prep_reference \
--est_method kallisto \
--left <sampleID>_R1_paired.fastq \
--right <sampleID>_R2_paired.fastq \
--gene_trans_map Reference_component_to_trans_map.
tsv \
--seqType fq \
--thread_count 4 \
--output_dir <sampleID>_kallistoOut
Once finished, the relevant output files called ‘abundance.
tsv.genes’ are found in the ‘<sampleID>_kallistoOut’ folder for
each sample.
4. Build gene abundance matrices.
Using the gene-level abundance estimates generated at
step 3, construct the matrix of counts and the matrix of nor-
malized abundance values for all samples (i.e., from “sam-
ple_P0_A” to “sample_P5_B”) using the following script
(<drug> should hereafter be replaced by the appropriate
drug name):
Gain of Function Cos-seq Screens in Leishmania 161
#shell
$TRINITY_HOME/util/abundance_estimates_to_matrix.
pl \
--est_method kallisto \
--gene_trans_map Reference_component_to_trans_map.
tsv \
--out_prefix <drug>_kallisto_matrix \
sample_P0_A/abundance.tsv.genes \ sample_P0_B/abun-
dance.tsv.genes \sample_P1_A/abundance.tsv.genes \
sample_P1_B/abundance.tsv.genes \
sample_P2_A/abundance.tsv.genes \ sample_P2_B/abun-
dance.tsv.genes \
sample_P3_A/abundance.tsv.genes \ sample_P3_B/abun-
dance.tsv.genes \
sample_P4_A/abundance.tsv.genes \ sample_P4_B/abun-
dance.tsv.genes \
sample_P5_A/abundance.tsv.genes \ sample_P5_B/abun-
dance.tsv.genes
#shell
$TRINITY_HOME/Analysis/DifferentialExpression/
analyze_diff_expr.pl \
--order_columns_by_samples_file \
--samples conditions.tsv \
--matrix ../<drug>_kallisto_matrix.gene.TMM.EXPR.
matrix \
-P 0.001 \
-C 2
Finally, cluster significantly enriched genes based on their
enrichment profile using the script (see Note 38):
#shell
$TRINITY_HOME/Analysis/DifferentialExpression/de-
fine_clusters_by_cutting_tree.pl\
--no_column_reordering \
-R diffExpr.P0.001_C2.matrix.RData \
--Ptree 20
Genes have now been grouped into clusters based on how
they behaved during the Cos-Seq selection. The results are in
the new directory called “diffExpr.P0.001_C2.matrix.RData.
clusters_fixed_P_20” that contains the abundance matrix for
the gene clusters (data is log2-transformed, median centered).
The gene abundance pattern is also summarized in the pdf file
named “my_cluster_plots.pdf”. In this file, the individual pro-
files for the genes part of a given cluster are plotted in gray
and the mean abundance profile for the cluster is plotted in
blue. Genes part of the same cosmid are expected to behave
similarly and thus to be part of the same gene cluster. Also,
since the resistance phenotype conferred by a given cosmid is
expected to result from the overexpression of a single gene (or
at maximum only a few genes), it is important to realize that
not all genes from a given cluster will produce a phenotype
upon their individual overexpression. The gene clusters should
thus be carefully analyzed and ranked in terms of priority
based on their enrichment profile using the file “my_cluster_
plots.pdf” (see Note 39). The quantitative data for the priori-
tized gene clusters can be recovered from the appropriate
“subcluster_XX_log2_medianCentered_fpkm.matrix” files.
Use these files to compute (1) the gene-level mean abundance
for drug concentration replicates and (2) the gene-level fold-
enrichment compared to the P0 baseline sample (Fig. 2).
These computations can be done using Microsoft Excel or
similar spreadsheet software.
3.6 Validation 1. Cosmids that were highly enriched during Cos-Seq can be spe-
of Resistance cifically recovered by transforming E. coli with cosmid DNA
Conferred by Enriched derived from the passage at which the peak of selection
Cosmids occurred (e.g., transform DNA derived from passage 5 to
retrieve cosmids whose enrichment peaked at 16× EC50).
Gain of Function Cos-seq Screens in Leishmania 163
Fig. 2 Example of Cos-Seq output for gene loci implicated in drug resistance. Top panels: gene abundance and
differential enrichment profiles are generated from sequencing reads coverage. Genes sharing similar Cos-
Seq enrichment profiles are grouped into clusters. For each cluster, gray lines represent individual genes and
the blue line denotes the average gene profile. Gene abundance is expressed on the y-axis as log2-transformed
FPKM values centered to the median FPKM. Samples are ordered on the abscissa according to the selection
procedure, from nontreated (P0) samples to the fourth drug increment (P4). Middle panels: cosmids are identi-
fied from the list of enriched genes by looking for stretch of neighbor genes in the genome. Genes from the
same cosmid insert are expected to have similar enrichment profiles and usually belong to the same gene
cluster. Bottom panels: Fold enrichment for the genes part of enriched cosmids is normalized to the drug-free
control and expressed as fold increase at each increment in comparison to P0 baseline levels
4 Notes
18. The four bands at 494, 1732, 3032, and 6947 bp are derived
from the cLHYG vector itself. These bands should be present
in every successful digestion.
19. The efficiency of transfection may vary depending on the
strain. The number of clones obtained per transfection will
influence the number of transfections required to reach accept-
able genome coverage.
20. We usually test a minimum of five drug concentrations and a
no-drug control (six flasks total), but you can test more
concentrations.
21. Incubation can be done with gentle shaking.
22. For this section we recommend using two Cos-Seq replicates
for each drug concentration. We also recommend performing
both replicates at the same time.
23. Be careful not to touch the middle phase. Contamination with
phenol will ruin the process. It is advisable to recover a bit less
aqueous phase than collecting most of it at the risk of contami-
nating your sample with phenol.
24. Before proceeding to genomic DNA digestion, it is necessary
to remove RNase because it will decrease DNase efficiency.
25. At this point the DNA pellet may not be visible.
26. The kDNA is usually less than 2 kb.
27. No more than 5 min.
28. Be careful not to over dry as this will hamper proper solubili-
zation. To ensure as much removal of isopropanol as possible
without over drying the pellet, incubate the tube with its cap
opened for 15 min at 37 °C for 15 min after solubilization of
the DNA with H2O.
29. We usually quantify our DNAs using the Quantus system from
Promega, or equivalent.
30. Because the diversity of cosmids is inversely proportional to
drug pressure during Cos-Seq selection, it may be possible to
increase the number of samples per flowcell lane if only multi-
plexing highly selected samples (e.g., samples selected at 8× or
16× EC50).
31. An alternative way of installing kallisto is to clone it from
GitHub at https://github.com/pachterlab/kallisto
32. Differential abundance analysis can also be done using limma
or DESeq2. To install these packages, type:
#shell
biocLite('limma')
biocLite('DESeq2')
33. Our Cos-Seq sequencing is usually conducted in paired-ends
mode so we have left and right sequencing reads. If using single
166 Jade-Eva Potvin et al.
References
1. Ryan KA, Garraway LA, Descoteaux A et al for mutations in the high affinity folate trans-
(1993) Isolation of virulence genes directing porter and contributes to methotrexate resis-
surface glycosyl-phosphatidylinositol synthesis tance in the protozoan parasite Leishmania
by functional complementation of Leishmania. tarentolae. EMBO J 18(9):2342–2351.
Proc Natl Acad Sci U S A 90(18):8609–8613 https://doi.org/10.1093/emboj/18.9.2342
2. Kundig C, Haimeur A, Legare D et al (1999) 3. Coelho AC, Beverley SM, Cotrim PC (2003)
Increased transport of pteridines compensates Functional genetic identification of PRP1, an
Gain of Function Cos-seq Screens in Leishmania 167
ABC transporter superfamily member confer- Int J Parasitol Drugs Drug Resist 8(2):
ring pentamidine resistance in Leishmania 165–173. https://doi.org/10.1016/j.ijpddr.
major. Mol Biochem Parasitol 130(2):83–90 2018.03.004
4. Cotrim PC, Garrity LK, Beverley SM (1999) 13. Haas BJ, Papanicolaou A, Yassour M et al
Isolation of genes mediating resistance to (2013) De novo transcript sequence recon-
inhibitors of nucleoside and ergosterol metab- struction from RNA-seq using the Trinity plat-
olism in Leishmania by overexpression/selec- form for reference generation and analysis. Nat
tion. J Biol Chem 274(53):37723–37730 Protoc 8(8):1494–1512. https://doi.org/
5. Kotze AC, Hunt PW, Skuce P et al (2014) 10.1038/nprot.2013.084
Recent advances in candidate-gene and whole- 14. Li B, Dewey CN (2011) RSEM: accurate tran-
genome approaches to the discovery of anthel- script quantification from RNA-Seq data with
mintic resistance markers and the description of or without a reference genome. BMC
drug/receptor interactions. Int J Parasitol Bioinformatics 12:323. https://doi.org/
Drugs Drug Resist 4(3):164–184. https:// 10.1186/1471-2105-12-323
doi.org/10.1016/j.ijpddr.2014.07.007 15. Zhang C, Zhang B, Lin LL et al (2017)
6. Horn D, Duraisingh MT (2014) Antiparasitic Evaluation and comparison of computational
chemotherapy: from genomes to mechanisms. tools for RNA-seq isoform quantification.
Annu Rev Pharmacol Toxicol 54:71–94. BMC Genomics 18(1):583. https://doi.
https://doi.org/10.1146/annurev-pharmtox- org/10.1186/s12864-017-4002-1
011613-135915 16. Zakeri M, Srivastava A, Almodaresi F et al
7. Downing T, Imamura H, Decuypere S et al (2017) Improved data-driven likelihood fac-
(2011) Whole genome sequencing of multiple torizations for transcript abundance estimation.
Leishmania donovani clinical isolates provides Bioinformatics 33(14):i142–i151. https://
insights into population structure and mecha- doi.org/10.1093/bioinformatics/btx262
nisms of drug resistance. Genome Res 21(12): 17. Patro R, Duggal G, Love MI et al (2017)
2143–2156. https://doi.org/10.1101/gr. Salmon provides fast and bias-aware quantifi-
123430.111 cation of transcript expression. Nat Methods
8. Coelho AC, Boisvert S, Mukherjee A et al 14(4):417–419. https://doi.org/10.1038/
(2012) Multiple mutations in heterogeneous nmeth.4197
miltefosine-resistant Leishmania major popula- 18. Bray NL, Pimentel H, Melsted P et al (2016)
tion as determined by whole genome sequenc- Near-optimal probabilistic RNA-seq quantifi-
ing. PLoS Negl Trop Dis 6(2):e1512. https:// cation. Nat Biotechnol 34(5):525–527.
doi.org/10.1371/journal.pntd.0001512 https://doi.org/10.1038/nbt.3519
9. Leprohon P, Fernandez-Prada C, Gazanion E 19. Robinson MD, McCarthy DJ, Smyth GK
et al (2015) Drug resistance analysis by next gen- (2010) edgeR: a Bioconductor package for dif-
eration sequencing in Leishmania. Int J Parasitol ferential expression analysis of digital gene
Drugs Drug Resist 5(1):26–35. https://doi. expression data. Bioinformatics 26(1):139–
org/10.1016/j.ijpddr.2014.09.005 140. https://doi.org/10.1093/bioinformat-
10. Gazanion E, Fernandez-Prada C, Papadopoulou ics/btp616
B et al (2016) Cos-Seq for high-throughput 20. Love MI, Huber W, Anders S (2014) Moderated
identification of drug target and resistance estimation of fold change and dispersion for
mechanisms in the protozoan parasite RNA-seq data with DESeq2. Genome Biol
Leishmania. Proc Natl Acad Sci U S A 15(12):550. https://doi.org/10.1186/
113(21):E3012–E3021. https://doi.org/ s13059-014-0550-8
10.1073/pnas.1520693113 21. Law CW, Chen Y, Shi W et al (2014) voom:
11. Albert Descoteaux LAG, Ryan KA, Garrity LK, Precision weights unlock linear model analysis
Tuco SJ, Beverly SM (1994) Identification of tools for RNA-seq read counts. Genome Biol
Genes by Functional Complementation in 15(2):R29. https://doi.org/10.1186/
Protozoan Parasite Leihsmania. Methods Mol gb-2014-15-2-r29
Biol 3:23 22. White TC, Fase-Fowler F, van Luenen H et al
12. Fernandez-Prada C, Sharma M, Plourde M (1988) The H circles of Leishmania tarentolae
et al (2018) High-throughput Cos-Seq screen are a unique amplifiable system of oligomeric
with intracellular Leishmania infantum for the DNAs associated with drug resistance. J Biol
discovery of novel drug-resistance mechanisms. Chem 263(32):16977–16983
Chapter 8
Abstract
While homologous recombination-based gene replacement is about to be supplanted by more modern
approaches, it is still retaining usefulness for genes that prove to be poor targets for CRISPR/cas-based
approaches. Homologous recombination has proven to be relatively robust to minor sequence mismatches
between GOI-flanking sequences and the gene replacement constructs, and the faithfulness of recombina-
tion events is easily verified by whole-genome sequencing. Moreover, the availability of custom synthetic
gene production by numerous service providers should allow for a relatively quick generation of null
mutants without the need to introduce additional protein-coding genes beyond the selection markers.
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_8, © Springer Science+Business Media, LLC, part of Springer Nature 2019
169
170 Henner Zirpel and Joachim Clos
2 Materials
2.4 Electro- 1. PBS (0.137 M NaCl, 10 mM Na2HPO4, 2.7 mM KCl, 1.8 mM
transfection K2HPO4, pH = 7.4).
2. Electroporation buffer: 21 mM HEPES pH = 7.5, 137 mM
NaCl, 5 mM KCl, 0.7 mM Na2HPO4, and 6 mM glucose.
3. Electroporation cuvette 0.4 cm electrode gap (e.g., Biozym).
4. Bio-Rad Gene Pulser or similar system.
5. Medium 199+: 1× Medium199 with Hanks’ Salts (Sigma) sup-
plemented with 20% heat-inactivated, fetal calf serum (batch-
tested for optimal promastigote growth from low cell density),
100 μM adenine, 10 μg/ml heme, 40 μM HEPES pH 7.4,
1.2 μg/ml 6-biopterin, and 20 μg/ml gentamycin.
6. 100× PenStrep: 10,000 units/ml penicillin, 10 mg/ml strep-
tomycin, Sigma-Aldrich.
7. Selection antibiotics (G418, puromycin, bleocin, blasticidin,
hygromycin, or streptothricin).
8. Cryo storage medium: 1× M199, 50% v/v heat-inactivated
fetal calf serum, 20% v/v DMSO.
9. Cryo vials.
Gene Replacement by Homologous Recombination 173
2.6 Cloning 1. Medium 199+: 1× Medium199 with Hanks’ salts (Sigma) sup-
of Putative Null plemented with 20% heat-inactivated, fetal calf serum (batch-
Mutants tested for optimal promastigote growth from low cell density),
100 μM adenine, 10 μg/ml heme, 40 μM HEPES pH 7.4,
1.2 μg/ml 6-biopterin, and 20 μg/ml gentamycin.
2. 100× PenStrep: 10,000 units/ml penicillin, 10 mg/ml strep-
tomycin, Sigma-Aldrich).
3. Selection antibiotics (G418, puromycin, bleocin, blasticidin,
hygromycin, or streptothricin).
4. Sterile 96-well tissue culture plate (any vendor).
3 Methods
3.1 In Silico Planning 1. From the TriTryp database, download the current release of
of the Gene the relevant genome sequences (http://tritrypdb.org/com-
Replacement mon/downloads/Current_Release/).
Constructs 2. Identify the GOI with its flanking 5′- and 3′ noncoding
sequences. Locate the upstream and downstream neighboring
CDSs as well. Identify 1000 bp each of noncoding sequences
immediately upstream (5′) and downstream (3′) of the GOI. If
necessary, shorten the 5′- and 3′-flanks to avoid overlap with
upstream or downstream CDSs.
3. Design oligonucleotide primers for amplification of the selected
5′- and 3′-noncoding sequences. An 18–20 nt 3′ sequence match
is required, while a 5′ addition of between 10 and 20 nt adds the
required restriction sites to the PCR amplificates. Add four nucle-
otides 5′ of the restriction site to facilitate efficient cleavage.
10. Ligate the amplified and digested 3′-NC DNA into the digested
pUC19-5′-NC plasmid and process as described in Subheading
3.2, steps 6 and 7 to produce pUC19-5′ + 3′-NC (Fig. 1h).
11. Next, amplify the antibiotic resistance marker genes using
primers that engineer KpnI and BamHI sites at the 5′- and 3′
ends, respectively, or excise marker gene from a plasmid
(Fig. 1i) with KpnI and BamHI and ligate between the KpnI
and BamHI sites of the pUC19-5′+3′-NC plasmid to yield one
of the two gene replacement constructs (Fig. 1j). Produce
high-quality plasmids either by cesium chloride density gradi-
ent ultracentrifugation [15] or by using a plasmid maxiprep
kit. Verify the finished plasmids by sequencing.
12. Excise the recombination cassette from the plasmid backbone
(Fig. 1k). This can be done by a double digest, for example, with
Hind III and EcoRI, or when amplifying the 5′- and 3′-flanks,
178 Henner Zirpel and Joachim Clos
Fig. 2 Assembly of plasmid construct for ectopic expression of the GOI. (a) Amplification of GOI CDS by
proofreading-capable PCR system. (b) Digest of PCR product with restriction endonucleases; here: KpnI and
BamHI. (c) Digest of expression plasmid pCL2N with compatible restriction endonucleases; here: KpnI and
BglII. (d) Ligation of expression plasmid
180 Henner Zirpel and Joachim Clos
3.4 Electro- Carry out all procedures under sterile conditions in a laboratory
transfection licensed for the handling of recombinant leishmaniae! Observe
guidelines and regulations for the handling of recombinant patho-
gens in your country! Always wear a lab coat, gloves and eye pro-
tection when handling cells or buffers. Clean all surfaces, bottles,
and plasticware with an antiseptic solution. Prewarm media and
buffers for cell cultivation, unless otherwise specified.
1. Grow Leishmania promastigotes in appropriate medium to
middle logarithmic phase (i.e., 8 × 106 cells/ml).
2. Sediment 4 × 107 cells at 1000 × g, 4 °C for 10 min.
3. Discard the supernatant and resuspend cells in 10 ml cold
(4 °C) PBS. Sediment at 1000 × g, 4 °C for 10 min.
4. Repeat step 3.
Gene Replacement by Homologous Recombination 181
3.6 Cloning Carry out all procedures under sterile conditions. Clean all sur-
of Putative Null faces, bottles, and plasticware with an antiseptic solution. Prewarm
Mutants media and buffers for cell cultivation, unless otherwise specified.
Always wear a lab coat and gloves when handling cells or buffers.
1. Sediment 1 × 107 cells obtained in Subheading 3.4, step 17 or
in Subheading 3.5, step 2 at 1200 × g, 4 °C for 10 min.
2. Discard the supernatant and resuspend cells in 1 ml M199+.
Determine cell density. Using serial dilution steps, produce a
50 cells/ml culture.
Gene Replacement by Homologous Recombination 183
3.7 Verifying Null For gDNA isolation, use “ISOLATE II Genomic DNA Kit” or
Mutant Genotype similar.
1. Sediment 5 × 107 to 2 × 108 cells obtained in Subheading 3.4,
step 17 or in Subheading 3.5, step 2 at 1200 × g, 4 °C for
10 min. Discard the supernatant and resuspend cells in 10 ml
cold (4 °C) PBS.
2. Resuspend the pellet in 200 μl Lysis buffer GL. Add 200 μl
Lysis buffer G3 augmented with 25 μl proteinase K solution.
3. Continue gDNA isolation as described in the manufacturer’s
protocol.
4. To verify the successful gene replacement four PCRs are
needed (Fig. 4). In a first step the loss of the gene of interest
(GOI) is verified. Therefore, use two specific primers for your
GOI, one at the 5′-end (GOI-5′-fwd) and one at the 3′-end
(GOI-3′-rev) of the gene. The resulting PCR fragment should
be visible in the positive WT control, but missing in the null
mutant. (Please be aware that this PCR is not suitable for sin-
gle allele gene replacement mutants.)
5. The presence of the replacement construct is verified in a first
step by the presence of the resistance marker gene (RMG).
Therefore, use two specific primers binding to the 5′-end
(RMG-5′-fwd) and the 3′-end (RMG-3′-rev) of the resistance
maker gene. The resulting PCR fragment should be visible in
the null mutant, but missing in the WT control.
6. To verify the insertion at the correct gene position two PCRs
are needed. The first PCR will verify the correct 5′-position,
while the second will verify the correct 3′-position. The fwd
primer for the first PCR binds outside of the 5′-NC (GOI-5′-
NC-fwd), and the rev primer will bind at the 5′-end of the
RMG (RMG-5′-rev). The corresponding primer at the 3′-end
are the GOI-3′-NC-rev and the RMG-3′-fwd. Both PCRs
should show a fragment for the null mutant, while no frag-
ments should be visible for the WT control.
184 Henner Zirpel and Joachim Clos
Fig. 4 Genotyping of putative null mutants. (a) Amplification of GOI CDS. (b) Control of resistance marker gene
integration in place of the GOI, using puroAC and bleoR as examples. Note that NC primers anneal beyond the
end points of the recombination constructs
3.8 Verifying Null The increasing availability and decreasing costs of next generation
Mutants by Whole- sequencing makes whole-genome sequencing of null mutants fea-
Genome Sequencing sible. This allows not only a high resolution verification of gene
(Optional) loss but may also detect gene duplications, changed ploidy of chro-
mosomes, and DNA sequence variants that may arise as compensa-
tion for the loss of the GOI. Using gDNA of a null mutant clone
and of its parental Leishmania strain to create a DNA fragment
library and the methodology involved in NGS is not the topic
of this chapter. However, Fig. 5 shows an example of a whole-
genome sequencing performed on wild type L. donovani and on
a replacement mutant for the 23 kD heat shock protein (HSP23)
gene [18]. The sequencing read coverage shows a gap for the
region encoding HSP23, confirming the gene replacement with
high resolution. Moreover, single nucleotide polymorphisms and
insertions/deletions specific for the null mutant can be detected
and give insight (not shown) into the genome rearrangements that
may ameliorate the phenotypic effects of the loss of gene function.
3.9 Verifying Null While working with viable parasites carry out all procedures under
Mutants and Add- sterile conditions. Clean all surfaces, bottles, and plasticware with an
Backs by RT-qPCR antiseptic solution. Prewarm media and buffers for cell cultivation,
unless otherwise specified. Always wear a lab coat and gloves when
Gene Replacement by Homologous Recombination 185
Fig. 5 Illumina MiSeq reads of a genomic DNA library of L. donovani HSP23−/− [18]. The L. donovani gene IDs
are shown above the chromosome 34, with the red arrows representing the region containing the genes for the
58 kD antimony resistance marker, ARM58 [18], HSP23, and an emp24 family member protein. The HSP23 gene
was replaced by homologous recombination [18]. The positions of single nucleotide polymorphisms (SNPs) and
of insertions/deletions (INDELs) are shown above the sequencing read coverage graphs for wild type and
HSP23−/−. Note the absence of NGS reads in the HSP23 coding sequence for the null mutant [18, 19]
3.10 Verifying Null If a protein of interest (POI)-specific antibody is available, the null
Mutants and Add- mutant may be tested for disappearance of the POI band in lieu of
Backs by Western Blot or in addition to RT-qPCR analysis of GOI-specific RNA.
1. Sediment 5 × 106 to 1 × 107 cells of null mutant, of null mutant
with gene add-back, and of wild type at 1000 × g, 4 °C for
10 min. Discard the supernatant and resuspend cells in 10 ml
cold (4 °C) PBS. Sediment at 1000 × g, 4 °C for 10 min. Repeat
PBS wash once.
Gene Replacement by Homologous Recombination 187
4 Notes
Acknowledgments
References
1. Cruz A, Beverley SM (1990) Gene replace- 12(5):e1001868. https://doi.org/10.1371/
ment in parasitic protozoa. Nature 348: journal.pbio.1001868
171–173 10. Papadopoulou B, Dumas C (1997) Parameters
2. Cruz A, Coburn CM, Beverley SM (1991) controlling the rate of gene targeting frequency
Double targeted gene replacement for creating in the protozoan parasite Leishmania. Nucleic
null mutants. Proc Natl Acad Sci U S A Acids Res 25(21):4278–4286
88:7170–7174 11. Krobitsch S, Clos J (2000) Cross-species
3. Sollelis L, Ghorbal M, MacPherson CR, homologous recombination in Leishmania
Martins RM, Kuk N, Crobu L, Bastien P, donovani reveals the sites of integration. Mol
Scherf A, Lopez-Rubio JJ, Sterkers Y (2015) Biochem Parasitol 107:123–128
First efficient CRISPR-Cas9-mediated genome 12. Yanisch-Perron C, Vieira J, Messing J (1985)
editing in Leishmania parasites. Cell Microbiol Improved M13 phage cloning vectors and host
17(10):1405–1412. https://doi. strains: nucleotide sequences of the M13mp18
org/10.1111/cmi.12456 and pUC19 vectors. Gene 33(1):103–119
4. Zhang WW, Matlashewski G (2015) CRISPR- 13. Bartsch K, Hombach-Barrigah A, Clos J (2017)
Cas9-mediated genome editing in Leishmania Hsp90 inhibitors radicicol and geldanamycin
donovani. MBio 6(4):e00861. https://doi. have opposing effects on Leishmania Aha1-
org/10.1128/mBio.00861-15 dependent proliferation. Cell Stress Chaperones
5. Duncan SM, Myburgh E, Philipon C, Brown 22:729–742. https://doi.org/10.1007/
E, Meissner M, Brewer J, Mottram JC (2016) s12192-017-0800-2
Conditional gene deletion with DiCre demon- 14. Ommen G, Lorenz S, Clos J (2009) One-step
strates an essential role for CRK3 in Leishmania generation of double-allele gene replacement
mexicana cell cycle regulation. Mol Microbiol mutants in Leishmania donovani. Int J Parasitol
100(6):931–944. https://doi.org/10.1111/ 39(5):541–546
mmi.13375 15. Sambrook J, Russell DW (2001) Molecular
6. Beneke T, Madden R, Makin L, Valli J, Sunter Cloning, 3rd edn. Cold Spring Harbor
J, Gluenz E (2017) A CRISPR Cas9 high- Laboratory Press, Cold Spring Harbor, NY
throughput genome editing toolkit for kineto- 16. Schäfer C, Tejera Nevado P, Zander D, Clos
plastids. R Soc Open Sci 4(5):170095. J (2014) ARM58 overexpression reduces intra-
https://doi.org/10.1098/rsos.170095 cellular antimony concentration in Leishmania
7. Martel D, Beneke T, Gluenz E, Spath GF, infantum. Antimicrob Agents Chemother
Rachidi N (2017) Characterisation of casein 58:1565–1574. https://doi.org/10.1128/
kinase 1.1 in Leishmania donovani using the AAC.01881-13
CRISPR Cas9 toolkit. Biomed Res Int 17. Laemmli UK (1970) Cleavage of structural pro-
2017:4635605. https://doi. teins during the assembly of the head of bacte-
org/10.1155/2017/4635605 riophage T4. Nature 227(5259):680–685
8. Bifeld E, Chrobak M, Zander D, Schleicher U, 18. Hombach A, Ommen G, MacDonald A, Clos
Schonian G, Clos J (2015) Geographical J (2014) A small heat shock protein is essential
sequence variation in the Leishmania major for thermotolerance and intracellular survival
virulence factor P46. Infect Genet Evol of Leishmania donovani. J Cell Sci 127(Pt
30:195–205. https://doi.org/10.1016/j. 21):4762–4773. https://doi.org/10.1242/
meegid.2014.12.029 jcs.157297
9. Ubeda JM, Raymond F, Mukherjee A, Plourde 19. Tejera Nevado P, Bifeld E, Hohn K, Clos
M, Gingras H, Roy G, Lapointe A, Leprohon J (2016) A Telomeric cluster of antimony resis-
P, Papadopoulou B, Corbeil J, Ouellette M tance genes on chromosome 34 of Leishmania
(2014) Genome-wide stochastic adaptive DNA infantum. Antimicrob Agents Chemother
amplification at direct and inverted DNA 60(9):5262–5275. https://doi.org/10.1128/
repeats in the parasite Leishmania. PLoS Biol AAC.00544-16
Chapter 9
Abstract
Postgenomic analyses of Leishmania biology benefit from rapid and precise methods for gene manipulation.
Traditional methods of gene knockout or tagging by homologous recombination have limitations: they
tend to be slow and require successive transfection and selection rounds to knock out multiple alleles of a
gene. Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 systems overcome these
limitations. We describe here in detail a simple, rapid, and scalable method for CRISPR-Cas9-mediated
gene knockout and tagging in Leishmania. This method details how to use simple PCR to generate (1)
templates for single guide RNA (sgRNA) transcription in cells expressing Cas9 and T7 RNA polymerase
and (2) drug-selectable editing cassettes, using a modular set of plasmids as templates. pT plasmids allow
for amplification of drug resistance genes for knockouts and pPLOT plasmids provide a choice of different
tags to generate N- or C-terminally tagged proteins. We describe how to use an online platform
(LeishGEdit.net) for automated primer design and how to perform PCRs and transfections in small
batches or on 96-well plates for large-scale knockout or tagging screens. This method allows generation of
knockout mutants or tagged cell lines within 1 week.
Key words LeishGEdit, Leishmania, Kinetoplastids, CRISPR, Cas9, Gene editing, T7 RNA poly-
merase, Knockout, Tagging
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_9, © Springer Science+Business Media, LLC, part of Springer Nature 2019
189
190 Tom Beneke and Eva Gluenz
have only been reported for 200 of a total of ca. 9000 Leishmania
genes [3].
Post-genomic analyses of parasite biology call for high-
throughput genetic tools to enable the study of larger cohorts of
genes. Clustered regularly interspaced short palindromic repeats
(CRISPR)/Cas9 systems are revolutionizing genome editing
across eukaryotes [4], including protozoan parasites [5, 6]. A vari-
ety of different approaches have been used in Leishmania spp. to
supply the required single guide RNA (sgRNA) and Cas9 nuclease:
Cas9 nuclease (typically derived from Streptococcus pyogenes) can be
expressed in the target cell [7–9] or alternatively the smaller Cas9
protein from Staphylococcus aureus can be delivered by transfection
of recombinant protein [10]. Precise cleavage of double-stranded
DNA is achieved upon formation of a ribonucleoprotein complex,
composed of Cas9 and a sequence-specific sgRNA. sgRNA mole-
cules can be synthesized [11] or transcribed from template DNA
[7, 9, 12], using a variety of promoters, including ribosomal RNA
promoters [8, 12, 13], U6 [12, 14, 15] or T7 [7, 9, 10]. Repair of
the resulting double strand break (DSB) occurs in kinetoplastids
by a mechanism called microhomology-mediated end joining
(MMEJ) [8] rather than nonhomologous end joining (NHEJ),
which is the dominant pathway in mammalian cells. MMEJ relies
on short stretches of sequence identity on either side of the
DSB. Providing repair templates with matching homology flanks
(which can be as short as 24 nt [7]) enables precise editing of a
gene locus.
We designed a streamlined protocol for gene editing in
Leishmania spp. and other kinetoplastids [7, 16, 17] which we
termed LeishGEdit. The key advantages of this robust system are
that it does not require any gene-specific cloning procedures or
in vitro transcription prior to transfections, making it rapid, scal-
able, and economical. Our system relies on a cell line that expresses
Cas9 nuclease and T7 RNA polymerase (RNAP) constitutively.
This allows for in vivo transcription of sgRNAs from transfected
short 124 nt PCR fragments made by using two overlapping single
oligonucleotides and incorporating a T7 promoter [18]. Donor
DNA constructs, containing 30 nt homology flanks identical to
the target locus and drug-selectable marker genes, can be amplified
from a plasmid template using long primers. A modular set of tem-
plate plasmids allows the reuse of the same primer pairs for genera-
tion of a variety of tagging or knockout (KO) constructs (Fig. 1a).
Applying drug-selection to transfected cells eliminates nonedited
cells from the population enabling the generation of Leishmania
null mutants in a single transfection in 1 week. To facilitate high-
throughput projects, an online platform www.leishgedit.net has
been generated to design the required primers for a variety of
different kinetoplastid species [7].
CRISPR-Cas9 Gene Editing Method 191
a pT plasmids
KNOCKOUT
Genomic locus
TAGGING
1 4 2 5
pPLOT plasmids
*mNeonGreen, eYFP, BirA*, mCherry, mStrawberry, Halo, 10-TY, nanoLuc, DD-domain, TEV-Strep
3
5’sgRNA primer: 5’gaaattaatacgactcactatagg[sgN20]gttttagagctagaaatagc 3’
Fig. 1 A modular plasmid system for streamlined gene editing. (a) Strategy for donor DNA amplification from
pT and pPLOT plasmids to repair a target locus after a double-strand break has been introduced by CRISPR-
Cas9. Numbers 1–6 denote oligos used for gene editing: Oligos 1, 2, 4, and 5 contain 30 nt homology flanks
specific to the target locus for integration of donor DNA fragments; 3 and 6 specify the sgRNA target sites,
directing Cas9 to cut immediately upstream (5′) or downstream (3′) of the target ORF. Knockout constructs
encoding a drug-selectable marker gene with endogenous UTRs from L. mexicana are amplified from pT
plasmids with primer pair 1 and 5 and integrated in the target locus after cutting with sgRNAs 3 and 6.
Tagging constructs encode a protein-tag for in-frame fusions to the target gene and a selectable marker.
Examples of available tags are listed. Tagging constructs are amplified from pPLOT plasmids with primer pair
1 and 2 to a tag protein at its N-terminus (cutting target locus at 5′ end with sgRNA 3) or primer pair 4 and
5 for C-terminal tagging (cutting target locus at 3′ end with sgRNA 6). (b) Primer sequences. Oligos 1, 2, 4,
and 5 contain a target-gene specific 30 nt homology flank ([HFN30]) followed by primer binding sites for pT
and pPLOT plasmids (underlined in red). Oligos 3 and 6 contain a T7 promoter (underlined in blue) followed
by 20 nt sgRNA target sequence ([sgN20]) and sequence complementary to the sgRNA backbone (underlined
in green) (reproduced from ref. 7 with permission)
2 Materials
2.2 Agarose Gel 1. 50× stock of Tris–acetate–EDTA (TAE) buffer: 2 M Tris ace-
Electrophoresis tate, 0.05 M EDTA. Dissolve 242 g Tris base in 500 ml dis-
tilled water (dH2O), add 57.1 ml glacial acetic acid, and 100 ml
of 500 mM EDTA (pH 8.0) solution. Bring up solution to 1 l
final volume using dH2O.
2. Agarose.
CRISPR-Cas9 Gene Editing Method 193
2.3 Transfection 1. 1 M sucrose solution. Add 250 ml dH2O to a 500 ml glass
and Selection bottle and add 171 g sucrose while stirring. Fill up to 500 ml
and incubate at 100 rpm at 50 °C until completely dissolved.
2. 1 M HEPES. Add 250 ml dH2O to a 500 ml glass bottle and
add 10 solid NaOH pellets while stirring. When the pellets
have dissolved add 119 g HEPES, titrate to pH 7.4 while
mixing, using 1 M NaOH solution, and fill up to 500 ml with
dH2O.
3. 1 M Na2HPO.
4. 1 M NaH2PO4.
5. 1 M KCl.
6. 200 mM CaCl2.
7. 3× Tb-BSF buffer [19]: 200 mM Na2HPO4, 70 mM NaH2PO4,
15 mM KCl, 150 mM HEPES pH 7.4. For 500 ml buffer mix
stock solutions as follows: 100 ml of 1 M Na2HPO4, 35 ml of
1 M NaH2PO4, 7.5 ml of 1 M KCl and 75 ml of 1 M HEPES
pH 7.4. Add dH2O to bring to 500 ml.
8. 3× modified Tb-BSF buffer (based on observations made in
[20]): 22.3 mM Na2HPO4, 7.67 mM NaH2PO4, 45 mM KCl,
75 mM, HEPES pH 7.4. For 500 ml buffer mix stock solu-
tions as follows: 11.2 ml of 1 M Na2HPO4, 3.8 ml of 1 M
NaH2PO4, 22.5 ml of 1 M KCl, 37.5 ml of 1 M HEPES
pH 7.4, and 225 ml of 1 M sucrose. Add dH2O to bring to
500 ml.
9. 1.5 mM CaCl2. Make 500 ml by adding 3.75 ml of 200 mM
CaCl2 to 496.25 ml dH2O.
10. Transfection mix for knockouts: 25 μl 1.5 mM CaCl2, 83 μl 3×
Tb-BSF, 42 μl ddH2O, 100 μl pooled PCR products (sgRNA
template and donor DNA). Just before transfection, make a
transfection buffer master mix for the required number of
transfections.
11. Transfection mix for tagging: 25 μl 1.5 mM CaCl2, 83 μl 3×
Tb-BSF, 92 μl ddH2O, 50 μl pooled PCR products (sgRNA
template and donor DNA). Just before transfection, make a
transfection buffer master mix for the required number of
transfections.
12. M199 medium. Dissolve 9.5 g M199 powder in 500 ml
ddH2O and add 2.2 g NaHCO3. Add 100 ml fetal bovine
serum (FBS) (10% v/v final concentration), 40 ml of 1 M
194 Tom Beneke and Eva Gluenz
2.4 Genomic DNA 1. Lysis buffer (200 mM NaCl, 0.5% SDS, 5 mM EDTA,
Extraction 100 μg/ml Proteinase K, 10 mM Tris–HCl, pH 8.0): Make
and Diagnostic PCR 50 ml by mixing 1 ml of 0.5 M Tris–HCl pH 8.0, 0.5 ml of
for Knockout 0.5 M EDTA pH 8.0, 1.25 ml of 20% SDS solution, 10 ml of
Validation 1 M NaCl, and 0.5 ml of 10 mg/ml proteinase K solution.
Add dH2O to bring to 50 ml. Aliquot and store at −20 °C.
Defrost in 37 °C water bath before use.
2. Primers: Design primers as described in Subheading 3.7
and prepare 100 μM stock in ddH2O.
3. PCR reagents: Expand™ High Fidelity PCR System (Roche;
contains 10× reaction buffer supplemented with 15 mM MgCl2,
10 mM deoxynucleotide (dNTP) mix, Expand High Fidelity
enzyme mix and 25 mM MgCl2 solution).
4. Standard or 96-well PCR thermal cycler.
5. PCR tubes (we recommend using strips of eight 0.2 ml thin-
walled tubes).
CRISPR-Cas9 Gene Editing Method 195
3 Methods
a Primer design b
PCR1 PCR2
sgRNA donor
template DNA(s)
DNA(s)
5 minutes 3 hours
4-10 days +
L. mex Cas9
Knockout Tagging T7 RNAP cells
2 hours 2 hours
Fig. 2 Gene editing workflow using the LeishGEdit toolkit. Each step is indicated in
a single frame with approximate times for each step indicated below each box in
green. Time required for ordering of oligos is not indicated as it will vary; the selec-
tion time depends on the type of experiment and may vary too. (a) Primer design
can be automated with the LeishGEdit.net primer design tool. (b) Primers are used
to generate sgRNAs and donor DNAs. (c) PCR products from (b) can be mixed
without further purification with a Cas9 and T7 RNAP expressing cell line followed
by electroporation. (d) Cells are subjected to drug selection to obtain populations of
edited cells. Genomic DNA is extracted from knockout candidates and tagged cell
lines are assessed by microscopy. (e) Knockout candidates are screened using
diagnostic PCRs to test genomic DNA for (1) ORF presence in mutant DNA, (2) ORF
presence in parental DNA, and (3) control gene presence in mutant DNA. Finally, the
phenotype of validated cell lines can be studied in detail for example by measuring
growth rate, motility, analyzing cell shape, or testing infectivity (f)
196 Tom Beneke and Eva Gluenz
3.1 Primer Design 1. Manual design of sgRNA primers: the sequence consists of (1)
a T7 promoter sequence, (2) 20 nt sgRNA target site ([sgN20])
(see Note 4), which must be next to a protospacer adjacent
motif (PAM) “NGG” at the target locus, and (3) sequence
complementary to the sgRNA backbone (G00 primer)
(Fig. 1b). For designing the [sgN20] manually, use the
EuPaGDT CRISPR gRNA Design Tool [21] (http://grna.
ctegd.uga.edu/).
2. Manual design of donor DNA primers: the sequence consists
of 30 nt homology flanks ([HFN30] at either end of the donor
DNA (corresponding to target locus sequence next to the
sgRNA target) and sequences binding to the pT or pPLOT
template plasmids (Fig. 1b).
3. Steps 1 and 2 can be automated for genomes available on
www.leishgedit.net. To get sequences, go to the website and
navigate to the primer design tab.
4. Enter the target gene GeneID (from TritrypDB.org) in the
primer design box and choose “pT and pPLOT plasmids” for
gene editing in Leishmania. Choose your desired gene editing
strategy (tagging, knockout, or both).
5. Press the button “Design primers.”
6. A new tab in your browser will appear showing the primer
sequences. You should first validate your search result by check-
ing the sgRNA target count for each primer, which represents
the number of total matches for the sgRNA target sequence
(including a PAM site) within your chosen reference genome.
For most genes the sgRNA target sequence is unique, that is, a
sgRNA target count of 1. If the sgRNA target count is >1 this
means the same sequence is found elsewhere in the genome; this
could result in a lower efficiency of editing the gene of interest
and there may be a higher chance of off-target modifications.
7. Once validated, primers can be exported as .csv file. All primer
sequences are written in a 5′ to 3′ orientation and are ready for
ordering from a suitable manufacturer without further
modifications.
3.2 PCR Gene tagging requires preparation of only one PCR to produce one
Amplification sgRNA template. For tagging a protein at the N-terminus, design
of sgRNA Templates the sgRNA to direct a DSB at the 5′ end of the target gene (Fig. 3a),
for a C-terminal tag, place the DSB at the 3′ end (Fig. 3b). A gene
knockout requires preparation of two PCRs for each target gene
(one sgRNA directing a DSB upstream of the target CDS and
one downstream, (Fig. 4). The following protocol is suitable for
individual PCR tubes (strips of eight tubes are convenient) or
96-well PCR plates.
CRISPR-Cas9 Gene Editing Method 197
a
CGGGGACACGTATCCGCGCTACACAGTGGCCCTCTTCCCTCCTCTCCCGTCCGCCAAACAAAGCATGTCGAATCGGGTTATTCTGCAAACCTTCGACGAGTACCAG
GCCCCTGTGCATAGGCGCGATGTGTCACCGGGAGAAGGGAGGAGAGGGCAGGCGGTTTGTTTCGTACAGCTTAGCCCAATAAGACGTTTGGAAGCTGCTCATGGTC
PAM DSB Met Ser Asn Arg Val Ile Leu Gln Thr Phe Asp Glu Tyr Gln
HFN30 of upstream forward primer sgN20 of 5’sgRNA primer PF16 ORF LmxM.20.1400
HFN30 of upstream reverse primer
b
GAGAAGATCGAGAACTACCACGTGCAGCAGCACTAGCGGGGGAGGAGGCGTCGCGGATGCTCAGCGGGCCTTTCGGCACAGTCACGCCCATGCACGCTGCTCGTCG
CTCTTCTAGCTCTTGATGGTGCACGTCGTCGTGATCGCCCCCTCCTCCGCAGCGCCTACGAGTCGCCCGGAAAGCCGTGTCAGTGCGGGTACGTGCGACGAGCAGC
Glu Lys Ile Glu Asn Tyr His Val Gln Gln His* DSB PAM
PF16 ORF LmxM.20.1400 sgN20 of 3’sgRNA primer HFN30 of downstream reverse primer
HFN30 of downstream forward primer
Fig. 3 Insertion of protein tag into endogenous locus. Strategy for generating cell line expressing protein
tagged at the N-terminus (a), or C-terminus (b). Left panels, Locus map of PF16 (LmxM.20.1400) showing
position of homology flanks (HFN30) used for integration of donor DNA, 20 nt sgRNA target sequence (sgN20),
the PAM site (highlighted in red) and the site of the double-strand break (DSB, red line). The stop codon of PF16
ORF is indicated with asterisk. Right panels, Micrographs showing the result of tagging PF16 with eYFP at the
N-terminus (a) or at the C-terminus (b). Cells were imaged live and images are a composite of phase contrast
and fluorescence channels. Both PF16 fusion proteins localize to the flagellum (eYFP fluorescence shown in
green). DNA is stained with Hoechst (red). Scale bar, 5 μm. Sequence maps were generated with SnapGene
(www.snapgene.com)
a TATCCGCGCTACACAGTGGCCCTCTTCCCTCCTCTCCCGTCCGCCAAACAAAGCATGTCGAATCGGGTTATTCTGC
..
ATAGGCGCGATGTGTCACCGGGAGAAGGGAGGAGAGGGCAGGCGGTTTGTTTCGTACAGCTTAGCCCAATAAGACG
PAM DSB Met Ser Asn Arg Val Ile Leu
HFN30 of upstream forward primer sgN20 of 5’sgRNA primer PF16 ORF LmxM.20.1400
.. C A C T A G C G G G G G A G G A G G C G T C G C G G A T G C T C A G C G G G C C T T T C G G C A C A G T C A C G C C C A T G C A C G C T G C T C G T C G
GTGATCGCCCCCTCCTCCGCAGCGCCTACGAGTCGCCCGGAAAGCCGTGTCAGTGCGGGTACGTGCGACGAGCAGC
His * DSB PAM
sgN20 of 3’sgRNA primer HFN30 of downstream reverse primer
K P K P
b c
600
400 5’UTR PF16 3’UTR 800 5’UTR Ctrl 3’UTR
200
ORF 600
400
200
Fig. 4 Knocking out ORF by replacement with donor DNA cassette. (a) Locus map of PF16 (LmxM.20.1400)
showing upstream and downstream region. The dotted line denotes PF16 ORF internal sequence not shown in
figure. Yellow arrows indicate the position of the homology flanks (HFN30), sgRNA target sequence (sgN20),
PAM site (red) and DSB site (red line) for targeting the 5′ end of the donor DNA to a site immediately upstream
of the PF16 ORF. Grey arrows indicate the position of the same elements, targeting the 3′ end of the donor DNA
to a site immediately downstream from the PF16 ORF (stop codon indicated with asterisk). Insertion of the
donor DNA will result in loss of the PF16 ORF. (b and c) Strategy and results of diagnostic PCRs for knockout
verification. PCR products were run on agarose gels, the numbers indicate band sizes for DNA ladder. The PF16
ORF is detected in the parental DNA (P) but missing from the knockout (K). (c) Control PCR amplifying a control
gene from the parental and the PF16 knockout DNA. The cartoons show the gene loci with small arrows indi-
cating primer binding sites. Sequence maps were generated with SnapGene (www.snapgene.com)
198 Tom Beneke and Eva Gluenz
3.3 PCR Gene tagging requires preparation of one PCR product encoding
Amplification of Donor the tag and drug resistance marker. A gene knockout requires
DNA preparation of two PCR products (one for each drug resistance
marker). Alternatively, knockouts can be generated using only one
drug resistance marker followed by cloning out cell lines after
transfection (see Note 7). Transfection efficiencies may depend on
the chosen drug resistance markers (see Note 8). The following
protocol is suitable for PCR tubes or 96-well plates.
CRISPR-Cas9 Gene Editing Method 199
3.4 Agarose Gel 1. Make a 1% (w/v) agarose gel by dissolving 1 g agarose in
Electrophoresis 100 ml 1× TAE buffer. Bring to the boil until agarose is dis-
solved then cool to ca. 50 °C and add 1 μl ethidium bromide
solution. Pour gel into tray, insert comb and leave to set at
room temperature (see Note 9).
2. Remove comb and load 2 μl of each reaction into the wells of
the gel without loading dye and before submerging the gel in
the buffer tank. Loading is easiest using a multichannel pipette.
200 Tom Beneke and Eva Gluenz
Carefully and slowly place your gel into the gel tank containing
1× TAE buffer, then load DNA ladder.
3. Run the agarose gel for 20 min at 120 V and verify product
yield by using a UV transilluminator.
3.5.1 Pooling of PCR 1. For each new cell line to be generated, pool sgRNA PCR
Reactions reaction(s) together with the corresponding donor PCR
reaction(s) to combine all PCR reactions for the same target
gene in a single tube or well of a plate. If applicable use a mul-
tichannel pipette. For a knockout you will end up with approx-
imately 100 μl total PCR reaction (2 × 40 μl donor DNA PCR
plus 2 × 20 μl sgRNA DNA template PCR minus amount
loaded for gel electrophoresis minus evaporation and sample
loss during handling); for a tagging transfection the yield is
approximately 50 μl total PCR reaction (40 μl donor DNA
PCR plus 20 μl sgRNA DNA template PCR minus amount
loaded for gel electrophoresis minus evaporation and sample
loss during handling).
2. Close PCR tubes, or if pooled on 96-well plates, seal plates
with adhesive foil. Heat-sterilize pooled PCR products at
94 °C for 5 min. Proceed to transfection protocol.
3.5.2 Single Cuvette 1. Prewarm medium: Fill the required number of 25 cm2 flasks
Transfection with 3–5 ml M199 medium or fill the required number of
wells of a 24-well plate with 1 ml M199 and warm up in 28 °C
incubator. If 24-well plates are used, it is recommended to
incubate them in an incubator with a humid 5% CO2 atmo-
sphere (see Note 10).
2. Collect the required number of cells (1 × 107 cells per transfec-
tion) by centrifugation at 800 × g for 10 min.
3. During the centrifugation step, prepare appropriate amount of
transfection buffer master mix (as described in Subheading 2.3)
for the required number of transfections and volume needed
for the washing step below (see step 5).
For 50 knockout transfections, mix 1.25 ml 1.5 mM CaCl2,
4.15 ml 3× Tb-BSF, and 2.1 ml ddH2O (7.5 ml total).
For 50 tagging transfections, mix 1.25 ml 1.5 mM CaCl2,
4.15 ml 3× Tb-BSF, and 4.6 ml ddH2O (10 ml total).
4. Sterilize transfection mix by passaging though a 0.22 μm filter.
CRISPR-Cas9 Gene Editing Method 201
3.5.3 96-Well Plate 1. Prewarm M199 medium to 28 °C (see Note 10).
Transfection 2. Collect 52 × 107 cells expressing Cas9 and T7 RNAP
(1 × 107 cells per reaction) by centrifugation at 800 × g for
15 min (see Note 12).
3. While waiting for the centrifugation step to complete, label
two 24-well plates and fill each well with 1 ml of M199
medium.
4. Prepare transfection buffer as follows:
202 Tom Beneke and Eva Gluenz
3.6 Selection 1. For selection on 24-well plates, add 1 ml M199 with double
the concentration of the desired drug. For selection in flasks,
add an equal volume of M199 with double the concentration
of the desired drug (or add the required volume of drug stock
solution directly to each flask). For selection of L. mexicana or
L. major transfectants, we use the following concentrations:
32 μg/ml hygromycin B, 20 μg/ml puromycin dihydrochlo-
ride, 5 μg/ml blasticidin S hydrochloride, 40 μg/ml G-418
CRISPR-Cas9 Gene Editing Method 203
3.7.1 DNA Isolation Genomic DNA can be isolated quickly and cost-effectively from a
large number of samples using a simplified DNA isolation proce-
dure described in [22]:
1. Collect cells from 400 to 800 μl of exponentially growing
Leishmania by centrifugation at 800 × g for 5 min in a 1.5 ml
Eppendorf tube. Extract DNA from each of the mutant cell
lines to be tested and from the parental cell line.
2. Remove supernatant and resuspend cells in 100 μl prewarmed
lysis buffer.
3. Incubate samples for 30 min at 65 °C.
4. After incubation add 250 μl 100% (v/v) EtOH and spin at
17,000 × g for 20 min at 4 °C.
5. Discard supernatant (see Note 16).
6. Add 50 μl of ddH2O.
7. Allow genomic DNA to dissolve overnight at 4 °C.
8. Vortex genomic DNA after overnight incubation for 5 s and
spin Eppendorf tubes briefly to collect liquid from lid and walls.
9. Determine the DNA concentration of your samples and calcu-
late the necessary dilution to reach a concentration of about
30 ng/μl (see Note 17).
204 Tom Beneke and Eva Gluenz
10. Dilute DNA into new PCR tubes (see Note 16).
11. Repeat steps 1–8 from above to isolate genomic DNA from
the parental cell line separately (scale up number of collected
cells if DNA is required for a large number of PCRs). Dilute
DNA to 60 ng/μl.
3.7.2 Knockout 1. Prepare 100 μM stocks of ORF PCR primers then dilute cor-
Verification: Test Mutant responding forward and reverse primers to 10 μM by adding
DNA for Loss of ORF 5 μl of 100 μM forward primer stock, 5 μl of 100 μM reverse
primer stock and 40 μl ddH2O to a PCR tube.
2. Mix your 10 μM primer dilutions well and pipet 4 μl of this
dilution into a new PCR tube.
3. Add 2 μl of diluted genomic DNA (as prepared in step 10 in
Subheading 3.7.1) from the corresponding cell line. Centrifuge
tubes to collect liquid at the bottom. Freeze tubes at −80 °C
for 30 min (ideally in a cold rack).
4. During the freezing process, calculate the required number of
reactions and prepare the PCR master mix accordingly. For
each reaction add 0.4 μl of 10 mM dNTP mix, 2 μl of 10×
reaction buffer supplemented with 15 mM MgCl2 and
11.4 μl of ddH2O. Add 0.2 μl high-fidelity polymerase last
(see Note 6).
5. Start the following program on a PCR thermocycler
(a) Step 1: First denaturation 94 °C 5 min,.
(b) Step 2: Denaturation 94 °C 30 s.
(c) Step 3: Annealing 60 °C 5 s.
(d) Step 4: Elongation 72 °C 30 s.
(e) Step 5: 35× back to steps b–d.
(f) Step 6: 72 °C 7 min.
(g) Step 7: keep reaction at 4 °C (until removal from the PCR
machine).
6. As soon as it reaches 94 °C, pause the program and remove
your primer dilutions from −80 °C (see Note 5).
7. Add PCR master mix to primer dilutions: When processing a
small number of samples (less than 24) add 14 μl of the PCR
master mix to each primer dilution (total reaction volume
20 μl). For a larger number of samples pipet the entire master
mix into a reagent reservoir and add 14 μl of the PCR master
mix from the reservoir to each primer dilution by using a mul-
tichannel pipette. Use a new tip every time and work quickly
before reactions reach room temperature.
8. Briefly centrifuge tubes and place in hot PCR block. Resume
the PCR program.
CRISPR-Cas9 Gene Editing Method 205
3.7.3 Knockout 1. Use the 10 μM primer dilutions prepared for ORF detection in
Verification: ORF Detection mutant DNA and pipet 4 μl of this dilution into new PCR
in Parental Cell Line tubes. Centrifuge tubes to collect liquid at the bottom. Freeze
tubes at −80 °C for 30 min (ideally in a cold rack).
2. During the freezing process, calculate the required number of
reactions and prepare the PCR master mix accordingly. For
each reaction add 1.0 μl of 60 ng/μl parental genomic DNA,
0.4 μl of 10 mM dNTP mix, 2 μl of 10× reaction buffer supple-
mented with 15 mM MgCl2 and 12.4 μl of ddH2O. Add 0.2 μl
high-fidelity polymerase at last (see Note 6).
3. Start the PCR thermocycler as described in step 5 in
Subheading 3.7.2. As soon as it reaches 94 °C, pause the
program and remove your primer dilutions from −80 °C
(see Note 5).
4. Add PCR master mix to primer dilutions: When processing a
small number of samples (less than 24) add 16 μl of the PCR
master mix to each primer dilution (total reaction volume
20 μl). For a larger number of samples pipet the entire master
mix into a reagent reservoir and add 16 μl of the PCR master
mix from the reservoir to each primer dilution by using a mul-
tichannel pipette. Use a new tip every time and work quickly
before reactions reach room temperature.
5. Briefly centrifuge tubes and place on hot PCR block. Resume
the PCR program.
3.7.4 Knockout 1. Pipet 2 μl of diluted mutant genomic DNA (as prepared in
Verification: Control Gene step 10 in Subheading 3.7.1) into new PCR tubes. Centrifuge
PCR tubes to collect liquid at the bottom. Freeze tubes at −80 °C
for 30 min (ideally in a cold rack).
2. During the freezing process, calculate the required number of
reactions and prepare the PCR master mix accordingly. For
each reaction add 0.4 μl of each 100 μM housekeeping gene
forward and reverse primer, 0.4 μl of 10 mM dNTP mix, 2 μl
of 10× reaction buffer supplemented with 15 mM MgCl2
and 14.6 μl of ddH2O. Add 0.2 μl High-fidelity polymerase
last (see Note 6).
3. Start the PCR thermocycler as described in step 5 in Subheading
3.7.2. As soon as it reaches 94 °C, pause the program and
remove your primer dilutions from −80 °C (see Note 5).
4. Add PCR master mix to primer dilutions: When processing a
small number of samples (less than 24) add 18 μl of the PCR
master mix to each primer dilution (total reaction volume
20 μl). For a larger number of samples pipet the entire master
mix into a reagent reservoir and add 18 μl of the PCR master
mix from the reservoir to each primer dilution by using a
206 Tom Beneke and Eva Gluenz
3.7.5 Knockout Assess all PCR products by running 4 μl of each PCR reaction on
Verification: Agarose Gel a 2% agarose gel (Subheading 3.4).
Electrophoresis
4 Notes
Funding Statement
References
1. Cruz A, Beverley SM (1990) Gene replace- (2018) High-throughput Cos-Seq screen with
ment in parasitic protozoa. Nature intracellular Leishmania infantum for the dis-
348(6297):171–173. https://doi. covery of novel drug-resistance mechanisms.
org/10.1038/348171a0 Int J Parasitol Drugs Drug Resist 8(2):165–
2. Dean S, Sunter J, Wheeler RJ, Hodkinson I, 173. https://doi.org/10.1016/j.
Gluenz E, Gull K (2015) A toolkit enabling effi- ijpddr.2018.03.004
cient, scalable and reproducible gene tagging in 12. Zhang WW, Lypaczewski P, Matlashewski G
trypanosomatids. Open Biol 5(1):140197. (2017) Optimized CRISPR-Cas9 genome
https://doi.org/10.1098/rsob.140197 editing for Leishmania and its use to target a
3. Jones NG, Catta-Preta CMC, Lima A, Mottram multigene family, induce chromosomal translo-
JC (2018) Genetically validated drug targets in cation, and study DNA break repair mecha-
Leishmania: current knowledge and future pros- nisms. mSphere 2(1):e00340-16. https://doi.
pects. ACS Infect Dis 4(4):467–477. https:// org/10.1128/mSphere.00340-16
doi.org/10.1021/acsinfecdis.7b00244 13. Lander N, Li ZH, Niyogi S, Docampo R
4. Komor AC, Badran AH, Liu DR (2017) (2015) CRISPR/Cas9-induced disruption of
CRISPR-based Technologies for the Paraflagellar rod protein 1 and 2 genes in
Manipulation of eukaryotic genomes. Cell Trypanosoma cruzi reveals their role in Flagellar
169(3):559. https://doi.org/10.1016/j. attachment. MBio 6(4):e01012. https://doi.
cell.2017.04.005 org/10.1128/mBio.01012-15
5. Duncan SM, Jones NG, Mottram JC (2017) 14. Ishemgulova A, Hlavacova J, Majerova K,
Recent advances in Leishmania reverse genet- Butenko A, Lukes J, Votypka J, Volf P, Yurchenko
ics: manipulating a manipulative parasite. Mol V (2018) CRISPR/Cas9 in Leishmania mexi-
Biochem Parasitol 216:30–38. https://doi. cana: a case study of LmxBTN1. PLoS One
org/10.1016/j.molbiopara.2017.06.005 13(2):e0192723. https://doi.org/10.1371/
6. Lander N, Chiurillo MA, Storey M, Vercesi journal.pone.0192723
AE, Docampo R (2016) CRISPR/Cas9-
15. Sollelis L, Ghorbal M, MacPherson CR,
mediated endogenous C-terminal tagging of Martins RM, Kuk N, Crobu L, Bastien P,
Trypanosoma cruzi genes reveals the Scherf A, Lopez-Rubio JJ, Sterkers Y (2015)
Acidocalcisome localization of the inositol First efficient CRISPR-Cas9-mediated
1,4,5-Trisphosphate receptor. J Biol Chem genome editing in Leishmania parasites. Cell
291(49):25505–25515. https://doi. Microbiol 17(10):1405–1412. https://doi.
org/10.1074/jbc.M116.749655 org/10.1111/cmi.12456
7. Beneke T, Madden R, Makin L, Valli J, Sunter 16. Costa FC, Francisco AF, Jayawardhana S,
J, Gluenz E (2017) A CRISPR Cas9 high- Calderano SG, Lewis MD, Olmo F, Beneke
throughput genome editing toolkit for kineto- T, Gluenz E, Sunter J, Dean S, Kelly JM,
plastids. R Soc Open Sci 4(5):170095. https:// Taylor MC (2018) Expanding the toolbox
doi.org/10.1098/rsos.170095 for Trypanosoma cruzi: a parasite line incor-
8. Zhang WW, Matlashewski G (2015) CRISPR- porating a bioluminescence-fluorescence
Cas9-mediated genome editing in Leishmania dual reporter and streamlined CRISPR/Cas9
donovani. MBio 6(4):e00861. https://doi. functionality for rapid in vivo localisation and
org/10.1128/mBio.00861-15 phenotyping. PLoS Negl Trop Dis
12(4):e0006388. https://doi.org/10.
9. Peng D, Kurup SP, Yao PY, Minning TA, 1371/journal.pntd.0006388
Tarleton RL (2015) CRISPR-Cas9-mediated
single-gene and gene family disruption in 17. Martel D, Beneke T, Gluenz E, Spath GF,
Trypanosoma cruzi. MBio 6(1):e02097-02014. Rachidi N (2017) Characterisation of casein
https://doi.org/10.1128/mBio.02097-14 kinase 1.1 in Leishmania donovani using the
CRISPR Cas9 toolkit. Biomed Res Int
10. Soares Medeiros LC, South L, Peng D, 2017:4635605. https://doi.org/10.1155/
Bustamante JM, Wang W, Bunkofske M, 2017/4635605
Perumal N, Sanchez-Valdez F, Tarleton RL
(2017) Rapid, selection-free, high-efficiency 18. Bassett A, Liu JL (2014) CRISPR/Cas9 medi-
genome editing in protozoan parasites using ated genome engineering in Drosophila.
CRISPR-Cas9 Ribonucleoproteins. MBio 8(6). Methods 69(2):128–136. https://doi.
https://doi.org/10.1128/mBio.01788-17 org/10.1016/j.ymeth.2014.02.019
11. Fernandez-Prada C, Sharma M, Plourde M, 19. Schumann Burkard G, Jutzi P, Roditi I (2011)
Bresson E, Roy G, Leprohon P, Ouellette M Genome-wide RNAi screens in bloodstream
210 Tom Beneke and Eva Gluenz
form trypanosomes identify drug transporters. for eukaryotic pathogens. Microb Genom
Mol Biochem Parasitol 175(1):91–94. https:// 1(4):e000033. https://doi.org/10.1099/
doi.org/10.1016/j.molbiopara.2010.09.002 mgen.0.000033
20. Dyer P, Dean S, Sunter J (2016) High- 22.
Rotureau B, Gego A, Carme B (2005)
throughput gene tagging in Trypanosoma Trypanosomatid protozoa: a simplified DNA
brucei. J Vis Exp (114). https://doi.org/ isolation procedure. Exp Parasitol 111(3):
10.3791/54342 207–209. https://doi.org/10.1016/j.
21. Peng D, Tarleton R (2015) EuPaGDT: a web exppara.2005.07.003
tool tailored to design CRISPR guide RNAs
Chapter 10
Abstract
Conditional gene deletion using dimerizable Cre recombinase (DiCre) is so far the best developed system
for the phenotypic analysis of essential genes in Leishmania species. Here, we describe a protocol for the
generation of a conditional gene deletion mutant and the subsequent inducible deletion of a target gene.
Leishmania parasites are genetically modified to express two inactive Cre subunits (DiCre) and a single
LoxP-flanked version of a target gene in a context where both endogenous copies of the gene have been
deleted. Treatment with rapamycin dimerizes the DiCre subunits, resulting in activation of the enzyme,
recombination between the LoxP sites, and excision of the LoxP-flanked target gene. Subsequent pheno-
typing allows for the analysis of essential gene function.
Key words DiCre, Cre recombinase, Conditional gene deletion, Essential genes, LoxP sites,
Rapamycin, Leishmania
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_10, © Springer Science+Business Media, LLC, part of Springer Nature 2019
211
212 Samuel M. Duncan et al.
2 Materials
Table 1
Primers for Gateway cloning of 5′ and 3′ gene flanks and sequencing of pDONR vectors
Fig. 2 Generation of pDONR LoxP with GOI. (a) pGL2314 and pGL2315 have C-terminal 6xHA or GFP fusion tags
downstream of their multiple cloning sites (MCS). PCR amplification of the target gene with 5′ NdeI and 3′ SpeI
is recommended for insertion. However, if these sites are not unique, there are EcoRI, KpnI, and ClaI sites avail-
able. PCR amplification without a stop codon allows fusion with 6xHA or GFP. (b) pGL2316 has an N-terminal
GFP fusion tag upstream of the multiple cloning site, therefore the GOI should be amplified with a stop codon at
the 3′ end. The gene may be digested and ligated in via KpnI, ClaI, SpeI, and XbaI sites; it may be preferable to
ligate the GOI in via KpnI and XbaI sites to remove the 6xHA tag; however, if a stop codon is added to the end of
the gene coding sequence, this HA tag will not be translated into a fusion protein (see Note 7). LoxP sites are
indicated by arrows
2.2 Generation 1. Final knockout (KO), floxed GOI (GOIflox), and DiCre (e.g.,
of Conditional Deletion pGL2399) plasmids (generated in Subheading 3.1).
Leishmania spp. 2. Restriction endonucleases (selected for plasmid linearization in
Mutants Subheading 3.1.1 (e.g., PacI and PmeI)).
3. Wild-type Leishmania promastigotes (in mid-log stage of
growth).
4. Amaxa Human T-Cell Nucleofector™ kit.
5. Amaxa 2D Nucleofector™.
DiCre Inducible Gene Disruption 215
3 Methods
Table 2
BP recombination reaction
3.1.2 Plasmid 1. Design GOI specific primers containing the appropriate restric-
Generation: pDONR LoxP tion sites that are compatible with the multiple cloning sites
with GOI for N-(pGL2316) or C-(pGL2314/5) terminal tagging, or
containing upstream and downstream stop codons if no protein
tag is desired (see Note 7). The available pDONR LoxP vectors
and available restriction sites are shown in Fig. 2.
2. Perform PCR amplification of the GOI from genomic DNA
using a high-fidelity DNA polymerase such as Phusion® or
Q5® according to the chosen enzyme specifications.
3. Subclone the amplicon into an appropriate cloning vector (e.g.,
pGEM®-T or PCRScript) to enable sequencing and restriction
enzyme digestion from a plasmid. This enables the gene to be
DiCre Inducible Gene Disruption 217
Table 3
Vectors used for the generation of conditional deletion Leishmania mutants
Table 4
LR recombination reaction
3.2 Generation For the first approach (expression of DiCre from the endogenous
of Conditional Deletion locus) two rounds of transfection are performed using the method
Leishmania Mutants below. For the second approach (expression of DiCre from the
ribosomal locus) it is necessary to generate the DiCre-expressing
line first using the procedure below followed by another two
rounds of transfection for replacement of each allele of the GOI.
DiCre Inducible Gene Disruption 219
3.2.1 Plasmid 1. Set up a double restriction digest of the desired construct with
Preparation appropriate enzymes to linearize the transfection cassette (see
for Transfection Subheading 3.1.1). For example use PacI and PmeI if these
were added to the 5′ and 3′ flanks. For pG2399 (pRIB-DiCre)
digestion use PacI and PmeI.
2. Resolve the restriction digestion products by 0.7% agarose gel
electrophoresis to separate the transfection cassette from the
plasmid backbone. The pGL2399 digest should produce two
fragments of 5460 bp and 2557 bp, respectively. Other frag-
ment sizes will depend on the size of GOI or the resistance
marker chosen.
3. Visualize the DNA and extract the appropriate transfection
fragment using a gel extraction kit.
4. Elute the DNA in a large volume to maximize yield and con-
centrate to ~20 μL by ethanol precipitation.
5. Quantify the purity and concentration of DNA prior to trans-
fection: for integration into the ribosomal RNA locus use 5 μg
DNA, and for gene replacement it is recommended to use
10 μg of purified DNA per transfection.
(a) Add 4 mL from each flask of cells to 20 mL culture media
(1/6 dilution)—plate out 200 μL per well in a 96-well
plate.
(b) Add 2 mL from the above dilution to 22 mL media
(1/72 dilution)—plate out in a 96-well plate.
(c) Add 2 mL from above dilution to 22 mL media (1/864
dilution)—plate out in a 96-well plate.
9. Seal the plates with Parafilm or cling film to reduce
evaporation.
10. Incubate plates for 3–4 weeks at 25 °C to obtain antibiotic-
resistant clones.
11. Expand clonal populations in flasks and extract gDNA from
5 × 106 to 1 × 107 cells to check for integration of constructs
(see Subheading 3.2.3 and Note 13).
Table 5
Primers used for construct integration checks
Integration
Primer plasmid Binding site Orientation Primer sequence
OL13 KO-HYGR Start of HYGR Reverse GGTGAGTTCAGGCTTTTTCA
OL14 KO-HYG R
End of HYG R
Forward CGTCCGAGGGCAAAGGAATA
OL17 KO-SATR Start of SATR Reverse CAGGGATCACCGAAATCTTCA
OL18 KO-SATR End of SATR Forward CGGGAGCACAGGATGACGCCT
OL5118 GOI -PUR flox R
PolyA downstream Reverse CTGCCTCAAACTTGCTTTTC
of second LoxP site
OL16 GOIflox-PURR End of PURR Forward ACCCGCAAGCCCGGTGCCTGA
OL2380 DiCre-BSD in R
5′ of rRNA locus Forward CATTCCGTGCGAAAGCCGG
rRNA locus integration site
OL4101 DiCre-BSDR End of BSDR Forward CTGGTTATGTGTGGGAGG
OL4102 DiCre-BSDR Start of FKBP12 Reverse GATGGTTTCCACCTGCAC
(fused to Cre59)
DiCre Inducible Gene Disruption 221
3.3 Induction Once it has been confirmed that a cell line is deficient of the endog-
of Conditional Gene enous GOI and contains integrated GOIflox and DiCre cassettes,
Deletion the process of dissecting the phenotype upon conditional deletion
can begin.
1. Seed log-phase procyclic promastigotes at a low density
(5 × 104 to 5 × 105 cells/mL) in culture medium, mix the cul-
ture, and separate into two flasks with equal volumes.
2. Inoculate 300 nM of rapamycin into the induced flasks and an
equal volume of DMSO into the noninduced control.
Alternatively, rapamycin and DMSO can also be added daily at
100 nM for the duration of the experiment. Gently mix the cul-
tures to ensure even distribution of the ligand (see Note 16).
3. Count cells every 24 h to generate growth curves. Dilute cells
and add fresh rapamycin or DMSO if needed.
4. Extract genomic DNA to perform PCR and Southern blotting
analysis of gene excision to validate loss of the floxed gene
(see Note 17).
5. Carry out Western blotting using a primary native antibody, or
an anti-HA/GFP Ab if the GOI has been cloned into a
pDONR conferring a protein tag (see Note 18).
6. Apply the appropriate biochemical analysis to determine the
effect of gene loss on the cells.
4 Notes
Acknowledgments
References
1. Cruz AK, Titus R, Beverley SM (1993) 5. Duncan SM, Jones NG, Mottram JC (2017)
Plasticity in chromosome number and testing Recent advances in Leishmania reverse genetics:
of essential genes in Leishmania by targeting. manipulating a manipulative parasite. Mol
Proc Natl Acad Sci U S A 90(4):1599–1603 Biochem Parasitol 216:30–38. https://doi.
2. Mottram JC, McCready BP, Brown KG, Grant org/10.1016/j.molbiopara.2017.06.005
KM (1996) Gene disruptions indicate an essen- 6. Jones NG, Catta-Preta CMC, Lima A, Mottram
tial function for the LmmCRK1 cdc2-related JC (2018) Genetically validated drug targets in
kinase of Leishmania mexicana. Mol Microbiol Leishmania: current knowledge and future pros-
22(3):573–583. https://doi.org/10.1046/ pects. ACS Infect Dis 4(4):467–477. https://
j.1365-2958.1996.00136.x doi.org/10.1021/acsinfecdis.7b00244
3. Hassan P, Fergusson D, Grant KM, Mottram 7. Jullien N, Sampieri F, Enjalbert A, Herman JP
JC (2001) The CRK3 protein kinase is essen- (2003) Regulation of Cre recombinase by
tial for cell cycle progression of Leishmania ligand-induced complementation of inactive
mexicana. Mol Biochem Parasitol 113(2): fragments. Nucleic Acids Res 31(21):e131
189–198 8. Duncan SM, Myburgh E, Philipon C, Brown E,
4. Agron PG, Reed SL, Engel JN (2005) An Meissner M, Brewer J, Mottram JC (2016)
essential, putative MEK kinase of Leishmania Conditional gene deletion with DiCre demon-
major. Mol Biochem Parasitol 142(1):121–125. strates an essential role for CRK3 in Leishmania
https://doi.org/10.1016/j.molbiopara.2005. mexicana cell cycle regulation. Mol Microbiol
03.007 100(6):931–944. https://doi.org/10.1111/
mmi.13375
Chapter 11
Abstract
Induction of gene expression is a valuable approach for functional studies since it allows for the assessment
of phenotypes without the need for clonal selection. Inducible expression can find a wide range of appli-
cations, from the study of essential genes to the characterization of overexpression of genes of interest.
Here, we describe a detailed protocol for the use of the DiCre-based inducible gene expression system in
Leishmania parasites. This is a tightly regulated induction system that allows for time- and dose-controlled
expression of gene products, as rapidly as within 12 h.
Key words Dimerizable cre recombinase, DiCre, Inducible gene expression, Conditional genome
engineering, Leishmania, Trypanosomatids
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_11, © Springer Science+Business Media, LLC, part of Springer Nature 2019
225
226 Jeziel D. Damasceno et al.
A) C)
a b DiCre/GFPFloxed
Kb
0.7- a+c
5’SSU FKBP12-Cre FRB-Cre59 BLA 3’SSU
2.0- d+e
B) 1.5- Control
66 77 Rapamycin - +
lox lox
5’SSU SL-AS GOI-6xHA PAC 3’SSU D)
a e c d DiCre/GFPFloxed
KDa
43- GFP
P 72
lox lox 43- Control
5’SSU SL-AS GOI-6xHA PAC 3’SSU
- 12h 24h 48h
a c e d Rapamycin
+
Fig. 1 The DiCre-based induction system for Leishmania. (a) Schematic representation (not to scale) of the
cassette encoding FKBP12-Cre59 and FRB-Cre60, the truncated forms of Cre recombinase (DiCre) after inte-
gration into the 18S ribosomal RNA locus in the DiCre-expressing cell line; this cassette contains the blastici-
din resistance marker (BLA) and is also flanked by regions homologous to the 18S ribosomal RNA locus (5′SSU
and 3′SSU); the cassette is obtained by digesting the pGL2339 plasmid with PacI and PmeI restriction enzymes.
(b) Schematic representation (not to scale) of the cassette containing the GOIFloxed construct after integration
into the 18S ribosomal RNA locus of the DiCre-expressing cell line (a) to generate the DiCre/GOIFloxed cell line;
to obtain this cassette the GOI must be cloned into the pGL6000 vector, which contains a sequence encoding
for a peptide with six copies of hemagglutinin (6xHA) in an inverted orientation, flanked by lox66 and lox77
sites and followed by the puromycin resistance marker (PAC); the cassette also contains a splice leader accep-
tor site (SL-AS) upstream to the inverted 6xHA coding sequence; DNA fragments encoding for GOI can be
cloned in an inverted orientation allowing for the generation of a floxed version of GOI containing a C-terminal
fusion with 6xHA tag; the linear DNA fragment containing the GOIFloxed construct is generated by digesting the
pGL6000-GOIFloxed vector with PacI and PmeI restriction enzymes and then transfected into the DiCre-expressing
cell line; upon rapamycin addition, the lox66 and lox77 sites mediate the flipping of GOI-6xHA allowing for its
expression. In (a) and (b), black arrows indicate approximate annealing position of primers that can be used
for PCR analysis; a anneals at 5′SSU (5′-CATTCCGTGCGAAAGCCGG-3′); b anneals at the 5′ end of FKBP12-
Cre59 (5′-GATGGTTTCCACCTGCAC-3′); c is specific for the GOI and anneals at the 5′ end of GOI; d anneals at
the 5′ end of PUR (5′-CCGTGGGCTTGTACTCGGTCA-3′); e is specific for the GOI and anneals at the 3′ end of
GOI. (c) PCR of genomic DNA from a DiCre/GOIFloxed cell line (where GOI is GFP) cultivated in the absence (−) or
presence (+) of Rapamycin for 48 h; primers pairs a + c and d + e (annealing positions shown in b) were used
for the analysis; Control indicates a PCR product using primers for the dihydrofolate reductase thymidylate
synthase coding sequence, which was as used as loading control. (d) Western blotting analysis of whole cell
extracts from DiCre/GFPFlox cells treated with rapamycin for the indicated period of times; Control is an unspe-
cific band recognized by anti-EF1α antibody and was used as the loading control
DiCre-Based Inducible Gene Expression 227
2 Materials
2.1 Generation 1. Wild-type Leishmania cells in mid-log phase (see Note 1).
of DiCre-Expressing 2. Supplemented M199 medium [4].
Cell Line
3. pGL2339 vector (Fig. 1a; [5]).
4. Restriction endonuclease PacI.
5. Restriction endonuclease PmeI.
6. QIAquick gel extraction kit (QIAGEN) (see Note 2).
7. Cytomix electroporation buffer (120 mM KCl2, 0.15 mM
CaCl2, 10 mM K2HPO4, 25 mM HEPES, 2 mM EDTA, and
5 mM MgCl2; pH 7.6) [6] (see Note 3).
8. 4 mm gap electroporation cuvettes.
9. Electroporator.
10. 96-well flat bottom plates.
11. Blasticidin.
12. DNeasy Blood and Tissue genomic DNA extraction Kit
(QIAGEN).
13. Primers a and b (Fig. 1a).
2.4 Confirm 1. DNeasy Blood and Tissue genomic DNA extraction Kit
Induction of Gene (QIAGEN).
of Interest 2. Primers a, d, c, and e (Fig. 1b).
3. 1× PBS (137 mM NaCl; 2.7 mM KCl; 10 mM Na2HPO4;
1.8 mM KH2PO4).
4. Laemmli buffer (63 mM Tris–HCl pH 6.8; 10% glycerol; 2%
SDS; 0.0025% Bromophenol Blue; 5% v/v
2-mercaptoethanol).
5. Anti-hemagglutinin antibody.
6. ECL HRP-linked anti-mouse secondary antibody (Amersham).
7. PVDF membrane.
8. ECL Prime Western Blotting Detection Reagent (Amersham)
(see Note 5).
DiCre-Based Inducible Gene Expression 229
3 Methods
3.1.2 Transfection 1. On the day before the transfection, dilute mid-log wild type
and Clone Selection cells to ~1 × 106 cells/ml.
2. Allow cells to grow for approximately 18 h (~2 to 3 rounds
of cell cycle) until a 5 to 7 × 106 cells/ml density is reached
(see Note 8).
3. Harvest cells by centrifugation at 2000 × g for 5 min at 25 °C.
4. Resuspend cells in half of the original cell culture volume using
the cytomix electroporation buffer and harvest them again by
centrifugation at 2000 × g for 5 min at 25 °C.
5. Resuspend cell pellet in cytomix electroporation buffer to a
final density of 2 × 108 cells/ml.
6. Transfer 0.8 ml of the cell suspension to a 4 mm gap cuvette
containing 5 μg of purified DNA (see Subheading 3.1.1).
7. Electroporate cells twice at 25 μF, 1500 V (3.75 kV/cm), with
a 30 s pause between pulses (see Note 9).
8. Immediately transfer the cells to 10 ml of M199 medium
supplemented with 20% fetal bovine serum and incubate
overnight.
9. Clone parasites by limiting dilution in the presence of 10 μg/ml
blasticidin in 96 well plates (see Note 10).
10. After 2–4 weeks of selection, genomic DNA from resistant
clones can be extracted using DNeasy Blood and Tissue
genomic DNA extraction Kit (see Note 11).
11. Confirm pGL2339 integration by PCR using primers pair
a + b. A fragment of ~500 bp should be observed (see Notes
12 and 13).
230 Jeziel D. Damasceno et al.
3.2 Generation After establishment of the DiCre-expressing cell line, it can be used
of the DiCre/GOIFloxed as background cell line to generate a cell line for inducible expres-
Cell Line for Inducible sion of GOIs.
Expression of GOI
3.2.1 Cloning GOI 1. Design the appropriated pair of primers to perform a PCR of
into pGL6000 vector the GOI coding sequence from genomic DNA. Include appro-
to Generate the pGL6000- priate restriction sites in the primers to allow restriction digest
GOIFloxed Construct of PCR products and cloning into pGL6000 vector (Fig. 1b)
(see Note 14).
2. Perform PCR using Phusion® High Fidelity DNA polymerase
and run PCR products on an agarose gel.
3. Purify the amplified fragment using the Gel Extraction Kit.
4. Digest the purified PCR product with the appropriated restric-
tion enzymes to allow cloning into pGL6000 vector.
5. Digest pGL6000 vector with the same set of restriction
enzymes used to digest the PCR product in step 4.
6. Confirm digest of pGL6000 by running an aliquot on an aga-
rose gel. A single DNA fragment of 8079 bp should be
observed.
7. Treat the linearized pGL6000 with calf intestinal alkaline
phosphatase, run it on an agarose gel and purify the fragment
using the Gel Extraction Kit.
8. Set up the ligation reaction using the purified pGL6000 and
GOI digestion products.
9. Transform ligation reaction products into Ca2+-competent
E. coli cells.
10. Screen for the clones bearing the plasmid containing GOIFloxed
(pGL6000-GOIFloxed) (see Note 15).
3.2.3 Transfection 1. One day before transfection, dilute mid-log phase DiCre-
and Clone Selection expressing cells to ~1 × 106 cells/ml.
2. Allow cells to grow for approximately 18 h (around 2–3
rounds of cell cycle) to reach ~5 to 7 × 106 cells/ml density
(see Note 8).
3. Harvest cells by centrifugation at 2000 × g for 5 min at 25 °C.
4. Resuspend cells in half of the original cell culture volume with
cytomix electroporation buffer and harvest them again by
centrifugation at 2000 × g for 5 min at 25 °C.
5. Resuspend cell pellet in cytomix buffer to give a final concen-
tration of 2 × 108 cells/ml.
6. Transfer 0.8 ml of the suspension to a 4 mm gap electropora-
tion cuvette containing 5 μg of purified DNA (see Subheading
3.1.2).
7. Electroporate cells twice at 25 μF, 1500 V (3.75 kV/cm), with
30 s pause between each (see Note 9).
8. Immediately transfer parasites to 10 ml M199 medium supple-
mented with 20% fetal bovine serum and incubate overnight.
9. Clone parasites by limiting dilution in 96-well plates. Selection
must be performed in the presence of both blasticidin and
puromycin at a concentration of 10 μg/ml each (see Note 10).
10. After 2–4 weeks of selection, genomic DNA from resistant
clones can be extracted using DNeasy Blood and Tissue
genomic DNA extraction Kit (see Note 11).
11. Confirm correct integration of the GOIFloxed construct by PCR
using primers pairs a + e and/or c + d (Fig. 1b). Also, confirm
that the DiCre-bearing construct is present in the selected
clones, using primers pair a + b (see Note 12).
3.2.4 Induction Once clones have been selected and proper integration of DiCre
of Expression and GOIFloxed cassettes have been confirmed, DiCre/GOIFloxed cell
line can be used for inducible expression of the GOI.
1. In the day before induction, dilute mid-log phase DiCre/
GOIFloxed cells to ~1 × 106 cells/ml.
2. Allow cells to grow for approximately 18 h (~2 to 3 rounds of
cell cycle) to a ~5 to 7 × 106 cells/ml density (see Note 18).
3. Seed cells at 0.5 to 1 × 105 cells/ml density (see Notes 19
and 20).
4. Add rapamycin to a 100 nM final concentration (see Note 21).
5. Collect cells every 24 h (see Notes 22 and 23).
6. Extract genomic DNA from cells collected at each time point
using DNeasy Blood and Tissue genomic DNA extraction Kit
(see Note 11).
232 Jeziel D. Damasceno et al.
4 Notes
References
1. Santos RERS, Silva GLA, Santos EV et al Leishmania major delineates a 30- kilobase
(2017) A DiCre recombinase-based system for region sufficient for extrachromosomal replica-
inducible expression in Leishmania major. Mol tion and expression. Mol Cell Biol 10:1084–
Biochem Parasitol 216:45–48. https://doi. 1094. https://doi.org/10.1128/
org/10.1016/j.molbiopara.2017.06.006 MCB.10.3.1084
2. Jullien N, Sampieri F, Enjalbert A, Herman J-P 5. Duncan SM, Myburgh E, Philipon C et al
(2003) Regulation of Cre recombinase by (2016) Conditional gene deletion with DiCre
ligand-induced complementation of inactive demonstrates an essential role for CRK3 in L.
fragments. Nucleic Acids Res 31:e131. https:// eishmania mexicana cell cycle regulation. Mol
doi.org/10.1093/NAR/GNG131 Microbiol 100:931–944. https://doi.org/
3. Albert H, Dale EC, Lee E, Ow DW (1995) 10.1111/mmi.13375
Site-specific integration of DNA into wild-type 6. Robinson KA, Beverley SM (2003)
and mutant lox sites placed in the plant genome. Improvements in transfection efficiency and
Plant J 7:649–659. https://doi.org/ tests of RNA interference (RNAi) approaches in
10.1046/j.1365-313X.1995.704649.x the protozoan parasite Leishmania. Mol
4. Kapler GM, Coburn CM, Beverley SM (1990) Biochem Parasitol 128:217–228. https://doi.
Stable transfection of the human parasite org/10.1016/S0166-6851(03)00079-3
Chapter 12
Abstract
Murine bone marrow-derived macrophages (BMMs) can be differentiated within 10 days from ex vivo
bone marrow progenitor cells by supplementing the cell growth medium with colony stimulating factor-1
(CSF-1). Mature macrophages express specific myeloid markers which can be labeled and detected by flow
cytometry (FACS).
BMMs are a valuable tool to investigate the interactions between the Leishmania parasites and their
host cell as well as to screen anti-Leishmania components. Options for the readout of in vitro infection
experiments are diverse and may range from simple counting of intracellular parasites to the determination
of metabolic changes of the intracellular parasite or the infected cell, thus providing the investigator with
valuable results.
Key words Bone marrow-derived macrophages, Colony stimulating factor-1, Flow cytometry
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_12, © Springer Science+Business Media, LLC, part of Springer Nature 2019
237
238 Eugenia Bifeld
2 Materials
Prepare all solutions using sterile filtered (0.22 μm), distilled water.
Store all solutions at 2–8 °C, unless indicated otherwise. Sterilize
all material prior to use with an alcoholic disinfection solution and
use a safety cabinet for all cell manipulations.
Generation of Bone Marrow-Derived Macrophages for In Vitro Infection Experiments 239
2.1 Bone Marrow- 1. Donor mice: female BALB/c or C57BL/6, typically 6–8
Derived Macrophages weeks old.
2. Harvesting medium: Phosphate-buffered saline (PBS) without
calcium and magnesium. Add 0.2 g KCl, 0.24 g KH2PO4, 8 g
NaCl, and 1.41 g Na2HPO4 to 800 mL water, adjust the pH
to 7.4 using a 10 mM HCl solution, fill up to 1000 mL, filtrate
through 0.2 μm bottle top filter into a sterilized glass bottle.
3. BMM growth and differentiation medium: DMEM/F-12,
supplemented with GlutaMAX (see Note 1) (Thermo Fisher
Scientific, Germany), 10% heat-inactivated fetal calf serum
(FCS) (see Note 2), 5% horse serum, 100 units penicillin,
0.1 mg mL−1 streptomycin, and 5–20% of CSF-1 condi-
tioned medium, and filtered through a 0.2 μm filter system.
(see Note 3)
4. Trypsin–EDTA (Sigma-Aldrich, Germany).
5. Trypan Blue for cell viability testing was prepared according to
a protocol by G.A. Perry, Creighton University: For the Trypan
Blue stock solution dissolve 0.2 g Trypan Blue (Sigma-Aldrich,
Germany) in 99.8 mL water, filtrate through 0.2 μm filter, add
0.2% sodium azide (Sigma-Aldrich, Germany). Prepare a
0.7 M NaCl solution in water, mix 0.5 mL of the 0.7 M saline
solution with 2 mL of the Trypan Blue stock solution to prepare
the working solution.
6. 20-mL syringes (Injekt®, B. Braun Medical AG, Sempach,
Switzerland) and 27-G needles (Sterican®, B. Braun Medical
AG).
7. Scalpels and preparation cutlery set.
8. Hemacytometer, 1 mm2 surface × 0.1 mm depth (Hecht
Assistant, Germany).
9. Suitable culture dish for adherent cells (e.g., cell culture flasks
(150/300 cm2 growth surface) with ventilated caps).
10. Cell culture plates suitable for adherent cells from 6 to 24
wells.
2.2 LADMAC Cells 1. LADMAC cells, American Type Culture Collection (ATCC®
CRL-2420™).
2. Complete growth medium for cultivation: Minimum Essential
Medium Eagle (MEME, Sigma-Aldrich, Germany) supple-
mented with 10% heat-inactivated FCS, 1× GlutaMAX
(ThermoFisher Scientific, Germany), 100 U penicillin, 0.1 mg
mL−1 streptomycin, and filtered through a 0.2 μm filter
system.
3. Growth medium for cultivation in roller bottles: RPMI-1640
(Sigma-Aldrich, Germany) supplemented with 10% heat-
inactivated FCS, 1× GlutaMAX (ThermoFisher Scientific,
240 Eugenia Bifeld
2.3 FACS Analysis 1. FACS buffer: PBS supplemented with 10% of heat-inactivated
FCS, and filtered through a 0.2 μm filter system.
2. Antibodies (Biolegend, Germany): Purified nonlabeled anti-
mouse CD16/32 antibody (clone 93) (see Note 5), PE labeled
anti-mouse F4/80 (clone BM8), PerCP-labeled anti-mouse/
human CD11b (clone M1/70), PerCP/Cy5.5-labeled anti-
mouse/human CD86 (clone GL-1), and FITC-labeled anti-
mouse CD11c (clone N418).
3. Zombie UV Fixable Viability Kit (Biolegend, Germany): dis-
solve the delivered powder in 100 μL DMSO and prepare ali-
quots at 2 μL, protect from light, store at −20 °C.
4. Falcon® 5 mL round bottom polystyrene tubes.
5. Flow cytometer (e.g., the LSR II Flow Cytometer from BD
Bioscience (Germany)).
3 Methods
3.1 Cultivation 1. Precool centrifuge to 4 °C, chill the complete growth medium
of LADMAC Cells (for recipe see Subheading 2.2) on ice, and chill a 15 mL tube
After Freezing on ice.
2. Cells from the ATCC are delivered in cryogenic tubes as fro-
zen cultures. Thaw cells immediately after arrival in a water
bath until the culture is unthawed to approximately 80%.
Transfer the cells into the 15 mL tube on ice.
3. Add 4 mL of the complete growth medium dropwise to the
cells while gently shaking the tube.
4. Immediately spin the cells down at 400 × g and 4 °C for 10 min.
Generation of Bone Marrow-Derived Macrophages for In Vitro Infection Experiments 241
Fig. 1 Monitoring of LADMAC cell growth. Cells were counted using a hemocy-
tometer on day 3, 5, and 7 after the start of cultivation
3.2 Generation 1. Scale up the LADMAC cell culture 1–2 weeks prior to the
of the CSF-1 transfer into roller bottles.
Conditioned Medium 2. Cool down a 50 mL centrifuge tube to 4 °C, fill roller bottles
with 280 mL of growth medium for cultivation (for recipe see
Subheading 2.2), and place the bottle in a suitable incubator at
37 °C and 5% CO2 in air atmosphere.
3. Count the cell density in the culture using the hemacytometer.
Take 1.8 × 108 cells/mL for 300 mL of growth medium
(6 × 105/mL) per roller bottle (for recipe see Subheading 2.2).
4. Fill required amount of the cell culture into 50 mL tubes and
centrifuge at 400 × g and 4 °C for 10 min.
242 Eugenia Bifeld
3.3 Generation 1. Euthanize mice according to the relevant ethical and legal
of Bone Marrow- regulations.
Derived 2. Sterilize abdomen and hind legs with an antiseptic solution.
Macrophages (BMMs)
3. Sterilize the preparation cutlery set.
4. Make an incision along the hind legs and flip the skin outward
to expose the legs.
5. Remove the muscle tissue and the feet using scissors or a
scalpel.
6. Remove the head of the femur from the acetabulum by press-
ing the scalpel between both. Disjoin femur from tibia.
7. Clean the bones by placing them in 70% 2-propanol for 5 min
and air-dry the bones afterward.
8. Prepare two 75 cm2 cell culture flasks with ventilated caps (see
Note 7) and fill them with 20 mL CSF-1-containing complete
growth medium for macrophages each. Place the flasks hori-
zontally in a incubator set to 37 °C and 5% CO2.
9. Perform the next four steps on ice.
10. Cut the ends of femur and tibia and flush the bone marrow
with complete growth medium for macrophages (for recipe see
Subheading 2.1) into a 50 mL tube using a 20-mL syringe and
a 27-G needle.
11. Incubate for 5 min on ice.
12. Transfer supernatant into a fresh 50 mL tube without disturb-
ing the sediments.
13. Centrifuge at 400 × g and 4 °C for 10 min.
14. Decant the supernatant, resuspend the cell pellet in 10 mL of
prewarmed, CSF-1-containing complete growth medium for
macrophages, and transfer 5 mL aliquots into the prepared cell
culture flasks.
15. Incubate at 37 °C and 5% CO2 with high humidity.
Generation of Bone Marrow-Derived Macrophages for In Vitro Infection Experiments 243
3.5 FACS Analysis Perform all procedures on ice unless otherwise specified.
1. Transfer 1 × 106 cells from each culture from Subheading 3.4
into Falcon® 5 mL round-bottom polystyrene tubes prefilled
with 1 mL FACS buffer (for recipe see Subheading 2.3).
2. For the negative control transfer another 1 × 106 cells from the
BMM culture grown in complete medium into a Falcon® 5 mL
Generation of Bone Marrow-Derived Macrophages for In Vitro Infection Experiments 245
Table 1
Pipetting scheme for antibody pool
4 Notes
Acknowledgments
References
1. Stanley ER, Guilbert LJ (1981) Methods for lating factor 1. J Cell Physiol 125(3):403–412.
the purification, assay, characterization and tar- https://doi.org/10.1002/jcp.1041250307
get cell binding of a colony stimulating factor 9. Sieff CA, Niemeyer CM, Mentzer SJ, Faller
(CSF-1). J Immunol Methods 42(3):253–284 DV (1988) Interleukin-1, tumor necrosis fac-
2. Clark SC, Kamen R (1987) The human hema- tor, and the production of colony-stimulating
topoietic colony-stimulating factors. Science factors by cultured mesenchymal cells. Blood
236(4806):1229–1237 72(4):1316–1323
3. Eske K, Breitbach K, Kohler J, Wongprompitak 10. Olivas E, Chen BB, Walker WS (1995) Use of
P, Steinmetz I (2009) Generation of murine the Pannell-Milstein roller bottle apparatus to
bone marrow derived macrophages in a stan- produce high concentrations of the CSF-1, the
dardised serum-free cell culture system. mouse macrophage growth factor. J Immunol
J Immunol Methods 342(1–2):13–19. https:// Methods 182(1):73–79
doi.org/10.1016/j.jim.2008.11.011 11. Leenen PJ, de Bruijn MF, Voerman JS,
4. Hume DA, Gordon S (1982) Regulation of Campbell PA, van Ewijk W (1994) Markers of
bone-marrow macrophage proliferation. Adv mouse macrophage development detected by
Exp Med Biol 155:261–266 monoclonal antibodies. J Immunol Methods
5. Sherr CJ, Rettenmier CW, Roussel MF (1988) 174(1–2):5–19
Macrophage colony-stimulating factor, CSF-1, 12. Tabel H, Kaushik RS, Uzonna J (1999)
and its proto-oncogene-encoded receptor. Experimental African trypanosomiasis: differ-
Cold Spring Harb Symp Quant Biol 53(Pt 1): ences in cytokine and nitric oxide production by
521–530 macrophages from resistant and susceptible
6. Englen MD, Valdez YE, Lehnert NM, Lehnert mice. Pathobiology 67(5–6):273–276. https://
BE (1995) Granulocyte/macrophage colony- doi.org/10.1159/000028078
stimulating factor is expressed and secreted in 13. Kaushik RS, Uzonna JE, Zhang Y, Gordon JR,
cultures of murine L929 cells. J Immunol Tabel H (2000) Innate resistance to experi-
Methods 184(2):281–283 mental African trypanosomiasis: differences in
7. Tushinski RJ, Oliver IT, Guilbert LJ, Tynan cytokine (TNF-alpha, IL-6, IL-10 and IL-12)
PW, Warner JR, Stanley ER (1982) Survival of production by bone marrow-derived macro-
mononuclear phagocytes depends on a lineage- phages from resistant and susceptible mice.
specific growth factor that the differentiated Cytokine 12(7):1024–1034. https://doi.
cells selectively destroy. Cell 28(1):71–81 org/10.1006/cyto.2000.0685
8. Sklar MD, Tereba A, Chen BD, Walker WS 14. Sacks D, Noben-Trauth N (2002) The immu-
(1985) Transformation of mouse bone marrow nology of susceptibility and resistance to
cells by transfection with a human oncogene Leishmania major in mice. Nat Rev Immunol
related to c-myc is associated with the endoge- 2(11):845–858. https://doi.org/10.1038/
nous production of macrophage colony stimu- nri933
Chapter 13
Abstract
While infecting humans and other mammals, Leishmania spp. are obligate intracellular parasites. Therefore,
for the purpose of therapeutic intervention and the study of infectivity, the relevant form of Leishmania
spp. is the intracellular amastigote. Therefore, monitoring intracellular parasite load is an essential require-
ment in many fields of Leishmania research. Real-time quantitative PCR is a highly accurate technique for
the detection and quantification of parasite burden in in vitro or in vivo infection experiments. The quan-
tification of DNA for standard curves shows linearity over a 5 to 6-log concentration range indicating the
high sensitivity of the method. Moreover, qPCR allows for the simultaneous quantification of host and
parasite DNA in the same reaction, thereby allowing for an assessment of relative parasite load for basic
research, but also for low- to medium-throughput compound screening. The method also allows to
analyze late stages of in vitro infections where host cells and parasites have detached from surfaces and
escape microscopy-based assays.
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_13, © Springer Science+Business Media, LLC, part of Springer Nature 2019
249
250 Eugenia Bifeld
(Et ) ( )
∆Ct t control sample
Ratio = (1)
(Er ) (
∆Ct control sample )
r
The qPCR technique has become indispensable for work with
Leishmania spp. and is used for a variety of tests. Besides the use
for gene expression analysis or the monitoring of gene deletions,
the intracellular parasite load may also be evaluated via qPCR anal-
ysis. Since Leishmania spp. are obligate intracellular parasites,
in vivo or in vitro infection experiments are common for the study
of these parasites. For the evaluation of parasite load by qPCR,
genomic DNA (gDNA) is preferable as it is not dependent on fluc-
tuation of mRNA abundance and more stable than RNA, but still
rapidly degraded after parasite death [11].
While the qPCR applications used for Leishmania spp. molec-
ular diagnosis generally require high sensitivity, the evaluation of
in vitro infection experiments requires an accurate quantification of
the parasite load relative to host cells or tissue. High sensitivity can
be achieved by targeting a high copy number gene (e.g., the
kinetoplast minicircle DNA of Leishmania spp.) [12–14], which is
overrepresented in the parasites. A high copy number target can
also be the choice for the evaluation of in vivo infection experi-
ments by a duplex qPCR with TaqMan® chemistry since the excess
252 Eugenia Bifeld
2 Materials
2.1 In Vitro Infection 1. Mature BMMs (see Chapter 12) or THP-1 cells [6].
of Bone Marrow- 2. BMM growth and differentiation medium: DMEM/F-12,
Derived Macrophages supplemented with GlutaMAX (see Note 1) (Thermo Fisher
(BMMs) Scientific, Germany), 10% heat-inactivated fetal calf serum
(FCS) (see Note 2), 5% horse serum, 100 units penicillin,
0.1 mg/mL streptomycin, and 5–20% of CSF-1 conditioned
medium, and filtered through 0.2 μm filter system.
3. Leishmania growth medium: Medium 199 (M199) powder
(Sigma-Aldrich, Germany) is dissolved in deionized water to
obtain a 1× solution and supplemented with 20% heat-
inactivated FCS, 40 mM HEPES (Biomol, Germany), 10 mg/
mL hemin, 1 mM adenine, 5 μM 6-biopterin, 2 mM gluta-
mine, 100 units penicillin, and 0.1 mg/mL streptomycin, the
pH is adjusted to 7.4 using a 10 mM HCl solution, medium is
filtered through a 0.2 μm bottle top filter into sterilized glass
bottles. Medium can be stored at 4 °C.
4. Trypsin–EDTA (Sigma-Aldrich, Germany).
5. Trypan-blue for cell viability was prepared according to the
protocol from G.A. Perry, Creighton University: Briefly, for
the Trypan Blue stock solution dissolve 0.2 g Trypan Blue
(Sigma-Aldrich, Germany) in 99.8 mL water, filter with 0.2 μm
filter, add 0.2% sodium azide (Sigma-Aldrich, Germany).
Prepare a 0.7 M saline solution in water, mix 0.5 mL of the
0.7 M saline solution with 2 mL of the Trypan Blue stock
solution to gain the working solution.
6. Hemacytometer, 1 mm2 surface × 0.1 mm depth (Hecht
Assistant, Germany).
7. CASY® Cell Counter System (Roche Innovatis AG) or an
equivalent system to determine cell density.
Quantification of Intracellular Leishmania spp. Using Real-Time Quantitative PCR (qPCR) 253
2.2 Real-Time Prepare all material using deionized, nucleic acid-free water.
qPCR Assay Store all solutions frozen at −20 °C, unless indicated otherwise.
1. TE-buffer: Prepare a solution of 10 mM Tris and 1 mM EDTA
with deionized water, adjust the pH to 8.0 using a 1 M HCl
solution. Sterilize the buffer by filtering the solution through a
0.2 μm filter. Store at room temperature.
2. Oligonucleotides: Dissolve the lyophilized oligonucleotides in
TE buffer for a 100 μM stock solution.
3. 0.5% SDS solution: Dissolve 2.5 mg of SDS powder in 500 mL
deionized water.
4. Appropriate real-time PCR instrument.
5. Appropriate optical reaction plates or reaction tubes for the
particular instrument.
3 Methods
3.1 In Vitro Infection 1. Follow the protocol in Chap. 0, Subheading 3.3 to generate
of BMMs mature BMMs for in vitro infection experiments. Briefly:
(a) Remove the medium from the mature BMM mono layer,
rinse 2 times with prewarmed PBS.
(b) Add 10 mL of trypsin–EDTA to the BMMs and incubate
at 37 °C for 10 min.
254 Eugenia Bifeld
11. Add 2 mL BMM growth medium per well to the cells.
12. Incubate the cells for 48–72 h at 37 °C, 5% CO2, and high
humidity.
or:
13. If antileishmanial compounds should be tested, remove the
BMM growth medium from the wells 24 h post infection.
Supplement BMM growth medium with the desired concen-
tration of the compound and add. Incubate the cells for
another 48 h at 37 °C in 5% CO2 with high humidity.
14. Remove the medium from the infected BMMs, rinse the cell
monolayer twice with prewarmed PBS, and proceed with the
extraction of gDNA.
Alternatively, include adherent and detached cells, including
parasites from ruptured host cells, into the analysis [6]. This
prevents underestimation of parasite loads in nontreated
infections:
15. Collect adherent cells and suspended cells in the medium
supernatant by using cell scrapers. Spin down all cells (1200 × g,
4 °C, 20 min), wash twice in PBS, and proceed with the extrac-
tion of gDNA from the cell pellet.
3.2 Extraction 1. The extraction of gDNA may be performed with any commer-
of Genomic DNA cial gDNA preparation kit. Avoid PCR-interfering substances
such as phenol in the preparation. Ideally, utilize kits based on
magnetic beads or silica membranes, which are available from
different companies (e.g., the silica-based kit ISOLATE II
from Bioline) for the isolation of nucleic acids.
2. When using the ISOLATE II kit (Bioline, Germany), follow
the manufacturer’s instruction. It allows for the direct applica-
tion of cell lysis buffer to attached cells or to cell pellets, avoid-
ing the loss of material during the cell recovery process. Lysed
cells are transferred to columns containing silica membranes,
which selectively bind the nucleic acids (e.g., gDNA), separat-
ing them from contaminants during the washing steps. The
bound gDNA is then eluted into a microcentrifuge tube and
ready to use for the qPCR assay. Genomic DNA should be
stored at 4 °C if used frequently or at −20 °C for long-term
storage.
Fig. 2 Example of a primer/probe design for the L. infantum actin gene, using the primer design module of the
MacVector™ software suite. (a) Parameter settings for PCR primers. (b) Parameter settings for the probe.
Note that Tm (°C) for the probe is set higher than for the primers. (c) Graphic display of the product lengths and
the positions on the gene of suggested primer/probe combinations
3.4 Real-Time qPCR, Prepare all materials using deionized, nucleic acids-free water.
Test for Best Primer Keep the qPCR reagents and primers separate from any nucleic
Combination acids-containing material at all times. If possible, use a clean bench
for assay assembly; clean with a 0.5% SDS-solution prior to assem-
bling the qPCR assay. Use fresh disposable gloves and a dedicated,
clean lab coat. Avoid contaminations with nucleic acids by follow-
ing a strict pipetting direction from negative to positive material.
1. To test the ideal primer conditions prepare primer working
solutions in water with concentrations of 50 nM, 200 nM, 300
nM, and 900 nM (see Note 6) for the reverse (rev) and for-
ward (fwd) primers, respectively. Sixteen primer combinations
should be tested (Table 1).
2. Prepare qPCR assays to test the ideal combinations for parasite-
specific and host cell-specific primer pairs first.
3. Use purified host or Leishmania spp. gDNA of a high and a
low concentration (e.g., 500 ng/μL and 0.5 ng/μL) as tem-
plate for the qPCR assay.
4. Thaw all reagents and samples before preparing the qPCR assay.
Mix all reagents and samples by gentle vortexing and a subse-
quent spin down directly before adding to the master mix.
5. Prepare the master mix for three technical replicates of each
primer combination, and both template concentrations as well
as a water control according to Table 2 (see Note 7).
Table 1
Pipetting scheme for the 16 different combinations using the 4 designated
concentrations for the reverse (rev) and the forward (fwd) primer
respectively
Table 2
Reaction setup for a single qPCR assay
6. Pipet 18 μL of the master mix into each required well or reac-
tion tube.
7. Pipet 2 μL of water into the well or reaction tube designated
for the no-template control. Close the reaction tube to avoid
contamination with the template.
8. Add 2 μL of template (see Note 9) into the required wells or
reaction tubes. Close the reaction tubes or seal the multiwell
plate.
9. Run the qPCR assay on an appropriate real-time qPCR instru-
ment (e.g., Rotor-Gene™ 3000 (Corbett Research) with
settings according to the manufacturer’s instructions) (see
Note 10).
10. Set the temperature profile for a one-step real-time qPCR
according to Table 3:
11. Evaluate the best primer concentrations by comparing the cor-
responding amplification kinetics.
12. Prepare probe working solutions (see Note 12) in water with
the concentrations 50 nM, 100 nM, and 200 nM.
13. Use the best primer pair combination to determine the ideal
probe concentration following the same procedure as for the
primers.
14. After the evaluation of the best primer/probe concentrations
for both the host- and the Leishmania spp.-specific reactions,
Quantification of Intracellular Leishmania spp. Using Real-Time Quantitative PCR (qPCR) 259
Table 3
Temperature profile for the qPCR assay
Table 4
Reaction setup for a duplex qPCR assay, with a Leishmania-specific
oligonucleotide set (L) and a mouse-specific oligonucleotide set (M)
Table 5
Reaction setup for 6 samples in a single qPCR assay either with a
Leishmania-specific oligonucleotide set (L) or a host-(mouse-)specific
oligonucleotide set (M) and a duplex qPCR assay with oligonucleotide
sets specific for both organisms
4 Notes
Acknowledgments
Thanks to Heidrun Von Thien for the advice and help with the
establishment of the real-time qPCR assay.
Quantification of Intracellular Leishmania spp. Using Real-Time Quantitative PCR (qPCR) 263
References
1. Weksberg R, Hughes S, Moldovan L, Bassett for gene expression analysis. Biotechniques
A, Chow E, Squire J (2005) A method for 44(5):619–626. https://doi.org/10.2144/
accurate detection of genomic micro-deletions 000112776
using real-time quantitative PCR. BMC 9. Morrison TB, Weis JJ, Wittwer CT (1998)
Genomics 6:180 Quantification of low-copy transcripts by con-
2. Day E, Dear PH, McCaughan F (2013) Digital tinuous SYBR Green I monitoring during
PCR strategies in the development and analysis amplification. Biotechniques 24(6):954–958,
of molecular biomarkers for personalized medi- 960, 962
cine. Methods 59(1):101–107. https://doi. 10. Pfaffl MW (2001) A new mathematical model
org/10.1016/j.ymeth.2012.08.001 for relative quantification in real-time
3. Nassirpour R, Mathur S, Gosink MM, Li Y, RT-PCR. Nucleic Acids Res 29(9):e45
Shoieb AM, Wood J, O’Neil SP, Homer BL, 11. Prina E, Roux E, Mattei D, Milon G (2007)
Whiteley LO (2014) Identification of tubular Leishmania DNA is rapidly degraded following
injury microRNA biomarkers in urine: com- parasite death: an analysis by microscopy and
parison of next-generation sequencing and real-time PCR. Microbes Infect 9(11):
qPCR-based profiling platforms. BMC 1307–1315
Genomics 15:485. https://doi.org/10.1186/ 12. Lachaud L, Marchergui-Hammami S,
1471-2164-15-485 Chabbert E, Dereure J, Dedet JP, Bastien P
4. Kearns AM, Guiver M, James V, King J (2001) (2002) Comparison of six PCR methods using
Development and evaluation of a real-time peripheral blood for detection of canine visceral
quantitative PCR for the detection of human leishmaniasis. J Clin Microbiol 40(1):210–215
cytomegalovirus. J Virol Methods 95(1–2): 13. Mary C, Faraut F, Lascombe L, Dumon H
121–131 (2004) Quantification of Leishmania infantum
5. Nicolas L, Prina E, Lang T, Milon G (2002) DNA by a real-time PCR assay with high sensi-
Real-time PCR for detection and quantitation tivity. J Clin Microbiol 42(11):5249–5255
of leishmania in mouse tissues. J Clin Microbiol 14. Weirather JL, Jeronimo SM, Gautam S, Sundar
40(5):1666–1669 S, Kang M, Kurtz MA, Haque R, Schriefer A,
6. Bifeld E, Tejera Nevado P, Bartsch J, Eick J, Talhari S, Carvalho EM, Donelson JE, Wilson
Clos J (2016) A versatile qPCR assay to quan- ME (2011) Serial quantitative PCR assay for
tify trypanosomatidic infections of host cells detection, species discrimination, and quantifi-
and tissues. Med Microbiol Immunol cation of Leishmania spp. in human samples.
205(5):449–458. https://doi.org/10.1007/ J Clin Microbiol 49(11):3892–3904. https://
s00430-016-0460-3 doi.org/10.1128/JCM.r00764-11
7. Chen C, Ridzon DA, Broomer AJ, Zhou Z, 15. Jara M, Berg M, Caljon G, de Muylder G,
Lee DH, Nguyen JT, Barbisin M, Xu NL, Cuypers B, Castillo D, Maes I, Orozco MDC,
Mahuvakar VR, Andersen MR, Lao KQ, Livak Vanaerschot M, Dujardin JC, Arevalo J (2017)
KJ, Guegler KJ (2005) Real-time quantifica- Macromolecular biosynthetic parameters and
tion of microRNAs by stem-loop metabolic profile in different life stages of
RT-PCR. Nucleic Acids Res 33(20):e179. Leishmania braziliensis: amastigotes as a func-
https://doi.org/10.1093/nar/gni178 tionally less active stage. PLoS One 12(7):
8. VanGuilder HD, Vrana KE, Freeman WM e0180532. https://doi.org/10.1371/journal.
(2008) Twenty-five years of quantitative PCR pone.0180532
Chapter 14
Abstract
The study of in vitro infections is essential to evaluate distinct aspects of Leishmania biology and also
invaluable for more meaningful in vitro screening of promising chemical entities. Macrophage-like cells
lines from different origins are amenable to Leishmania infection. Cell lines due to their stability and stan-
dardization potential are highly valued for their capacity to support reproducible infections and consistent
data. In fact, these cells have been a mainstay of leishmaniasis research for more than 40 years. In this
context, the human monocytic THP-1 cell line is commonly used as it can be differentiated with phorbol-
12myristate-13-acetate (PMA) into macrophages that are susceptible to Leishmania infection. In this sec-
tion, we will describe generalities concerning the use of cell lines for in vitro Leishmania infection using
THP-1 derived macrophages and Leishmania infantum axenic amastigotes expressing luciferase associated
to preclinical drug screening as example.
Key words Leishmania, Macrophage-like cell lines, Drug screening, Axenic amastigotes
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_14, © Springer Science+Business Media, LLC, part of Springer Nature 2019
265
266 Nuno Santarém et al.
2 Materials
2.3 Culture Media 1. Culture media for THP-1: RPMI-1640 medium supple-
mented with 10% FBS, 0.05 mM 2-mercaptoethanol, and 1%
penicillin/streptomycin.
2. Culture media for axenic amastigotes: M199 supplemented
with Hank’s balanced salts, 0.5% soya trypto-casein, 5 mM
glutamine, 4 mM NaHCO3, 23 μM hemin, 25 mM Hepes
(final pH, 6.5), and 20% FBS.
3 Methods
3.1 Cell and Parasite For more details on THP-1 cell culture, such as storage, thawing,
Culture and maintenance of cells, see the ATCC recommendations [22].
Although THP-1 is a biosafety level 1 cell type all the manipulations
3.1.1 Culture
are performed on a class II biosecurity cabinet due to the need for
and Maintenance
parasite infections. All media used are prewarmed to 37 °C.
of THP-1 Cells
268 Nuno Santarém et al.
3.1.2 Culture All the manipulations are performed on a class II biosecurity cabi-
and Maintenance net. All media used should be prewarmed to 37 °C. The time that
of Leishmania infantum the axenic amastigotes remain outside the incubator should be
Axenic Amastigotes minimized.
Expressing Luciferase
1. Defrost (see Note 5) a stock vial of luciferase-expressing
Leishmania infantum axenic amastigotes (frozen as 1 × 107
axenic amastigotes are in complete axenic amastigotes culture
media supplemented with 10% (V/V) DMSO) in 10 mL of
prewarmed (37 °C) axenic amastigote culture media using a
15 mL conical tube (see Note 6).
2. Centrifuge at 1800 × g for 10 min at RT and remove the
supernatant.
3. Suspend the parasites in 5 mL of amastigote culture media
supplemented with 60 μg/mL of G418 and seed it into a
25 cm2 tissue culture flask.
4. Incubate the flask on its side for 3 days in a humidified tissue
culture incubator at 37 °C and atmospheric conditions of 5%
CO 2.
5. Observe the parasites in the inverted microscope to confirm
that they are indeed round/oval shaped and dwelling near the
bottom. With a disposable Pasteur pipette remove two samples
from the flask into empty 1.5 mL reaction vials. Dilute the
Leishmania in vitro Drug Screening 269
3.2 In Vitro Before starting, place the THP-1 media and also the PBS in a
Screening of Drugs 37 °C water bath for at least 30 min.
Against Intracellular
1. With a disposable Pasteur pipette remove two samples from
Leishmania infantum
the flask into empty 1.5 mL reaction vials. Dilute each of the
3.2.1 Differentiation samples 1:2 in trypan blue 0.4% and count the cells in a
of THP-1 into Macrophages Neubauer chamber (viability should be more than 90%) using
an optical microscope.
2. After establishing the average cell number, transfer 1 × 107
cells (for each 96-well plate planned for the assay) to a 50 mL
conical tube and centrifuge cells in a table top centrifuge at
125 × g for 10 min RT.
3. Discard supernatant and suspend the cells in 5 mL of THP-1
medium for each plate planed. Count the THP-1 cells in try-
pan blue (dilution 1:1 cells–trypan blue) using a Neubauer
chamber as described in step 1. Cell number should be
between 1.5 and 2 × 106/mL.
4. After establishing the cell number, add THP-1 media to dilute
the cells to 1 × 106/mL.
5. Supplement the cell suspension with PMA at a final concentra-
tion of 20 ng/mL (see Note 10).
6. Using a multichannel pipette, fill the border wells of the
96-well plate with 200 μL of PBS, and then transfer 100 μL of
the cell suspension (1 × 105 cells/well) to each well of the
96-well plate (see Note 11).
7. Incubate the plate for 18 h in a humidified tissue culture incu-
bator set at a temperature of 37 °C and atmospheric condi-
tions of 5% CO 2.
8. Place the THP-1 media in a 37 °C water bath for at least
30 min.
9. Observe the cells in inverted light microscope to confirm that
they are adherent (with a 70–80% confluence). Using a multi-
channel pipette to remove the media from each well contain-
ing cells, wash once with 100 μL of complete media, and then
add 100 μL of fresh culture media.
10. Incubate the plate overnight in a humidified tissue culture
incubator at 37 °C and atmospheric conditions of 5% CO2.
270 Nuno Santarém et al.
3.3 Infection Before starting: place the THP-1 media in a 37 °C water bath for
of THP-1 Cells at least 30 min. Confirm that parasites and cell morphology is in
and Treatment accordance to what is described for the parasites and cells.
with Drugs to Test 1. With a disposable Pasteur pipette remove two samples from a
3.3.1 Infection 5-day old axenic amastigotes culture into empty 1.5 mL reac-
and Treatment tion vials. Dilute the samples 1:40 in 0.4% glutaraldehyde and
count the cells in a Neubauer chamber.
2. Transfer 1 × 108 amastigotes for each plate planned into a
15 mL conical tube. Centrifuge parasites at 1800 × g for
10 min at RT.
3. Wash the parasites, discard the supernatant and suspend the
parasites in 10 mL of THP-1 media for each plate planed.
Centrifuge parasites at 1800 × g for 10 min at room
temperature.
4. Discard supernatant and suspend the parasites in 5 mL of
THP-1 media for each plate planed. Take 10 μL of parasite
suspension and dilute it 1:20 in glutaraldehyde 0.25% and
count the parasites in a Neubauer chamber using a bench top
optical microscope, at this stage parasite concentration should
be between 1.5 and 2 × 107/mL.
5. After establishing the parasite concentration, add THP-1
media sufficient to dilute the parasites to 1 × 107/mL.
6. Using a multichannel pipette remove all media from wells
containing cells and immediately add either 100 μL of THP-1
media in wells labeled NI or parasite suspension to all other
wells (Table 1). This leads to a 1:10 ratio of infection (cells–
parasites) (see Note 12).
7. Incubate the plate for 4 h in a humidified tissue culture incu-
bator at 37 °C and 5% CO2.
8. At this stage the compounds to add to the plate should be
prepared, for the proposed assay from the stock solutions
using warm media (see Note 13).
9. After 4 h, remove the media containing noninternalized para-
sites using a multichannel pipette and wash carefully with
100 μL of complete THP-1 media (pipette up and down for at
least six times) (see Note 14).
10. Remove the media and repeat the wash with another 100 μL
of complete THP-1.
11. Repeat step 10 twice more.
12. After three washes add 50 μL of THP-1 media and confirm
that no free parasites are detectable using an inverted
microscope.
13. At this stage the plate is ready to receive 50 μL of the com-
pounds to be tested (T1 through T6), the reference drug, the
Leishmania in vitro Drug Screening 271
Table 1
Generic schematic example of a 96-well plate layout for a drug screening assay
1 2 3 4 5 6 7 8 9 10 11 12
EC EC
Ref Ref Ref
B NT T1 T1 T1 T1
C1 C1 C1
100 100
EC EC
Ref Ref Ref
G NT T6 T6 T6 T6
100 C6 C6 C6 100
Gray PBS filled wells, EC100 positive controls, treated with >EC100 of reference drugs, NI noninfected, NT
negative controls, nontreated, T1–6 treatments, Ref reference drugs for control dose response curve
272 Nuno Santarém et al.
3.3.2 Determine 1. Before starting, place lysis buffer, luciferin substrate and PBS
Compound Activity in a 37 °C water bath for at least 30 min before use.
Through Luciferase Assay 2. Using a multichannel pipette, remove media from wells con-
taining cells and add 100 μL of PBS to each well. Then add
25 μL of Glo Lysis buffer, mixing with the pipette (aspirate
fluid up and down three times) to ensure homogeneity.
3. Incubate the plates for 10 min in an agitator at 100 rpm.
4. Using a multichannel pipette, add 30 μL of luciferase substrate
to each well ensuring homogeneity (aspirate fluid up and
down three times). Cover plate in tin foil to protect from light.
5. Incubate the plates for 15 min in an agitator at 100 rpm.
6. Using a multichannel pipette transfer 140 μL from each well
to a white bottom 96-well plate.
7. Read luminescence in a Synergy 2 BioTek reader with 250
sensitivity (see Note 15).
% Antiparasitic activity = ( mean neg − test value ) / ( mean neg − mean pos ) ×100
4 Notes
Acknowledgments
References
1. WHO (2017) Leishmaniasis. http://www. axenic assay with high predictivity of leishmani-
who.int/leishmaniasis/en/. Accessed 30 Nov cidal intracellular activity. PLoS Negl Trop Dis
2017. 9(9):e0004094. https://doi.org/10.1371/
2. Edmondson R, Broglie JJ, Adcock AF, Yang L journal.pntd.0004094
(2014) Three-dimensional cell culture systems 6. Shafi S, Afrin F, Islamuddin M, Chouhan G,
and their applications in drug discovery and Ali I, Naaz F, Sharma K, Zaman MS
cell-based biosensors. Assay Drug Dev Technol (2016) Beta-nitrostyrenes as potential
12(4):207–218. https://doi.org/10.1089/ anti-leishmanial agents. Front Microbiol
adt.2014.573 7:1379. https://doi.org/10.3389/fmicb.
3. Zulfiqar B, Shelper TB, Avery VM (2017) 2016.01379
Leishmaniasis drug discovery: recent progress 7. Santarem N, Cunha J, Silvestre R, Silva C,
and challenges in assay development. Drug Moreira D, Ouellette M, Cordeiro-da-Silva A
Discov Today 22(10):1516–1531. https:// (2014) The impact of distinct culture media in
doi.org/10.1016/j.drudis.2017.06.004 Leishmania infantum biology and infectivity.
4. De Muylder G, Ang KK, Chen S, Arkin MR, Parasitology 141(2):192–205. https://doi.
Engel JC, McKerrow JH (2011) A screen org/10.1017/S0031182013001388
against Leishmania intracellular amastigotes: 8. Maia C, Rolao N, Nunes M, Goncalves L,
comparison to a promastigote screen and iden- Campino L (2007) Infectivity of five different
tification of a host cell-specific hit. PLoS Negl types of macrophages by Leishmania infantum.
Trop Dis 5(7):e1253. https://doi. Acta Trop 103(2):150–155. https://doi.
org/10.1371/journal.pntd.0001253 org/10.1016/j.actatropica.2007.06.001
5. Nuhs A, De Rycker M, Manthri S, Comer E, 9. Tsuchiya S, Yamabe M, Yamaguchi Y,
Scherer CA, Schreiber SL, Ioset JR, Gray DW Kobayashi Y, Konno T, Tada K (1980)
(2015) Development and validation of a novel Establishment and characterization of a human
Leishmania donovani screening cascade for acute monocytic leukemia cell line (THP-1).
high-throughput screening using a novel Int J Cancer 26(2):171–176
Leishmania in vitro Drug Screening 277
Abstract
High content analysis enables automated, robust, and unbiased evaluation of in vitro Leishmania
infection. Here, we describe a protocol based on the infection of THP-1 macrophages with Leishmania
promastigotes and the quantification of parasite load by high content analysis. The technique is capable
of detecting and quantifying intracellular amastigotes, providing a multiparametric readout of the total
number of cells, ratio of infected cells, total number of parasites, and number of parasites per infected
cells. The technique can be used to quantitate infection of any Leishmania species in virtually all types of
permissive host cells and can be applied to quantification of drug activity and studies of the Leishmania
intracellular life cycle stage.
Key words High content screening, High content analysis, Phenotypic assays, Intracellular amasti-
gotes, Automated image analysis, Leishmania intracellular parasites, In vitro infection, Leishmania-
infected THP-1 macrophages
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_15, © Springer Science+Business Media, LLC, part of Springer Nature 2019
279
280 Carolina Borsoi Moraes and Laura Maria Alcântara
2 Materials
Fig. 1 High content analysis workflow for Leishmania intracellular amastigote detection and quantification.
Central workflow shows sequential analysis steps, while side-boxes provide details from specific prepro-
grammed algorithms from distinct high content analysis software: PerkinElmer Harmony (left) and General
Electric Investigator (right)
282 Carolina Borsoi Moraes and Laura Maria Alcântara
4. Draq5.
5. Fetal bovine serum (FBS).
6. Hepes.
7. Medium 199.
8. Paraformaldehyde (PFA).
9. Phorbol myristate acetate (PMA).
10. Phosphate buffered saline (PBS), pH 7.4.
11.
10,000 U/mL penicillin–10,000 μg/mL streptomycin
solution.
12. RPMI 1640 media, containing 2 mM l-glutamine, 25 mM
HEPES, 2000 mg/L glucose, and 5 mg/L phenol red.
13. Sodium bicarbonate.
2.3 Equipment High content screening system—this protocol has been validated
with Operetta (PerkinElmer) and IN Cell Analyzer 2200 (GE
Healthcare) but can be adapted to virtually any high content
screening platform available.
3 Methods
3.1 Cell Culture 1. Culture THP-1 cells in RPMI 1640 medium supplemented
with 20% FBS, 100 μg/mL penicillin, and 100 U/mL strep-
tomycin at 37 °C in a humidified atmosphere containing 5%
CO2. Cells should be subcultured at 2 × 105/mL every 3 days
and cellular density should not exceed 1 × 106/mL.
2. Culture Leishmania spp. as promastigotes at 1 × 106/mL in
medium 199 supplemented with 0.1 mM adenine, 40 mM
hepes and 0.0001% biotin, 10% FBS (or 20% for L. brazilien-
sis), 100 U/mL penicillin, and 100 μg/mL streptomycin, at
26 °C under agitation of 30 rpm. Cultures should be passaged
every 3 days, while in exponential growth phase (see Note 2).
3.3 Washing 1. After incubation period, add 25 μL of 12% PFA (in PBS, pH
and Fixing 7.4 v/v) solution into the plates of culture. PFA final concen-
tration should be 4%.
2. Incubate the plates for 15 min at room temperature.
3. Wash plates three times with 1× PBS.
4. Stain the plates with 10 μL of 5 μM Draq5 (in PBS) (see Note 7).
5. Incubate the plates for 20 min at room temperature and in the
absence of light. No washing is required.
3.4 Image 1. Insert the microplate into the high content screening equip-
Acquisition ment following the supplier’s instructions.
2. Choose the plate specification (format, model, and brand).
3. Select the 20× objective.
4. Select the far-red emission filters (Excitation/Emission (nm):
630/650).
5. Define empirically the exposure time by taking pictures and
checking the signal histogram. As the lamp power declines
with lamp usage, it is necessary to adjust exposure time often.
In the histogram, the intensity values should be distributed in
the entire intensity range, without saturating image pixels.
6. Select the proper image focus. When the autofocus is not
available in the device options, perform multiple stacks imag-
ing, adjusting the focus based on the intracellular parasite
(see Note 8).
7. Select wells for image acquisition.
8. Select the number of images per well. For 384-well plates, the
number of four images/well is often sufficient for an appropri-
ate analysis (see Note 9).
9. Start plate reading following the device specifications.
3.5 Images Analysis The following steps can be performed in different high content
analysis software, adapting the conditions to each program’s speci-
ficities (Figs. 1 and 2).
284 Carolina Borsoi Moraes and Laura Maria Alcântara
Fig. 2 Images of high content analysis workflow for Leishmania infection. THP-1 cells were infected with
Leishmania promastigotes and incubated for 96 h. Host cells and parasites were fixed with 4% PFA and
stained with Draq5. In this case, images were acquired by Operetta high content system. Figures from left to
right: raw image obtained by high content microscope, detection of host cell nuclei, segmentation of host cell
cytoplasm, detection of intracellular amastigotes, and identification of infected cells (green color) and nonin-
fected cells (red color)
3.6 Data Analysis 1. Determine the average infection ratio in infected cell control
wells (see Note 13).
2. Determine the average infection ratio in noninfected cell con-
trol wells (see Note 13).
3. The average infection ratio in noninfected cells is the back-
ground and can be subtracted from the infection ratio of
infected cells (both from control and test wells).
4 Notes
Acknowledgments
References
1. Mosser DM, Edelson PJ (1985) The mouse Leishmania (Viannia) braziliensis. Am J Trop
macrophage receptor for C3bi (CR3) is a major Med Hyg 96:656–659
mechanism in the phagocytosis of Leishmania 9. Seifert K, Escobar P, Croft SL (2010) In vitro
promastigotes. J Immunol 135:2785–2789 activity of anti-leishmanial drugs against
2. Mosser DM, Edelson PJ (1987) The third Leishmania donovani is host cell dependent.
component of complement (C3) is responsible J Antimicrob Chemother 65:508–511
for the intracellular survival of Leishmania 10. Zulfiqar B, Shelper TB, Avery VM (2017)
major. Nature 327:329–331 Leishmaniasis drug discovery: recent progress
3. Sampaio WM et al (2007) In vitro binding and and challenges in assay development. Drug
survival assays of Leishmania parasites to Discov Today 22:1516–1531
peripherical blood monocytes and monocyte- 11. Field MC et al (2017) Anti-trypanosomatid
derived macrophages isolated from dogs natu- drug discovery: an ongoing challenge and a
rally and experimentally infected with Leishmania continuing need. Nat Rev Microbiol 15:
(Leishmania) chagasi. BMC Vet Res 3:11. 217–231
https://doi.org/10.1186/1746-6148-3-11 12. Nühs A et al (2015) Development and valida-
4. Sundar S, Rai M (2002) Laboratory diagnosis tion of a novel Leishmania donovani screening
of visceral leishmaniasis. Clin Diagn Lab cascade for high-throughput screening using a
Immunol 9:951–958 novel axenic assay with high predictivity of
5. Siqueira-Neto JL et al (2012) An image-based leishmanicidal intracellular activity. PLoS Negl
high content screening assay for compounds Trop Dis 9:e0004094. https://doi.org/
targeting intracellular Leishmania donovani 10.1371/journal.pntd.0004094
amastigotes in human macrophages. PLoS 13. De Muylder G et al (2011) A screen against
Negl Trop Dis 6:e1671. https://doi. Leishmania intracellular amastigotes: compari-
org/10.1371/journal.pntd.0001671 son to a promastigote screen and identification
6. De Rycker M et al (2013) Comparison of a of a host cell-specific hit. PLoS Negl Trop Dis
high-throughput high content intracellular 5:e1253. https://doi.org/10.1371/journal.
Leishmania donovani assay with an axenic pntd.0001253
amastigote assay. Antimicrob Agents 14. Dagley MJ, Saunders EC, Simpson KJ,
Chemother 57:2913–2922 McConville MJ (2015) High content assay for
7. Maes L et al (2016) In vitro ‘time-to-kill’ assay measuring intracellular growth of Leishmania
to assess the cidal activity dynamics of current in human macrophages. Assay Drug Dev
reference drugs against Leishmania donovani Technol 13:389–401
and Leishmania infantum. J Antimicrob 15. Tsuchiya S et al (1980) Establishment and
Chemother 72:428–430. https://doi.org/ characterization of a human acute monocytic
10.1093/jac/dkw409 leukemia cell line (THP-1). Int J Cancer
8. Espada CR et al (2017) Susceptibility to 26:171–176
miltefosine in Brazilian clinical isolates of
Chapter 16
Abstract
Visceral leishmaniasis (VL) is mainly caused by Leishmania donovani (India and East Africa), and
Leishmania infantum (Mediterranean Basin and South America) infections. Although murine models of
visceral infection lack the clinicopathological aspects of VL in humans, they have been proven useful at
advancing our knowledge in the Leishmania field. Indeed, these models have been used not only to better
understand the pathophysiology of the infection but also in drug and vaccine development. This chapter
focuses on the protocols used to experimentally infect mice and to quantify parasite burdens in mice
infected with L. infantum using limiting dilution methodology of target organs and whole-mouse in vivo
imaging.
Key words Leishmania infantum, Visceral infection, Limiting dilution, Whole-mouse in vivo
imaging
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_16, © Springer Science+Business Media, LLC, part of Springer Nature 2019
289
290 Joana Tavares et al.
2 Materials
2.2 Laboratory 1. In our laboratory 6-week-old BALB/c mice are used. The
Animals mice are obtained from Charles River (France). All experi-
ments involving rodents must conform to national and institu-
tional regulations and will follow the Principle of the 3Rs.
Final approval of the experiments is dependent on licensing by
the relevant authorities.
2.3 Reagents 1. Culture media: (a) complete RPMI: RPMI 1640 medium
supplemented with 10% heat-inactivated Fetal Bovine Serum—
2.3.1 Quantification
FBS, 2 mM l-glutamine, 100 U/ml penicillin, 100 μg/ml
of Parasite Burden
streptomycin, and 20 mM HEPES buffer; (b) Schneider cul-
by Limiting Dilution
ture medium: Schneider’s Insect Medium supplemented with
10% heat inactivated FBS, 200 U/ml penicillin, 200 μg/ml
streptomycin, 5 mM HEPES buffer, 2.5 mg/ml phenol red.
2. Sterile PBS.
3. 0.25% glutaraldehyde in PBS.
4. Trypan blue solution, 0.4%.
2.5 Software 1. Imaging data are analyzed with the software provided with the
in vivo imaging system (i.e., LIVING IMAGE 4.4 for the
IVIS Lumina LT from PerkinElmer).
2. Microsoft Excel is used to calculate parasite burdens by the
limiting dilution method.
3. GraphPad Prism software (Graph-Pad software, Inc., USA) or
comparable software is used for statistical analysis.
3 Methods
3.1.2 Infection of Mice 1. Inside a biohazard class II safety cabinet inject promastigotes
with Leishmania into mice by performing an intraperitoneal injection. For that,
Promastigotes open the cage and restrain the animals by gently removing it
from the cage and apply the restraining technique. Slightly
move the animal head down so that the abdominal viscera
move toward the thorax and inject into the lower right quad-
rant of the abdomen toward the head at 30–40° angle to
horizontal.
3.1.3 Quantification 1. Anesthetize mice using the isoflurane anesthesia system and
of Parasite Burden euthanize the animal by cervical dislocation.
in Organs (Workflow Is 2. Inside a biohazard class II safety cabinet place the mouse in
Shown in Fig. 1) dorsal decubitus (laying on the back) and wet the abdomen
with 70% ethanol (see Note 4).
3. Lift the skin in the mid-abdomen and make an approximately
2-cm long horizontal skin incision with a scissor. Liver and
spleen should be visible under the muscle layer. Make a hori-
zontal incision in the muscle layer and remove the spleen and
the liver. Place the organs on previously weighed petri dishes
placed on ice.
4. To collect the bone marrow, remove fur and skin from the legs
by lifting skin at the base of each leg with tweezers and cutting
away skin across thigh and down to ankle. Peel skin down the
leg and over the foot and firmly tug until it is removed.
Remove remaining muscles from femur and tibia so that bone
is completely exposed. The entire leg will be removed. Place
intact bones in 70% ethanol and then in PBS (see Note 5).
5. Discard mouse and all excess tissues according to institutional
policy.
6. Weigh the liver- and spleen-containing petri dishes and calcu-
late organ weights.
7. To prepare a single cell suspension of the spleen, place a sterile
cell strainer in the petri dish, add 4 ml of complete RPMI cul-
ture medium and pass the tissue through the wire mesh with
the sterile plunger head of a 1-ml syringe. Disaggregate cells
by gently pipetting up and down several times using a 3 ml
294 Joana Tavares et al.
L. infantum
infected
mice
Target 2 B 2 B 2 B
4 C 4 C 4 C
oragans 8 D 1 2 3 4 5 6 7 8 9 10 11 12 8 8 D
Serial dilutions
D 1 2 3 4 5 6 7 8 9 10 11 12 1 2 3 4 5 6 7 8 9 10 11 12
A A A
16 E 16 E 16 E
colletion, 32 F
B
C
32 F
B
C
32 F
B
C
64 G 64 G 64 G
processing 128 H
D
E
A
1 2 3 4 5 6 7 8 9 10 11 12
128 H
D
E
A
1 2 3 4 5 6 7 8 9 10 11 12
128 H
D
E
A
1 2 3 4 5 6 7 8 9 10 11 12
and serial
B B B
F F F
C C C
G G G
dilutions H
D
E
H
D
E
H
D
... F
... F
... F
4194304 G
4194304 G
4194304 G
8389608 H
8388608 H
8388608 H
Analysis
Fig. 1 Workflow scheme for quantitative analysis of Leishmania infantum parasite loads in BALB/c mice using
the limiting dilution assay. Liver, spleen, and bone marrow of infected mice are collected, and tissue homog-
enates are prepared and twofold serial-diluted in microtitration plates. The plates are then incubated for
2 weeks at 27 °C. The wells are macroscopically (plates in the left) and then microscopically inspected for the
presence of promastigotes (representative photograph images on the right taken from wells (depicted with
dashed lines) showing high (green dashed line) and medium (red dashed line) density promastigote growth or
negative (blue dashed line)
3.2.2 Infection of Mice 1. Place the mice under an IR heat lamp for 5–10 min before
with Amastigotes injection of the parasites. The tail veins swell at high
temperature.
2. Inject the parasite suspension in the mouse tail vein.
3.2.3 Quantification 1. Prepare the in vivo imaging system for imaging the mice
of Parasite Burden (see Note 10).
2. For imaging visceral infection, anesthetize infected mice using
the isoflurane anesthesia system (see Note 11).
3. Prior to image acquisition remove the ventral fur with an
appropriate clipper. This must be done carefully as hematoma
might affect the imaging.
4. Inject 60 μl of d-luciferin substrate solution subcutaneously
into the neck of the anesthetized mice (see Note 12).
5. Transfer the mice to the 37 °C heated stage of the imaging
chamber and maintain anesthesia with 2.5% isoflurane. After a
5-min incubation allowing the distribution of the substrate in
the body, a 5-min signal acquisition controlled by the Living
Image software is initiated. After exposure is complete, the
overlay of the photographic and luminescent picture is dis-
played (see Fig. 2 for a representative image).
6. Animals are returned to their cages to recover from
anesthesia.
3.2.4 Image Analysis The quantitative assessment of the bioluminescent signal in the
regions encompassing target organs such as the liver and spleen can
be performed with the Living Image software as it enables the
quantification of the signal emanating from the specific areas of
interest (“region of interest,” ROI) [35, 36].
1. Select the image to analyze.
2. Define and adjust the regions of interest (ROI) encompassing
most of the ventral view of the animal body, liver, and spleen.
Multiple ROI of different sizes and shapes can be created.
Leishmania Infection in Mice 297
L. infantum
infected mice
D-luciferin injection
5 min
Imaging
5 min
Days
15 20 26 40
post-infection
nº treatments 0 4 10 10
Untreated
10000
Analysis
8000
6000
Treatment A
4000
Radiance
Treatment B
(p/sec/cm 2/sr)
Fig. 2 Workflow scheme for quantitative analysis of parasite loads in BALB/c mice infected with firefly
luciferase-expressing axenic amastigotes using whole-body in vivo imaging. Infected mice are injected with
d-luciferin subcutaneously in the neck and anesthetized with isoflurane for imaging with the IVIS Lumina
LT. The images show representative mice enrolled in a longitudinal study where animals remained either
untreated or treated (treatment A or B) during 10 consecutive days starting at day 15 postinfection. Animals
were imaged at the indicated time points
298 Joana Tavares et al.
4 Notes
Acknowledgments
References
6. Melby PC et al (2001) The hamster as a model 20. Tavares J et al (2012) Anti-leishmanial activity
of human visceral Leishmaniasis: progressive of the bisnaphthalimidopropyl derivatives.
disease and impaired generation of nitric oxide Parasitol Int 61:360–363
in the face of a prominent Th1-like cytokine 21. Pérez-Cabezas B et al (2016) Interleukin-27
response. J Immunol 166:1912–1920 early impacts Leishmania infantum infection in
7. Aslan H et al (2013) A new model of progres- mice and correlates with active visceral disease
sive visceral leishmaniasis in hamsters by natu- in humans. Front Immunol 7:478
ral transmission via bites of vector sand flies. 22. Nascimento MS et al (2016) NOD2-RIP2-
J Infect Dis 207:1328–1338 mediated signaling helps shape adaptive immu-
8. Loeuillet C et al (2016) Study of Leishmania nity in visceral leishmaniasis. J Infect Dis
pathogenesis in mice: experimental consider- 214:1647–1657
ations. Parasit Vectors 9:144 23. Arcanjo AF et al (2017) Toll-like receptor 2 is
9. Scott P, Novais FO (2016) Cutaneous leish- required for inflammatory process develop-
maniasis: immune responses in protection and ment during Leishmania infantum infection.
pathogenesis. Nat Rev Immunol 16:581–592 Front Microbiol 8:978
10. Leclercq V et al (1996) The outcome of the 24. Silvestre R et al (2007) SIR2-deficient
parasitic process initiated by Leishmania infan- Leishmania infantum induces a defined IFN-
tum in laboratory mice: a tissue-dependent gamma/IL-10 pattern that correlates with
pattern controlled by the Lsh and MHC loci. protection. J Immunol 179:3161–3170
J Immunol 157:4537–4545 25. Agallou M et al (2017) Identification of
11. Kaye PM, Beattie L (2016) Lessons from other BALB/c immune markers correlated with a
diseases: granulomatous inflammation in leish- partial protection to Leishmania infantum
maniasis. Semin Immunopathol 38:249–260 after vaccination with a rationally designed
12. Atayde VD (2015) Exosome secretion by the multi-epitope cysteine protease A peptide-
parasitic protozoan Leishmania within the sand based Nanovaccine. PLoS Negl Trop Dis
fly midgut. Cell Rep 13:957–967 11:e0005311
13. Gomes R, Oliveira F (2012) The immune 26. Banerjee A et al (2018) Live attenuated
response to sand fly salivary proteins and its Leishmania donovani centrin gene-deleted par-
influence on Leishmania immunity. Front asites induce IL-23-dependent IL-17-
Immunol 3:110 protective immune response against visceral
14. Rogers ME (2012) The role of Leishmania leishmaniasis in a murine model. J Immunol
proteophosphoglycans in sand fly transmission 200:163–176
and infection of the mammalian host. Front 27. Buffet PA et al (1995) Culture microtitration:
Microbiol 3:223 a sensitive method for quantifying Leishmania
15. Dey R et al (2018) Gut microbes egested dur- infantum in tissues of infected mice. Anti
ing bites of infected sand flies augment severity microb Agents Chemother 39:2167–2168
of leishmaniasis via inflammasome-derived 28. Nicolas L et al (2002) Real-time PCR for
IL-1β. Cell Host Microbe 23:134–143 detection and quantitation of Leishmania in
16. Sacks DL, Melby PC (2015) Animal models mouse tissues. J Clin Microbiol 40:
for the analysis of immune responses to leish- 1666–1669
maniasis. Curr Protoc Immunol 29. Cunha J et al (2013) Characterization of the
108:19.2.1–19.2.24 biology and infectivity of Leishmania infantum
17. Faria J et al (2016) Leishmania infantum viscerotropic and dermotropic strains isolated
asparagine synthetase a is dispensable for para- from HIV+ and HIV- patients in the murine
sites survival and infectivity. PLoS Negl Trop model of visceral leishmaniasis. Parasit Vectors
Dis 10:e0004365 6:122
18. Faria J et al (2016) Disclosing the essentiality 30. Moreira D et al (2015) Leishmania infantum
of ribose-5-phosphate isomerase B in modulates host macrophage mitochondrial
Trypanosomatids. Sci Rep 6:26937 metabolism by hijacking the SIRT1-AMPK
axis. PLoS Pathog 11:e1004684
19. Costa Lima SA et al (2012) Characterization
and evaluation of BNIPDaoct-loaded PLGA 31. Michel G et al (2011) Luciferase-expressing
nanoparticles for visceral leishmaniasis: in vitro Leishmania infantum allows the monitoring of
and in vivo studies. Nanomedicine (Lond) amastigote population size, in vivo, ex vivo and
7:1839–1849 in vitro. PLoS Negl Trop Dis 5:e1323
Leishmania Infection in Mice 301
32. Reimao JQ et al (2015) Generation of screening against Leishmania infantum: a reli-
luciferase-expressing Leishmania infantum able method to evaluate efficacy and optimize
chagasi and assessment of miltefosine efficacy treatment regimens. bioRxiv. https://doi.
in infected hamsters through bioimaging. org/10.1101/326355
PLoS Negl Trop Dis 9:e0003556 35. Sereno D et al (2001) DNA transformation of
33. Melo GD et al (2017) New insights into exper- Leishmania infantum axenic amastigotes and
imental visceral leishmaniasis: real-time in vivo their use in drug screening. Antimicrob Agents
imaging of Leishmania donovani virulence. Chemother 45:1168–1173
PLoS Negl Trop Dis 11:e0005924 36. Tavares J et al (2017) In vivo imaging of patho-
34. Costa DM et al (2018) Whole-mouse in vivo gen homing to the host tissues. Methods
bioluminescence imaging applied to drug 127:37–44
Chapter 17
Abstract
Animal models are needed along the development and evaluation of potential chemotherapeutic agents
against leishmaniasis. Infections of Syrian hamsters with Leishmania species causing visceral leishmaniasis
(VL) closely mimic the disease in the natural hosts, including target organs, lesions, and clinical course.
Therefore, despite some shortcomings (e.g., genetic background, price, and scarcity of reagents), it is
probably the best laboratory rodent model of VL. However, handling of hamsters can be technically chal-
lenging because of their particular anatomy. Here, we describe in detail four different routes to establish
an experimental VL in the hamster model using Leishmania promastigotes and amastigotes. Each route
requires various manipulations and has different benefits and drawbacks. Choice of the most suitable route
should be made by the researcher in accordance with the specific plan and purpose of the study.
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_17, © Springer Science+Business Media, LLC, part of Springer Nature 2019
303
304 María Dolores Jiménez-Antón et al.
2 Materials
3 Methods
3.1 Preparation 1. Collect cell cultures in sterile 50 mL Falcon tubes and centri-
of Promastigote fuge at 1000 × g for 10 min at RT. Discard supernatant from
Inoculum each tube, resuspend and pool the pellets obtained in the left-
over medium (ca. 5 mL/pellet) and centrifuge as above.
Repeat until all promastigotes are in a single tube.
2. To a 30 mL transparent conical-bottom tube, add carefully
Ficoll 30% (10 mL), Ficoll 10% (10 mL), and promastigote
culture suspension (10 mL). It is important to follow this
order (see Note 4).
3. Centrifuge at 365 × g for 10 min at RT without brake. Due to
their distinct shape and sedimentary properties [7, 15], meta-
cyclic promastigotes accumulate on top of the 10% Ficoll phase.
4. Discard most of the upper phase with a pipette. Collect the
interphase between cell suspension and 10% Ficoll containing
the metacyclic promastigote fraction. To assure maximum col-
lection of infective forms, small amounts from the adjacent
10% Ficoll layer (ca. 10%) can be included, since interphases
may contain cell forms too. Discard the tube with remaining
Ficoll 10% and Ficoll 30% phases.
5. Move the cell suspension to a clean tube and wash twice in
RPMI-1640 or HBSS by centrifugation at 1000 × g for 10 min
at RT to remove the Ficoll.
6. Wash the final pellet with sterile PBS by resuspending the pel-
let in 50 mL of PBS, centrifuge at 1000 × g for 10 min at RT,
306 María Dolores Jiménez-Antón et al.
Table 1
Specific material recommendations and notes for inoculation parameters for intraperitoneal (IP),
intracardiac (IC), retro-orbital (RO), and intradermic (ID) inoculation routes
IP IC RO ID
Inoculum size (cells/animal) 107–108 107–108 107–108 105–107
Syringe 1 mL or insulin syringe
Needle gauge 25 G 27–29 G 29–30 G 29–30 G
Inoculation volume < 2 mL ≤ 0.2 mL ≤ 0.2 mL ≤ 0.05 mL
3.2 Preparation 1. Spleen extract: Aseptically extract the whole spleen from a
of Amastigote euthanized natural or experimental host with an established
Inoculum Leishmania infection. Process always within 24 h after organ
extraction.
2. Cut the spleen into manipulable parts (Ø 3–4 cm) and homog-
enize in PBS (w/o Mg and Ca) +1% penicillin-streptomycin
(100 μg/mL) (PBS-pen-strep). For larger pieces use a glass
Tenbroeck tissue grinder or electric tissue homogenizer. Add
PBS-pen-strep to cover up the tissue sample (ca. 5 mL). For
small pieces (e.g., from mouse and hamster) it is possible to
pass them through a cell strainer set on a 6-well plate filled
with 5 mL PBS-pen-strep solution. Maintain organ pieces on
ice during processing (see Note 6).
3. Gather all suspensions obtained and centrifuge at 50 × g for
10 min at 4 °C and discard pellet to remove cell debris.
Centrifuge supernatant again at 1000 × g for 10 min at
4 °C. Discard supernatant.
Hamster Model for Visceral Leishmaniasis 307
7. Right after piercing the skin, slightly draw back the syringe
plunge to get negative pressure inside and enable to perceive
the cardiac approach.
8. At the moment that blood comes up in the needle hub or the
syringe, slowly inject half of the content. Without changing
the needle position, draw back the plunge again and, if right
position it is still confirmed, inject the remaining material.
9. Carefully withdraw the needle linearly.
10. Monitor animal health status after injection, including rhythm
and effort of breathing as well as proper recovery.
4 Notes
Acknowledgments
References
1. Nagle AS, Khare S, Kumar AB, Supek F, 11. Moreira N, Vitoriano-Souza J, Roatt BM,
Buchynskyy A, Mathison C, Chennamaneni Vieira PM, Ker HG, de Oliveira Cardoso JM,
NK, Pendem N, Buckner FS, Gelb MH, Giunchetti RC, Carneiro CM, de Lana M, Reis
Molteni V (2014) Recent developments in AB (2012) Parasite burden in hamsters infected
drug discovery for Leishmaniasis and human with two different strains of Leishmania
African Trypanosomiasis. Chem Rev (Leishmania) infantum: “Leishman Donovan
114(22):11305–11347 units” versus real-time PCR. PLoS One
2. World Health Organization (2010) Control of 7(10):e47907
Leishmaniases. Technol Rep Ser 949:1–186 12. Wyllie S, Fairlamb AH (2006) Refinement
3. Corral-Caridad MJ, Alunda JM (2013) of techniques for the propagation of Leishma
Chemotherapy of leishmaniasis: a veterinary nia donovani in hamsters. Acta Trop 97:
perspective. In: Jäger T, Koch O, Flohé L (eds) 364–369
Trypanosomatid diseases. Molecular routes to 13. Moreira ND, Vitoriano-Souza J, Roatt BM,
drug discovery. Wiley-VCH, Weinheim, Vieira PM, Coura-Vital W, Cardoso JM,
pp 17–36 Rezende MT, Ker HG, Giunchetti RC,
4. Nishi GS (2011) Visceral leishmaniasis: experi- Carneiro CM, Reis AB (2016) Clinical, hema-
mental models for drug discovery. Indian tological and biochemical alterations in ham-
J Med Res 133(1):27–39 ster (Mesocricetus auratus) experimentally
5. Hommel M, Jaffe CL, Travi B, Milon G (1995) infected with Leishmania infantum through
Experimental models for leishmaniasis and for different routes of inoculation. Parasit Vectors
testing anti-leishmanial vaccines. Ann Trop 31(9):181
Med Parasitol 89(Suppl 1):55–73 14. Kaur S, Kaur T, Garg N, Mukherjee S, Raina P,
6. Melby PC, Chandrasekar B, Zhao W, Coe JE Athokpam V (2008) Effect of dose and route
(2001) The hamster as a model of human vis- of inoculation on the generation of CD4+
ceral Leishmaniasis: progressive disease and Th1/Th2 type of immune response in murine
impaired generation of nitric oxide in the face visceral leishmaniasis. Parasitol Res 103:1413
of a prominent Th1-like cytokine response. 15. Spath GF, Beverley SM (2001) A
J Immunol 166:1912–1920 lipophosphoglycan- independent method for
7. Sacks DL, Perkins PV (1984) Identification of isolation of infective Leishmania metacyclic
an infective stage of Leishmania promastigotes. promastigotes by density gradient centrifuga-
Science 223(4643):1417–1419 tion. Exp Parasitol 99:97–103
8. Bates PA (1993) Complete developmental 16. Lei SM, Romine NM, Beetham JK (2010)
cycle of Leishmania mexicana in axenic culture. Population changes in Leishmania chagasi pro-
Parasitology 108:1–9 mastigote developmental stages due to serial
passage. J Parasitol 96(6):1134–1138
9. Gonzaga M, Laranjeira MF, Andrade R,
Marino R, Floeter-Winter LM (2011) 17. Flecknell P, Lofgren J, Dyson M, Marini R,
Correlation of meta 1 expression with culture Swindle M (2015) Preanesthesia, Anesthesia,
stage, cell morphology and infectivity in analgesia and euthanasia. In: Fox JG (ed)
Leishmania (Leishmania) amazonensis promas- Laboratory animal medicine. Academic Press-
tigotes. Mem Inst Oswaldo Cruz Elsevier, London, pp 1135–1200
106(2):190–193 18. U.S. Department of Health and Human
10. Silva AM, Cordeiro-da-Silva A, Coombs GH Services (2009) Section VIII-C: parasitic
(2011) Metabolic variation during develop- agents. In: Biosafety in microbiological and
ment in culture of Leishmania donovani pro- biomedical laboratories. HHS Publication No.
mastigotes. PLoS Negl Trop Dis 5(12):e1451 (CDC) 21–1112: 182–194
Chapter 18
Abstract
Experimental cutaneous leishmaniasis of mice is a valuable model to study the immune response to the
protozoan pathogen Leishmania and to define mechanisms of parasite control and resolution of inflamma-
tion as well as of parasite evasion and chronicity of disease. In addition, over many years Leishmania-
infected mice have been successfully used to analyze the function of newly discovered immune cell types,
transcription factors, cytokines, and effector mechanisms in vivo. In this chapter we present detailed pro-
tocols for the culture, propagation, and inoculation of Leishmania promastigotes, the monitoring of the
course of cutaneous infection, the determination of the tissue parasite burden and for the phenotyping of
the ensuing immune response. The focus lies on the L. major mouse model, but an overview on other
established models of murine cutaneous leishmaniasis is also provided.
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_18, © Springer Science+Business Media, LLC, part of Springer Nature 2019
315
316 Christian Bogdan et al.
(continued)
317
Table 1
318
(continued)
L. L. tropicab MHOM/AF/88/KK27 high, s.c.c BALB/c, C57BL/6 Nonulcerative, nonprogressing, Acute, prolonged, [91, 92]
or low, long-lasting skin lesions ultimately self-
i.d.d healing CL
Christian Bogdan et al.
High, s.c.g Swiss albino Nonhealing skin lesion → skin Chronic, nonhealing [93]
(rump) metastases, visceralization CL with
disseminated
lesions; viscerotropic
CL, VL
L. L. mexicana MNYC/BZ/62/M379, low, i.d.d BALB/c Nonhealing, progressive skin Chronic nonhealing [19, 38,
MHOM/BZ/82/BEL21 lesion (± metastases) CL with 94, 95]
disseminated lesions
(DCL)
low, i.d.d C57BL/6, CBA/Ca Healing or nonhealing (slowly Acute, self-healing [19, 38,
progressing) skin lesion CL; chronic 94–97]
nonhealing CL
L. L. IFLA/BR/67/PH8 low, i.d.d BALB/c, C57BL/6, Nonhealing, progressive skin Chronic nonhealing [20, 98,
amazonensis MHOM/BR/00/ or high, C57BL/10 lesion CL 99]
LTB0016 s.c.
MPRO/BR/1972/
M1841
L. Viannia MAN/BR/79/LTB-111 high, s.c.c C57BL/6, BALB/c Small, nonulcerative, self- Acute, self-healing CL [100–104]
braziliensis MHOM/BR/75/ or healing skin lesion
M2903 low, i.d.d
MHOM/BR/01/BA788
MHOM/
BR/94/H-3227
L. Viannia WHI/BR/78/M5313 high, s.c.c C57BL/6 Nonulcerative, self-healing Acute, self-healing CL [105, 106]
guyanensis MHOM/BR/75/ lesion (more severe if parasites (± distant skin
M4147 carry Leishmaniavirus LRV1) metastases)
a
Formerly termed L. tropica major
b
Formerly termed L. tropica minor
c
High dose: mice were subcutaneously (s.c.) inoculated into the footpad; parasite dose ranged from 1–5 × 105 and 1–3 × 106 to 1–2 × 107 (in most cases stationary-phase pro-
mastigotes were used, sometimes purified metacyclic parasites)
d
Low dose: mice were intradermally (i.d.) inoculated into ear skin; parasite numbers ranged from 10 to 1000 (in most cases, 1000 metacyclic promastigotes were injected)
e
Low dose: mice were s.c. inoculated into the footpad using stationary-phase parasites; parasite numbers ranged from 100 to 104
f
High dose: mice were s.c. infected into the footpad with 2 × 106 L. major amastigotes
g
High dose: mice were s.c. infected in the dorsal skin of the rump with 1 × 105 metacyclic L. major promastigotes
Mouse Cutaneous Leishmaniasis
319
320 Christian Bogdan et al.
2 Materials
2.1 General Remarks 1. All solutions, buffers, and media used for cell cultures will be
prepared with ultrapure, deionized water (minimum resistance
>18 MΩ, total organic content <5 ppm; derived from a
Millipore Merck water purification system [e.g., Milli-Q-
Biocel]), are autoclaved or subjected to sterile filtration (pore
size 0.2 mm) and need to be tested for their endotoxin (i.e.,
lipopolysaccharide [LPS]) content using a colorimetric Limulus
amebocyte lysate-assay (QCL-1000, Lonza Inc., Verviers,
Belgium; cat. no. 50-647 U). Alternatively, they are purchased
as sterile ready-to-use cell culture-tested products certified to
be endotoxin-free.
2. All instruments used for preparing these solutions, buffers and
media (e.g., glass cylinders, bottles, magnetic stirring bars,
spatulas) need to be endotoxin-free (achieved by baking for
2 h at 200 °C). The final LPS concentration of all buffers and
media in contact with Leishmania parasites or immune cells
should not exceed 10 pg/mL (<0.1 endotoxin unit/mL).
2.2.2 Biphasic Novy– The basic version of this medium used for growing Leishmania
Nicolle–McNeal (NNN) parasites was originally published by Charles Nicolle in 1908
Rabbit Blood Agar Slants [68, 69].
in 96 Well Plates
2.2.2.1 Components (for 1. 200 mL Brain Heart Infusion agar (consisting of 7.4 g Bacto™
300 mL Agar) Brain Heart Infusion [Becton Dickinson cat. no. 237500] and
3 g Bacto™ agar [Becton Dickinson cat. no. 214040] ad
200 mL ultrapure endotoxin-free water; boiled while stirring
until completely dissolved; pH adjusted to 7.4 ± 0.2 with 1 M
NaOH; autoclaved for 15 min. at 121 °C) (see Note 1).
2. 50 mL 0.9% sodium chloride solution (autoclaved or sterile
filtered).
3. 50 mL defibrinated rabbit blood (controlled for sterility).
4. 0.3 mL penicillin G (60 mg/mL; sterile filtered).
5. 0.3 mL streptomycin (100 mg/mL; sterile filtered).
322 Christian Bogdan et al.
2.2.2.2 Preparation 1. Place bottle with autoclaved BHI agar on magnetic stirrer and
adjust temperature to approximately 50 °C.
2. Add the ingredients listed above while stirring. Keep the com-
plete NNN-agar in a 42 °C water bath.
3. Pour the agar in portions into a preheated glass petri dish
(42 °C; diameter ca. 15 cm) with stirring bar, which has been
placed on a heated magnetic stirrer in a laminar airflow
cabinet.
4. Using an 8-channel pipette transfer 50 μL/well of the NNN-
agar in sterile 96-well flat-bottomed tissue culture plates with
lids that are placed on an oblique (45°) metal stand.
5. Once the agar has solidified, the plates are taken from the
stand, tightly wrapped in plastic bags (to avoid dehydration
and shrinkage of the agar slants) and stored at 4 °C with the
lids facing the bottom. The plates can be stored for
≤3 months.
6. An aliquot of the NNN-agar is subjected to sterility control
(cultures for aerobic and anaerobic bacteria as well as fungi).
2.2.3 Monophasic The use of Schneider’s drosophila or insect medium for the growth
Complete Modified of Leishmania was first described in 1981 [70]. Subsequently, the
Schneider’s Drosophila medium was modified and enriched by the addition of human
Medium (cmSDM) urine and an amino acid cocktail [71, 72].
Table 2
Composition of the 25 × AAP-solution
mL or g Final concentration of
Component Concentration of stock added 25 × solution
100 × penicillin G/ 10,000 U/mL (= 6 mg/L) 50 mL 2500 U/mL (= 1.5 mg/mL)
streptomycin solution (e.g., PenG, 10 mg/mL PenG, 2.5 mg/mL
Sigma-Aldrich P4333) streptomycin streptomycin
100 × sodium pyruvate solution 100 mM 50 mL 25 mM
(e.g., Sigma-Aldrich 3662)
100 × l-glutamine solution 200 mM 50 mL 50 mM
(e.g., Biochrom GmbH,
K0282)
DMEM-medium w/o phenol 50 mL
red (e.g., Sigma-Aldrich no.
D5921)
L-asparagine (free base; e.g., 0.18 g 0.9 g/L (= 6.8 mM)
Calbiochem no. 1860)
L-arginine HCl (e.g., Sigma- 0.58 g 2.9 g/L (= 13.76 mM)
Aldrich no. A5131)
Total volume 200 mLa
a
Stir at room temperature for ca. 1 h until a clear solution is obtained. Sterile filter (0.22 μm), prepare 10 mL aliquots
and store at −20° or − 70 °C (do not store at 4 °C!)
Table 3
Composition of the complete modified Schneider’s drosophila medium
(cmSDM)a
weeks old. Sex [42–45] and age [46–48] of the mice have an
influence on the course of infection.
3. Mouse injection chamber (used for restraining the mice during
the foot injection procedure; e.g., ZOONLAB GmbH
Castrop-Rauxel, Germany, cat. no. IK-M).
4. Tuberculin syringe (1 mL).
5. Disposable hypodermic injection needles (27 G).
6. Sterile microcentrifuge (2 mL) or centrifuge tubes (5 mL).
2.5 Clinical Course 1. Metric caliper Oditest® (mechanical external measuring gauge;
of Infection scale interval 0.01 mm; measuring force ≤1.75 N) (Kroeplin,
D-36381 Schlüchtern/Germany; cat. no. S5010 or D110T).
2. Scales (range 0–100 g; accuracy 0.01 mg).
19. Free software Lcalc™ version 1.1 for limiting dilution analysis
(STEMCELL Technologies GmbH, Cologne, Germany; com-
pany offers no updates or technical support; https://www.
stemcell.com/products/product-types/
instruments/l-calc-software.html).
2.7 Immunopheno- 1. Sterilized tweezers and pairs of scissors for the preparation of
typing mouse tissues (e.g., skin lesion, draining pLN, spleen).
2.7.1 mRNA Analyses 2. TRIzol® (Thermo Fisher Scientific) or TRIzol® equivalent
(e.g., TriFast, VWR International).
2.7.1.1 Preparation
3. Chloroform.
of Total RNA from Infected
Organs 4. Isopropanol.
5. 75% (v/v) ethanol prepared with ultrapure sterile water.
6. Ultrapure sterile water (DNAse-, RNAse-, and endotoxin-free;
Biochrom, cat. no. L0020).
7. 2 mL sterile polypropylene tubes.
8. Bench centrifuge.
9. Stainless steel beads (diameter 3 mm; Max Lamb GmbH &
CoKG, Würzburg, Germany; https://www.lamb.de).
10. Tissue homogenizer (e.g., Tissue Lyser Qiagen).
2.7.1.2 cDNA Synthesis 1. High capacity cDNA Reverse Transcription Kit (Thermo
Fisher Scientific; cat. no. 4368813).
2. Ultrapure sterile water (Biochrom, cat. no. L0020).
3. 0.2 mL sterile polypropylene tubes.
4. PCR machine.
2.7.2 Flow Cytometry 1. Sterilized tweezers and pairs of scissors for the preparation of
and Intracellular Cytokine mouse tissues (e.g., skin lesion, pLN, spleen).
Staining of Immune Cells 2. RPMI1640 cell culture medium without any supplements.
2.7.2.1 Preparation 3. Collagenase P (Roche).
of Single Cell Suspensions 4. DNAse I (Roche).
5. Percoll (GE Healthcare, Cat No 17-0891-01).
6. Hanks’ balanced salt solution (HBSS; Sigma-Aldrich).
Mouse Cutaneous Leishmaniasis 327
2.7.2.3 Intracellular 1. Complete RPMI medium with supplements and 10% FCS (see
Cytokine Staining Subheading 2.2.1, item 5).
2. Brefeldin A (Sigma-Aldrich).
3. Phorbol myristate acetate (PMA, Sigma-Aldrich).
4. Ionomycin (Sigma-Aldrich).
5. Fluorochrome-labeled cytokine- or effector molecule-specific
antibodies (e.g., Biolegend, BD Biosciences, Miltenyi, Thermo
Fisher Scientific).
6. Cytofix/Cytoperm™ solution (BD Biosciences, cat. no.
51-2090KZ).
7. Saponin buffer: PBS/2% FCS/0.5% saponin (Sigma-Aldrich).
8. FACS staining buffer: PBS with 1% FCS and 2 mM EDTA.
9. 5 mL polystyrene or polypropylene tubes.
10. Sterile 96-well round-bottom tissue culture plates.
2.7.3 Restimulation of T 1. Sterilized tweezers and pairs of scissors for the preparation of
Lymphocytes pLNs and spleen.
2. Complete RPMI medium with supplements and 10% FCS (see
Subheading 2.2.1, item 5).
328 Christian Bogdan et al.
3 Methods
3.1 General Remarks 1. When handling L. major parasites or infected organs, prepar-
ing amastigotes, or infecting mice, always wear lab coat, gloves
3.1.1 Important Remarks
and goggles.
on Lab Safety
2. When handling chloroform or phenol-containing TRIzol®,
always work in a fume hood and wear lab coat, gloves, and
goggles to protect yourself from toxic fumes and/or skin and
eye burns.
3.1.2 Important Remarks 1. All cell culture procedures need to be performed in a laminar
on General Lab Practice airflow cabinet using sterile aseptic techniques.
2. All cultures of L. major parasites (i.e., maintenance of promas-
tigotes, generation of promastigotes from infected tissues or
purified amastigotes) are routinely kept at (26-)28 °C with 5%
CO2 and 95% humidified air.
3. All cultures of mouse immune cells are routinely kept at 37 °C
with 5% CO2 and 95% humidified air.
4. When preparing total RNA from tissues or cells, always wear
gloves to avoid contamination with skin-derived RNases. All
plasticware, reagents, buffers and solutions need to be molecu-
lar biology grade, RNase- and DNase-free and reserved for
RNA work only. Glassware, spatulas, tweezers, and scissors are
baked at 200 °C for at least 2 h.
3.2.3 In Vitro Passaging 1. For in vivo infection experiments and long-term maintenance:
of L. major Promastigotes (a) The parasites are kept in 96-well flat-bottomed plates with
NNN-rabbit blood agar slants and 100 μL/well RPMI1640
with 10% FCS.
(b) Cultures are split 1: 200 (or higher) on a weekly basis.
(c) After a maximum of six consecutive in vitro passages, a
new stock of L. major promastigotes is obtained from
lesional amastigotes (see Subheading 3.3) or a new aliquot
of a previously frozen large stock of an early NNN-blood
agar passage of L. major promastigotes is thawed to ascer-
tain the infectivity of the promastigotes.
2. For short-term expansion (e.g., for in vitro infection experi-
ments, biochemical or molecular biological experiments):
A small aliquot of stationary-phase L. major promastigotes
from a NNN-blood agar culture is transferred into a 96-well
flat-bottomed plate or a 25 cm2 tissue culture flask with cmSDM
and allowed to grow for 5–6 days until the stationary growth-
phase is reached.
330 Christian Bogdan et al.
3.5 Clinical Course The clinical course of L. major infection is followed by (a) measur-
of Infection ing the thickness of the infected foot and of the contralateral unin-
fected foot (once or twice weekly) and by (b) determining the
body weight of the mice (weekly).
1. Perform the measurements at day 0 (immediately prior to
infection) and then at day 3, 7, 10, 14, 17, 21, 24, 28 etc. after
L. major infection.
2. Put mouse into restrainer which allows free access to the lower
leg and foot.
3. Measure the maximal thickness of the foot lesion using a
mechanical metric caliper (see Note 9) and determine the body
weight of the mice (see Note 10).
4. Calculate for each day the relative increase of the foot thickness
(see Note 11):
% thickness increase = ({infected foot [ mm ] - uninfected foot [ mm ]}
¸ uninfected foot [ mm ]) ´ 100
3.6 Tissue 1. L. major-infected mice with nonulcerated foot lesion are euth-
Parasite Burden anized according to approved animal protocols.
3.6.1 Removal of Organs 2. Carefully disinfect the entire mouse corpse with 70% ethanol.
and Preparation of Tissue
Homogenates
3.6.1.1 Skin Lesion 1. Aseptically remove the infected foot below the ankle, cut off
the toes and weigh the foot.
2. Transfer into 15 mL polypropylene tube with 10 mL sterile
PBS and put on ice.
3. Pour the PBS with the mouse foot onto a sterilized metal sieve
that was placed into a sterile polystyrene petri dish.
4. Using sterile tweezers and a pair of scissors carefully cut the
foot into small pieces.
5. Mince the pieces of tissue with the plunger of a 10 mL syringe
and pass them through the sieve. Rinse with additional 10 mL
sterile PBS.
6. Harvest the cell suspension from the petri dish and transfer in
a 50 mL polypropylene tube.
332 Christian Bogdan et al.
3.6.1.2 Draining Popliteal 1. Remove the skin from the lower extremities of the L. major-
Lymph Node (pLN) infected mouse, bluntly prepare the fossa poplitea and remove
the draining pLN.
2. Transfer the pLN into a sterile microcentrifuge tube filled with
1 mL PBS and predetermined tare weight.
3. Weigh the tube with the pLN and thereby determine the
weight of the pLN.
4. Empty the microcentrifuge tube with the pLN on a 100 μm
cell strainer placed on top of a 50 mL polypropylene tube.
5. Using the plunger of a 2 mL syringe pass the pLN through a
100 μm cell strainer and flush the cell strainer with 15 mL PBS.
6. Centrifuge the cell suspension at 3400 × g and 4 °C for 10 min
(see Note 12).
7. Resuspend the cell pellet in 3 mL PBS and determine the cell
number per mL with a regular Neubauer counting chamber
(depth 0.1 mm) (see Note 13).
8. Prepare 3 mL of a pLN suspension in cmSDM with a cell
concentration of 1 × 106/mL (or lower depending on the
time-point of infection and the size of the pLN). The remain-
der of the original pLN cell suspension in PBS can be used for
immunophenotyping (see Subheading 3.7).
3.6.1.3 Spleen 1. Remove the skin from the abdomen of the sacrificed L. major-
infected mouse.
2. Cut the peritoneum on the left-lateral side and resect the entire
spleen.
3. Transfer the spleen into a sterile microcentrifuge tube filled
with 1 mL PBS and predetermined tare weight.
4. Weigh the tube with the spleen and thereby determine the
weight of the spleen (see Note 14).
5. Empty the microcentrifuge tube with the spleen on a 100 μm
cell strainer placed on top of a 50 mL polypropylene tube.
6. Using the plunger of a 2 mL syringe pass the spleen through a
100 μm cell strainer and flush the cell strainer with 15 mL PBS.
7. Centrifuge the cell suspension at 3400 × g and 4 °C for 10 min
(see Note 12).
8. Resuspend the cell pellet in 5 mL erythrocyte lysis puffer
(37 °C) and leave at room temperature for exactly 5 min.
9. Stop the lysis by adding at least 30 mL PBS.
Mouse Cutaneous Leishmaniasis 333
10. Centrifuge the cell suspension at 3400 × g and 4 °C for 10 min
(see Note 12).
11. Determine the cell number per mL with a regular Neubauer
counting chamber (see Note 13).
12. Prepare 3 mL of a spleen suspension in cmSDM with a cell
concentration of 1 × 107/mL (or lower depending on the
time-point of infection and the size of the spleen). The remain-
der of the original spleen cell suspension in PBS can be used
for immunophenotyping (see Subheading 3.7).
3.6.2 Limiting Dilution The parasite load in the tissues (skin, pLN, spleen) will be deter-
(LD) Analysis mined by classical LD analysis adapting previously published
protocols and statistical methods [76, 77]. The procedure entails
16 or 24 serial 1:2, 1:3, or 1:5 dilutions with at least 12 replicates
per dilution step in cmSDM, depending on the mouse strain, the
organ and the time-point of infection (Table 4).
1. Prepare serial 1:2, 1:3, or 1:5 dilutions of the original tissue
suspension (3 mL) in cmSDM using 5 mL polystyrene tubes
(see Note 15).
2. Using a repeating pipette, seed 12 wells of a 96 well flat-bot-
tomed plate with 100 μL of each dilution. Start with the highest
dilution first, which makes changing of pipette tips dispensable.
Carefully avoid spill-overs into neighboring wells.
3. Incubate the plates at 28 °C/5%CO2/95% humidified air for
10–14 days.
4. Read the plates in a 96 well-plate photometer (ELISA reader)
at 450 nm. Wells with dense parasite growth, but also with
high host cell numbers, will have a “positive” OD value.
5. Microscopically scrutinize all wells for the presence of L. major
promastigotes, which were read as “positive” (due to high host
Table 4
Parameters for LD analysis of different organs and mouse strains after L. major infection
Skin Skin
lesion pLN Spleen lesion pLN Spleen
Starting concentration of n.a.a 1 × 106/mL 1 × 107/mL n.a. 1 × 106/mL 1 × 107/mL
cell suspension
Dilution factor 1:3 1:3 1:2 1:5 1:5 1:3
No. of dilution steps 16–24 16–24 16 24 24 24
n.a not applicable
a
334 Christian Bogdan et al.
3.7.1.1 Preparation 1. Mice are euthanized according to the animal protocol and
of Total RNA from Infected thoroughly disinfected with 70% ethanol. Please note general
Organs lab practice and safety remarks (see Subheading 3.1).
2. Prepare the organs of interest (cut lesional skin without ten-
dons and bones into small pieces; at least one complete pLN;
one eighth to one half of the spleen) with tweezers and pairs of
scissors.
3. Place the tissue immediately into sterile 2 mL tubes filled with
1 mL of TRIzol® (or equivalent reagent). Alternatively, if RNA
extraction is postponed, put the tissue samples into empty tubes,
immediately freeze in liquid nitrogen and store at −80 °C.
Mouse Cutaneous Leishmaniasis 335
3.7.1.2 cDNA Synthesis 1. Depending on the RNA yield reverse transcribe 1–10 μg of
total RNA into cDNA following the instructions of the High
Capacity cDNA reverse transcription kit (see Note 18).
2. Total RNA solution (1–10 μg) is mixed at a 1:1 ratio with the
RT (reverse transcription)-PCR master mix containing the
reverse transcriptase enzyme, nucleotides, and random primers
in 2 × RT-PCR buffer.
3. RT-PCR is performed with the following cycle conditions:
10 min at 25 °C, 120 min at 37 °C.
3.7.2 Flow-Cytometric 1. Prepare skin lesion tissue without bones and toes, draining
Characterization pLN and/or (a piece of the) spleen and transfer the tissue
of Immune Cells sample(s) into sterile microcentrifuge tube(s) kept on ice.
3.7.2.1 Preparation 2. For generation of single cell suspensions from draining pLN or
of Single Cell Suspensions spleens: proceed as detailed in Subheading 3.6.1.2 (steps 1–5)
and Subheading 3.6.1.3 (steps 1–6).
3. For generation of single cell suspensions from skin lesions (see
Note 22):
(a) Cut the tissue in small pieces and suspend them in 1 mL
RPMI1640 containing 200 μg/mL collagenase P and
100 μg/mL DNAse I.
(b) Place the tube containing the tissue fragments in a 37 °C
shaker for 45 min.
(c) Transfer the digested tissue to a 100 μm cell strainer placed
on top of a 50 mL polypropylene tube.
(d)
Using the plunger of a 2 mL syringe pass the tissue
through the cell strainer and flush the cell strainer with
10 mL PBS.
4. Centrifuge the skin, pLN or spleen cell suspension at 350 × g
and 4 °C for 10 min.
5. Draining pLN: determine the cell number with a regular
Neubauer counting chamber (see Note 13).
6. Spleen: Perform red blood cell lysis (see Subheading 3.6.1.3,
steps 8–10, but centrifuge with 350 × g and 4 °C for 10 min.)
prior to cell counting.
Mouse Cutaneous Leishmaniasis 337
7. Skin lesion:
(a) Resuspend cell pellet in 2.5 mL 40% Percoll (50 mL prep-
aration: 20 mL Percoll stock solution, 2.2 mL 10× PBS,
27.8 mL HBSS) and carefully transfer it onto a 1.5 mL
60% Percoll (50 mL preparation: 30 mL Percoll, 3.3 mL
10× PBS, 16.7 mL HBSS) in 5 mL polystyrene tubes to
remove cell debris from the suspension.
(b)
Centrifuge with slow acceleration and without brake
(930 × g, 20 min, room temperature!).
(c) Carefully remove the gradient from the centrifuge.
(d) Gently take off the debris on top of the 40% layer with a
pipette and discard it.
(e) Transfer the cell layer at the interphase of 40% and 60% to
a new 50 mL tube filled with 20 mL 1× PBS.
(f) Centrifuge the cells (350 × g, 10 min, 4 °C) and determine
the cell number.
3.7.2.2 Staining 1. Design a detailed staining protocol and make yourself familiar
of Cell-Specific Surface with the basic principles of flow cytometry using available
Molecules reviews [78] (see Note 23).
2. Use 1–2 × 106 cells in 100 μL PBS in a 5 mL tube per
staining.
3. Add fixable viability dye (FVD) at a final dilution of 1:1000.
4. Mix cells by gentle vortexing.
5. Incubate for 20 min in the dark at 4 °C. In case you use other
cell viability dyes optimal concentration has to be determined
before.
6. Wash cells with cold FACS staining buffer and centrifuge at
350 × g and 4 °C for 6 min.
7. Pour off supernatant which usually leaves a residual volume of
approximately 100 μL sufficient to resuspend the cell pellet.
8. Add 2 μL of rat anti-mouse CD16/32 antibodies (Fc Block,
concentration 0.5 mg/mL) (see Note 24).
9. Incubate at room temperature for 5 min.
10. Add your mix of fluorochrome-labeled antibodies (see Note 25).
11. Mix cells by gentle vortexing and incubate for 20 min in the
dark at 4 °C.
12. Wash cells as mentioned above.
13. If your antibody mix contains a biotin-labeled antibody, proceed
with a second staining using fluorochrome-labeled streptavidin.
14. Wash cells as mentioned above.
15. Pass the stained cells through a nylon mesh (100 μm) to avoid
clogging during acquisition at the flow cytometer.
338 Christian Bogdan et al.
3.7.3 Restimulation of T 1. Prepare pLN and spleen single cell suspensions as described in
Lymphocytes Subheading 3.7.2.1.
2. Seed pLN and spleen cells in round bottom 96-well plates in
complete RPMI medium (total volume per well 250 μL, cell
number per well 1–2.5–5 × 105).
Mouse Cutaneous Leishmaniasis 339
3. Stimulate the T cells within the culture (a) by the T cell recep-
tor-crosslinking lectin ConA (2.5 μg/mL) and (b) in a
Leishmania antigen-specific manner by adding ft. L. major
lysate in a parasite–cell ratio of 5:1 (important: briefly vortex
the ft. lysate just before use to ascertain homogenous suspension
of the lysed parasites). Instead of using ConA the T cells can
also be stimulated with plate-bound anti-CD3ε (see Note 28).
Set up the cultures in triplicates for all conditions.
4. Incubate the cells for 72 h at 37 °C, 95% humidified air and 5%
CO2.
5. Collect the cell culture supernatant after 24 to 72 h.
6. Test the cell culture supernatant for the content of T cell
derived cytokines such as IFN-γ (Th1), TNF (Th1), IL-4
(Th2) and/or IL-10 (Th2, regulatory T cells) with the help of
commercially available ELISAs or a bead-based immunoassay
that simultaneously detects several cytokines.
4 Notes
Table 5
Possible sites of infection in mouse cutaneous leishmaniasis
15. Important: (a) Change pipette tips after each dilution step to
prevent carry-over of parasites from lower to higher dilution
steps. (b) The minimum final volume per dilution should be
1.5 mL (sufficient for seeding 12 replicates with 100 μL each).
16. We recommend the DNAfree® DNA removal kit from Thermo
Fisher Scientific (cat. no. AM1906), because after the digest
DNAse is not inhibited by adding EDTA, which might inter-
fere with the subsequent qPCR reaction.
17. Complete digestion of genomic DNA can be verified by the
absence of mouse β-actin DNA amplification in a conventional
PCR reaction using 1 μL of the digested RNA sample as tem-
plate (95 °C for 5 min, 35 cycles of 95 °C 30 s, 58 °C 30 s and
72 °C 30 s; sense primer: 5′-CACCCGCCACCAGTTC
GCCA-3′; antisense primer: 5′-CAGGTCCCGGCCAG
CCAGGT-3′).
18. We recommend this kit, because cDNA synthesis is done with
random hexamer primers that cover the entire length of the
mRNA transcripts rather than the 3′-end of mRNA transcripts
as it is the case with oligo-dT primers often used in cDNA
synthesis. Another advantage is that the cDNA yield can be
scaled up to 10 μg per reaction.
19. The quantification of a target gene within the cDNA prepara-
tion is based on its amplification in a PCR reaction with gene-
specific primers that is monitored “in real time” by generation
of a fluorescent signal during each PCR cycle. The higher the
starting copy number of the gene of interest is, the sooner a
significant increase of the fluorescence signal will become
detectable. The fluorescence signal may be released by two dif-
ferent strategies, the SYBR® Green or the TaqMan™-based
chemistry. The SYBR® Green I dye binds to each new copy of
double-stranded DNA as soon it is formed during the gene-
specific PCR, resulting in a gain of fluorescence intensity pro-
portional to the amount of PCR product generated. In
contrast, in TaqMan™ technology a gene-specific probe
labelled with a reporter dye at the 5′ end, whose fluorescence
is extinguished by the nearby quencher dye fixed to the 3′ end
of the probe, anneals downstream from one of the primer sites.
During PCR reaction the reporter dye is cleaved by the 5′
nuclease activity of the Taq polymerase enzyme and the
reporter fluorescence becomes detectable as the quencher is
now separated from the reporter and is therefore no longer
able to inhibit its signal. During each PCR cycle additional
reporter dye molecules will be cleaved and enhance the fluo-
rescence intensity proportional to the amplified gene product.
Due to the higher specificity we prefer to use the TaqMan™
based qPCR system.
Mouse Cutaneous Leishmaniasis 343
Acknowledgments
References
1. Rittig MC, Bogdan C (2000) Leishmania- resources/Leishmaniasis_worldwide_epide-
host cell interaction: complexities and alterna- miological_and_drug_access_update.pdf.
tive views. Parasitol Today 16:292–297 Accessed May 30 2012
2. Kaye P, Scott P (2011) Leishmaniasis: com- 6. Steverding D (2017) The history of leishman-
plexity at the host-pathogen interface. Nat iasis. Parasit Vectors 10(1):82. https://doi.
Rev Microbiol 9(8):604–615 org/10.1186/s13071-017-2028-5
3. Bogdan C (2012) Leishmaniasis in rheumatol- 7. Bayon H (1912) Demonstration of specimens
ogy, hematology, and oncology: epidemiologi- relating to the transmission of artificial cul-
cal, immunological, and clinical aspects and tures of Leishmania infantum to mice and
caveats. Ann Rheum Dis 71(suppl 2):i60–i66 rats. Brit Med J 2(2705):1197–1199
4. Banuls AL, Bastien P, Pomares C, Arevalo J, 8. Philippe E, Chadli A (1961) Experimental
Fisa R, Hide M (2011) Clinical pleiomor- leishmaniasis in the mouse (Leishmania don-
phism in human leishmaniases, with special ovani and Leishmania tropica). Arch Inst
mention of asymptomatic infection. Clin Pasteur Tunis 38:241–254
Microbiol Infect 17(10):1451–1461 9. Kellina OI (1973) Differences of susceptibil-
5. Leishmaniasis: worldwide epidemiological ity of inbred mice of different strains to
and drug access update (2012) WHO. Leishmania tropica major. Med Parazitol
h t t p : / / w w w. w h o . i n t / l e i s h m a n i a s i s / Parazit Bolezni 42:279
Mouse Cutaneous Leishmaniasis 345
10. Handman E, Ceredig R, Mitchell GF (1979) 22. da Silva R, Sacks DL (1987) Metacyclogenesis
Murine cutaneous leishmaniasis: disease pat- is a major determinant of Leishmania promas-
terns in intact and nude mice of various geno- tigote virulence and attenuation. Infect
types and examination of some differences Immun 55(11):2802–2806
between normal and infected macrophages. 23. Lang T, Courret N, Colle JH, Milon G,
Aust J Exp Biol Med Sci 57:9–29 Antoine JC (2003) The levels and patterns of
11. Howard JG, Hale C, Chan-Liew WL (1980) cytokines produced by CD4 T lymphocytes of
Immunological regulation of experimental BALB/c mice infected with Leishmania
cutaneous leishmaniasis. I. Immunogenetic major by inoculation into the ear dermis
aspects of susceptibility to Leishmania tropica depend on the infectiousness and size of the
in mice. Parasite Immunol 2:303–314 inoculum. Infect Immun 71(5):2674–2683
12. DeTolla LJ, Scott PA, Farrell JP (1981) Single 24. Felizardo TC, Toma LS, Borges NB, Lima
gene control of resistance to cutaneous leish- GM, Abrahamsohn IA (2007) Leishmania
maniasis in mice. Immunogenetics (Leishmania) amazonensis infection and dis-
14(1–2):29–39 semination in mice inoculated with station-
13. Preston PM, Carter RL, Leuchars E, Davies ary-phase or with purified metacyclic
AJS, Dumonde DC (1972) Experimental promastigotes. Parasitology 134(Pt
cutaneous leishmaniasis. III. Effects of thy- 12):1699–1707
mectomy on the course of infection of CBA 25. van Zandbergen G, Bollinger A, Wenzel A,
mice with Leishmania tropica. Clin Exp Kamhawi S, Voll R, Klinger M, Muller A,
Immunol 10:337–344 Holscher C, Herrmann M, Sacks D, Solbach
14. Leclerc C, Modabber F, Deriaud E, Cheddid W, Laskay T (2006) Leishmania disease devel-
L (1981) Systemic infection of Leishmania opment depends on the presence of apoptotic
tropica (major) in various strains of mice. promastigotes in the virulent inoculum. Proc
Trans R Soc Trop Med Hyg 75:851–854 Natl Acad Sci U S A 103(37):13837–13842
15. Nasseri M, Modabber FZ (1979) Generalized 26. Noben-Trauth N, Paul WE, Sacks DL (1999)
infection and lack of delayed hypersensitivity IL-4- and IL-4 receptor-deficient BALB/c
in BALB/c mice infected with Leishmania mice reveal differences in susceptibility to
tropica major. Infect Immun 26(2):611–614 Leishmania major parasite substrains.
16. Preston PM, Dumonde DC (1976) J Immunol 162:6132–6140
Experimental cutaneous leishmaniasis 27. Ritter U, Mattner J, Soares Rocha J, Bogdan
V. Protective immunity in subclinical and self- C, Körner H (2004) The control of
healing infection in the mouse. Clin Exp Leishmania (Leishmania) major by TNF
Immunol 23:126–138 in vivo is dependent on the parasite strain.
17. Preston PM (1973) Immunology in cutane- Microbes Infect 6:559–565
ous leishmaniasis. Proc Roy Soc Med 28. Anderson CF, Mendez S, Sacks DL (2005)
66(8):776–777 Nonhealing infection despite Th1 polariza-
18. Bretscher PA, Wei G, Menon JN, Bielefeldt- tion produced by a strain of Leishmania major
Ohmann H (1992) Establishment of stable, in C57BL/6 mice. J Immunol
cell-mediated immunity that makes "suscep- 174:2934–2941
tible" mice resistant to Leishmania major. 29. Lee SH, Charmoy M, Romano A, Paun A,
Science 257:539–542 Chaves MM, Cope FO, Ralph DA, Sacks DL
19. Pérez H, Arredondo B, Gonzalez M (1978) (2018) Mannose receptor high, M2 dermal
Comparative study of American cutaneous macrophages mediate nonhealing Leishmania
leishmaniasis and diffuse cutaneous leishman- major infection in a Th1 immune environ-
iasis in two strains of inbred mice. Infect ment. J Exp Med 215(1):357–375
Immun 22:301–307 30. Indiani de Oliveira C, Teixeira MJ, Teixeira
20. Courret N, Lang T, Milon G, Antoine JC CR, Ramos de Jesus J, Bomura Rosato A,
(2003) Intradermal inoculations of low doses Santa da Silva J, Brodskyn C, Barral-Netto M,
of Leishmania major and Leishmania amazo- Barral A (2004) Leishmania braziliensis iso-
nensis metacyclic promastigotes induce differ- lates differing at the genome level display dis-
ent immunoparasitic processes and status of tinctive features in BALB/c mice. Microbes
protection in BALB/c mice. Int J Parasitol Infect 6(11):977–984
33(12):1373–1383 31. Teixeira MJ, Fernandes JD, Teixeira CR,
21. Lira R, Doherty M, Modi G, Sacks DL (2000) Andrade BB, Pompeu ML, da Silva JS,
Evolution of lesion formation, parasitic load, Brodskyn CI, Barral-Netto M, Barral A
immune response, and reservoir potential in (2005) Distinct Leishmania braziliensis iso-
C57BL/6 mice following high- and low-dose lates induce different paces of chemokine
challenge with Leishmania major. Infect expression patterns. Infect Immun
Immun 68:5176–5182 73:1191–1195
346 Christian Bogdan et al.
32. Sulahian A, Garin YJ, Pratlong F, Dedet JP, Leishmania major systemic infections. Infect
Derouin F (1997) Experimental pathogenic- Immun 56(12):3316–3319
ity of viscerotropic and dermotropic isolates 44. Satoskar A, Alexander J (1995) Sex-
of Leishmania infantum from immunocom- determined susceptibility and differential
promised and immunocompetent patients in IFN-γ and TNF-α mRNA expression in
a murine model. FEMS Immunol Med DBA/2 mice infected with Leishmania mexi-
Microbiol 17(3):131–138 cana. Immunology 84:1–4
33. Garin YJ, Sulahian A, Pratlong F, Meneceur 45. Bryson KJ, Millington OR, Mokgethi T,
P, Gangneux JP, Prina E, Dedet JP, Derouin F McGachy HA, Brombacher F, Alexander
(2001) Virulence of Leishmania infantum is J (2011) BALB/c mice deficient in CD4 T
expressed as a clonal and dominant pheno- cell IL-4Ralpha expression control
type in experimental infections. Infect Immun Leishmania mexicana Load although female
69(12):7365–7373 but not male mice develop a healer pheno-
34. Nabors GS, Nolan T, Croop W, Li J, Farrell type. PLoS Negl Trop Dis 5(1):e930.
JP (1995) The influence of the site of parasite https://doi.org/10.1371/journal.
inoculation on the development of Th1 and pntd.0000930
Th2 type immune responses in (BALB/c x 46. Cillari E, Milano S, Dieli M, Arcoleo F,
C57BL/6) F1 mice infected with Leishmania Perego R, Leoni F, Gromo G, Severn A, Liew
major. Parasite Immunol 17:569–579 FY (1992) Thymopentin reduces the suscep-
35. Kirkpatrick CE, Nolan TJ, Farrell JP (1987) tibility of aged mice to cutaneous leishmania-
Rate of Leishmania-induced skin-lesion devel- sis by modulating CD4 T-cell subsets.
opment in rodents depends on the site of Immunol 76:362–366
inoculation. Parasitology 94(Pt 3):451–465 47. Lages CS, Suffia I, Velilla PA, Huang B,
36. Baldwin TM, Elso C, Curtis J, Buckingham Warshaw G, Hildeman DA, Belkaid Y,
L, Handman E (2003) The site of Leishmania Chougnet C (2008) Functional regulatory T
major infection determines disease severity cells accumulate in aged hosts and promote
and immune responses. Infect Immun chronic infectious disease reactivation.
71(12):6830–6834 J Immunol 181(3):1835–1848
37. Felizardo TC, Gaspar-Elsas MI, Lima GM, 48. Kropf P, Herath S, Weber V, Modolell M,
Abrahamsohn IA (2012) Lack of signaling by Muller I (2003) Factors influencing Leishmania
IL-4 or by IL-4/IL-13 has more attenuating major infection in IL-4-deficient BALB/c
effects on Leishmania amazonensis dorsal mice. Parasite Immunol 25(8–9):439–447
skin--than on footpad-infected mice. Exp 49. Quinonez-Diaz L, Mancilla-Ramirez J, Avila-
Parasitol 130(1):48–57 Garcia M, Ortiz-Avalos J, Berron A, Gonzalez
38. Rosas LE, Keiser T, Barbi J, Satoskar AA, S, Paredes Y, Galindo-Sevilla N (2012) Effect
Septer A, Kaczmarek J, Lezama-Davila CM, of ambient temperature on the clinical mani-
Satoskar AR (2005) Genetic background festations of experimental diffuse cutaneous
influences immune responses and disease out- leishmaniasis in a rodent model. Vector Borne
come of cutaneous L. mexicana infection in Zoonot Dis 12(10):851–860
mice. Int Immunol 17(10):1347–1357 50. Sacks DL, Noben-Trauth N (2002) The
39. Mitchell GF, CJ M, Handman E (1981) immunology of susceptibility and resistance
Resistance to cutaneous leishmaniasis in to Leishmania major in mice. Nat Rev
genetically susceptible BALB/c mice. Aust Immunol 2:845–858
J Exp Biol Med Sci 59:555–565 51. Bogdan C (2008) Mechanisms and conse-
40. Scott PA, Farrell JP (1982) Experimental quences of persistence of intracellular patho-
cutaneous leishmaniasis: disseminated leish- gens: leishmaniasis as an example. Cell
maniasis in genetically susceptible and resis- Microbiol 10:1221–1234
tant mice. Am J Trop Med Hyg 52. Bogdan C, Gessner A, Röllinghoff M (1993)
31(2):230–238 Cytokines in Leishmaniasis: a complex net-
41. Melby PC, Yang Y-Z, Cheng J, Zhao W work of stimulatory and inhibitory interac-
(1998) Regional differences in the cellular tions. Immunobiology 189:356–396
immune response to experimental cutaneous 53. Bogdan C, Röllinghoff M (1998) The
or visceral leishmaniasis with Leishmania don- immune response to Leishmania: mechanisms
ovani. Infect Immun 66:18–27 of parasite control and evasion. Int J Parasitol
42. Alexander J (1988) Sex differences and cross- 28:121–134
immunity in DBA/2 mice infected with L. 54. Schleicher U, Paduch K, Debus A, Obermeyer
mexicana and L. major. Parasitology 96(Pt S, Konig T, Kling JC, Ribechini E, Dudziak
2):297–302 D, Mougiakakos D, Murray PJ, Ostuni R,
43. Mock BA, Nacy CA (1988) Hormonal mod- Korner H, Bogdan C (2016) TNF-mediated
ulation of sex differences in resistance to restriction of arginase 1 expression in myeloid
Mouse Cutaneous Leishmaniasis 347
cells triggers type 2 no synthase activity at the 65. Paul C, Wolff S, Zapf T, Raifer H, Feyerabend
site of infection. Cell Rep 15(5):1062–1075 TB, Bollig N, Camara B, Trier C, Schleicher
55. McMahon-Pratt D, Alexander J (2004) Does U, Rodewald HR, Lohoff M (2016) Mast
the Leishmania major paradigm of pathogen- cells have no impact on cutaneous leishmani-
esis and protection hold for New World cuta- asis severity and related Th2 differentiation in
neous leishmaniases or the visceral disease? resistant and susceptible mice. Eur J Immunol
Immunol Rev 201:206–224 46(1):114–121
56. Stenger S, Thüring H, Röllinghoff M, 66. Amer EI, Eissa MM, Mossallam SF (2016)
Manning P, Bogdan C (1995) L-N6-(1- Oral azithromycin versus its combination
iminoethyl)lysine potently inhibits inducible with miltefosine for the treatment of experi-
nitric oxide synthase and is superior to mental Old World cutaneous leishmaniasis.
NG-monomethyl-arginine in vitro and J Parasit Dis 40(2):475–484
in vivo. Eur J Pharmacol 294:703–712 67. Ivens AC, Lewis SM, Bagherzadeh A, Zhang
57. Solbach W, Forberg K, Kammerer E, Bogdan L, Chan HM, Smith DF (1998) A physical
C, Röllinghoff M (1986) Suppressive effect map of the Leishmania major Friedlin
of cyclosporin A on the development of genome. Genome Res 8(2):135–145
Leishmania tropica-induced lesions in geneti- 68. Nicolle C (1908) Nouvelles acquisitions sur le
cally susceptible BALB/c mice. J Immunol kala-azar: culture; inoculation au chien; etiol-
137:702–707 ogie. Compte rendu hebdomadaire des
58. Solbach W, Forberg K, Röllinghoff M (1986) Sciences de I’dcademie des Sciences, Paris
Effect of T-lymphocyte suppression on the 146:498–499
parasite burden in Leishmania major-infected, 69. Nicolle C (1908) Culture du parasite du bou-
genetically susceptible BALB/c mice. Infect ton d’orient. Compte rendu hebdomadaire
Immun 54:909–912 des Sciences de l’Academie des Sciences, Paris
59. Unsoeld H, Mueller K, Schleicher U, Bogdan 146:842–843
C, Zwirner J, Voehringer D, Pircher H 70. Hockmeyer WT, Kager PA, Rees PH,
(2007) Abrogation of CCL21 chemokine Hendricks LD (1981) The culture of
function by transgenic over-expression Leishmania donovani in schneider’s insect
impairs T cell immunity to local infections. medium: its value in the diagnosis and man-
Int Immunol 19(11):1281–1289 agement of patients with visceral leishmania-
60. Brewig N, Kissenpfennig A, Malissen B, Veit sis. Trans R Soc Trop Med Hyg
A, Bickert T, Fleischer B, Mostbock S, Ritter 75(6):861–863
U (2009) Priming of CD8+ and CD4+ T cells 71. Howard MK, Pharoah MM, Ashall F, Miles
in experimental leishmaniasis is initiated by MA (1991) Human urine stimulates growth
different dendritic cell subtypes. J Immunol of Leishmania in vitro. Trans R Soc Trop Med
182(2):774–783 Hyg 85:477–479
61. Fromm PD, Kling J, Mack M, Sedgwick JD, 72. Lima HC, Bleyenberg JA, Titus RG (1997) A
Korner H (2012) Loss of TNF signaling facil- simple method for quantifying Leishmania in
itates the development of a novel Ly-6C(low) tissues of infected animals. Parasitol Today
macrophage population permissive for 13:80–82
Leishmania major infection. J Immunol 73. Prajeeth CK, Haeberlein S, Sebald H,
188(12):6258–6266 Schleicher U, Bogdan C (2011) Leishmania-
62. Gonzalez-Leal IJ, Roger B, Schwarz A, infected macrophages are targets of NK cell-
Schirmeister T, Reinheckel T, Lutz MB, Moll derived cytokines, but not of NK cell
H (2014) Cathepsin B in antigen-presenting cytotoxicity. Infect Immun 79:2699–2708
cells controls mediators of the Th1 immune 74. Blos M, Schleicher U, Rocha FJ, Meissner U,
response during Leishmania major infection. Röllinghoff M, Bogdan C (2003) Organ-
PLoS Negl Trop Dis 8(9):e3194. https:// specific and stage-dependent control of
doi.org/10.1371/journal.pntd.0003194 Leishmania major infection by inducible
63. Matsushita M, Freigang S, Schneider C, nitric oxide synthase and phagocyte NADPH
Conrad M, Bornkamm GW, Kopf M (2015) oxidase. Eur J Immunol 33:1224–1234
T cell lipid peroxidation induces ferroptosis 75. Schleicher U, Liese J, Justies N, Mischke T,
and prevents immunity to infection. J Exp Haeberlein S, Sebald H, Kalinke U, Weiss S,
Med 212(4):555–568 Bogdan C (2018) Type I interferon signaling
64. Schatz V, Strussmann Y, Mahnke A, Schley G, is required for CpG-oligodesoxynucleotide-
Waldner M, Ritter U, Wild J, Willam C, Dehne induced control of Leishmania major, but not
N, Brune B, McNiff JM, Colegio OR, Bogdan for spontaneous cure of subcutaneous pri-
C, Jantsch J (2016) Myeloid cell-derived HIF- mary or secondary L. major infection. Front
1alpha promotes control of Leishmania major. Immunol 9:79. https://doi.org/10.3389/
J Immunol 197(10):4034–4041 fimmu.2018.00079
348 Christian Bogdan et al.
76. Taswell C (1981) Limiting dilution assays for Schmitt S, Schober K, Schuler T, Schulz AR,
the determination of immunocompetent cell Schumacher T, Scotta C, Shankey TV, Shemer
frequencies. I. Data analysis. J Immunol A, Simon AK, Spidlen J, Stall AM, Stark R,
126(4):1614–1619 Stehle C, Stein M, Steinmetz T, Stockinger
77. Titus RG, Marchand M, Boon T, Louis JA H, Takahama Y, Tarnok A, Tian Z, Toldi G,
(1985) A limiting dilution assay for quantify- Tornack J, Traggiai E, Trotter J, Ulrich H,
ing Leishmania major in tissues of infected van der Braber M, van Lier RAW, Veldhoen
mice. Parasite Immunol 7:545–555 M, Vento-Asturias S, Vieira P, Voehringer D,
78. Cossarizza A, Chang HD, Radbruch A, Akdis Volk HD, von Volkmann K, Waisman A,
M, Andra I, Annunziato F, Bacher P, Barnaba Walker R, Ward MD, Warnatz K, Warth S,
V, Battistini L, Bauer WM, Baumgart S, Watson JV, Watzl C, Wegener L, Wiedemann
Becher B, Beisker W, Berek C, Blanco A, A, Wienands J, Willimsky G, Wing J, Wurst P,
Borsellino G, Boulais PE, Brinkman RR, Yu L, Yue A, Zhang Q, Zhao Y, Ziegler S,
Buscher M, Busch DH, Bushnell TP, Cao X, Zimmermann J (2017) Guidelines for the use
Cavani A, Chattopadhyay PK, Cheng Q, of flow cytometry and cell sorting in immu-
Chow S, Clerici M, Cooke A, Cosma A, nological studies. Eur J Immunol 47(10):
Cosmi L, Cumano A, Dang VD, Davies D, 1584–1797
De Biasi S, Del Zotto G, Della Bella S, 79. Dwyer DM, Langreth SG, Dwyer NK (1974)
Dellabona P, Deniz G, Dessing M, Diefenbach Evidence for a polysaccharide surface coat in
A, Di Santo J, Dieli F, Dolf A, Donnenberg the developmental stages of Leishmania
VS, Dorner T, Ehrhardt GRA, Endl E, Engel donovani: a fine structure-cytochemical study.
P, Engelhardt B, Esser C, Everts B, Dreher A, Z Parasitenkd 43(4):227–249
Falk CS, Fehniger TA, Filby A, Fillatreau S, 80. Ambit A, Woods KL, Cull B, Coombs GH,
Follo M, Forster I, Foster J, Foulds GA, Mottram JC (2011) Morphological events
Frenette PS, Galbraith D, Garbi N, Garcia- during the cell cycle of Leishmania major.
Godoy MD, Geginat J, Ghoreschi K, Gibellini Eukaryot Cell 10(11):1429–1438. https://
L, Goettlinger C, Goodyear CS, Gori A, doi.org/10.1128/EC.05118-11
Grogan J, Gross M, Grutzkau A, Grummitt 81. Wheeler RJ, Gluenz E, Gull K (2011) The
D, Hahn J, Hammer Q, Hauser AE, Haviland cell cycle of Leishmania: morphogenetic
DL, Hedley D, Herrera G, Herrmann M, events and their implications for parasite biol-
Hiepe F, Holland T, Hombrink P, Houston ogy. Mol Microbiol 79(3):647–662
JP, Hoyer BF, Huang B, Hunter CA, Iannone 82. Hand WL (1984) Inhibition of cell-free oxi-
A, Jack HM, Javega B, Jonjic S, Juelke K, dative bactericidal activity by erythrocytes and
Jung S, Kaiser T, Kalina T, Keller B, Khan S, hemoglobin. Infect Immun 44:465–468
Kienhofer D, Kroneis T, Kunkel D, Kurts C, 83. Martins R, Maier J, Gorki AD, Huber KV,
Kvistborg P, Lannigan J, Lantz O, Larbi A, Sharif O, Starkl P, Saluzzo S, Quattrone F,
LeibundGut-Landmann S, Leipold MD, Gawish R, Lakovits K, Aichinger MC, Radic-
Levings MK, Litwin V, Liu Y, Lohoff M, Sarikas B, Lardeau CH, Hladik A, Korosec A,
Lombardi G, Lopez L, Lovett-Racke A, Brown M, Vaahtomeri K, Duggan M,
Lubberts E, Ludewig B, Lugli E, Maecker Kerjaschki D, Esterbauer H, Colinge J,
HT, Martrus G, Matarese G, Maueroder C, Eisenbarth SC, Decker T, Bennett KL,
McGrath M, McInnes I, Mei HE, Melchers F, Kubicek S, Sixt M, Superti-Furga G, Knapp S
Melzer S, Mielenz D, Mills K, Mirrer D, (2016) Heme drives hemolysis-induced sus-
Mjosberg J, Moore J, Moran B, Moretta A, ceptibility to infection via disruption of
Moretta L, Mosmann TR, Muller S, Muller phagocyte functions. Nat Immunol 17(12):
W, Munz C, Multhoff G, Munoz LE, Murphy 1361–1372
KM, Nakayama T, Nasi M, Neudorfl C, 84. Fischer MR, John D, Kautz-Neu K,
Nolan J, Nourshargh S, O'Connor JE, Schermann AI, Schwonberg K, von Stebut E
Ouyang W, Oxenius A, Palankar R, Panse I, (2013) Animal model for cutaneous leish-
Peterson P, Peth C, Petriz J, Philips D, Pickl maniasis. Methods Mol Biol 961:389–402
W, Piconese S, Pinti M, Pockley AG, Podolska 85. Hulspas R, O'Gorman MR, Wood BL,
MJ, Pucillo C, Quataert SA, Radstake T, Gratama JW, Sutherland DR (2009)
Rajwa B, Rebhahn JA, Recktenwald D, Considerations for the control of background
Remmerswaal EBM, Rezvani K, Rico LG, fluorescence in clinical flow cytometry.
Robinson JP, Romagnani C, Rubartelli A, Cytometry B Clin Cytom 76(6):355–364
Ruckert B, Ruland J, Sakaguchi S, Sala-de- 86. Solbach W, Lohoff M, Streck H, Rohwer P,
Oyanguren F, Samstag Y, Sanderson S, Röllinghoff M (1987) Kinetics of cell-medi-
Sawitzki B, Scheffold A, Schiemann M, ated immunity developing during the course
Schildberg F, Schimisky E, Schmid SA, of Leishmania major infection in ‘healer’ and
Mouse Cutaneous Leishmaniasis 349
Abstract
Sand fly colonies are of major importance for experimental studies on biology, behavior, vector compe-
tence, relationship with Leishmania parasites, and vector control. This chapter is intended to provide
methods and techniques used to initiate, establish, and maintain sand fly colonies. Details on collecting
sand flies for colonization, colony initiation, maintenance, and experimental infection of Phlebotomus spp.
with Leishmania spp. are reported.
1 Introduction
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_19, © Springer Science+Business Media, LLC, part of Springer Nature 2019
351
352 Ifhem Chelbi and Elyes Zhioua
Anesthetic.
Autoclave.
Brushes.
CDC light traps.
CO2.
Cotton.
Distilled water.
Entomological needles.
Electric mill.
Filter paper.
Glass vials for single oviposition.
Guinea pigs.
Incubator.
Larvae food.
Microscope.
Mouth and electric aspirator.
Nylon holding cages for adults with 1000-mesh netting.
Oviposition pots.
Plaster of Paris.
Plastic bag.
Plastic petri dishes.
Rabbit feces.
Rabbit food.
Sand.
Soft tweezers.
Stainless steel frames.
Stainless steel tray.
Stereomicroscope.
Sugar solutions (30%).
Washing bottles.
Colonization and Experimental Infection of Sand Flies 353
Fig. 1 Phenology of sand fly vector of zoonotic visceral leishmaniasis in North Africa
354 Ifhem Chelbi and Elyes Zhioua
Fig. 6 Adding cotton soaked with sugar solution on the top of oviposition vials
5. Place all vials in a sealed plastic box over several sheets of paper
towels soaked with distilled water and place a piece of cotton
soaked with 30% sugar solution on the top of the vial (Fig. 6).
6. Place the plastic box in an incubator at 29–30 °C with a pho-
toperiod of 17:7 L.D.
7. Check vials on a daily basis for eggs and soak the filter paper
with distilled water when needed.
8. After oviposition, remove the dead females for species identifi-
cation by using the keys of Croset et al. [12].
9. Adjust the filter paper for humidity with distilled water. Due to
the fragility of eggs, replace the mesh with parafilm to provide
a high level of relative humidity in the vial. Keep the vial in the
incubator for 24 h.
10. Extract the filter paper with eggs from the vial by using a soft
tweezers (Fig. 7).
11. Because they are very fragile, remove the eggs gently with a
fine brush (Fig. 8) and deposit them at the center of the sur-
face of a plaster pot (Fig. 9).
3.1 Preparation Larval food is made of a mixture of 50% rabbit feces and 50% pel-
of Food and Feeding lets of rabbit food.
Larvae
1. Grind rabbit feces and pellets in an electric mill and mix the
powder with distilled water in a plastic box.
2. Apply a thin layer of the mix on the surface of the stainless steel
tray (Fig. 10). All trays are placed in a plastic bag and incubated
at 30 °C for 2 days to undergo an aerobic fermentation.
Colonization and Experimental Infection of Sand Flies 357
Fig. 8 Transferring eggs from the paper strip with fine brush to the plaster box
3. Remove trays from plastic bag and return them on the support
upside down for another 15 days at 30 °C and high humidity
to complete the fermentation (Fig. 11).
4. Allow all trays to dry and grind the food with an electric mill.
The final product must be autoclaved. Distribute the food in
small jars (Fig. 12) and store them at +4 °C.
358 Ifhem Chelbi and Elyes Zhioua
5. Feed larvae three times per week by sprinkling food over them
(Fig. 13).
6. Maintain the humidity of the plaster pot by adding distilled
water.
7. In the case of fungal growth, remove hyphae with a needle or
add some autoclaved sand (Fig. 14).
8. Follow the whole life cycle until emergence of adults.
Fig. 12 Larval food distributed into storage jars and stored at +4 °C
Fig. 13 Sprinkling of larval food on the edge of the plaster with eggs placed in the
center
Fig. 14 Checking plaster pot for fungal growths and removing hyphae with
needle
Fig. 16 Holding cage with sand flies inside the plastic bag
3.3 Establishing Upon emergence of adult sand flies in individual rearing pots,
a Colony of Sand Fly transfer the sand fly species intenden for colonization from plaster
Species pot to holding cage.
1. Introduce the plaster pot into the holding cage and gently
open the cover to allow adult sand flies to be released into the
holding cage.
2. Place a petri dish containing cotton soaked with 30% sugar
solution at the bottom of the holding cage.
3. Wrap the holding cage in a plastic bag containing cotton
soaked with distilled water at one corner of the bag to maintain
a stable relative humidity (Fig. 16).
3.4 Maintenance 1. Remove sugar meal from the holding cage 24 h prior to blood
of Sand Fly Colonies feeding.
2. Use 5-day-old sand flies because younger ones are not ready to
feed and older ones usually have a lower rate of survival.
3. Anesthetize a BALB/c mouse with ketamine (150 mg/kg)
and place it for 2 h in an environment with 27 °C in the hold-
ing cage for sand flies (Fig. 4).
4. Cover the cage with dark cloth.
5. Keep the blood-fed females with males for 3 days to allow full
digestion, defecation, and mating (Fig. 17) before transferring
them to a plaster pot.
6. Maintain humidity of the pot with distilled water (Fig. 18).
7. Place a 2-cm layer of autoclaved sand in the bottom of a plastic
box and adjust for humidity the sand with distilled water
(Fig. 19).
8. Transfer gravid females from the holding cage to the plaster
pot using a mouth aspirator (Fig. 20) and place cotton soaked
with 30 % sugar solution on the mesh (Fig. 21).
362 Ifhem Chelbi and Elyes Zhioua
Fig. 22 Sprinkling of larval food on the edge of the plaster pot containing first
instar larvae
13. Check pots three times per week for fungal infection and add a
thin layer of larval food (Fig. 23).
14. Allow sand flies to complete their life cycle.
9. Place the feeder above the inner part of the membrane and fix
it with parafilm.
10. Connect the feeder to the thermo-circulating water bath and
switch it on (Fig. 24).
11. Add 1 ml of 107 metacyclic promastigotes of Leishmania major
into the inner tube of the feeder.
12. Attach the cage containing 5–7-day-old 100–150 female and
100 male Phlebotomus papatasi to the feeder with rubber plas-
tic (Fig. 24).
13. Cover the feeding system with dark cloth.
14. Allow sand flies to feed for 2–3 h (Fig. 25).
15. Detach the cage from the feeding system after a good feeding
success (70% of females should be blood fed).
16. Remove the unfed females and use them for the next experi-
mental infection.
17. Maintain blood-fed females in the cage in the presence of males
at 26–27 °C with a photoperiod of 17:7 L:D with sugar and
wrapped in a plastic bag with cotton soaked with distilled water
in a secure P2 insectary to allow the parasite to complete its life
cycle in the sand fly vector.
366 Ifhem Chelbi and Elyes Zhioua
3.6 Examine Sand Between fifth and seventh day post infectious blood meal, sand
Flies for Leishmania flies can be examined for the presence of Leishmania spp.
Infection
1. By using a mouth aspirator, take 5 to 10 females and anaesthe-
tize them with CO2.
2. Place anesthetized females in a sterile petri dish with PBS and
a few drops of liquid soap.
3. Shake soaked sand flies gently to remove wax.
4. Place two drops of sterile PBS on a sterile slide and remove
wings and legs by using an entomological needle.
5. Place the rest of the body (head, thorax, and abdomen) in the
second drop.
6. Hold the sand fly at the thorax level gently with an entomo-
logical needle, and with a second entomological needle pull
gently at the last three segments of the abdomen to remove the
midgut in the drop of PBS (Fig. 26).
7. Remove the abdomen.
8. Cover the midgut in the drop of PBS with a coverslip.
9. Examine the gut for the presence of promastigotes under the
microscope (Fig. 27).
Colonization and Experimental Infection of Sand Flies 367
References
1. Safyanova VM (1964) Laboratory cultivation flies (Diptera: Psychodidae). Parasite 24:42.
of sandflies (Diptera: Phlebotominae). Bull https://doi.org/10.1051/parasite/2017041
WHO 31:573–576 5. Valenzuela J, Belkaid Y, Garfiela MK, Mendez
2. Endris RG, Perkins PV, Young DG, Johnson S, Kamhawi S, Rowton E, Sacks D, Ribeiro
RD (1982) Techniques for laboratory rearing JMC (2001) Toward a defined anti-Leishmania
of sand flies (Diptera: Psychodidae). Mosquito vaccine targeting vector antigens: characteriza-
News 42:400–407 tion of a protective salivary protein. J Exp Med
3. Killick-kendrick R, Leaney AJ, Ready PD 194:331–342
(1977) The establishment, maintenance and 6. Anonymous (1977) Report of the first meet-
productivity of a laboratory colony of ing, Scientific Working Group on leishmaniasis.
Lutzomyia longipalpis (Diptera: Psychodidae). World Health Organization Special Program
J Med Entomol 13:429–440 for Research and Training in Tropical Diseases,
4. Lawyer P, Killick-Kendrick M, Rowland T, Geneva, p 31
Rawton E, Volf P (2017) Laboratory coloniza- 7. Chelbi I, Zhioua E (2007) Biology of
tion and mass rearing of phlebotomine sand Phlebotomus papatasi Scopoli (Diptera:
368 Ifhem Chelbi and Elyes Zhioua
A F
Amastigotes����������� v, 1, 69, 105, 169, 265, 280, 290, 304, 315 Flow cytometry������������������������� 326–327, 334, 336–338, 343
Automated image analysis����������������������������������������279–287
Axenic amastigotes��������� v, 2, 4–6, 8, 169, 265–270, 273, 274, G
290–292, 294–298 Gene editing�������������������������������123, 169, 190, 191, 195, 196
Gene expression���������������������������95, 109, 225–235, 249, 251,
B
326, 334, 335
Bioinformatics������������������������������30–33, 70, 72, 73, 142, 157 Genetic markers�����������������������������������������������������������������10
Bone marrow-derived macrophages (BMMs)��������� 237–247,
252–255, 261, 266 H
Hamsters�������������������������������������������������7, 90, 289, 303–313
C
High content analysis������������������������������� 279–281, 283–285
Cas9��������������������������������������������������������������������������189–208 High-content screening������������������������������������ 279, 282, 283
CDSs��������������������������������������������������������������������������������174
Clustered regularly interspaced short palindromic repeats I
(CRISPR)��������������������������������������������123, 169, 189–208 Inducible gene expression�����������������������������������������225–235
Colonization������������������������������������������������������������� 351, 352 Intracardiac (IC)����������������������������������������������� 304, 306–309
Colony-stimulating factor-1 (CSF-1)��������������������� 238, 239, Intracellular amastigotes�������������������� 280, 281, 284, 285, 304
241–244, 252 Intradermic (ID)���������������������������������������159, 306, 310, 311
Conditional gene deletion�������������������������211, 212, 215, 221 Intraperitoneal (IP)��������������������������� 290, 293, 304, 306–308
Conditional genome engineering�������������������������������������225 In vitro infections�������������������������������������237–246, 251–255,
Cos-Seq������������������������������������������������������������ 135, 141–166 265–276, 279, 329
Cre recombinase����������������������������������������������� 211, 225, 226
Cutaneous leishmaniasis (CL)����������������������������������315–344 K
D Kinetoplastids��������������������������������������������������23, 27, 59, 190
Knockouts (KO)�����������������189–208, 213, 214, 217, 218, 223
Deep sequencing������������������������������������������������������������������v
Development������������������������� 1, 4, 14, 83, 123, 238, 266, 273, L
303, 316, 341, 352
LeishGEdit��������������������������������������������������������������189–208
Differential gene expression���������������������������������������������104
Leishmania��������������������������������v, 1–28, 33, 34, 38–41, 43, 51,
Differentiation�������������������������������1–8, 13, 23, 238, 239, 244,
57, 59, 69–92, 95–97, 103, 105, 110, 123, 124, 127,
252, 266, 269, 274
135–138, 141–166, 169, 170, 173, 175, 178–180, 184,
Dimerizable cre recombinase (DiCre)������123, 169, 211–223,
187, 189, 190, 192, 196, 200–203, 207, 211–223,
225–235
225–227, 232, 237, 238, 249–262, 279–284, 286, 287,
DNA sequence analysis�������������������������������������� 48, 177, 180
289–299, 303, 304, 306, 308–312, 315–317, 320–322,
Drug resistance��������� 79, 82, 88, 141–166, 198, 206, 208, 212
339, 341, 344, 351–367
Drug screening������������������������������������������266, 271, 273, 275
Leishmania-infected THP-1 macrophages�����������������������287
E Leishmania infections������������������������������� 266, 279, 284, 289,
304, 306, 339, 366
Essential genes�����������������������������������������������������������������211 Leishmania intracellular parasites��������������������������������������280
Experimental infections�����������������������������290, 352, 364, 365 Leishmania major���������������������������������������������� 232, 238, 365
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2, © Springer Science+Business Media, LLC, part of Springer Nature 2019
369
370 ILndex
eishmania: Methods and Protocols
Limiting-dilution (LD)����������������������������138, 229, 290–292, 311, 312, 315, 319, 320, 324, 328–330, 333, 339, 340,
295, 311, 326, 333–334, 341 365, 366
LoxP sites������������������������������������������ 211, 212, 214, 226, 227
R
M
Rapamycin���������� 211–213, 215, 221, 223, 226, 228, 231, 234
Macrophage-like cell lines����������������������������������������265–276 Retro-orbitary (RO)����������������������������������304, 306, 309–310
Mouse models����������������������������������������������������������315–344 Ribosome profiling���������������������������������������������������109–121
mRNA levels�������������������������������������������������������� 95, 97, 109 RNA-seq����������������������������������������������������������������������������95
mRNAs���������������������������������95–97, 100, 104, 105, 109, 112,
227, 249, 251, 326, 334–336, 342 S
Multi locus approaches�������������������������������������������������19–21 Signaling������������������������������������������������������������������������������1
Single locus approaches�������������������������11–12, 15–18, 23–28
N
SNP calling��������������������������������74, 76, 81–84, 86–88, 90, 92
Next generation sequencing (NGS)�������������������� 69–92, 135,
136, 141, 173, 184 T
Tagging������������������������������������������������������������� 189–208, 216
P
Taxonomic levels���������������������������������������������������� 13, 33, 59
Phagolysosomes��������������������������������������������������������������������1 Transcriptome���������������������������������������������������������� 331, 341
Phenotypic assays�������������������������������������������������������������279 Translational control���������������������������������������������������������109
Phlebotomus���������������������������������������������������������������351–366 Translational efficiency�����������������������������������������������������109
Phylogenetic inference methods����������������������� 10, 14, 18, 23, T7 RNA polymerase������������������������� 190, 195, 200, 201, 203
28–29, 34, 49–54, 56 Trypanosomatids�����������������������������11, 23, 39–41, 60, 96, 97,
Phylogenetic inference software�����������������������������������������61 105, 109–121, 123
Phylogenetics�������������������������������������������������9–60, 69, 86, 89
Ploidy variation������������������������������������������������������������������77 V
Promastigotes������������������������������ 1–7, 28, 69, 88, 91, 92, 105, Visceral leishmaniasis (VL)������� 289, 303–313, 315, 341, 353
124, 127, 137, 142, 144, 151, 153, 169, 170, 172, 173,
180, 181, 200–202, 207, 214, 219, 221, 254, 266, 273, W
274, 280, 282, 284, 286, 290, 292–295, 298, 304–306,
Whole-mouse in vivo imaging������������������291, 292, 294–298